From: eryuan | Date: 11/17/2009 | Rated: 0 (0) | Views: 6

Add to My Docs Add to Collection Not Relevant Good Result

Human more>>

From: paveldatsuk | Date: 7/26/2009 | Rated: 0 (0) | Views: 39

Add to My Docs Add to Collection Not Relevant Good Result

Sanger miRBase Human miRNA Sequence 11.0 Precursor Name Precursor Seq Mature Name Mature Seq CCCACCACUGGGAGAUAA*CUAUACAAUCUACUGUCUUUCCUA ...  more>>

From: eryuan | Date: 11/15/2009 | Rated: 0 (0) | Views: 0

Add to My Docs Add to Collection Not Relevant Good Result

Human-Reproduction-316 more>>

From: eryuan | Date: 11/16/2009 | Rated: 0 (0) | Views: 1

Add to My Docs Add to Collection Not Relevant Good Result

HUMAN-TRAFFICKING more>>

From: eryuan | Date: 11/21/2009 | Rated: 0 (0) | Views: 1

Add to My Docs Add to Collection Not Relevant Good Result

Human-Bounds more>>

From: eryuan | Date: 11/18/2009 | Rated: 0 (0) | Views: 13

Add to My Docs Add to Collection Not Relevant Good Result

Human-resources more>>

From: FreddyD | Date: 7/15/2008 | Rated: 8 (1) | Views: 1686

Add to My Docs Add to Collection Not Relevant Good Result

The human heart more>>

From: anbuinfosys | Date: 5/18/2009 | Rated: 0 (0) | Views: 237

Add to My Docs Add to Collection Not Relevant Good Result

It is a simple PowerPoint Presentation About the Human Anatomy! more>>

From: dorebaugh | Date: 8/18/2008 | Rated: 0 (0) | Views: 77

Add to My Docs Add to Collection Not Relevant Good Result

Human malarias more>>

From: idlx | Date: 8/26/2009 | Rated: 0 (0) | Views: 7

Add to My Docs Add to Collection Not Relevant Good Result

On Being Human more>>

From: idlx | Date: 8/20/2009 | Rated: 0 (0) | Views: 9

Add to My Docs Add to Collection Not Relevant Good Result

The Human Machine more>>

From: Miaka | Date: 8/23/2009 | Rated: 0 (0) | Views: 115

Add to My Docs Add to Collection Not Relevant Good Result

The Human Society more>>

From: idlx | Date: 8/26/2009 | Rated: 0 (0) | Views: 17

Add to My Docs Add to Collection Not Relevant Good Result

The Human Chord more>>

From: idlx | Date: 8/22/2009 | Rated: 0 (0) | Views: 30

Add to My Docs Add to Collection Not Relevant Good Result

Of Human Bondage more>>