Documents > human

Human
Human
From: eryuan | Date: 11/17/2009 | Rated: 0 (0) | Views: 6
Add to My Docs Add to Collection Not Relevant Good Result

Human more>>

Tags: Human
Views: 6
Language: English Add to Collection
The Human
The Human
From: juanagui | Date: 4/28/2009 | Rated: 0 (0) | Views: 37
Add to My Docs Add to Collection Not Relevant Good Result
Tags: The Human
Views: 37
Language: English Add to Collection
Human
Human
From: paveldatsuk | Date: 7/26/2009 | Rated: 0 (0) | Views: 39
Add to My Docs Add to Collection Not Relevant Good Result

Sanger miRBase Human miRNA Sequence 11.0 Precursor Name Precursor Seq Mature Name Mature Seq CCCACCACUGGGAGAUAA*CUAUACAAUCUACUGUCUUUCCUA ...  more>>

Tags: Human
Categories: Technology >
Views: 39
Language: English Add to Collection
Human-Reproduction-316
Human-Reproduction-316
From: eryuan | Date: 11/15/2009 | Rated: 0 (0) | Views: 0
Add to My Docs Add to Collection Not Relevant Good Result

Human-Reproduction-316 more>>

Views: 0
Language: English Add to Collection
HUMAN-TRAFFICKING
HUMAN-TRAFFICKING
From: eryuan | Date: 11/16/2009 | Rated: 0 (0) | Views: 1
Add to My Docs Add to Collection Not Relevant Good Result

HUMAN-TRAFFICKING more>>

Views: 1
Language: English Add to Collection
Human-Bounds
Human-Bounds
From: eryuan | Date: 11/21/2009 | Rated: 0 (0) | Views: 1
Add to My Docs Add to Collection Not Relevant Good Result

Human-Bounds more>>

Views: 1
Language: English Add to Collection
Human-resources
Human-resources
From: eryuan | Date: 11/18/2009 | Rated: 0 (0) | Views: 12
Add to My Docs Add to Collection Not Relevant Good Result

Human-resources more>>

Views: 12
Language: English Add to Collection
the human heart
Views: 1686
Language: English
Add to Collection
human Anatomy!
human Anatomy!
From: anbuinfosys | Date: 5/18/2009 | Rated: 0 (0) | Views: 237
Add to My Docs Add to Collection Not Relevant Good Result

It is a simple PowerPoint Presentation About the Human Anatomy! more>>

Views: 237
Language: English Add to Collection
Human malarias
Human malarias
From: dorebaugh | Date: 8/18/2008 | Rated: 0 (0) | Views: 77
Add to My Docs Add to Collection Not Relevant Good Result

Human malarias more>>

Views: 77
Language: English Add to Collection
On Being Human
On Being Human
From: idlx | Date: 8/26/2009 | Rated: 0 (0) | Views: 7
Add to My Docs Add to Collection Not Relevant Good Result

On Being Human more>>

Tags: Being, Human
Views: 7
Language: English Add to Collection
The Human Machine
The Human Machine
From: idlx | Date: 8/20/2009 | Rated: 0 (0) | Views: 9
Add to My Docs Add to Collection Not Relevant Good Result

The Human Machine more>>

Tags: Human, Machine
Views: 9
Language: English Add to Collection
The Human Society
The Human Society
From: Miaka | Date: 8/23/2009 | Rated: 0 (0) | Views: 115
Add to My Docs Add to Collection Not Relevant Good Result

The Human Society more>>

Categories: Education >
Views: 115
Language: English Add to Collection
The Human Chord
The Human Chord
From: idlx | Date: 8/26/2009 | Rated: 0 (0) | Views: 17
Add to My Docs Add to Collection Not Relevant Good Result

The Human Chord more>>

Tags: Human, Chord
Views: 17
Language: English Add to Collection
Of Human Bondage
Of Human Bondage
From: idlx | Date: 8/22/2009 | Rated: 0 (0) | Views: 30
Add to My Docs Add to Collection Not Relevant Good Result

Of Human Bondage more>>

Tags: Human, Bondage
Views: 30
Language: English Add to Collection

Submit a document request and get notified of matches on Docstoc.