Home

Your criteria did not result in any documents.

Please select a different combination, click the Best Match button or start over by clicking here.
Submit a document request and let us find it for you.
Request a document title now!
Scarf

Scarf

pgs. 2
Scarf A scarf originated in ancient Rome and was originally used to keep clean, and also to wipe off sweat from faces as well as neck. Besides, it... ... 
 ...  More »
Tags: Scarf
 ...  More »
Categories:Business › 
2869173 16 views Language: English
Secrets of the Prayer Shawl

Secrets of the Prayer Shawl

pgs. 55
Secrets of the Prayer Shawl PROF.M.M.NINAN 0 THE SECRET OF THE PRAYER... ... 
 ...  More »
Tags: Prayer Shawl, prayer life
 ...  More »
Categories:Lifestyle › Religion and Spirituality › 
15331583 147 views Language: English
___ Arab Tactical Scarf Shemagh RedBlack

___ Arab Tactical Scarf Shemagh RedBlack

pgs. 1
Buy Arab Tactical Scarf Shemagh Red/Black How to get deals. 1. Click "Select Text" at header left of this frame document(Symbol look... ... 
 ...  More »
10463893 8 views Language: English
The Kashmir shawl in the Mughal period.(Report)

The Kashmir shawl in the Mughal period.(Report)

pgs. 9
Article: The Kashmir shawl in the Mughal period.(Report) Article from:Marg, A Magazine of the Arts | Article date:June 01, 2009 [FIGURE 1  ... 
 ...  More »
Tags: The Kashmir shawl in the Mughal perio..., Marg, A Magazine of the Arts, Rizvi, Janet, 6 1 2009, Magazines, Lifestyle magazines, Entertainment magazines, journal articles, news articles
 ...  More »
Categories:DocStore › Periodicals › Lifestyle › 
5642036 42 views Language: English $5.95
Olive GreenBlack Arab Kafiyah Head Scarf Shemagh - 5 Star Review

Olive GreenBlack Arab Kafiyah Head Scarf Shemagh - 5 Star Review

pgs. 2
Olive Green / Black Arab Kafiyah Head Scarf Shemagh Olive Green / Black Arab Kafiyah Head Scarf Shemagh This cool olive green and black... ... 
 ...  More »
1946882 0 views Language: English
Brick RedBlack Arab Kafiyah Head Scarf Shemagh - 5 Star Review

Brick RedBlack Arab Kafiyah Head Scarf Shemagh - 5 Star Review

pgs. 2
Brick Red / Black Arab Kafiyah Head Scarf Shemagh Brick Red / Black Arab Kafiyah Head Scarf Shemagh This cool brick red and black kafiyah, or... ... 
 ...  More »
1946882 10 views Language: English
Image Scarf sign

Image Scarf sign

pgs. 6
Image 1: Hats of Jerusalem Image 2: Hats and kerchiefs are not always worn as adornments or for protection against the rain or the sun. Hats... ... 
 ...  More »
12173529 11 views Language: English
Traditional Arab Costume Ideas

Traditional Arab Costume Ideas

pgs. 2
==== ==== Please like My Fan Page By Visiting This Link www.reviewsandadvices.com/arabcostume ==== ==== The ancient Middle East is... ... 
 ...  More »
Tags: arab costume, arab clothes, arab clothing
 ...  More »
Categories:Art & Literature › 
21429187 3 views Language: Any
Arab

Arab

pgs. 2
RESUME ABDUR RAB NADWI Dar-Ul-Umoor (TSAS&RC) Gumbaz-e-Shahi Road, Ganjam Srirangapatana Distt-Mandiya-571438, Karnataka, India Phone:... ... 
 ...  More »
8105446 0 views Language: English
AraB

AraB

pgs. 1
From Wikipedia, the free encyclopedia araB araB The araB gene... ... 
 ...  More »
10203636 0 views Language: English
arab

arab

pgs. 2
Errata and Clarifications for Arab-Israeli Wars by the Avalon Hill Game Company From The General Vol. 15 No. 5; Jan-Feb 1979 Q. Using the... ... 
 ...  More »
Tags: the Arab, the Arabs, the Arab world, arab league, the Middle East, Arab countries, arab american, United Arab Emirates, online dictionary, North Africa
 ...  More »
3418187 3 views Language: English
arab

arab

pgs. 22
Impo7ible_love@yahoo.com
 ...  More »
Categories:Templates › 
5317924 55 views Language: English
arab

arab

pgs. 14
Show Recent Messages (F3) --封 mOj!封--: nazi to khdeot midoni kal dokhtaroone bashe man nemikesham vasat ! on sia jokereto bego fohshe madaretam... ... 
 ...  More »
6566192 164 views Language: English
Arab

Arab

pgs. 7
CCGACTGGACCTCCGGCTACAACTCCAATCGTGGGGAGAACACGCAGCGA TG CCCGGCGTATGCGAAAGA TGTTTAATCCAGAGTATGTGTTTGGCACATCTTTACTTGTAGATTTGAGATAT CTCTCTACCTTGCTGAC GA ... 
 ...  More »
Tags: the Arab, the Arab World, the Middle East, the Arabs, Arab League, North Africa, Saudi Arabia, Arab dating, middle east, online dictionary
 ...  More »
6535274 2 views Language: Catalan

Submit a document request and get notified of matches on Docstoc.

Per Page: 152550