Docstoc

Supporting Online Material for - DOC

Document Sample
Supporting Online Material for - DOC Powered By Docstoc
					Warlich et al. 2010                                                                  1


                        Supporting Online Material for

        Lentiviral Vector Design and Imaging Approaches to Visualize the
                       Early Stages of Cellular Reprogramming



Eva Warlich1, Johannes Kühle1, Tobias Cantz2,3, Martijn H. Brugman1, Tobias Maetzig1,
Melanie Galla1, Adam A. Filipczyk4, Stephan Halle5, Hannes Klump1,6, Hans R. Schöler3,
Christopher Baum1, Timm Schroeder4*, Axel Schambach1,7*



* Correspondence should be addressed to T.S. or A.S.:e-mail: timm.schroeder@helmholtz-
  muenchen.de (for time-lapse movies and clonal tracking) or schambach.axel@mh-
  hannover.de (for the remaining work).


This supplementary online material file includes:

       Supplementary Information

            o   Legends Supplementary Movies S1-S6 (Movies in separate files). A ‘read-

                me’ file is attached containing brief instructions on how to view the

                Supplementary movies.

            o   Legends Supplementary Figures S1-S8 (Figures in separate files)

       Supplementary Material and Methods
Warlich et al. 2010                                                                          2



Supplementary Information
Legends Supplementary Movies S1-S6
Supplementary Movies S1a,b. Heterogeneity of early reprogramming. Starting 7 days
after co-transduction of OG2 MEFs with vectors encoding hc-Myc, hOct4, hKlf4 and hSox2
(the latter linked to dTomato) the movies demonstrate formation of some representative iPS-
like colonies (timer: d-hh:mm:ss after movie start). (a) On the left side, two transduced (red)
iPS-like colonies proliferate in close proximity and in consequence merge with one another
(timer: 0-20:31:03). Within this colony, EGFP (from the Oct4-EGFP reporter) appears rather
inhomogeneous at one pole, reflecting a frequently observed patchwork pattern of iPS
development. In contrast, another iPS-like colony emerges on the right side, that also first
expresses the dTomato linked to the Sox2 factor, but switches on the Oct4-EGFP reporter
rather homogeneously in the course of reprogramming. This phenomenon is observed less
frequently   than     patchwork   reprogramming.   (b)   Same   experimental    setup   as   in
Supplementary Movie S1a with 3 panels: Left phase contrast, middle EGFP signal, right
dTomato signal. Fibroblastic progeny start to form a colony of typical ES characteristics
(round, sharp border, shiny, compact structure) around time point 2-23:26:12 after movie
start. EGFP is switched on in a subset of cells (4-10:37:59) and expands in the course of the
movie.

Supplementary Movie S2. Rapid expansion of Oct4-EGFP expressing iPS-like cells.
Displaying the growth behavior of an iPS-like colony the movie demonstrates that cells which
continue to express the lentiviral reprogramming vectors (red) are rapidly overgrown upon
emergence of reprogrammed Oct4-EGFP expressing cells (green).

Supplementary Movie S3. Structured illumination microscopy of an iPS-like colony 15
days after transduction. Apotome fluorescence microscopy provides a high precision
scanning mechanism through the different layers of the iPS-like colony. Using a
mathematical algorithm a 3D reconstruction of the iPS-like colony is calculated. Here we see
downregulation of the red fluorescence (indicating the 4 reprogramming factors expressed
from a 4-in-1 vector) in areas of green fluorescence (demonstrating the Oct4-EGFP
pluripotency marker) within the iPS-like colony. The movie displays optical sections of an
iPS-like colony, starting with the bottom layer of the colony, which mainly consists of
reprogramming factor expressing (red) cells. After zooming in, consecutive upper layers
(thickness: 2µm) are repeatedly faded in and out, demonstrating that the upper layers are
largely composed of Oct4-EGFP expressing cells. Following 45° reciprocating rotations the
3-dimensional structure is illustrated, showing that most cells either express the
reprogramming factors or the Oct4-EGFP pluripotency marker.
Warlich et al. 2010                                                                           3


Supplementary Movie S4. Dynamics of iPSC generation. OG2 MEFs were transduced
with the 4 reprogramming factors. Here a 3-in-1 vector expressing hOct4, hKlf4 and hSox2
linked to an IRES-dTomato cassette was used in combination with an hc-Myc vector linked to
a nuclear-membrane localized Venus expression cassette. Enabled by the nuclear
localization of Venus expression, colonies can be easier tracked and followed. The film
depicts phase contrast (left) and EGFP/Venus fluorescence images (right). Fluorescent
photos are taken along with every 12th phase contrast image. One c-Myc-IRES-Venus-
nucMembrane expressing fibroblast (1) gives rise to two daughter cells (2, 3) (timer: 0-
05:22:08) that segregate after division, showing mobility of transduced fibroblasts within the
feeder layer. The progeny of both cells form neighboring iPS-like colonies, which fuse (2-
03:02:12) upon growth.

Supplementary Movies S5a,b. Stochastic character of reprogramming. (a) Oct4-EGFP
murine embryonic fibroblasts (OG2 MEFs) were co-transduced with the 4 reprogramming
factors (Sox2 being linked to an IRES-dTomato sequence, red) and monitored via time-lapse
imaging from day 4.5-11.5 pt. Phase contrast is depicted on the left side, EGFP in the middle
and dTomato signal on the right side with the movie spanning a selected period of 5.4 days.
A single transduced fibroblast (1) gives rise to several daughter cells (labeled 2-15) which
then compact and form a colony of typical iPS-like morphology (timer: 1-10:00:47). At time
point 3-10:24:54 expression of the Oct4-EGFP reporter starts indicating activation of the
transcriptional network involved in pluripotency. First, EGFP appears only in a subset of
cells, arguing for a stochastic principle of reprogramming (see text for details). Note that the
movie accelerates 12-fold starting at 1-15:05:29. (b) For a precise illustration of the kinetics
of Sox2.IRES-dTomato (red) and Oct4-EGFP (green) expression, an overlay of both
fluorescence markers is shown, displaying the exact same colony and time period as above.
This movie is displayed in linear time course.

Supplementary Movie S6. Stochasticity of reprogramming. In contrast to the
experimental setup of Supplementary Movie S5a,b (transduced with single factor vectors)
OG2 MEFs were reprogrammed using the 4-in-1 construct linked to a nuclear localized
dTomato derivative, to ease the tracking of single cells in the condensed proliferative clusters
emerging during reprogramming. Cells were monitored from day 1 to 13 pt with phase
contrast images given on the left, Tomato signals in the middle and EGFP on the right
(demonstrated in grayscale). The film displays a selected period of 4 days, demonstrating the
fate of a single reprogramming factor transduced (dTomato, middle image) fibroblast (1)
giving rise to its progeny (in the beginning indicated with numbers, also see Supplementary
Figure S8), which first forms a cluster and then exhibits iPS-like morphology. Towards the
Warlich et al. 2010                                                                             4

end of the movie, Oct4-EGFP appears at multiple distinct spots within the clonal colony
(EGFP, right image).


Legends Supplementary Figures S1-8
Supplementary Figure S1. Schematic overview of vector modifications and resulting
effects. On top of the figure a schematic illustration of lentiviral vector design for 1-factor
reprogramming (1factor) vectors is given. Translation initiation is enhanced by a Kozak
sequence, reprogramming factors optionally codon-optimzed (co) and expression and titers
improved by a wPRE element. Effects of codon-optimization of Oct4, Sox2 and Klf4 on
expression of a fluorescent protein located on the same mRNA (linked via an IRES site) are
shown for murine and human reprogramming factors. Single factors were combined in 3-in-1
or 4-in-1 reprogramming vectors by using various 2A sites. 4-in-1 vectors were equipped
either with the PGK (phosphoglycerate kinase), UCOE (ubiquitous chromatin opening
element) or SFFV (spleen focus-forming virus) promoter. Influences of the wPRE element,
promoter choice and codon-optimzation measured by fluorescence intensity of co-expressed
dTomato are illustrated in the bar graphs. Dot blots illustrate the different expression levels of
the various promoters.  marks the self-inactivating (SIN) configuration with partially deleted
U3 of the 3’ LTR. RSV: Rous sarcoma virus U3 promoter; SD: splice donor; : packaging
signal; RRE: Rev response element; SA: splice acceptor; cPPT: central polypurine tract;
IRES:    internal     ribosomal   entry   site;   FP:   fluorescent   protein;   PRE:   woodchuck
posttranscriptional regulatory element; Prom: promoter; P2A: porcine teschovirus 2A; T2A:
thosea asigna virus 2A; E2A: equine rhinitis A virus 2A.


Supplementary Figure S2. Promoter expression characteristics in undifferentiated or
differentiating ES cells. (a) Configuration of gammaretroviral (RV) and lentiviral (LV) vector
plasmids harboring the PGK (phosphoglycerate kinase) or SFFV (spleen focus-forming virus)
internal promoter. EGFP: enhanced green fluorescent protein; (b) Screening experiment for
promoter activity. ES cells were kept under ES culture conditions or alternatively placed in
embryoid body (EB) differentiation medium 4 days pt. EGFP marking was assessed by flow
cytometry 2, 4 and 9 days pt, and the maximum set to 100%.


Supplementary Figure S3. Correct processing of reprogramming factor RNA and
protein. (a) Vector RNA processing of monocistronic reprogramming constructs as shown in
northern blot of HT1080 cells (total RNA). Vector RNA was detected using a radiolabeled
PRE probe. Lane 1 indicates (untransduced) Mock cells, lanes 2-5 show the expected sizes
for the SFFV-driven reprogramming factor RNAs. Size standards are given on the left,
rehybridization was done with a probe against 18S RNA. (b) Western blot analysis of
Warlich et al. 2010                                                                           5

HT1080 cells transduced with reprogramming vectors and CCE ES cells serving as a
positive control. In the upper part specific signals for the reprogramming factor proteins Klf4,
Sox2 and Oct4 are depicted; in the lower part Erk protein is shown as loading control. Size
markers are on the left. (c) Western blot analysis of murine fibroblast SC-1 cells transduced
with a 4-in-1 vector (see Figure 2), expressing the reprogramming factors Oct4, Klf4, Sox2
und c-Myc. Above the specific signals of the reprogramming factors are given (label on right),
below the loading control (stained for Actin). c-Myc is just weakly detectable because of the
short half-life time of the protein.


Supplementary Figure S4. Analysis of ES cell marker expression in iPSC clones. (a)
FACS analysis of SSEA-1 and Oct4-EGFP expression in representative iPS lines. The lower
clone was derived from Oct4-EGFP (OG2)-MEFs, the upper from C3H-MEFs devoid of the
reporter. (b) Immunofluorescence showing expression levels of Oct4 protein (red) and the
Oct4-EGFP reporter (green) in an OG2-iPS line (LV1-7b) cultured under standard ES
conditions. Alterations in colony morphology result from the fixation/permeablization
procedure. (c) Alkaline phosphatase staining of a representative iPSC clone. Alkaline
phosphatase staining was performed and was highly positive for all clones tested. (d) Real-
time PCR analysis for endogenous mRNA expression of ES cell markers. iPSC were sorted
based on EGFP expression and total RNA was isolated. Expression of ES cell markers was
set in reference to beta-Actin (ActinB, set to 1) and displayed on a logarithmic scale. C3H
MEFs served as a control.


Supplementary Figure S5. Endogenous Nanog and Oct4 promoters are highly
unmethylated in generated iPSC clones. Analysis of the Nanog (a) and Oct4 (b) promoter
methylation status based on bisulphate sequencing is shown for representative iPSC clones
(LV1-7b, LV2-5b) in comparison with OG2-MEFs. Open circles are indicative for
unmethylated, filled circles for methylated CpGs.


Supplementary Figure S6. Teratoma formation. Selected iPS cell clones LV1-7b and LV2-
5b were injected subcutaneously into the flanks of NOD/SCID mice. Teratoma formation
occurred between 4-8 weeks after injection. Teratomas were fixed, embedded in paraffin and
stained with hematoxylin/eosin. Differentiation was shown into all 3 germ layers
(endoderm/mesoderm/ectoderm) for both iPS clones (labeled on the right). Immature
endodermal acinar cells (dotted circles in a) and immature endodermal epithelial structures
(arrows in d) were detected demonstrating endodermal derivatives. Chondrogenic structures
(dotted circles in b + e) represent mesoderm derivatives and large areas of the teratoma
contained immature neuroectodermal tissue (c + f).
Warlich et al. 2010                                                                            6



Supplementary Figure S7. Relation of Oct4-EGFP reporter and reprogramming factor
expression. (a) Expression of Oct4-EGFP (green) in relation to reprogramming factor
expression (dTomato signal, red) in the course of reprogramming. OG2-MEFs were
reprogrammed using the 4-in-1 vector linked to dTomato, harvested at different time points
after transduction and analyzed by flow cytometry.           (b) Fluorescence microscopy of
reprogramming colonies at early phases of reprogramming. Reprogramming of OG2-MEFs
was induced using a 4-in-1 vector linked to dTomato. Reprogramming factor expression is
indicated by dTomato signal, activation of the reporter by EGFP expression.


Supplementary Figure S8. Single cell tracking tree of a transduced fibroblast and its
progeny. Tracking of the single transduced fibroblast of Supplementary Movie S6 based on
the nuclear dTomato signal (from a 4-in-1 vector) demonstrated the clonal character of the
observed iPS colony. Cells are numbered according to their position in the tracking tree. The
movie was started 1 day pt. Time scale after movie start is given on the left. ? indicate loss of
single cell detectability due to the condensed structure of the cell cluster. ES-like morphology
and the Oct4-EGFP signal (colonywise) appear roughly at the same time.
Warlich et al. 2010                                                                      7

Supplemental Material and Methods
Vector construction / reprogramming genes
Primer details for amplification of the reprogramming genes are shown below.

 Gene/Element          Forward Primer                Reverse Primer
 mOct4                 GCACCGGTGCCACCATGGCTGGAC      GAGTCGACTCAGTTTGAATGCATGGGAGA
                       ACCTGGCTTCAGA                 GC
 mKlf4                 GCACCGGTGCCACCATGGCTGTCA      GCGTCGACTTAAAAGTGCCTCTTCATGTGT
                       GCGACGCTCTGCTC                A
 mSox2                 GCACCGGTGCCACCATGTATAACAT     GCGTCGACTCACATGTGCGACAGGGGCAG
                       GATGGAGACGGA                  TG
 mc-Myc                GCACCGGTGCCACCATGCCCCTCAA     GCGTCGACTTATGCACCAGAGTTTCGAAG
                       CGTGAACTTCAC                  CT
 hOct4                 GCACCGGTGCCACCATGGCGGGAC      CAGTCGACTCAGTTTGAATGCATGGGAGA
                       ACCTGGCTTCGGA                 GCC
 hKlf4                 CCACCGGTGCCACCATGAGGCAGC      TTGTCGACTTAAAAATGCCTCTTCATGTGT
                       CACCTGGCGAGTCT                AA
 hSox2                 GCACCGGTGCCACCATGTACAACAT     TTGTCGACTCACATGTGTGAGAGGGGCAG
                       GATGGAGACGGA                  TGTGCC
 hc-Myc                GCACCGGTGCCACCATGCCCCTCAA     CAGTCGACTTACGCACAAGAGTTCCGTAG
                       CGTTAGCTTCAC                  CT


Embryonic stem cell culture and embryoid body formation
CCE is a mouse embryonic stem (ES) cell line derived from 129/Sv mouse strain (kindly

provided by E.F. Wagner, IMP, Vienna), cultured in DMEM supplemented with 2 mM L-

glutamine, 15% ES-grade FCS (PAA), 100 U/ml penicillin / 100 μg/ml streptomycin, non-

essential amino acids, 1% leukemia inhibitory factor (LIF)-supernatant from a producer cell

line and monothioglycerol (MTG; 150 μM) on gelatin-coated plates. For EB (embryoid body)
                  50
differentiation    , 1000 CCE cells/ml were plated on a non-treated Petri dish in EB

differentiation medium containing IMDM, 2 mM L-glutamine, penicillin/streptomycin, 15%

FCS (PAA), 50 mg/ml ascorbic acid (Sigma, Munich, Germany), 300 mg/ml human

transferrin (Sigma), 5% protein-free hybridoma medium (PFHM-II; Gibco, Paisley, UK) and

400 μM MTG. EB differentiation medium was replaced at day 5 of differentiation. For

dissociation, EB were incubated at 37°C in 0.05% trypsin for 3-5 minutes, FCS added and

EBs dissociated by repeated pipetting.



Oct4 immunofluorescence
Cells were washed, fixed in 4% paraformaldhyde and permeabilized using PBS/0.1%
TritionX-100. Unspecific binding was blocked with PBS/10%FCS and primary and secondary
staining were performed using pure mouse anti-Oct4 antibody (Santa Cruz) and goat anti-
Warlich et al. 2010                                                                      8

mouse Alexa594 antibody (Invitrogen), respectively. Nuclei were counterstained with DAPI
and the samples embedded in Mounting Medium (Invitrogen).


Alkaline phosphatase staining
Staining   was    performed   using   Alkaline   Phosphatase   Detection   Kit   (Chemicon,
Schwalbach/Ts., Germany) according to manufacturer´s instructions (Chemicon). Cells were
fixed with 4% paraformaldehyde, washed with Tris-buffered saline/0.05% Tween and stained
with AP staining solution.



SSEA-1 staining

For flow cytometry, cells were harvested after trypsinization and resuspended in PBS/2%
FCS. For flow cytometry and immunofluorescence, cells were rinsed with PBS and stained
with biotinylated anti-SSEA-1 antibody (eBioscience, San Diego, USA) diluted in
PBS/2%FCS for 30 min at 4°C. After rinsing secondary staining was performed with a
streptavidin-PE antibody (eBioscience). Immunofluorescence was analyzed on a Zeiss Axio
Observer.Z1 fluorescence microscope and flow cytometry using a FACSCalibur (Becton
Dickinson, Heidelberg, Germany).



Real-time PCR for ES markers
RNA of iPS clones LV1-7b and LV2-5b, and C3H MEF cells was extracted using RNeasy
column purification (Qiagen, Hilden, Germany). Subsequently, RNA was reverse transcribed
using Quantiscript Reverse Transcriptase (Qiagen) and the cDNA was tested for the
expression of ES cell markers Zfp42, Nanog, Eras, Utf1, Fgf4, Oct4, Ecat and Esg1 (primers
see below) by SYBR Green PCR. As internal control Actb was used, which was amplified
using a primer pair against Actb (Qiagen, Quantiscript Cat. No. QT01136772). qPCR was
performed using QuantiTect SYBR Green mastermix (Qiagen) on a StepOnePlus
thermocycler (Applied Biosystems, Carlsbad, CA, USA) using 30 cycles of 95°C for 15
seconds and 60°C for 1 minute.
Gene              Forward primer                       Reverse primer
Nanog             CAGGTGTTTGAGGGTAGCTC                 CGGTTCATCATGGTACAGTC

Oct4              TCTTTCCACCAGGCCCCCGGCTC              TGCGGGCGGACATGGGGAGATCC

Ecat              TGTGGGGCCCTGAAAGGCGAGCTGAGAT         ATGGGCCGCCATACGACGACGCTCAACT

Esg1              GAAGTCTGGTTCCTTGGCAGGATG             ACTCGATACACTGGCCTAGC

Eras              ACTGCCCCTCATCAGACTGCTACT             CACTGCCTTGTACTCGGGTAGCTG

Fgf4              CGTGGTGAGCATCTTCGGAGTGG              CCTTCTTGGTCCGCCCGTTCTTA

Zfp42             ACGAGTGGCAGTTTCTTCTTGGGA             TATGACTCACTTCCAGGGGGCACT
Warlich et al. 2010                                                                         9


Utf1              GGATGTCCCGGTGACTACGTCTG                GGCGGATCTGGTTATCGAAGGGT



Bisulphite sequencing
The sequence upstream of Nanog and Oct4 coding sequences was retrieved from
Ensembl.org. Primers covering the CpGs in the 721 bp upstream of Oct4 coding sequence
and the CpGs in the 820 bp upstream of Nanog coding sequence were designed using
BiSearch primer design software (http://bisearch.enzim.hu/). Using these primers, PCR was
performed on bisulphite treated DNA. DNA of clones LV1-7b and LV2-5b was isolated using
QIAamp DNA micro columns (Qiagen). Bisulphite reaction was performed on DNA using
Epitect bisulphite reagents according to manufacturer’s instructions (Qiagen). The resulting
amplicons were excised and isolated from agarose gels and subcloned into pCR2
(Invitrogen, Karlsruhe, Germany). Sequencing was performed using M13 primers. CpGs
were analyzed in >5 different clones. Primer details are listed below.
Promoter PCR          Forward primer                       Reverse primer
Nanog 1               ATTTGATTTGAAATTTTTTATT               TAATCTAAAAACATCCCCCC

Nanog 2               AGGTAATAGAGAAAAATTTG                 CTAAAAAAATCTTCCCTCCAAA

Oct4 1                TTGAAGGTTGAAAATGAAGGTT               CAAAACTATAAAAATAAAAAAAAC

Oct4 2                TGAGGAGTGGTTTTAGAAATAA               CAAAACCTATTAACACTACA

Oct4 3                GGGTGGTTAGTGTTTAATTTATT              AAAATTTAAAAACTCTACACCA



Teratoma formation
One million cells were injected into left and right dorsal flanks of NOD/SCID-mice under
isoflurane anesthesia according to approved institutional animal protocols. The mice were
daily investigated for tumor growth and ascites development and sacrificed when palpable
tumors were detectable. Tissues were fixed in 4% formaldehyde and paraffin sections were
stained with hematoxylin/eosin according to standard protocols for histological analyses.



Northern blots
Total RNA was isolated using RNAzol (WAK-Chemicals, Steinbach, Germany). Ten µg RNA
were denatured at 65°C and separated in denaturing formaldehyde gels at 0.6 V/cm2. RNA
was transferred onto a Biodyne B nylon membrane (Pall, Pensacola, USA) via capillary blot
technique and heat fixed for 2h at 80°C. Blots were hybridized against the vector´s PRE
element. Radiolabeling of the probes was carried out using the DecaLabeling Kit (Fermentas,
St. Leon-Rot, Germany) and subsequent purification with spin columns (Mobitec, Göttingen,
Germany). After hybridization, blots were washed and exposed to Kodak Biomax XAR films.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:4
posted:10/18/2011
language:English
pages:9