Docstoc

RID=1056489588-0120-15674_

Document Sample
RID=1056489588-0120-15674_ Powered By Docstoc
					99   UNCLASSIFIED                                 661
11   RESCUE, DEFENSE, STRESS                      191
01   METABOLISM                                   166
02   ENERGY                                       120
98   NO CLEAR ANNOTATION POSSIBLE                  95
05   PROTEIN SYNTHESIS                             75
06   PROTEIN DESTINATION                           74
04   TRANSCRIPTION                                 68
10   COMMUNICATION SIGNAL TRANSDUCTION             64
07   TRANSPORT FACILITATION                        64
13   CELLULAR ORGANISATION                         30
03   CELL GROWTH, CELL DIVISION, DNA SYNTHESIS     23
08   CELLULAR TRANSPORT                            10
15   DEVELOPMENT                                    9
12   IONIC HOMEOSTASIS                              3
16   TRANSPOSABLE ELEMENTS                          2
09   CELLULAR BIOGENESIS                            2
                                                 1657
   Genbank             Clone                                                                                                                          Funct
                                                  Annotation                                                Annotation
  Accession            Name                                                                                                                           . Cat.

                               gi|19684791|gb|BM986125.1|BM986125 9_G08_T3
gi|19684791|gb|BM9              Ath Thellungiella halophila cDNA clone 9_G08_T3
                      9_G08_T3                                                             U2 RNA gene, between At2g02930 and At2g02950               04.4
86125.1|BM986125               similar to Arabidopsis thaliana DNA chromosome 3,
                                             BAC clone F15B8, mRNA

                                 gi|19684798|gb|BM986132.1|BM986132 9_H06_T3
gi|19684798|gb|BM9                Ath Thellungiella halophila cDNA clone 9_H06_T3
                      9_H06_T3                                                             U2 RNA gene, between At2g02930 and At2g02950               04.4
86132.1|BM986132                 similar to Arabidopsis thaliana DNA chromosome 3,
                                               BAC clone F15B8, mRNA

                                 gi|19684341|gb|BM985675.1|BM985675 3_C10_T3
gi|19684341|gb|BM9                Ath Thellungiella halophila cDNA clone 3_C10_T3
                      3_C10_T3                                                                       unknown protein (At1g01230)                      99
85675.1|BM985675                      similar to AB017067 - Arabidopsis thaliana
                                       chromosome 5, P1 clone:MJC20, mRNA

                                     gi|15661316|gb|BI698687.1|BI698687 Ts345
gi|15661316|gb|BI69
                       Ts345            Thellungiella salsuginea cDNA similar to             transcription factor TINY, putative (At1g01250)          04.0
  8687.1|BI698687
                                      transcription factor TINY, mRNA sequence
                                 gi|19684285|gb|BM985619.1|BM985619 2_C08_T3
gi|19684285|gb|BM9                Ath Thellungiella halophila cDNA clone 2_C08_T3
                      2_C08_T3                                                            no apical meristem (NAM) protein family (At1g01720)         15.0
85619.1|BM985619                  similar to Sequence of BAC T1N6 from A.thaliana,
                                                          mRNA
                                 gi|19684307|gb|BM985641.1|BM985641 2_F06_T3
gi|19684307|gb|BM9                Ath Thellungiella halophila cDNA clone 2_F06_T3
                      2_F06_T3                                                            no apical meristem (NAM) protein family (At1g01720)         15.0
85641.1|BM985641                  similar to Sequence of BAC T1N6 from A.thaliana,
                                                          mRNA

                                   gi|19913633|gb|BQ079274.1|BQ079274 Ts780
gi|19913633|gb|BQ0
                       Ts780        Thellungiella salsuginea cDNA similar to NAC     similar to NAC domain protein NAM GB:AAD17313 (At1g01720)        15.0
79274.1|BQ079274
                                      domain protein, putative, mRNA sequence

                               gi|19684574|gb|BM985908.1|BM985908 6_G04_T3
gi|19684574|gb|BM9              Ath Thellungiella halophila cDNA clone 6_G04_T3
                      6_G04_T3                                                                       expressed protein (At1g01730)                    99
85908.1|BM985908               similar to AC009273 - Sequence of BAC T1N6 from
                                   Arabidopsis thaliana chromosome 1, mRNA

                                 gi|19684143|gb|BM985507.1|BM985507 10_F11_T
gi|19684143|gb|BM9                Ath Thellungiella halophila cDNA clone 10_F11_T
                      10_F11_T                                                       short-chain dehydrogenase/reductase family protein (At1g01800)   98
85507.1|BM985507                 similar to AC009273 - Sequence of BAC T1N6 from
                                     Arabidopsis thaliana chromosome 1, mRNA
                                  gi|19684338|gb|BM985672.1|BM985672 3_C07_T3
gi|19684338|gb|BM9                 Ath Thellungiella halophila cDNA clone 3_C07_T3
                      3_C07_T3                                                                     putative carbonyl reductase (At1g01800)               98
85672.1|BM985672                   similar to Sequence of BAC T1N6 from A.thaliana,
                                                         mRNA

                                  gi|19855137|gb|BQ060189.1|BQ060189 Ts1055
gi|19855137|gb|BQ0
                       Ts1055     Thellungiella salsuginea cDNA similar to carbonyl                putative carbonyl reductase (At1g01800)               98
60189.1|BQ060189
                                        reductase, putative, mRNA sequence

                                   gi|19855301|gb|BQ060351.1|BQ060351 Ts1398
gi|19855301|gb|BQ0                 Thellungiella salsuginea cDNA similar to a retinal
                       Ts1398                                                           short-chain dehydrogenase/reductase family protein (At1g01800)   98
60351.1|BQ060351                   short-chain dehydrogenase/reductase retSDR4,
                                                    mRNA sequence

                                     gi|15661448|gb|BI698819.1|BI698819 Ts749
gi|15661448|gb|BI69                 Thellungiella salsuginea cDNA similar to retinal
                        Ts749                                                                      putative carbonyl reductase (At1g01800)               98
  8819.1|BI698819                   short-chain dehydrogenase/reductase retSDR4
                                         from Homo sapiens, mRNA sequence

                                   gi|19855352|gb|BQ060402.1|BQ060402 Ts1100
gi|19855352|gb|BQ0
                       Ts1100          Thellungiella salsuginea cDNA similar to             guanine nucleotide exchange protein family (At1g01960)       99
60402.1|BQ060402
                                        hypothetical protein, mRNA sequence

                                   gi|19855336|gb|BQ060386.1|BQ060386 Ts1466
gi|19855336|gb|BQ0
                       Ts1466          Thellungiella salsuginea cDNA similar to             guanine nucleotide exchange protein family (At1g01960)       99
60386.1|BQ060386
                                        hypothetical protein, mRNA sequence

                               gi|19684152|gb|BM985510.1|BM985510 10_G04_T
gi|19684152|gb|BM9              Ath Thellungiella halophila cDNA clone 10_G04_T
                      10_G04_T                                                                     GTP-binding protein-related (At1g02280)               99
85510.1|BM985510                similar to (U89959) similar to GTP-binding protein
                                           [Arabidopsis thaliana], mRNA

                                  gi|19684477|gb|BM985811.1|BM985811 5_C11_T3
gi|19684477|gb|BM9                 Ath Thellungiella halophila cDNA clone 5_C11_T3
                      5_C11_T3                                                                       glycine-rich protein (At1g02710)               99
85811.1|BM985811                  similar to Arabidopsis thaliana chromosome I BAC
                                                     T14P4 ,mRNA
                                      gi|15661024|gb|BI698395.1|BI698395 Ts034
gi|15661024|gb|BI69
                        Ts034      Thellungiella salsuginea cDNA similar to F21B7.3, putative 1-aminocyclopropane-1-carboxylate oxidase (At1g03400) 03.7
  8395.1|BI698395
                                                    mRNA sequence

                                  gi|19684494|gb|BM985828.1|BM985828 5_E10_T3
gi|19684494|gb|BM9
                      5_E10_T3     Ath Thellungiella halophila cDNA clone 5_E10_T3        2-oxoglutarate-dependent dioxygenase, putative (At1g03410)     03.7
85828.1|BM985828
                                           similar to A.t. 2A6 mRNA, mRNA

                                   gi|19855148|gb|BQ060200.1|BQ060200 Ts1071
gi|19855148|gb|BQ0
                       Ts1071     Thellungiella salsuginea cDNA similar to F21B7.3,     putative 1-aminocyclopropane-1-carboxylate oxidase (At1g03410) 03.7
60200.1|BQ060200
                                                   mRNA sequence
                                      gi|15661097|gb|BI698468.1|BI698468 Ts34
gi|15661097|gb|BI69
                        Ts34      Thellungiella salsuginea cDNA similar to F21B7.3, putative 1-aminocyclopropane-1-carboxylate oxidase (At1g03410) 03.7
  8468.1|BI698468
                                                   mRNA sequence
                                    gi|20046883|gb|BQ087682.1|BQ087682 Ts361
gi|20046883|gb|BQ0               Thellungiella salsuginea cDNA similar to putative 1-
                       Ts361                                                          putative 1-aminocyclopropane-1-carboxylate oxidase (At1g03410) 99
87682.1|BQ087682                  aminocyclopropane-1-carboxylate oxidase, mRNA
                                                       sequence
                                   gi|19855360|gb|BQ060410.1|BQ060410 Ts1109
gi|19855360|gb|BQ0
                       Ts1109    Thellungiella salsuginea cDNA similar to expressed               photosystem II protein family (At1g03600)          02.10
60410.1|BQ060410
                                               protein, mRNA sequence

                                   gi|15661145|gb|BI698516.1|BI698516 Ts474
gi|15661145|gb|BI69
                       Ts474          Thellungiella salsuginea cDNA similar to                       unknown protein (At1g03610)                    99
  8516.1|BI698516
                                  hypothetical protein F21B7.14, mRNA sequence

                                 gi|19684387|gb|BM985721.1|BM985721 4_A08_T3
gi|19684387|gb|BM9                Ath Thellungiella halophila cDNA clone 4_A08_T3
                      4_A08_T3                                                                  60S ribosomal protein L17 (At1g04480)               05.1
85721.1|BM985721                  similar to (AC002332) 60S ribosomal protein L23
                                             [Arabidopsis thaliana], mRNA

                                     gi|15661240|gb|BI698611.1|BI698611 Ts214
gi|15661240|gb|BI69
                       Ts214         Thellungiella salsuginea cDNA similar to 60S      strong similarity to 60S ribosomal protein L17 (At1g04480)   05.1
  8611.1|BI698611
                                        ribosomal protein L23, mRNA sequence
                                 gi|19684192|gb|BM985526.1|BM985526 1_A02_T3
gi|19684192|gb|BM9                Ath Thellungiella halophila cDNA clone 1_A02_T3
                      1_A02_T3                                                                    FtsH protease, putative (At1g06430)               06.5
85526.1|BM985526                 similar to Sequence of BAC T2D23 from A.thaliana,
                                                         mRNA

                                  gi|19855339|gb|BQ060389.1|BQ060389 Ts1474
gi|19855339|gb|BQ0
                       Ts1474         Thellungiella salsuginea cDNA similar to            clone C104937 putative FtsH protease (At1g06430)          06.5
60389.1|BQ060389
                                 deoxyribose-phosphate aldolase, mRNA sequence

                                    gi|15661403|gb|BI698774.1|BI698774 Ts656
gi|15661403|gb|BI69
                       Ts656        Thellungiella salsuginea cDNA similar to cell                 putative FtsH protease (At1g06430)                06.5
  8774.1|BI698774
                                 division protease FtsH, putative, mRNA sequence

                                  gi|19913669|gb|BQ079310.1|BQ079310 Ts847
gi|19913669|gb|BQ0
                       Ts847        Thellungiella salsuginea cDNA similar to cell         clone C104937 putative FtsH protease (At1g06430)          06.5
79310.1|BQ079310
                                 division protease FtsH, putative, mRNA sequence

                                   gi|15661296|gb|BI698667.1|BI698667 Ts257
gi|15661296|gb|BI69                 Thellungiella salsuginea cDNA similar to 4-
                       Ts257                                                            4-hydroxyphenylpyruvate dioxygenase HPD (At1g06570)         01.0
  8667.1|BI698667                 HYDROXYPHENYLPYRUVATE DIOXYGENASE
                                        (4HPPD) (HPD), mRNA sequence
                                    gi|15661099|gb|BI698470.1|BI698470 Ts397
                                   Thellungiella salsuginea cDNA similar to 39 KD
gi|15661099|gb|BI69
                       Ts397     FK506-BINDING NUCLEAR PROTEIN (PEPTIDYL-                            unknown protein (At1g06890)                99
  8470.1|BI698470
                                   PROLYL CIS-TRANS ISOMERASE) (PPIASE),
                                                   mRNA sequence

                                 gi|19684469|gb|BM985803.1|BM985803 5_C02_T3
gi|19684469|gb|BM9
                      5_C02_T3    Ath Thellungiella halophila cDNA clone 5_C02_T3                   expressed protein (At1g07040)               99
85803.1|BM985803
                                  similar to (AC000348) T7N9.9 [A.thaliana], mRNA

                                    gi|15661130|gb|BI698501.1|BI698501 Ts221
gi|15661130|gb|BI69
                       Ts221           Thellungiella salsuginea cDNA similar to                DNA-binding protein, putative (At1g07590)        99
  8501.1|BI698501
                                   metallothionein-like protein 1, mRNA sequence

                                  gi|19855215|gb|BQ060266.1|BQ060266 Ts1317
gi|19855215|gb|BQ0                   Thellungiella salsuginea cDNA similar to L-
                       Ts1317                                                              ascorbate peroxidase, putative (APX) (At1g07890)     11.4
60266.1|BQ060266                  ascorbate peroxidase (EC 1.11.1.11) precursor,
                                                  mRNA sequence
                                    gi|15661037|gb|BI698408.1|BI698408 Ts391
gi|15661037|gb|BI69                  Thellungiella salsuginea cDNA similar to L-
                       Ts391                                                               ascorbate peroxidase, putative (APX) (At1g07890)     11.4
  8408.1|BI698408                 ascorbate peroxidase (EC 1.11.1.11) precursor,
                                                   mRNA sequence
                                    gi|15661497|gb|BI698868.1|BI698868 Ts915
gi|15661497|gb|BI69                  Thellungiella salsuginea cDNA similar to L-
                       Ts915                                                               ascorbate peroxidase, putative (APX) (At1g07890)     11.4
  8868.1|BI698868                 ascorbate peroxidase (EC 1.11.1.11) precursor,
                                                   mRNA sequence

                               gi|19684714|gb|BM986048.1|BM986048 8_G02_T3
gi|19684714|gb|BM9              Ath Thellungiella halophila cDNA clone 8_G02_T3
                      8_G02_T3                                                             elongation factor 1-alpha (EF-1-alpha) (At1g07940)   05.2
86048.1|BM986048                  similar to Arabidopsis thaliana chromosome 1
                                             CHR1v12152001 ,mRNA

                                 gi|19684289|gb|BM985623.1|BM985623 2_D02_T3
gi|19684289|gb|BM9
                      2_D02_T3    Ath Thellungiella halophila cDNA clone 2_D02_T3                proline-rich protein family (At1g08370)        99
85623.1|BM985623
                                 similar to (AC006932) T27G7.7 [A.thaliana], mRNA

                                 gi|19684795|gb|BM986129.1|BM986129 9_H03_T3
gi|19684795|gb|BM9
                      9_H03_T3    Ath Thellungiella halophila cDNA clone 9_H03_T3                   proline-rich protein (At1g08370)            99
86129.1|BM986129
                                 similar to (AC006932) T27G7.7 [A.thaliana], mRNA

                                     gi|15661344|gb|BI698715.1|BI698715 Ts301
gi|15661344|gb|BI69
                       Ts301        Thellungiella salsuginea cDNA similar to yeast                  expressed protein (At1g08370)               99
  8715.1|BI698715
                                                dcp1, mRNA sequence
                                 gi|19684799|gb|BM986133.1|BM986133 9_H07_T3
gi|19684799|gb|BM9                Ath Thellungiella halophila cDNA clone 9_H07_T3
                      9_H07_T3                                                           contains Pfam profile PF00168: C2 domain (At1g09070)   99
86133.1|BM986133                 similar to (AJ007586) src2-like protein [A.thaliana],
                                                        mRNA
                                 gi|19684623|gb|BM985957.1|BM985957 7_D04_T3
gi|19684623|gb|BM9                Ath Thellungiella halophila cDNA clone 7_D04_T3
                      7_D04_T3                                                                expressed protein (At1g09310)            99
85957.1|BM985957                      similar to AC006416 - Arabidopsis thaliana
                                    chromosome 1 BAC T31J12 sequence, mRNA

                                  gi|10172530|gb|BE758538.1|BE758538 Sc0074
gi|10172530|gb|BE75                    Thellungiella salsuginea cDNA similar to
                       Sc0074                                                                 unknown protein (At1g09310)              99
  8538.1|BE758538                    gb|AA720210 come from this gene, mRNA
                                                       sequence
                                    gi|15661392|gb|BI698763.1|BI698763 Ts175
gi|15661392|gb|BI69
                       Ts175     Thellungiella salsuginea cDNA similar to unknown             unknown protein (At1g09310)              99
  8763.1|BI698763
                                              protein, mRNA sequence

                                    gi|15661370|gb|BI698741.1|BI698741 Ts439
                                   Thellungiella salsuginea cDNA similar to ESTs
gi|15661370|gb|BI69
                       Ts439     gb|T20589, gb|T04648, gb|AA597906, gb|T04111,                unknown protein (At1g09310)              99
  8741.1|BI698741
                                  gb|R84180, gb|R65428, gb|T44439, gb|T76570,
                                           gb|R90004,, mRNA sequence

                                    gi|15661376|gb|BI698747.1|BI698747 Ts539
gi|15661376|gb|BI69                Thellungiella salsuginea cDNA similar to ESTs
                       Ts539                                                                  unknown protein (At1g09310)              99
  8747.1|BI698747                gb|T20589, gb|T04648, gb|AA597906, gb|T04111,,
                                                  mRNA sequence

                                  gi|19855170|gb|BQ060221.1|BQ060221 Ts1170
gi|19855170|gb|BQ0
                       Ts1170     Thellungiella salsuginea cDNA similar to putative     putative RNA-binding protein (At1g09340)       04.4
60221.1|BQ060221
                                       RNA binding protein, mRNA sequence

                                 gi|19684559|gb|BM985893.1|BM985893 6_E05_T3
gi|19684559|gb|BM9
                      6_E05_T3    Ath Thellungiella halophila cDNA clone 6_E05_T3     putative 60S ribosomal protein L21 (At1g09590)   05.1
85893.1|BM985893
                                 similar to 60S RIBOSOMAL PROTEIN L21, mRNA

                                 gi|19684747|gb|BM986081.1|BM986081 9_B09_T3
gi|19684747|gb|BM9
                      9_B09_T3    Ath Thellungiella halophila cDNA clone 9_B09_T3     putative 60S ribosomal protein L21 (At1g09590)   05.1
86081.1|BM986081
                                 similar to 60S RIBOSOMAL PROTEIN L21, mRNA

                                    gi|15661244|gb|BI698615.1|BI698615 Ts616
gi|15661244|gb|BI69
                       Ts616       Thellungiella salsuginea cDNA similar to 60S       putative 60S ribosomal protein L21 (At1g09590)   05.1
  8615.1|BI698615
                                   RIBOSOMAL PROTEIN L21, mRNA sequence

                                 gi|19684410|gb|BM985744.1|BM985744 4_D05_T3
gi|19684410|gb|BM9
                      4_D05_T3    Ath Thellungiella halophila cDNA clone 4_D05_T3           ribosomal protein L21 (At1g09690)          05.1
85744.1|BM985744
                                 similar to 60S RIBOSOMAL PROTEIN L21, mRNA

                                 gi|19684416|gb|BM985750.1|BM985750 4_D12_T3
gi|19684416|gb|BM9
                      4_D12_T3    Ath Thellungiella halophila cDNA clone 4_D12_T3     putative 60S ribosomal protein L21 (At1g09690)   05.1
85750.1|BM985750
                                 similar to 60S RIBOSOMAL PROTEIN L21, mRNA
                                   gi|16004621|gb|BI851134.1|BI851134 Ts995
gi|16004621|gb|BI85
                       Ts995       Thellungiella salsuginea cDNA similar to ATP             ATP phosphoribosyl transferase (At1g09795)               01.1
  1134.1|BI851134
                                   phosphoribosyltransferase, mRNA sequence
                                  gi|19913664|gb|BQ079305.1|BQ079305 Ts835
gi|19913664|gb|BQ0
                        Ts835         Thellungiella salsuginea cDNA similar to                     expressed protein (At1g10090)                     99
79305.1|BQ079305
                                      At1g10080/T27I1_10, mRNA sequence
                               gi|19684196|gb|BM985530.1|BM985530 1_A07_T3
gi|19684196|gb|BM9              Ath Thellungiella halophila cDNA clone 1_A07_T3
                      1_A07_T3                                                                     expressed protein (At1g10590)                     99
85530.1|BM985530                  similar to (AC007067) T10O24.24 [Arabidopsis
                                                  thaliana], mRNA
                               gi|19684161|gb|BM985513.1|BM985513 10_G07_T
gi|19684161|gb|BM9              Ath Thellungiella halophila cDNA clone 10_G07_T
                      10_G07_T                                                                     expressed protein (At1g10590)                     99
85513.1|BM985513                  similar to (AC007067) T10O24.24 [Arabidopsis
                                                  thaliana], mRNA
                               gi|19684344|gb|BM985678.1|BM985678 3_D01_T3
gi|19684344|gb|BM9              Ath Thellungiella halophila cDNA clone 3_D01_T3
                      3_D01_T3                                                                     expressed protein (At1g10590)                     99
85678.1|BM985678                  similar to (AC007067) T10O24.24 [Arabidopsis
                                                  thaliana], mRNA
                               gi|19684511|gb|BM985845.1|BM985845 5_G10_T3
gi|19684511|gb|BM9              Ath Thellungiella halophila cDNA clone 5_G10_T3
                      5_G10_T3                                                                     expressed protein (At1g10590)                     99
85845.1|BM985845                  similar to (AC007067) T10O24.24 [Arabidopsis
                                                  thaliana], mRNA
                               gi|19684657|gb|BM985991.1|BM985991 7_H06_T3
gi|19684657|gb|BM9              Ath Thellungiella halophila cDNA clone 7_H06_T3
                      7_H06_T3                                                                     expressed protein (At1g10590)                     99
85991.1|BM985991                  similar to (AC007067) T10O24.24 [Arabidopsis
                                                  thaliana], mRNA
                                   gi|15661267|gb|BI698638.1|BI698638 Ts606
gi|15661267|gb|BI69
                        Ts606         Thellungiella salsuginea cDNA similar to                      unknown protein (At1g10590)                      99
  8638.1|BI698638
                                            T10O24.24, mRNA sequence

                                 gi|19684299|gb|BM985633.1|BM985633 2_E08_T3
gi|19684299|gb|BM9
                      2_E08_T3    Ath Thellungiella halophila cDNA clone 2_E08_T3                  expressed protein (At1g11060)                     99
85633.1|BM985633
                                  similar to (U95973) unknown protein [A.t.], mRNA

                                    gi|15661119|gb|BI698490.1|BI698490 Ts264
gi|15661119|gb|BI69                    Thellungiella salsuginea cDNA similar to
                       Ts264                                                              putative glucose transporter protein (At1g11260)           07.3
  8490.1|BI698490                 GLUCOSE TRANSPORTER (SUGAR CARRIER),
                                                   mRNA sequence

                                 gi|19684204|gb|BM985538.1|BM985538 1_B04_T3
gi|19684204|gb|BM9                Ath Thellungiella halophila cDNA clone 1_B04_T3
                      1_B04_T3                                                       glyoxalase I, putative (lactoylglutathione lyase) (At1g11840)   02.8
85538.1|BM985538                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA
                                 gi|19684426|gb|BM985760.1|BM985760 4_F02_T3
gi|19684426|gb|BM9                Ath Thellungiella halophila cDNA clone 4_F02_T3
                      4_F02_T3                                                           glyoxalase I, putative (lactoylglutathione lyase) (At1g11840)   02.8
85760.1|BM985760                      similar to AC002131 - Arabidopsis thaliana
                                    chromosome 1 BAC F12F1 sequence, mRNA

                                 gi|19684514|gb|BM985848.1|BM985848 5_H01_T3
gi|19684514|gb|BM9                Ath Thellungiella halophila cDNA clone 5_H01_T3
                      5_H01_T3                                                           glyoxalase I, putative (lactoylglutathione lyase) (At1g11840)   02.8
85848.1|BM985848                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                                     gi|15661046|gb|BI698417.1|BI698417 Ts008
                                  Thellungiella salsuginea cDNA similar to aspartic
gi|15661046|gb|BI69
                       Ts008        proteinase cDNA gb|U51036 from A. thaliana.                   putative aspartic proteinase (At1g11910)               06.5
  8417.1|BI698417
                                  ESTs gb|N96313, gb|T21893, gb|R30158,, mRNA
                                                        sequence
                                 gi|19684680|gb|BM986014.1|BM986014 8_C02_T3
gi|19684680|gb|BM9                Ath Thellungiella halophila cDNA clone 8_C02_T3               protease inhibitor/seed storage/ lipid transfer
                      8_C02_T3                                                                                                                           99
86014.1|BM986014                 similar to T28K15, complete sequence [Arabidopsis                  protein (LTP) family (At1g12090) (pEARLI1)
                                                    thaliana], mRNA
                                     gi|15661088|gb|BI698459.1|BI698459 Ts330
gi|15661088|gb|BI69
                       Ts330      Thellungiella salsuginea cDNA similar to extensin-                   putative pEARLI 1 (At1g12090)                     98
  8459.1|BI698459
                                             like protein, mRNA sequence

                                 gi|19684021|gb|BM985464.1|BM985464 10_A07_T
gi|19684021|gb|BM9                Ath Thellungiella halophila cDNA clone 10_A07_T      flavin-containing monooxygenase (FMO) family (At1g12200) also
                   10_A07_T3                                                                                                                             99
85464.1|BM985464                    similar to gb|AC022522.2|AC022522 T28K15,                     annotated as unknown protein (At1g12200)
                                 complete sequence [Arabidopsis Thaliana], mRNA

                                   gi|10128311|gb|BE727015.1|BE727015 Sc0036
gi|10128311|gb|BE72
                       Sc0036    Thellungiella salsuginea cDNA similar to T3P18.14,                     unknown protein (At1g12200)                      99
  7015.1|BE727015
                                                   mRNA sequence
                                   gi|11457354|gb|BF440073.1|BF440073 Sc0157
gi|11457354|gb|BF44
                       Sc0157     Thellungiella salsuginea cDNA similar to unknown                      unknown protein (At1g12200)                      99
  0073.1|BF440073
                                               protein, mRNA sequence
                                   gi|19855218|gb|BQ060269.1|BQ060269 Ts1320
gi|19855218|gb|BQ0
                       Ts1320     Thellungiella salsuginea cDNA similar to unknown                      unknown protein (At1g12200)                      99
60269.1|BQ060269
                                               protein, mRNA sequence

                                  gi|19855194|gb|BQ060245.1|BQ060245 Ts1206
gi|19855194|gb|BQ0
                       Ts1206      Thellungiella salsuginea cDNA similar to beta-                  putative beta-fructosidase (At1g12240)                01.5
60245.1|BQ060245
                                       fructosidase, putative, mRNA sequence

                                 gi|19684190|gb|BM985524.1|BM985524 10_H11_T
gi|19684190|gb|BM9                Ath Thellungiella halophila cDNA clone 10_H11_T
                      10_H11_T                                                                         expressed protein (At1g12450)                     99
85524.1|BM985524                     similar to (AC025416) F5O11.19 [A.thaliana],
                                                        mRNA
                                 gi|19684655|gb|BM985989.1|BM985989 7_H01_T3
gi|19684655|gb|BM9                Ath Thellungiella halophila cDNA clone 7_H01_T3
                      7_H01_T3                                                                      expressed protein (At1g12450)                 99
85989.1|BM985989                     similar to (AC025416) F5O11.19 [A.thaliana],
                                                        mRNA

                                   gi|19913644|gb|BQ079285.1|BQ079285 Ts795
gi|19913644|gb|BQ0
                       Ts795      Thellungiella salsuginea cDNA similar to uridine        uridine diphosphate glucose epimerase (At1g12780)       01.5
79285.1|BQ079285
                                 diphosphate glucose epimerase, mRNA sequence

                                   gi|15661347|gb|BI698718.1|BI698718 Ts266
                                      Thellungiella salsuginea cDNA similar to
gi|15661347|gb|BI69
                       Ts266       VACUOLAR ATP SYNTHASE SUBUNIT C (V-                    vacuolar ATP sythase subunit C (DET3) (At1g12840)       07.8
  8718.1|BI698718
                                   ATPASE C SUBUNIT) (VACUOLAR PROTON
                                       PUMP C SUBUNIT), mRNA sequence

                                 gi|19684411|gb|BM985745.1|BM985745 4_D06_T3
gi|19684411|gb|BM9                Ath Thellungiella halophila cDNA clone 4_D06_T3
                      4_D06_T3                                                               oxysterol-binding protein -related (At1g13170)       99
85745.1|BM985745                      similar to AC007357 - Arabidopsis thaliana
                                    chromosome 1 BAC F3F19 sequence, mRNA

                                 gi|19684200|gb|BM985534.1|BM985534 1_A12_T3
                                  Ath Thellungiella halophila cDNA clone 1_A12_T3
gi|19684200|gb|BM9
                      1_A12_T3           similar to Mustard mRNA for cytosolic       glyceraldehyde-3-phosphate dehydrogenase-related (At1g13440) 02.1
85534.1|BM985534
                                     glyceraldehyde-3-phosphate dehydrogenase
                                     (GAPDH, NAD-specific; EC 1.2.1.12), mRNA

                                 gi|19684286|gb|BM985620.1|BM985620 2_C10_T3
                                  Ath Thellungiella halophila cDNA clone 2_C10_T3
gi|19684286|gb|BM9
                      2_C10_T3           similar to Mustard mRNA for cytosolic       glyceraldehyde-3-phosphate dehydrogenase-related (At1g13440) 02.1
85620.1|BM985620
                                     glyceraldehyde-3-phosphate dehydrogenase
                                     (GAPDH, NAD-specific; EC 1.2.1.12), mRNA

                                 gi|19684340|gb|BM985674.1|BM985674 3_C09_T3
                                  Ath Thellungiella halophila cDNA clone 3_C09_T3
gi|19684340|gb|BM9
                      3_C09_T3           similar to Mustard mRNA for cytosolic       glyceraldehyde-3-phosphate dehydrogenase-related (At1g13440) 02.1
85674.1|BM985674
                                     glyceraldehyde-3-phosphate dehydrogenase
                                     (GAPDH, NAD-specific; EC 1.2.1.12), mRNA

                                 gi|19684396|gb|BM985730.1|BM985730 4_B09_T3
                                  Ath Thellungiella halophila cDNA clone 4_B09_T3
gi|19684396|gb|BM9
                      4_B09_T3           similar to Mustard mRNA for cytosolic    glyceraldehyde-3-phosphate dehydrogenase, putative (At1g13440) 02.1
85730.1|BM985730
                                     glyceraldehyde-3-phosphate dehydrogenase
                                     (GAPDH, NAD-specific; EC 1.2.1.12), mRNA
                                 gi|19684478|gb|BM985812.1|BM985812 5_C12_T3
                                  Ath Thellungiella halophila cDNA clone 5_C12_T3
gi|19684478|gb|BM9
                      5_C12_T3           similar to Mustard mRNA for cytosolic        glyceraldehyde-3-phosphate dehydrogenase-related (At1g13440) 02.1
85812.1|BM985812
                                     glyceraldehyde-3-phosphate dehydrogenase
                                     (GAPDH, NAD-specific; EC 1.2.1.12), mRNA

                                    gi|15661113|gb|BI698484.1|BI698484 Ts255
gi|15661113|gb|BI69                    Thellungiella salsuginea cDNA similar to
                       Ts255                                                          glyceraldehyde-3-phosphate dehydrogenase, putative (At1g13440) 02.1
  8484.1|BI698484                 glyceraldehyde-3-phosphate dehydrogenase (EC
                                        1.2.1.12), cytosolic, mRNA sequence
                                    gi|15661121|gb|BI698492.1|BI698492 Ts399
gi|15661121|gb|BI69                    Thellungiella salsuginea cDNA similar to
                       Ts399                                                          glyceraldehyde-3-phosphate dehydrogenase, putative (At1g13440) 02.1
  8492.1|BI698492                 glyceraldehyde-3-phosphate dehydrogenase (EC
                                        1.2.1.12), cytosolic, mRNA sequence

                                 gi|19684457|gb|BM985791.1|BM985791 5_A09_T3
gi|19684457|gb|BM9                Ath Thellungiella halophila cDNA clone 5_A09_T3
                      5_A09_T3                                                                         expressed protein (At1g13930)                        99
85791.1|BM985791                       similar to (AC007576) Unknown protein
                                            [Arabidopsis thaliana], mRNA

                                 gi|19684231|gb|BM985565.1|BM985565 1_E07_T3
gi|19684231|gb|BM9                Ath Thellungiella halophila cDNA clone 1_E07_T3
                      1_E07_T3                                                              ubiquitin-conjugating enzyme 1 (UBC1) (At1g14400)               06.5
85565.1|BM985565                      similar to Sequence of BAC F14L17 from
                                             Arabidopsis thaliana, mRNA

                                  gi|19913560|gb|BQ079195.1|BQ079195 Ts1517
gi|19913560|gb|BQ0
                       Ts1517         Thellungiella salsuginea cDNA similar to                         expressed protein (At1g14460)                        99
79195.1|BQ079195
                                       hypothetical protein, mRNA sequence

                                   gi|10128313|gb|BE727017.1|BE727017 Sc0039
gi|10128313|gb|BE72
                       Sc0039    Thellungiella salsuginea cDNA similar to T15D22.8,                     unknown protein (At1g15030)                         99
  7017.1|BE727017
                                                   mRNA sequence
                                   gi|19855230|gb|BQ060281.1|BQ060281 Ts1335
gi|19855230|gb|BQ0
                       Ts1335    Thellungiella salsuginea cDNA similar to expressed                    expressed protein (At1g15340)                        99
60281.1|BQ060281
                                               protein, mRNA sequence
                                    gi|19913670|gb|BQ079311.1|BQ079311 Ts854
gi|19913670|gb|BQ0
                       Ts854      Thellungiella salsuginea cDNA similar to unknown                     expressed protein (At1g15340)                        99
79311.1|BQ079311
                                               protein, mRNA sequence
                                     gi|15661471|gb|BI698842.1|BI698842 Ts944
gi|15661471|gb|BI69
                       Ts944      Thellungiella salsuginea cDNA similar to unknown                     expressed protein (At1g15350)                        99
  8842.1|BI698842
                                               protein, mRNA sequence

                               gi|19684717|gb|BM986051.1|BM986051 8_G05_T3
gi|19684717|gb|BM9              Ath Thellungiella halophila cDNA clone 8_G05_T3        glyoxalase family protein (lactoylglutathionelyase family protein)
                      8_G05_T3                                                                                                                              02.8
86051.1|BM986051                    similar to AC007591 - Arabidopsis thaliana                                   (At1g15380)
                                   chromosome 1 BAC F9L1 sequence, mRNA
                                  gi|19855333|gb|BQ060383.1|BQ060383 Ts1463
gi|19855333|gb|BQ0               Thellungiella salsuginea cDNA similar to a member    glyoxalase family protein (lactoylglutathione lyase family protein)
                       Ts1463                                                                                                                               02.8
60383.1|BQ060383                      of the PF|00903 gyloxalase family, mRNA                                    (At1g15380)
                                                      sequence

                                 gi|19684448|gb|BM985782.1|BM985782 4_H09_T3
gi|19684448|gb|BM9                Ath Thellungiella halophila cDNA clone 4_H09_T3
                      4_H09_T3                                                                         expressed protein (At1g16080)                        99
85782.1|BM985782                      similar to AC010924 - Arabidopsis thaliana
                                    chromosome 1 BAC T24D18 sequence, mRNA

                                 gi|19684551|gb|BM985885.1|BM985885 6_D08_T3
gi|19684551|gb|BM9                Ath Thellungiella halophila cDNA clone 6_D08_T3
                      6_D08_T3                                                                         expressed protein (At1g16080)                        99
85885.1|BM985885                      similar to AC010924 - Arabidopsis thaliana
                                    chromosome 1 BAC T24D18 sequence, mRNA

                                    gi|15661358|gb|BI698729.1|BI698729 Ts522
gi|15661358|gb|BI69                Thellungiella salsuginea cDNA similar to ESTs
                       Ts522                                                                            unknown protein (At1g16080)                         99
  8729.1|BI698729                 gb|AI992412, gb|AI994629 come from this gene,
                                                  mRNA sequence
                                    gi|15661329|gb|BI698700.1|BI698700 Ts638
gi|15661329|gb|BI69                Thellungiella salsuginea cDNA similar to ESTs
                       Ts638                                                                            unknown protein (At1g16080)                         99
  8700.1|BI698700                 gb|AI992412, gb|AI994629 come from this gene.,
                                                  mRNA sequence

                                 gi|19684687|gb|BM986021.1|BM986021 8_C12_T3
gi|19684687|gb|BM9                Ath Thellungiella halophila cDNA clone 8_C12_T3
                      8_C12_T3                                                                         expressed protein (At1g16560)                        99
86021.1|BM986021                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                                 gi|19684378|gb|BM985712.1|BM985712 3_H04_T3
gi|19684378|gb|BM9                Ath Thellungiella halophila cDNA clone 3_H04_T3
                      3_H04_T3                                                                         expressed protein (At1g16810)                        99
85712.1|BM985712                      similar to AC051629 - Arabidopsis thaliana
                                           chromosome I BAC F6I1 ,mRNA

                                   gi|19913627|gb|BQ079268.1|BQ079268 Ts772
gi|19913627|gb|BQ0
                       Ts772     Thellungiella salsuginea cDNA similar to SOUL-like                  SOUL-related protein (At1g17100)                       98
79268.1|BQ079268
                                               protein, mRNA sequence
                                    gi|15661462|gb|BI698833.1|BI698833 Ts957
gi|15661462|gb|BI69
                       Ts957      Thellungiella salsuginea cDNA similar to putative                     unknown protein (At1g17340)                         99
  8833.1|BI698833
                                               protein, mRNA sequence
                                  gi|19855177|gb|BQ060228.1|BQ060228 Ts1179
gi|19855177|gb|BQ0
                       Ts1179    Thellungiella salsuginea cDNA similar to unknown                      expressed protein (At1g17490)                        99
60228.1|BQ060228
                                               protein, mRNA sequence
                                   gi|14030866|gb|BG734510.1|BG734510 T0001
gi|14030866|gb|BG7
                       T0001     Thellungiella salsuginea cDNA similar to Unknown                       unknown protein (At1g18730)                         99
34510.1|BG734510
                                               protein, mRNA sequence
                                  gi|19913619|gb|BQ079260.1|BQ079260 Ts757
gi|19913619|gb|BQ0
                       Ts757    Thellungiella salsuginea cDNA similar to unknown     inter-alpha-trypsin inhibitor heavy chain-related (At1g19110)   99
79260.1|BQ079260
                                              protein, mRNA sequence
                               gi|19684493|gb|BM985827.1|BM985827 5_E08_T3
gi|19684493|gb|BM9              Ath Thellungiella halophila cDNA clone 5_E08_T3
                      5_E08_T3                                                                      unknown protein (At1g19130)                      99
85827.1|BM985827                  similar to (AC068602) F14D16.29 [Arabidopsis
                                                  thaliana], mRNA
                               gi|19684790|gb|BM986124.1|BM986124 9_G07_T3
gi|19684790|gb|BM9              Ath Thellungiella halophila cDNA clone 9_G07_T3
                      9_G07_T3                                                                     expressed protein (At1g19130)                     99
86124.1|BM986124                  similar to (AC068602) F14D16.29 [Arabidopsis
                                                  thaliana], mRNA
                                   gi|15661416|gb|BI698787.1|BI698787 Ts682
gi|15661416|gb|BI69
                        Ts682         Thellungiella salsuginea cDNA similar to                     expressed protein (At1g19130)                     99
  8787.1|BI698787
                                     (AC068602) F14D16.29, mRNA sequence

                                 gi|19684398|gb|BM985732.1|BM985732 4_B12_T3
gi|19684398|gb|BM9                Ath Thellungiella halophila cDNA clone 4_B12_T3
                      4_B12_T3                                                                     expressed protein (At1g19180)                     99
85732.1|BM985732                      similar to AC008263 - Arabidopsis thaliana
                                    chromosome 1 BAC F25A4 sequence, mRNA

                                    gi|15661098|gb|BI698469.1|BI698469 Ts342
gi|15661098|gb|BI69
                       Ts342           Thellungiella salsuginea cDNA similar to                   hypothetical protein (At1g19380)                   99
  8469.1|BI698469
                                            F18O14.10, mRNA sequence
                                    gi|15661493|gb|BI698864.1|BI698864 Ts920
gi|15661493|gb|BI69
                       Ts920           Thellungiella salsuginea cDNA similar to                   hypothetical protein (At1g19380)                   99
  8864.1|BI698864
                                        hypothetical protein, mRNA sequence

                                   gi|19855195|gb|BQ060246.1|BQ060246 Ts1207
gi|19855195|gb|BQ0
                       Ts1207     Thellungiella salsuginea cDNA similar to unknown                  unknown protein (At1g19740)                      99
60246.1|BQ060246
                                               protein, mRNA sequence

                                   gi|19855220|gb|BQ060271.1|BQ060271 Ts1323
gi|19855220|gb|BQ0
                       Ts1323     Thellungiella salsuginea cDNA similar to unknown                  unknown protein (At1g19740)                      99
60271.1|BQ060271
                                               protein, mRNA sequence
                                     gi|15661354|gb|BI698725.1|BI698725 Ts288
gi|15661354|gb|BI69
                       Ts288      Thellungiella salsuginea cDNA similar to Unknown                  unknown protein (At1g19740)                      99
  8725.1|BI698725
                                               Protein, mRNA sequence
                                     gi|15661346|gb|BI698717.1|BI698717 Ts378
                                        Thellungiella salsuginea cDNA similar to
gi|15661346|gb|BI69
                       Ts378        VACUOLAR ATP SYNTHASE SUBUNIT B (V-                             unknown protein (At1g20260)                      02.4
  8717.1|BI698717
                                       ATPASE B SUBUNIT) (V-ATPASE 57 KD
                                              SUBUNIT), mRNA sequence
                                 gi|19684423|gb|BM985757.1|BM985757 4_E10_T3
                                  Ath Thellungiella halophila cDNA clone 4_E10_T3
gi|19684423|gb|BM9
                     4_E10_T3          similar to M98456 - Arabidopsis thaliana              plastocyanin (At1g20340)      02.4
85757.1|BM985757
                                 recombination and DNA-damage resistance protein
                                                (DRT112) mRNA, mRNA

                                 gi|19684644|gb|BM985978.1|BM985978 7_F10_T3
gi|19684644|gb|BM9                Ath Thellungiella halophila cDNA clone 7_F10_T3
                     7_F10_T3                                                              expressed protein (At1g20410)   99
85978.1|BM985978                     similar to (AC027665) F5M15.23 [A.thaliana],
                                                        mRNA
                                 gi|19684232|gb|BM985566.1|BM985566 1_E08_T3
gi|19684232|gb|BM9                Ath Thellungiella halophila cDNA clone 1_E08_T3
                     1_E08_T3                                                              dehydrin (COR47) (At1g20440)    11.1
85566.1|BM985566                 similar to cold acclimation protein lti45 - A.thaliana,
                                                        mRNA
                                 gi|19684251|gb|BM985585.1|BM985585 1_H01_T3
gi|19684251|gb|BM9                Ath Thellungiella halophila cDNA clone 1_H01_T3
                     1_H01_T3                                                              dehydrin (COR47) (At1g20440)    11.1
85585.1|BM985585                 similar to cold-regulated protein cor47 - A.thaliana,
                                                        mRNA
                                 gi|19684379|gb|BM985713.1|BM985713 3_H06_T3
gi|19684379|gb|BM9                Ath Thellungiella halophila cDNA clone 3_H06_T3
                     3_H06_T3                                                              dehydrin (COR47) (At1g20440)    11.1
85713.1|BM985713                 similar to cold acclimation protein lti45 - A.thaliana,
                                                        mRNA
                                 gi|19684470|gb|BM985804.1|BM985804 5_C03_T3
                                  Ath Thellungiella halophila cDNA clone 5_C03_T3
gi|19684470|gb|BM9
                     5_C03_T3       similar to AC027665 - genomic sequence for             dehydrin (COR47) (At1g20440)    11.1
85804.1|BM985804
                                        Arabidopsis thaliana BAC F5M15 from
                                                  chromosome I, mRNA

                                 gi|19684571|gb|BM985905.1|BM985905 6_F10_T3
gi|19684571|gb|BM9
                     6_F10_T3     Ath Thellungiella halophila cDNA clone 6_F10_T3          dehydrin (COR47) (At1g20440)    11.1
85905.1|BM985905
                                         similar to A.t. cor47 mRNA, mRNA

                              gi|19684591|gb|BM985925.1|BM985925 7_A01_T3
gi|19684591|gb|BM9             Ath Thellungiella halophila cDNA clone 7_A01_T3
                     7_A01_T3                                                              dehydrin (COR47) (At1g20440)    11.1
85925.1|BM985925              similar to cold acclimation protein lti45 - A.thaliana,
                                                     mRNA
                              gi|19684649|gb|BM985983.1|BM985983 7_G06_T3
gi|19684649|gb|BM9             Ath Thellungiella halophila cDNA clone 7_G06_T3
                     7_G06_T3                                                              dehydrin (COR47) (At1g20440)    11.1
85983.1|BM985983              similar to cold acclimation protein lti45 - A.thaliana,
                                                     mRNA
                              gi|19684730|gb|BM986064.1|BM986064 9_A01_T3
                               Ath Thellungiella halophila cDNA clone 9_A01_T3
gi|19684730|gb|BM9
                     9_A01_T3    similar to AC027665 - genomic sequence for                dehydrin (COR47) (At1g20440)    11.1
86064.1|BM986064
                                     Arabidopsis thaliana BAC F5M15 from
                                              chromosome I, mRNA
                                 gi|19684287|gb|BM985621.1|BM985621 2_C11_T3
gi|19684287|gb|BM9                Ath Thellungiella halophila cDNA clone 2_C11_T3
                      2_C11_T3                                                        unknown protein (At1g20450)   99
85621.1|BM985621                 similar to D17714 - Arabidopsis thaliana mRNA for
                                               ERD10 protein, mRNA

                                    gi|15661075|gb|BI698446.1|BI698446 Ts147
gi|15661075|gb|BI69
                       Ts147        Thellungiella salsuginea cDNA similar to cold     unknown protein (At1g20450)   99
  8446.1|BI698446
                                     acclimation protein lti45, mRNA sequence

                                 gi|19684265|gb|BM985599.1|BM985599 2_A07_T3
gi|19684265|gb|BM9                Ath Thellungiella halophila cDNA clone 2_A07_T3
                      2_A07_T3                                                          catalase 3 (At1g20620)      11.4
85599.1|BM985599                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                               gi|19684275|gb|BM985609.1|BM985609 2_B06_T3
gi|19684275|gb|BM9              Ath Thellungiella halophila cDNA clone 2_B06_T3
                      2_B06_T3                                                          catalase 3 (At1g20620)      11.4
85609.1|BM985609                   similar to Brassica napus catalase (LSC650)
                                                   mRNA, mRNA
                               gi|19684320|gb|BM985654.1|BM985654 2_H08_T3
                                Ath Thellungiella halophila cDNA clone 2_H08_T3
gi|19684320|gb|BM9
                      2_H08_T3    similar to AC069251 - genomic sequence for            catalase 3 (At1g20620)      11.4
85654.1|BM985654
                               Arabidopsis thaliana BAC F2D10 from chromosome
                                                      I, mRNA
                               gi|19684645|gb|BM985979.1|BM985979 7_F11_T3
gi|19684645|gb|BM9              Ath Thellungiella halophila cDNA clone 7_F11_T3
                      7_F11_T3                                                          catalase 3 (At1g20620)      11.4
85979.1|BM985979                  similar to (U68219) catalase [Brassica napus],
                                                       mRNA
                               gi|19684784|gb|BM986118.1|BM986118 9_F11_T3
                                Ath Thellungiella halophila cDNA clone 9_F11_T3
gi|19684784|gb|BM9
                      9_F11_T3    similar to AC069251 - genomic sequence for            catalase 3 (At1g20620)      11.4
86118.1|BM986118
                               Arabidopsis thaliana BAC F2D10 from chromosome
                                                      I, mRNA

                               gi|19684788|gb|BM986122.1|BM986122 9_G05_T3
gi|19684788|gb|BM9              Ath Thellungiella halophila cDNA clone 9_G05_T3
                      9_G05_T3                                                          catalase 3 (At1g20620)      11.4
86122.1|BM986122                  similar to Arabidopsis thaliana chromosome 1
                                             CHR1v12152001 ,mRNA

                                   gi|10172554|gb|BE758562.1|BE758562 Sc0142
gi|10172554|gb|BE75
                       Sc0142     Thellungiella salsuginea cDNA similar to catalase     catalase 3 (At1g20620)      11.4
  8562.1|BE758562
                                                 2, mRNA sequence

                                  gi|19855281|gb|BQ060331.1|BQ060331 Ts1302
gi|19855281|gb|BQ0
                       Ts1302     Thellungiella salsuginea cDNA similar to catalase     catalase 3 (At1g20620)      11.4
60331.1|BQ060331
                                         (EC 1.11.1.6) 3, mRNA sequence
                                   gi|15661057|gb|BI698428.1|BI698428 Ts179
gi|15661057|gb|BI69
                       Ts179     Thellungiella salsuginea cDNA similar to catalase                catalase 3 (At1g20620)                  11.4
  8428.1|BI698428
                                         (EC 1.11.1.6) 3, mRNA sequence
                                  gi|19913609|gb|BQ079250.1|BQ079250 Ts338
gi|19913609|gb|BQ0
                       Ts338     Thellungiella salsuginea cDNA similar to catalase                catalase 3 (At1g20620)                  11.4
79250.1|BQ079250
                                                 2, mRNA sequence
                                   gi|15661100|gb|BI698471.1|BI698471 Ts468
gi|15661100|gb|BI69
                       Ts468     Thellungiella salsuginea cDNA similar to F5M15.5,                catalase 3 (At1g20620)                  11.4
  8471.1|BI698471
                                                  mRNA sequence
                                   gi|15661059|gb|BI698430.1|BI698430 Ts498
gi|15661059|gb|BI69
                       Ts498     Thellungiella salsuginea cDNA similar to catalase,               catalase 3 (At1g20620)                  11.4
  8430.1|BI698430
                                                  mRNA sequence
                                  gi|19913613|gb|BQ079254.1|BQ079254 Ts505
gi|19913613|gb|BQ0
                       Ts505     Thellungiella salsuginea cDNA similar to catalase                catalase 3 (At1g20620)                  11.4
79254.1|BQ079254
                                                 2, mRNA sequence
                                   gi|15661060|gb|BI698431.1|BI698431 Ts625
gi|15661060|gb|BI69
                       Ts625     Thellungiella salsuginea cDNA similar to catalase,               catalase 3 (At1g20620)                  11.4
  8431.1|BI698431
                                                  mRNA sequence
                                  gi|19913652|gb|BQ079293.1|BQ079293 Ts813
gi|19913652|gb|BQ0
                       Ts813     Thellungiella salsuginea cDNA similar to catalase                catalase 3 (At1g20620)                  11.4
79293.1|BQ079293
                                                 2, mRNA sequence
                                    gi|15661058|gb|BI698429.1|BI698429 Ts89
gi|15661058|gb|BI69
                        Ts89     Thellungiella salsuginea cDNA similar to catalase                catalase 3 (At1g20620)                  11.4
  8429.1|BI698429
                                                 2, mRNA sequence
                                   gi|15661500|gb|BI698871.1|BI698871 Ts909
gi|15661500|gb|BI69
                       Ts909     Thellungiella salsuginea cDNA similar to catalase                catalase 3 (At1g20620)                  11.4
  8871.1|BI698871
                                                 2, mRNA sequence

                                 gi|19684297|gb|BM985631.1|BM985631 2_E05_T3
gi|19684297|gb|BM9
                      2_E05_T3    Ath Thellungiella halophila cDNA clone 2_E05_T3              unknown protein (At1g21670)                99
85631.1|BM985631
                                  similar to (AC007727) F8K7.9 [A.thaliana], mRNA

                                 gi|19684415|gb|BM985749.1|BM985749 4_D10_T3
gi|19684415|gb|BM9
                      4_D10_T3    Ath Thellungiella halophila cDNA clone 4_D10_T3              expressed protein (At1g21670)              99
85749.1|BM985749
                                  similar to (AC007727) F8K7.9 [A.thaliana], mRNA

                                 gi|19684171|gb|BM985517.1|BM985517 10_H03_T
gi|19684171|gb|BM9                Ath Thellungiella halophila cDNA clone 10_H03_T
                      10_H03_T                                                        protein disulfide isomerase, putative (At1g21750)   06.1
85517.1|BM985517                      similar to AC007727 - Arabidopsis thaliana
                                     chromosome 1 BAC F8K7 sequence, mRNA

                                  gi|10172538|gb|BE758546.1|BE758546 Sc0099
gi|10172538|gb|BE75
                       Sc0099         Thellungiella salsuginea cDNA similar to              transmembrane protein (At1g21900)             99
  8546.1|BE758546
                                            T26F17.12, mRNA sequence
                                 gi|19684648|gb|BM985982.1|BM985982 7_G04_T3
gi|19684648|gb|BM9                                                                     ubiquitin family low homology (At1g22050) also annotated as
                      7_G04_T3    Ath Thellungiella halophila cDNA clone 7_G04_T3                                                                     06.5
85982.1|BM985982                                                                                              unknown protein
                                     similar to (AC009243) F28K19.8 [A.t.], mRNA

                                  gi|10128320|gb|BE727024.1|BE727024 Sc0048
gi|10128320|gb|BE72
                       Sc0048    Thellungiella salsuginea cDNA similar to F28K19.8,                  expressed protein (At1g22050)                    99
  7024.1|BE727024
                                                   mRNA sequence

                                 gi|19684226|gb|BM985560.1|BM985560 1_D11_T3
gi|19684226|gb|BM9                Ath Thellungiella halophila cDNA clone 1_D11_T3
                      1_D11_T3                                                                       expressed protein (At1g22270)                    99
85560.1|BM985560                       similar to (AC012680) unknown protein
                                            [Arabidopsis thaliana], mRNA

                                 gi|19684669|gb|BM986003.1|BM986003 8_A11_T3
gi|19684669|gb|BM9                Ath Thellungiella halophila cDNA clone 8_A11_T3
                      8_A11_T3                                                                       expressed protein (At1g22270)                    99
86003.1|BM986003                       similar to (AC012680) unknown protein
                                            [Arabidopsis thaliana], mRNA

                                  gi|19913557|gb|BQ079192.1|BQ079192 Ts1507
gi|19913557|gb|BQ0                    Thellungiella salsuginea cDNA similar to
                       Ts1507                                                                   C2 domain-containing protein (At1g22610)              99
79192.1|BQ079192                  phosphoribosylanthranilate transferase, putative,
                                                  mRNA sequence

                                  gi|19855290|gb|BQ060340.1|BQ060340 Ts1383
gi|19855290|gb|BQ0
                       Ts1383     Thellungiella salsuginea cDNA similar to putative                cytochrome C -related (At1g22840)                  02.4
60340.1|BQ060340
                                          cytochrome C, mRNA sequence

                                 gi|19684261|gb|BM985595.1|BM985595 2_A03_T3
gi|19684261|gb|BM9                Ath Thellungiella halophila cDNA clone 2_A03_T3
                      2_A03_T3                                                         RNA recognition motif (RRM)-containing protein (At1g22910)     98
85595.1|BM985595                   similar to AF000657 - Arabidopsis thaliana BAC
                                                   F19G10, mRNA

                                 gi|19684266|gb|BM985600.1|BM985600 2_A08_T3
gi|19684266|gb|BM9                Ath Thellungiella halophila cDNA clone 2_A08_T3
                      2_A08_T3                                                                alanine aminotransferase -related (At1g23310)           01.1
85600.1|BM985600                      similar to AC010796 - Arabidopsis thaliana
                                         chromosome 1 BAC F24J13 ,mRNA

                                  gi|19855371|gb|BQ060421.1|BQ060421 Ts1242
gi|19855371|gb|BQ0               Thellungiella salsuginea cDNA similar to Quinone
                       Ts1242                                                         oxidoreductase, zinc-binding dehydrogenase family (At1g23740)   98
60421.1|BQ060421                   oxidoreductase-like protein At1g23740, mRNA
                                                      sequence
                                    gi|15661333|gb|BI698704.1|BI698704 Ts633
gi|15661333|gb|BI69
                       Ts633     Thellungiella salsuginea cDNA similar to unknown                     unknown protein (At1g25260)                     99
  8704.1|BI698704
                                              protein, mRNA sequence
                                 gi|19684433|gb|BM985767.1|BM985767 4_F11_T3
                                  Ath Thellungiella halophila cDNA clone 4_F11_T3
gi|19684433|gb|BM9                   similar to AV536971 - AV536971 Arabidopsis
                      4_F11_T3                                                          expressed protein (At1g25275), E=0.039        99
85767.1|BM985767                      thaliana liquid-cultured seedlings Columbia
                                 Arabidopsis thaliana cDNA clone pAZNII0752R 5',
                                                          mRNA

                                 gi|19684502|gb|BM985836.1|BM985836 5_F08_T3
gi|19684502|gb|BM9                Ath Thellungiella halophila cDNA clone 5_F08_T3
                      5_F08_T3                                                               expressed protein (At1g25275)            99
85836.1|BM985836                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                                 gi|19684716|gb|BM986050.1|BM986050 8_G04_T3
gi|19684716|gb|BM9
                      8_G04_T3    Ath Thellungiella halophila cDNA clone 8_G04_T3     glutathione transferase, putative (At1g27130)   11.4
86050.1|BM986050
                                     similar to (AC000348) T7N9.20 [A.t.], mRNA

                                    gi|15661124|gb|BI698495.1|BI698495 Ts215
gi|15661124|gb|BI69
                       Ts215      Thellungiella salsuginea cDNA similar to putative   glutathione transferase, putative (At1g27130)   11.4
  8495.1|BI698495
                                      glutathione transferase, mRNA sequence

                                    gi|15661123|gb|BI698494.1|BI698494 Ts617
gi|15661123|gb|BI69
                       Ts617      Thellungiella salsuginea cDNA similar to putative   glutathione transferase, putative (At1g27130)   11.4
  8494.1|BI698494
                                      glutathione transferase, mRNA sequence

                                   gi|15661496|gb|BI698867.1|BI698867 Ts917
gi|15661496|gb|BI69
                       Ts917     Thellungiella salsuginea cDNA similar to T7N9.20,    glutathione transferase, putative (At1g27130)   11.4
  8867.1|BI698867
                                                  mRNA sequence

                                 gi|19684534|gb|BM985868.1|BM985868 6_B06_T3
gi|19684534|gb|BM9
                      6_B06_T3    Ath Thellungiella halophila cDNA clone 6_B06_T3            unknown protein (At1g27290)              99
85868.1|BM985868
                                     similar to (AC004557) F17L21.8 [A.t.], mRNA

                                    gi|15661104|gb|BI698475.1|BI698475 Ts555
gi|15661104|gb|BI69
                       Ts555           Thellungiella salsuginea cDNA similar to              unknown protein (At1g27350)              99
  8475.1|BI698475
                                             F17L21.12, mRNA sequence

gi|10172564|gb|BE75               gi|10172564|gb|BE758572.1|BE758572 Sc0063
                       Sc0063                                                                expressed protein (At1g27435)            99
  8572.1|BE758572                 Thellungiella salsuginea cDNA, mRNA sequence

                                  gi|19855142|gb|BQ060194.1|BQ060194 Ts1062
gi|19855142|gb|BQ0
                       Ts1062         Thellungiella salsuginea cDNA similar to               unknown protein (At1g27560)              99
60194.1|BQ060194
                                            F12A21.21, mRNA sequence

                                 gi|19684234|gb|BM985568.1|BM985568 1_E10_T3
gi|19684234|gb|BM9                Ath Thellungiella halophila cDNA clone 1_E10_T3
                      1_E10_T3                                                               expressed protein (At1g28190)            99
85568.1|BM985568                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA
                                   gi|19855187|gb|BQ060238.1|BQ060238 Ts1190
gi|19855187|gb|BQ0
                       Ts1190     Thellungiella salsuginea cDNA similar to unknown                      unknown protein (At1g28250)                      99
60238.1|BQ060238
                                                protein, mRNA sequence
                                   gi|19855282|gb|BQ060332.1|BQ060332 Ts1304
gi|19855282|gb|BQ0
                       Ts1304    Thellungiella salsuginea cDNA similar to expressed                    expressed protein (At1g28250)                     99
60332.1|BQ060332
                                                protein, mRNA sequence
                                     gi|15661383|gb|BI698754.1|BI698754 Ts262
gi|15661383|gb|BI69
                       Ts262     Thellungiella salsuginea cDNA similar to Unknown                       unknown protein (At1g28250)                      99
  8754.1|BI698754
                                                protein, mRNA sequence
                                 gi|19684350|gb|BM985684.1|BM985684 3_D10_T3
gi|19684350|gb|BM9                Ath Thellungiella halophila cDNA clone 3_D10_T3
                      3_D10_T3                                                                         expressed protein (At1g28280)                     99
85684.1|BM985684                        similar to (U78721) hypothetical protein
                                                    [A.thaliana], mRNA
                                   gi|19855225|gb|BQ060276.1|BQ060276 Ts1328
gi|19855225|gb|BQ0                                                                  hypothetical protein (At2g33780), alsor match with unknown protein
                       Ts1328    Thellungiella salsuginea cDNA similar to Unknown                                                                        99
60276.1|BQ060276                                                                                            (F3H9.7-At1g28280)
                                                protein, mRNA sequence

                                  gi|19855349|gb|BQ060399.1|BQ060399 Ts1097
gi|19855349|gb|BQ0
                       Ts1097     Thellungiella salsuginea cDNA similar to olfactory        dormancy-associated protein-related (At1g28330)              98
60399.1|BQ060399
                                       receptor MOR174-12, mRNA sequence

                                     gi|15661208|gb|BI698579.1|BI698579 Ts313
gi|15661208|gb|BI69                 Thellungiella salsuginea cDNA similar to Pfam
                       Ts313                                                                dormancy-associated protein (At1g28330) (7e-15)              98
  8579.1|BI698579                  family PF00076 (RNA recognition motif), mRNA
                                                       sequence

                                  gi|10128325|gb|BE727029.1|BE727029 Sc0031
gi|10128325|gb|BE72
                       Sc0031    Thellungiella salsuginea cDNA similar to Similar to         putative 19S proteosome subunit 9 (At1g29150)               06.5
  7029.1|BE727029
                                    26S proteasome subunits, mRNA sequence

                                  gi|19913554|gb|BQ079209.1|BQ079209 Ts1480
gi|19913554|gb|BQ0
                       Ts1480       Thellungiella salsuginea cDNA similar to 19S             putative 19S proteosome subunit 9 (At1g29150)               06.5
79209.1|BQ079209
                                  proteosome subunit 9, putative, mRNA sequence

                                   gi|19855302|gb|BQ060352.1|BQ060352 Ts1402
gi|19855302|gb|BQ0
                       Ts1402     Thellungiella salsuginea cDNA similar to unknown                    expressed protein (At1g29370)                      99
60352.1|BQ060352
                                               protein, mRNA sequence

                                     gi|15661373|gb|BI698744|BI698744 Ts210
gi|15661373|gb|BI69
                       Ts210      Thellungiella salsuginea cDNA similar to unknown                    unknown protein (At1g29395)                        99
  8744.1|BI698744
                                       protein; 31966-27882, mRNA sequence

                               gi|19684149|gb|BM985509.1|BM985509 10_G03_T
gi|19684149|gb|BM9              Ath Thellungiella halophila cDNA clone 10_G03_T
                      10_G03_T                                                               putative apoptosis-related protein 19 (At1g29850)           98
85509.1|BM985509                  similar to Arabidopsis thaliana chromosome 1
                                             CHR1v12152001 ,mRNA
                                 gi|19684682|gb|BM986016.1|BM986016 8_C05_T3
gi|19684682|gb|BM9                Ath Thellungiella halophila cDNA clone 8_C05_T3
                     8_C05_T3                                                               putative apoptosis-related protein 19 (At1g29850)            98
86016.1|BM986016                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                                  gi|19855226|gb|BQ060277.1|BQ060277 Ts1330
gi|19855226|gb|BQ0
                      Ts1330     Thellungiella salsuginea cDNA similar to apoptosis          putative apoptosis-related protein (At1g29850)              98
60277.1|BQ060277
                                        related protein 19, mRNA sequence

                                 gi|19684427|gb|BM985761.1|BM985761 4_F04_T3
gi|19684427|gb|BM9                Ath Thellungiella halophila cDNA clone 4_F04_T3     putative photosystem II type I chlorophyll a /b binding protein
                     4_F04_T3                                                                                                                            02.10
85761.1|BM985761                 similar to X03908 - A.thaliana gene (LHCP AB 180)                            (At1g29920)
                                      for chlorophyll a/b binding protein, mRNA

                              gi|19684659|gb|BM985993.1|BM985993 7_H09_T3
gi|19684659|gb|BM9             Ath Thellungiella halophila cDNA clone 7_H09_T3        photosystem II type I chlorophyll a /b binding protein, putative
                     7_H09_T3                                                                                                                            99
85993.1|BM985993               similar to Arabidopsis thaliana chromosome I BAC                                (At1g29920)
                                                  F1N18 ,mRNA
                                gi|19855155|gb|BQ060207.1|BQ060207 Ts1153
gi|19855155|gb|BQ0                   Thellungiella salsuginea cDNA similar to         putative photosystem II type I chlorophyll a /b binding protein
                      Ts1153                                                                                                                             02.10
60207.1|BQ060207                  photosystem II type I chlorophyll a /b binding                              (At1g29920)
                                        protein, putative, mRNA sequence
                                gi|19855269|gb|BQ060319.1|BQ060319 Ts1285
gi|19855269|gb|BQ0            Thellungiella salsuginea cDNA similar to chlorophyll    putative photosystem II type I chlorophyll a /b binding protein
                      Ts1285                                                                                                                             02.10
60319.1|BQ060319                    a/b binding protein (LHCP AB 180, mRNA                                    (At1g29920)
                                                     sequence
                                gi|19855233|gb|BQ060284.1|BQ060284 Ts1338
                                     Thellungiella salsuginea cDNA similar to
gi|19855233|gb|BQ0                                                                    putative photosystem II type I chlorophyll a /b binding protein
                      Ts1338     Chlorophyll A-B binding protein of LHCII type I,                                                                        02.10
60284.1|BQ060284                                                                                              (At1g29920)
                                chloroplast precursor (CAB) (LHCP) (Fragment),
                                                 mRNA sequence

                                 gi|19684264|gb|BM985598.1|BM985598 2_A06_T3
gi|19684264|gb|BM9                Ath Thellungiella halophila cDNA clone 2_A06_T3     putative photosystem II type I chlorophyll a/b binding protein
                     2_A06_T3                                                                                                                            02.10
85598.1|BM985598                 similar to X03908 - A.thaliana gene (LHCP AB 180)                            (At1g29930)
                                      for chlorophyll a/b binding protein, mRNA

                                 gi|19684282|gb|BM985616.1|BM985616 2_C04_T3
gi|19684282|gb|BM9                Ath Thellungiella halophila cDNA clone 2_C04_T3
                     2_C04_T3                                                              putative chlorophyll a/b-binding protein (At1g29930)          02.10
85616.1|BM985616                 similar to X03908 - A.thaliana gene (LHCP AB 180)
                                      for chlorophyll a/b binding protein, mRNA
                                 gi|19684302|gb|BM985636.1|BM985636 2_E12_T3
gi|19684302|gb|BM9                Ath Thellungiella halophila cDNA clone 2_E12_T3       putative photosystem II type I chlorophyll a/b binding protein
                      2_E12_T3                                                                                                                           02.10
85636.1|BM985636                 similar to X03909 - A.thaliana gene (LHCP AB 140)                              (At1g29930)
                                      for chlorophyll a/b binding protein, mRNA

                                 gi|19684318|gb|BM985652.1|BM985652 2_H02_T3
gi|19684318|gb|BM9                Ath Thellungiella halophila cDNA clone 2_H02_T3       putative photosystem II type I chlorophyll a/b binding protein
                      2_H02_T3                                                                                                                           02.10
85652.1|BM985652                 similar to X03908 - A.thaliana gene (LHCP AB 180)                              (At1g29930)
                                      for chlorophyll a/b binding protein, mRNA

                               gi|19684371|gb|BM985705.1|BM985705 3_G04_T3
gi|19684371|gb|BM9              Ath Thellungiella halophila cDNA clone 3_G04_T3         putative photosystem II type I chlorophyll a/b binding protein
                      3_G04_T3                                                                                                                           02.10
85705.1|BM985705               similar to X03909 - A.thaliana gene (LHCP AB 140)                                (At1g29930)
                                    for chlorophyll a/b binding protein, mRNA

                                 gi|19684570|gb|BM985904.1|BM985904 6_F09_T3
gi|19684570|gb|BM9                Ath Thellungiella halophila cDNA clone 6_F09_T3       putative photosystem II type I chlorophyll a/b binding protein
                      6_F09_T3                                                                                                                           02.10
85904.1|BM985904                 similar to X03908 - A.thaliana gene (LHCP AB 180)                              (At1g29930)
                                      for chlorophyll a/b binding protein, mRNA

                                 gi|19684686|gb|BM986020.1|BM986020 8_C11_T3
gi|19684686|gb|BM9                Ath Thellungiella halophila cDNA clone 8_C11_T3
                      8_C11_T3                                                          light-harvesting chlorophyll a/b bindingprotein (At1g29930)      02.10
86020.1|BM986020                 similar to X03909 - A.thaliana gene (LHCP AB 140)
                                      for chlorophyll a/b binding protein, mRNA

                                   gi|10128326|gb|BE727030.1|BE727030 Sc0032
gi|10128326|gb|BE72                    Thellungiella salsuginea cDNA similar to         putative photosystem II type I chlorophyll a/b binding protein
                       Sc0032                                                                                                                            02.10
  7030.1|BE727030                     CHLOROPHYLL A-B BINDING PROTEIN 2                                         (At1g29930)
                                          PRECURSOR, mRNA sequence

gi|10172539|gb|BE75               gi|10172539|gb|BE758547.1|BE758547 Sc0111
                       Sc0111                                                               putative chlorophyll a/b-binding protein (At1g29930)         02.10
  8547.1|BE758547                 Thellungiella salsuginea cDNA, mRNA sequence

                                   gi|16004576|gb|BI851089.1|BI851089 Ts1006
gi|16004576|gb|BI85                    Thellungiella salsuginea cDNA similar to         putative photosystem II type I chlorophyll a/b binding protein
                       Ts1006                                                                                                                            02.10
  1089.1|BI851089                   photosystem II type I chlorophyll a /b binding                              (At1g29930)
                                         protein, putative, mRNA sequence
                                  gi|19855362|gb|BQ060412.1|BQ060412 Ts1112
gi|19855362|gb|BQ0                     Thellungiella salsuginea cDNA similar to         putative photosystem II type I chlorophyll a/b binding protein
                       Ts1112                                                                                                                            02.10
60412.1|BQ060412                    photosystem II type I chlorophyll a /b binding                              (At1g29930)
                                         protein, putative, mRNA sequence
                                   gi|16004602|gb|BI851115.1|BI851115 Ts1138
gi|16004602|gb|BI85              Thellungiella salsuginea cDNA similar to chlorophyll
                       Ts1138                                                               putative chlorophyll a/b-binding protein (At1g29930)         02.10
  1115.1|BI851115                 A-B-binding protein 2 precursor, 5' partial; 1-750,
                                                   mRNA sequence
                                   gi|19855291|gb|BQ060341.1|BQ060341 Ts1384
gi|19855291|gb|BQ0                      Thellungiella salsuginea cDNA similar to       putative photosystem II type I chlorophyll a/b binding protein
                       Ts1384                                                                                                                           02.10
60341.1|BQ060341                      photosystem II type I chlorophyll a b binding                            (At1g29930)
                                                protein, mRNA sequence
                                     gi|15661056|gb|BI698427.1|BI698427 Ts246
                                        Thellungiella salsuginea cDNA similar to
gi|15661056|gb|BI69                                                                    putative photosystem II type I chlorophyll a/b binding protein
                       Ts246          CHLOROPHYLL A-B BINDING PROTEIN 2                                                                                 02.10
  8427.1|BI698427                                                                                              (At1g29930)
                                     PRECURSOR (LHCII TYPE I CAB-2), mRNA
                                                        sequence
                                     gi|15661054|gb|BI698425.1|BI698425 Ts563
                                        Thellungiella salsuginea cDNA similar to
gi|15661054|gb|BI69                                                                    putative photosystem II type I chlorophyll a/b binding protein
                       Ts563          CHLOROPHYLL A-B BINDING PROTEIN 2                                                                                 02.10
  8425.1|BI698425                                                                                              (At1g29930)
                                     PRECURSOR (LHCII TYPE I CAB-2), mRNA
                                                        sequence
                                 gi|19684749|gb|BM986083.1|BM986083 9_B11_T3
gi|19684749|gb|BM9                Ath Thellungiella halophila cDNA clone 9_B11_T3
                      9_B11_T3                                                         contains similarity to cyc1A protein GI:6358548 (At1g30210)      98
86083.1|BM986083                       similar to hypothetical protein F28J12.50 -
                                                    A.thaliana, mRNA
                                     gi|15661085|gb|BI698456.1|BI698456 Ts541
gi|15661085|gb|BI69                     Thellungiella salsuginea cDNA similar to
                       Ts541                                                                  elongation factor 1-beta, putative (At1g30230)            05.2
  8456.1|BI698456                   ELONGATION FACTOR 1-BETA (EF-1-BETA),
                                                    mRNA sequence
                                     gi|15661512|gb|BI698883.1|BI698883 Ts883
gi|15661512|gb|BI69
                       Ts883            Thellungiella salsuginea cDNA similar to                      expressed protein (At1g30260)                     99
  8883.1|BI698883
                                         hypothetical protein, mRNA sequence
                                      gi|15661266|gb|BI698637.1|BI698637 Ts74
gi|15661266|gb|BI69
                        Ts74     Thellungiella salsuginea cDNA similar to T17H7.12,   similar to ctp synthase (T17H7.12); contains Pfam (At1g30820)     01.3
  8637.1|BI698637
                                                    mRNA sequence

                                 gi|19684374|gb|BM985708.1|BM985708 3_G09_T3
gi|19684374|gb|BM9
                      3_G09_T3    Ath Thellungiella halophila cDNA clone 3_G09_T3                     expressed protein (At1g31170)                     99
85708.1|BM985708
                                    similar to (AC004793) F28K20.12 [A.t.], mRNA

                                 gi|19684504|gb|BM985838.1|BM985838 5_G01_T3
gi|19684504|gb|BM9
                      5_G01_T3    Ath Thellungiella halophila cDNA clone 5_G01_T3                     expressed protein (At1g31170)                     99
85838.1|BM985838
                                    similar to (AC004793) F28K20.12 [A.t.], mRNA

                                 gi|19684545|gb|BM985879.1|BM985879 6_C10_T3
gi|19684545|gb|BM9
                      6_C10_T3    Ath Thellungiella halophila cDNA clone 6_C10_T3                     expressed protein (At1g31170)                     99
85879.1|BM985879
                                    similar to (AC004793) F28K20.12 [A.t.], mRNA

                                   gi|15661168|gb|BI698539.1|BI698539 Ts550
gi|15661168|gb|BI69
                       Ts550     Thellungiella salsuginea cDNA similar to LAMIN A,                    unknown protein (At1g31170)                       99
  8539.1|BI698539
                                                   mRNA sequence
                                    gi|15661463|gb|BI698834.1|BI698834 Ts953
gi|15661463|gb|BI69
                       Ts953     Thellungiella salsuginea cDNA similar to LAMIN A,                      unknown protein (At1g31170)                    99
  8834.1|BI698834
                                                   mRNA sequence
                                    gi|15661417|gb|BI698788.1|BI698788 Ts685
gi|15661417|gb|BI69
                       Ts685      Thellungiella salsuginea cDNA similar to cell wall                     ORF, putative (At1g31580)                     99
  8788.1|BI698788
                                              protein, mRNA sequence

                                 gi|19684036|gb|BM985470.1|BM985470 10_B05_T
gi|19684036|gb|BM9                Ath Thellungiella halophila cDNA clone 10_B05_T
                      10_B05_T                                                           chloroplast 30S ribosomal protein S11, putative (At1g31817)   05.1
85470.1|BM985470                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                                   gi|16004597|gb|BI851110.1|BI851110 Ts1127
gi|16004597|gb|BI85
                       Ts1127     Thellungiella salsuginea cDNA similar to oxidase,                    oxidase, putative (At1g32350)                   98
  1110.1|BI851110
                                              putative, mRNA sequence

                                    gi|15661498|gb|BI698869.1|BI698869 Ts914
                                 Thellungiella salsuginea cDNA similar to alternative
gi|15661498|gb|BI69
                       Ts914           oxidase from Populus tremula x Populus                          oxidase, putative (At1g32350)                   98
  8869.1|BI698869
                                 tremuloides gb|AJ271889. It contains an alternative
                                    oxidase domain PF|01786, mRNA sequence

                                 gi|19684354|gb|BM985688.1|BM985688 3_E02_T3
gi|19684354|gb|BM9                Ath Thellungiella halophila cDNA clone 3_E02_T3
                      3_E02_T3                                                              disease resistance protein-related (LRR) (At1g33590)       98
85688.1|BM985688                 similar to hypothetical protein T9J22.5 - A.thaliana,
                                                         mRNA

                                 gi|19684533|gb|BM985867.1|BM985867 6_B05_T3
gi|19684533|gb|BM9                Ath Thellungiella halophila cDNA clone 6_B05_T3
                      6_B05_T3                                                                        hypothetical protein (At1g33690)                 99
85867.1|BM985867                      similar to AC010164 - Arabidopsis thaliana
                                          chromosome I BAC F14M2 ,mRNA

                                   gi|15661442|gb|BI698813.1|BI698813 Ts736
gi|15661442|gb|BI69
                       Ts736     Thellungiella salsuginea cDNA similar to unknown                       unknown protein (At1g33690)                    99
  8813.1|BI698813
                                              protein, mRNA sequence

                                  gi|10172558|gb|BE758566.1|BE758566 Sc0158
gi|10172558|gb|BE75
                       Sc0158    Thellungiella salsuginea cDNA similar to ribosomal              putative ribosomal protein S18 (At1g34030)            05.1
  8566.1|BE758566
                                      protein S18.A, cytosolic, mRNA sequence

                                  gi|19855340|gb|BQ060390.1|BQ060390 Ts1081
gi|19855340|gb|BQ0
                       Ts1081     Thellungiella salsuginea cDNA similar to putative          40S ribosomal protein S18 (RPS18B) (At1g34030)            05.1
60390.1|BQ060390
                                    40S ribosomal protein S18, mRNA sequence

                                   gi|15661147|gb|BI698518.1|BI698518 Ts259
gi|15661147|gb|BI69
                       Ts259          Thellungiella salsuginea cDNA similar to                         expressed protein (At1g34570)                   99
  8518.1|BI698518
                                 hypothetical protein F19B15.20, mRNA sequence
                                 gi|19684672|gb|BM986006.1|BM986006 8_B06_T3
gi|19684672|gb|BM9                Ath Thellungiella halophila cDNA clone 8_B06_T3
                      8_B06_T3                                                                  expressed protein (At1g35340)                99
86006.1|BM986006                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                                   gi|15661405|gb|BI698776.1|BI698776 Ts658
gi|15661405|gb|BI69
                       Ts658     Thellungiella salsuginea cDNA similar to unknown               unknown protein (At1g35340)                  99
  8776.1|BI698776
                                              protein, mRNA sequence
                                   gi|15661252|gb|BI698623.1|BI698623 Ts492
gi|15661252|gb|BI69                Thellungiella salsuginea cDNA similar to 50S     50S ribosomal protein L21 chloroplast precursor (CL21)
                       Ts492                                                                                                                 05.1
  8623.1|BI698623                 RIBOSOMAL PROTEIN L21, CHLOROPLAST                                     (At1g35680)
                                      PRECURSOR (CL21), mRNA sequence

                                 gi|19684096|gb|BM985491.1|BM985491 10_D08_T
gi|19684096|gb|BM9                Ath Thellungiella halophila cDNA clone 10_D08_T
                      10_D08_T                                                                 unknown protein (AAG51231.1)                  99
85491.1|BM985491                      similar to (AC023839) hypothetical protein
                                             [Arabidopsis thaliana], mRNA

                                 gi|19684458|gb|BM985792.1|BM985792 5_A10_T3
gi|19684458|gb|BM9                Ath Thellungiella halophila cDNA clone 5_A10_T3
                      5_A10_T3                                                                 unknown protein (AAG51231.1)                  99
85792.1|BM985792                      similar to (AC023839) hypothetical protein
                                             [Arabidopsis thaliana], mRNA

                                 gi|19684521|gb|BM985855.1|BM985855 5_H12_T3
gi|19684521|gb|BM9                Ath Thellungiella halophila cDNA clone 5_H12_T3
                      5_H12_T3                                                                 unknown protein (AAG51231.1)                  99
85855.1|BM985855                      similar to (AC023839) hypothetical protein
                                             [Arabidopsis thaliana], mRNA

                                 gi|19684635|gb|BM985969.1|BM985969 7_E10_T3
gi|19684635|gb|BM9                Ath Thellungiella halophila cDNA clone 7_E10_T3
                      7_E10_T3                                                                  expressed protein (At1g43580)                99
85969.1|BM985969                      similar to (AC007203) Hypothetical protein
                                                   [A.thaliana], mRNA
                                 gi|19684365|gb|BM985699.1|BM985699 3_F05_T3
gi|19684365|gb|BM9                Ath Thellungiella halophila cDNA clone 3_F05_T3
                      3_F05_T3                                                             cysteine proteinase RD21A (At1g47128)             06.5
85699.1|BM985699                     similar to CYSTEINE PROTEINASE RD21A
                                                  PRECURSOR, mRNA
                                 gi|19684390|gb|BM985724.1|BM985724 4_B01_T3
gi|19684390|gb|BM9                Ath Thellungiella halophila cDNA clone 4_B01_T3
                      4_B01_T3                                                             cysteine proteinase RD21A (At1g47128)             06.5
85724.1|BM985724                     similar to CYSTEINE PROTEINASE RD21A
                                                  PRECURSOR, mRNA
                                 gi|19684742|gb|BM986076.1|BM986076 9_B02_T3
gi|19684742|gb|BM9                Ath Thellungiella halophila cDNA clone 9_B02_T3
                      9_B02_T3                                                             cysteine proteinase RD21A (At1g47128)             06.5
86076.1|BM986076                     similar to CYSTEINE PROTEINASE RD21A
                                                  PRECURSOR, mRNA
                                 gi|19684778|gb|BM986112.1|BM986112 9_F02_T3
gi|19684778|gb|BM9                Ath Thellungiella halophila cDNA clone 9_F02_T3
                      9_F02_T3                                                                  cysteine proteinase RD21A (At1g47128)           06.5
86112.1|BM986112                     similar to CYSTEINE PROTEINASE RD21A
                                                 PRECURSOR, mRNA
                                  gi|19855202|gb|BQ060253.1|BQ060253 Ts1220
gi|19855202|gb|BQ0                Thellungiella salsuginea cDNA similar to cysteine
                       Ts1220                                                               putative cysteine proteinase RD21A (At1g47128)      06.5
60253.1|BQ060253                 protease component of protease-inhibitor complex,
                                                   mRNA sequence

                                 gi|19684447|gb|BM985781.1|BM985781 4_H08_T3
gi|19684447|gb|BM9                                                                       NADH-ubiquinone oxidoreductase 12 kD subunit-related
                      4_H08_T3    Ath Thellungiella halophila cDNA clone 4_H08_T3                                                               02.4
85781.1|BM985781                                                                                            (At1g49140)
                                     similar to (AC016041) F27J15.9 [A.t.], mRNA

                                 gi|19684284|gb|BM985618.1|BM985618 2_C07_T3
gi|19684284|gb|BM9                Ath Thellungiella halophila cDNA clone 2_C07_T3
                      2_C07_T3                                                                       expressed protein (At1g49500)              99
85618.1|BM985618                       similar to (AC007504) Unknown protein
                                            [Arabidopsis thaliana], mRNA

                                 gi|19684080|gb|BM985485.1|BM985485 10_D01_T
gi|19684080|gb|BM9                Ath Thellungiella halophila cDNA clone 10_D01_T
                      10_D01_T                                                                      hypothetical protein (At1g49700)            99
85485.1|BM985485                  similar to (AL138655) putative protein [A.thaliana],
                                                        mRNA

                                    gi|15661414|gb|BI698785.1|BI698785 Ts678
gi|15661414|gb|BI69
                       Ts678         Thellungiella salsuginea cDNA similar to 10-           10-formyltetrahydrofolate synthetase (At1g50480)    01.5
  8785.1|BI698785
                                 formyltetrahydrofolate synthetase, mRNA sequence

                                  gi|19855172|gb|BQ060223.1|BQ060223 Ts1174
gi|19855172|gb|BQ0
                       Ts1174    Thellungiella salsuginea cDNA similar to unknown                    unknown protein (At1g50740)                99
60223.1|BQ060223
                                              protein, mRNA sequence

                                  gi|19855268|gb|BQ060318.1|BQ060318 Ts1284
gi|19855268|gb|BQ0                 Thellungiella salsuginea cDNA similar to ABC
                       Ts1284                                                                       bHLH protein family (At1g51140)             98
60318.1|BQ060318                    transporter ATP-binding/membrane spanning
                                  protein - multidrug resistance, mRNA sequence

                                  gi|19913578|gb|BQ079219.1|BQ079219 Ts1503
gi|19913578|gb|BQ0
                       Ts1503    Thellungiella salsuginea cDNA similar to unknown                   bHLH protein family (At1g51140)             98
79219.1|BQ079219
                                              protein, mRNA sequence

                                  gi|19855160|gb|BQ060212.1|BQ060212 Ts1160
gi|19855160|gb|BQ0
                       Ts1160         Thellungiella salsuginea cDNA similar to                      KH domain protein (At1g51580)               98
60212.1|BQ060212
                                       hypothetical protein, mRNA sequence

                                  gi|19855201|gb|BQ060252.1|BQ060252 Ts1219
gi|19855201|gb|BQ0
                       Ts1219         Thellungiella salsuginea cDNA similar to                      KH domain protein (At1g51580)               98
60252.1|BQ060252
                                       hypothetical protein, mRNA sequence
                                    gi|16004622|gb|BI851135.1|BI851135 Ts998
gi|16004622|gb|BI85
                       Ts998           Thellungiella salsuginea cDNA similar to                     KH domain protein (At1g51580)                   98
  1135.1|BI851135
                                        hypothetical protein, mRNA sequence

                               gi|19684315|gb|BM985649.1|BM985649 2_G04_T3
gi|19684315|gb|BM9              Ath Thellungiella halophila cDNA clone 2_G04_T3      4-coumarate:CoA ligase 1 (4-coumaroyl-CoAsynthase 1) (4CL1),
                      2_G04_T3                                                                                                                      01.8
85649.1|BM985649                similar to 4-coumarate--CoA ligase (EC 6.2.1.12)                         putative (At1g51680 )
                                        4CL - Arabidopsis thaliana, mRNA

                                 gi|19684463|gb|BM985797.1|BM985797 5_B04_T3
gi|19684463|gb|BM9                Ath Thellungiella halophila cDNA clone 5_B04_T3    4-coumarate:CoA ligase 1 (4-coumaroyl-CoAsynthase 1) (4CL1),
                      5_B04_T3                                                                                                                      01.8
85797.1|BM985797                  similar to 4-coumarate--CoA ligase (EC 6.2.1.12)                       putative (At1g51680)
                                          4CL - Arabidopsis thaliana, mRNA

                                 gi|19684769|gb|BM986103.1|BM986103 9_E02_T3
gi|19684769|gb|BM9                Ath Thellungiella halophila cDNA clone 9_E02_T3    4-coumarate:CoA ligase 1 (4-coumaroyl-CoAsynthase 1) (4CL1),
                      9_E02_T3                                                                                                                      01.8
86103.1|BM986103                  similar to 4-coumarate--CoA ligase (EC 6.2.1.12)                       putative (At1g51680)
                                          4CL - Arabidopsis thaliana, mRNA

                                   gi|10172551|gb|BE758559.1|BE758559 Sc0138
gi|10172551|gb|BE75
                       Sc0138         Thellungiella salsuginea cDNA similar to 4-               4-coumarate:CoA ligase 1 (At1g51680)                01.8
  8559.1|BE758559
                                       coumarate--CoA ligase, mRNA sequence

                                 gi|19684388|gb|BM985722.1|BM985722 4_A09_T3
gi|19684388|gb|BM9                Ath Thellungiella halophila cDNA clone 4_A09_T3
                      4_A09_T3                                                                      expressed protein (At1g52140)                   99
85722.1|BM985722                      similar to AC006216 - Arabidopsis thaliana
                                    chromosome 1 BAC F5F19 sequence, mRNA

                                 gi|19684483|gb|BM985817.1|BM985817 5_D06_T3
gi|19684483|gb|BM9                Ath Thellungiella halophila cDNA clone 5_D06_T3
                      5_D06_T3                                                                      expressed protein (At1g52565)                   99
85817.1|BM985817                 similar to Arabidopsis thaliana chromosome 1 BAC
                                               F6D8 sequence, mRNA

                                 gi|19684562|gb|BM985896.1|BM985896 6_E08_T3
gi|19684562|gb|BM9                Ath Thellungiella halophila cDNA clone 6_E08_T3
                      6_E08_T3                                                                      expressed protein (At1g52565)                   99
85896.1|BM985896                 similar to Arabidopsis thaliana chromosome 1 BAC
                                               F6D8 sequence, mRNA

                                     gi|15661321|gb|BI698692.1|BI698692 Ts589
gi|15661321|gb|BI69
                       Ts589            Thellungiella salsuginea cDNA similar to                     unknown protein (At1g52565)                    99
  8692.1|BI698692
                                         gene_id:MSJ11.16, mRNA sequence
                                 gi|19684202|gb|BM985536.1|BM985536 1_B02_T3
gi|19684202|gb|BM9                Ath Thellungiella halophila cDNA clone 1_B02_T3
                      1_B02_T3                                                          contains Pfam profile PF00125 Core histone (At1g52740)      13.9
85536.1|BM985536                      similar to (AC019018) putative histone H2A
                                                   [A.thaliana], mRNA
                                 gi|19684229|gb|BM985563.1|BM985563 1_E03_T3
gi|19684229|gb|BM9
                      1_E03_T3    Ath Thellungiella halophila cDNA clone 1_E03_T3         ethylene responsive element binding factor 8 (At1g53170)     11.1
85563.1|BM985563
                                 similar to genomic sequence for A.thaliana, mRNA

                                 gi|19684558|gb|BM985892.1|BM985892 6_E04_T3
gi|19684558|gb|BM9                Ath Thellungiella halophila cDNA clone 6_E04_T3
                      6_E04_T3                                                    putative ethylene responsive element binding factor 8 (At1g53170) 11.1
85892.1|BM985892                   similar to AF003098 - Arabidopsis thaliana AP2
                                  domain containing protein RAP2.5 mRNA, mRNA

                                 gi|19684700|gb|BM986034.1|BM986034 8_E05_T3
gi|19684700|gb|BM9
                      8_E05_T3    Ath Thellungiella halophila cDNA clone 8_E05_T3 putative ethylene responsive element binding factor 8 (At1g53170) 11.1
86034.1|BM986034
                                 similar to genomic sequence for A.thaliana, mRNA

                                  gi|19855229|gb|BQ060280.1|BQ060280 Ts1334
gi|19855229|gb|BQ0                  Thellungiella salsuginea cDNA similar to AP2
                       Ts1334                                                         putative ethylene responsive element binding factor 8 (At1g53170) 11.1
60280.1|BQ060280                      domain containing protein RAP2.5, mRNA
                                                       sequence
                                  gi|19855141|gb|BQ060193.1|BQ060193 Ts1061
gi|19855141|gb|BQ0                     Thellungiella salsuginea cDNA similar to
                       Ts1061                                                              putative phosphoenolpyruvate carboxylase (At1g53310)        01.5
60193.1|BQ060193                   phosphoenolpyruvate carboxylase 1, putative,
                                                   mRNA sequence
                                    gi|15661204|gb|BI698575.1|BI698575 Ts135
gi|15661204|gb|BI69
                       Ts135           Thellungiella salsuginea cDNA similar to            putative phosphoenolpyruvate carboxylase (At1g53310)        01.5
  8575.1|BI698575
                                            F12M16.21, mRNA sequence

                                 gi|19684580|gb|BM985914.1|BM985914 6_G12_T3
gi|19684580|gb|BM9                                                                        glyoxalase II, putative (hydroxyacylglutathionehydrolase)
                      6_G12_T3    Ath Thellungiella halophila cDNA clone 6_G12_T3                                                                      02.8
85914.1|BM985914                                                                                                  (At1g53580)
                                     similar to (U74610) glyoxalase II [A.t.], mRNA

                                    gi|15661268|gb|BI698639.1|BI698639 Ts344
gi|15661268|gb|BI69                    Thellungiella salsuginea cDNA similar to
                       Ts344                                                                    putative transcriptional regulator (At1g53670)         04.0
  8639.1|BI698639                 transcriptional regulator, putative; 35498-34111,
                                                   mRNA sequence

                                   gi|19855135|gb|BQ060187.1|BQ060187 Ts1052
                                 Thellungiella salsuginea cDNA similar to PF|00657
gi|19855135|gb|BQ0
                       Ts1052    Lipase/Acylhydrolase with GDSL-motif family. ESTs          myrosinase-associated protein, putative (At1g54030)        02.9
60187.1|BQ060187
                                  gb|T75865, gb|R30449, gb|AI239373, gb|F19931
                                          and gb|F19930, mRNA sequence

                                   gi|19913640|gb|BQ079281.1|BQ079281 Ts787
gi|19913640|gb|BQ0
                       Ts787      Thellungiella salsuginea cDNA similar to putative      dihydrolipoamide S-acetyltransferase, putative (At1g54220)    02.11
79281.1|BQ079281
                                         acetyltransferase, mRNA sequence
                               gi|19684577|gb|BM985911.1|BM985911 6_G08_T3
gi|19684577|gb|BM9              Ath Thellungiella halophila cDNA clone 6_G08_T3
                      6_G08_T3                                                            protein translation factor Sui1 homolog-related (At1g54290)     05.2
85911.1|BM985911                    similar to AC005287 - Arabidopsis thaliana
                                       chromosome I BAC F20D21 ,mRNA

                                  gi|19684543|gb|BM985877.1|BM985877 6_C07_T3
gi|19684543|gb|BM9                 Ath Thellungiella halophila cDNA clone 6_C07_T3
                      6_C07_T3                                                                          expressed protein (At1g54440)                     99
85877.1|BM985877                       similar to AC005287 - Arabidopsis thaliana
                                          chromosome I BAC F20D21 ,mRNA

                                  gi|19684676|gb|BM986010.1|BM986010 8_B10_T3
gi|19684676|gb|BM9                 Ath Thellungiella halophila cDNA clone 8_B10_T3
                      8_B10_T3                                                                          expressed protein (At1g54440)                     99
86010.1|BM986010                       similar to AC005287 - Arabidopsis thaliana
                                          chromosome I BAC F20D21 ,mRNA

                                 gi|19855164|gb|BQ060215.1|BQ060215 Ts1164
gi|19855164|gb|BQ0                                                                       similar to human 100kD nucleolar protein, gb|JH0796
                       Ts1164   Thellungiella salsuginea cDNA similar to nucleolar                                                                      99
60215.1|BQ060215                                                                            (AAD25623.1); expressed protein (At1g54440)
                                              protein, mRNA sequence
                               gi|19684650|gb|BM985984.1|BM985984 7_G07_T3
gi|19684650|gb|BM9              Ath Thellungiella halophila cDNA clone 7_G07_T3
                      7_G07_T3                                                                       expressed protein (At1g54710)                      99
85984.1|BM985984                     similar to (AC005388) Strong similarity to
                                                  F21B7.33, mRNA
                               gi|19684060|gb|BM985478.1|BM985478 10_C04_T
                                Ath Thellungiella halophila cDNA clone 10_C04_T
gi|19684060|gb|BM9                                                                 sec14 cytosolic factor, putative (phosphoglyceride transfer protein,
                      10_C04_T     similar to AC002304 genomic sequence for                                                                             08.4
85478.1|BM985478                                                                                          putative) (At1g55840)
                                      Arabidopsis thaliana BAC F14J16 from
                                                chromosome I, mRNA
                                   gi|19855351|gb|BQ060401.1|BQ060401 Ts1099
                                        Thellungiella salsuginea cDNA similar to
gi|19855351|gb|BQ0                           PROBABLE ADP-HEPTOSE--                    sec14 cytosolic factor, putative(phosphoglyceride transfer protein,
                       Ts1099                                                                                                                              08.4
60401.1|BQ060401                               LIPOPOLYSACCHARIDE                                             putative) (At1g55840)
                                   HEPTOSYLTRANSFERASE II PROTEIN, mRNA
                                                        sequence
                                     gi|16004611|gb|BI851124.1|BI851124 Ts969
gi|16004611|gb|BI85                     Thellungiella salsuginea cDNA similar to
                        Ts969                                                             polyphosphoinositide binding protein, putative (At1g55840)      98
  1124.1|BI851124                   polyphosphoinositide binding protein, putative,
                                                    mRNA sequence

                                    gi|19855197|gb|BQ060248.1|BQ060248 Ts1209
gi|19855197|gb|BQ0
                       Ts1209           Thellungiella salsuginea cDNA similar to                        expressed protein (At1g56580)                     99
60248.1|BQ060248
                                         hypothetical protein, mRNA sequence

                                   gi|19855257|gb|BQ060308.1|BQ060308 Ts1376
gi|19855257|gb|BQ0
                       Ts1376     Thellungiella salsuginea cDNA similar to expressed                    expressed protein (At1g56580)                     99
60308.1|BQ060308
                                                protein, mRNA sequence
                                   gi|15661386|gb|BI698757.1|BI698757 Ts507
gi|15661386|gb|BI69
                       Ts507     Thellungiella salsuginea cDNA similar to Unknown                   expressed protein (At1g56580)                    99
  8757.1|BI698757
                                              protein, mRNA sequence

                                 gi|19684547|gb|BM985881.1|BM985881 6_C12_T3
gi|19684547|gb|BM9                Ath Thellungiella halophila cDNA clone 6_C12_T3      galactinol synthase water stress-induced protein, putative
                      6_C12_T3                                                                                                                       11.1
85881.1|BM985881                    similar to Arabidopsis thaliana chromosome 1                             (At1g56600)
                                               CHR1v12152001 ,mRNA

                                 gi|19684619|gb|BM985953.1|BM985953 7_C12_T3
                                  Ath Thellungiella halophila cDNA clone 7_C12_T3
gi|19684619|gb|BM9                                                                     galactinol synthase, water stress-induced protein, putative
                      7_C12_T3        similar to AC003970 - Arabidopsis thaliana                                                                     11.1
85953.1|BM985953                                                                                              (At1g56600)
                                    chromosome I BAC F14J9 genomic sequence
                                             contains phyA marker, mRNA

                                  gi|19913572|gb|BQ079213.1|BQ079213 Ts1554
gi|19913572|gb|BQ0
                       Ts1554         Thellungiella salsuginea cDNA similar to                 galactinol synthase, putative (At1g56600)             11.1
79213.1|BQ079213
                                      At1g56600/F25P12_16, mRNA sequence

                                    gi|15661112|gb|BI698483.1|BI698483 Ts244
gi|15661112|gb|BI69
                       Ts244      Thellungiella salsuginea cDNA similar to Putative            galactinol synthase, putative (At1g56600)             11.1
  8483.1|BI698483
                                        galactinol synthase, mRNA sequence

                                 gi|19684400|gb|BM985734.1|BM985734 4_C03_T3
gi|19684400|gb|BM9
                      4_C03_T3    Ath Thellungiella halophila cDNA clone 4_C03_T3                   expressed protein (At1g58270)                    99
85734.1|BM985734
                                       similar to (AB028194) ZW9 [A.t.], mRNA

                                    gi|15661254|gb|BI698625.1|BI698625 Ts415
gi|15661254|gb|BI69
                       Ts415     Thellungiella salsuginea cDNA similar to ribosomal           ribosomal protein S2, putative (At1g58380)             05.1
  8625.1|BI698625
                                  protein S2, cytosolic [similarity], mRNA sequence

                                  gi|19855332|gb|BQ060382.1|BQ060382 Ts1462
gi|19855332|gb|BQ0
                       Ts1462    Thellungiella salsuginea cDNA similar to trehalose-    trehalose-6-phosphate synthase 3 (TPS3) (At1g60140)          01.5
60382.1|BQ060382
                                 6-phosphate synthase, putative, mRNA sequence

                                   gi|15661466|gb|BI698837.1|BI698837 Ts949
gi|15661466|gb|BI69
                       Ts949     Thellungiella salsuginea cDNA similar to trehalose-   trehalose-6-phosphate synthase 3 (TPS3) (AAO15312.1)          01.5
  8837.1|BI698837
                                 6-phosphate synthase, putative, mRNA sequence

                                  gi|19855265|gb|BQ060315.1|BQ060315 Ts1281
gi|19855265|gb|BQ0
                       Ts1281    Thellungiella salsuginea cDNA similar to expressed                 expressed protein (At1g60420)                    99
60315.1|BQ060315
                                               protein, mRNA sequence

                                 gi|19684679|gb|BM986013.1|BM986013 8_C01_T3
gi|19684679|gb|BM9                Ath Thellungiella halophila cDNA clone 8_C01_T3
                      8_C01_T3                                                                      expressed protein (At1g60700)                    99
86013.1|BM986013                      similar to (AC002292) Hypothetical protein
                                             [Arabidopsis thaliana], mRNA
                                 gi|19684242|gb|BM985576.1|BM985576 1_G01_T3
gi|19684242|gb|BM9
                      1_G01_T3    Ath Thellungiella halophila cDNA clone 1_G01_T3        putative ferredoxin precursor protein (At1g60950)        11.4
85576.1|BM985576
                                    similar to FERREDOXIN PRECURSOR, mRNA

                                 gi|19684454|gb|BM985788.1|BM985788 5_A05_T3
gi|19684454|gb|BM9
                      5_A05_T3    Ath Thellungiella halophila cDNA clone 5_A05_T3        putative ferredoxin precursor protein (At1g60950)        11.4
85788.1|BM985788
                                    similar to FERREDOXIN PRECURSOR, mRNA

                                 gi|19684626|gb|BM985960.1|BM985960 7_D08_T3
gi|19684626|gb|BM9
                      7_D08_T3    Ath Thellungiella halophila cDNA clone 7_D08_T3        putative ferredoxin precursor protein (At1g60950)        11.4
85960.1|BM985960
                                    similar to FERREDOXIN PRECURSOR, mRNA

                                    gi|15661234|gb|BI698605.1|BI698605 Ts115
gi|15661234|gb|BI69
                       Ts115       Thellungiella salsuginea cDNA similar to RPS-2          RPS-2 disease resistance protein (At1g61180)           11.3
  8605.1|BI698605
                                    disease resistance protein, mRNA sequence

                                 gi|19684704|gb|BM986038.1|BM986038 8_E10_T3
gi|19684704|gb|BM9                                                                  contains S-locus glycoprotein family domain, Pfam:PF00954
                      8_E10_T3    Ath Thellungiella halophila cDNA clone 8_E10_T3                                                                 99
86038.1|BM986038                                                                                           (At1g61360)
                                     similar to (AC004255) T1F9.15 [A.t.], mRNA

                                gi|19855367|gb|BQ060417.1|BQ060417 Ts1119
gi|19855367|gb|BQ0
                       Ts1119 Thellungiella salsuginea cDNA similar to expressed                  expressed protein (At1g62480)                   99
60417.1|BQ060417
                                             protein, mRNA sequence
                                gi|19913556|gb|BQ079191.1|BQ079191 Ts1482
gi|19913556|gb|BQ0
                      Ts1482  Thellungiella salsuginea cDNA similar to expressed                  expressed protein (At1g62480)                   99
79191.1|BQ079191
                                             protein, mRNA sequence
                              gi|19684187|gb|BM985523.1|BM985523 10_H10_T
gi|19684187|gb|BM9             Ath Thellungiella halophila cDNA clone 10_H10_T      glutamate synthase, flavin-containing monooxygenase (FMO)
                    10_H10_T3                                                                                                                     01.1
85523.1|BM985523                  similar to (AC005698) T3P18.13 [A.thaliana],                           family (At1g62570)
                                                       mRNA
                                 gi|19913654|gb|BQ079295.1|BQ079295 Ts815
gi|19913654|gb|BQ0               Thellungiella salsuginea cDNA similar to flavin-   glutamate synthase, flavin-ciontaining monooxygenase family
                      Ts815                                                                                                                       01.1
79295.1|BQ079295                  containing monooxygenase, putative, mRNA                                  (At1g62570)
                                                     sequence
                                  gi|15661265|gb|BI698636.1|BI698636 Ts178
gi|15661265|gb|BI69
                      Ts178   Thellungiella salsuginea cDNA similar to T3P18.18,          flavin-containing monooxygenase 3 (At1g62600)           01.8
  8636.1|BI698636
                                                 mRNA sequence

                                 gi|19684628|gb|BM985962.1|BM985962 7_D10_T3
gi|19684628|gb|BM9                Ath Thellungiella halophila cDNA clone 7_D10_T3
                      7_D10_T3                                                        monodehydroascorbate reductase, putative (At1g63940)        11.4
85962.1|BM985962                      similar to AC010852 - Arabidopsis thaliana
                                         chromosome 1 BAC T12P18 ,mRNA
                                  gi|10128297|gb|BE727001.1|BE727001 Sc0006
gi|10128297|gb|BE72                    Thellungiella salsuginea cDNA similar to
                       Sc0006                                                           putative monodehydroascorbate reductase (At1g63940)        11.4
  7001.1|BE727001                    monodehydroascorbate reductase, mRNA
                                                       sequence
                                    gi|15661222|gb|BI698593.1|BI698593 Ts400
gi|15661222|gb|BI69               Thellungiella salsuginea cDNA similar to putative
                       Ts400                                                            putative monodehydroascorbate reductase (At1g63940)        11.4
  8593.1|BI698593                 monodehydroascorbate reductase; 10617-7178,
                                                   mRNA sequence

                                  gi|19913571|gb|BQ079212.1|BQ079212 Ts1553
gi|19913571|gb|BQ0                    Thellungiella salsuginea cDNA similar to        respiratory burst oxidase protein F (NADPHoxidase) (RbohF)
                       Ts1553                                                                                                                      02.4
79212.1|BQ079212                 cytochrome b245 beta chain homolog RbohAp108,                          (RbohAp108) (At1g64060)
                                             putative, mRNA sequence

                                 gi|19684212|gb|BM985546.1|BM985546 1_C03_T3
gi|19684212|gb|BM9                Ath Thellungiella halophila cDNA clone 1_C03_T3
                      1_C03_T3                                                                      expressed protein (At1g64370)                  99
85546.1|BM985546                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                                 gi|19684352|gb|BM985686.1|BM985686 3_D12_T3
gi|19684352|gb|BM9                Ath Thellungiella halophila cDNA clone 3_D12_T3
                      3_D12_T3                                                                      expressed protein (At1g64370)                  99
85686.1|BM985686                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                               gi|19684505|gb|BM985839.1|BM985839 5_G02_T3
gi|19684505|gb|BM9              Ath Thellungiella halophila cDNA clone 5_G02_T3
                      5_G02_T3                                                                      expressed protein (At1g64370)                  99
85839.1|BM985839                  similar to Arabidopsis thaliana chromosome 1
                                             CHR1v12152001 ,mRNA

                               gi|19684509|gb|BM985843.1|BM985843 5_G07_T3
gi|19684509|gb|BM9              Ath Thellungiella halophila cDNA clone 5_G07_T3
                      5_G07_T3                                                                      expressed protein (At1g64370)                  99
85843.1|BM985843                  similar to Arabidopsis thaliana chromosome 1
                                             CHR1v12152001 ,mRNA

                                    gi|15661334|gb|BI698705.1|BI698705 Ts100
gi|15661334|gb|BI69
                       Ts100      Thellungiella salsuginea cDNA similar to unknown                  unknown protein (At1g64370)                    99
  8705.1|BI698705
                                       protein; 54707-54171, mRNA sequence

                                   gi|19855146|gb|BQ060198.1|BQ060198 Ts1068
gi|19855146|gb|BQ0
                       Ts1068     Thellungiella salsuginea cDNA similar to unknown                  unknown protein (At1g64370)                    99
60198.1|BQ060198
                                               protein, mRNA sequence
                                    gi|16004606|gb|BI851119.1|BI851119 Ts1145
gi|16004606|gb|BI85
                       Ts1145     Thellungiella salsuginea cDNA similar to unknown                  unknown protein (At1g64370)                    99
  1119.1|BI851119
                                               protein, mRNA sequence
                                  gi|19855316|gb|BQ060366.1|BQ060366 Ts1427
gi|19855316|gb|BQ0
                       Ts1427    Thellungiella salsuginea cDNA similar to expressed                  expressed protein (At1g64370)                  99
60366.1|BQ060366
                                               protein, mRNA sequence
                                  gi|19855321|gb|BQ060371.1|BQ060371 Ts1437
gi|19855321|gb|BQ0
                       Ts1437    Thellungiella salsuginea cDNA similar to expressed                  expressed protein (At1g64370)                  99
60371.1|BQ060371
                                               protein, mRNA sequence
                                  gi|19855325|gb|BQ060375.1|BQ060375 Ts1447
gi|19855325|gb|BQ0
                       Ts1447    Thellungiella salsuginea cDNA similar to expressed                  expressed protein (At1g64370)                  99
60375.1|BQ060375
                                               protein, mRNA sequence

                                   gi|15661395|gb|BI698766.1|BI698766 Ts300
gi|15661395|gb|BI69
                       Ts300     Thellungiella salsuginea cDNA similar to unknown                     unknown protein (At1g64370)                   99
  8766.1|BI698766
                                      protein; 54707-54171, mRNA sequence

                                   gi|15661365|gb|BI698736.1|BI698736 Ts382
gi|15661365|gb|BI69
                       Ts382     Thellungiella salsuginea cDNA similar to unknown                     unknown protein (At1g64370)                   99
  8736.1|BI698736
                                      protein; 54707-54171, mRNA sequence

                                   gi|15661393|gb|BI698764.1|BI698764 Ts480
gi|15661393|gb|BI69
                       Ts480     Thellungiella salsuginea cDNA similar to unknown                     unknown protein (At1g64370)                   99
  8764.1|BI698764
                                      protein; 54707-54171, mRNA sequence

                                   gi|15661388|gb|BI698759.1|BI698759 Ts567
gi|15661388|gb|BI69
                       Ts567     Thellungiella salsuginea cDNA similar to unknown                     unknown protein (At1g64370)                   99
  8759.1|BI698759
                                      protein; 54707-54171, mRNA sequence

                                   gi|15661320|gb|BI698691.1|BI698691 Ts588
gi|15661320|gb|BI69
                       Ts588     Thellungiella salsuginea cDNA similar to unknown                     unknown protein (At1g64370)                   99
  8691.1|BI698691
                                      protein; 54707-54171, mRNA sequence

                                     gi|15661479|gb|BI698850.1|BI698850 Ts936
gi|15661479|gb|BI69
                       Ts936      Thellungiella salsuginea cDNA similar to unknown                    unknown protein (At1g64370)                   99
  8850.1|BI698850
                                               protein, mRNA sequence
                                 gi|19684431|gb|BM985765.1|BM985765 4_F08_T3
gi|19684431|gb|BM9                Ath Thellungiella halophila cDNA clone 4_F08_T3
                      4_F08_T3                                                             UDP-galactose 4-epimerase, putative (At1g64440)          01.5
85765.1|BM985765                  similar to probable UDPglucose 4-epimerase (EC
                                                     5.1.3.2), mRNA
                                     gi|15661343|gb|BI698714.1|BI698714 Ts133
gi|15661343|gb|BI69
                       Ts133     Thellungiella salsuginea cDNA similar to zinc finger          putative Dof zinc finger protein (At1g64620)         04.0
  8714.1|BI698714
                                            protein isolog, mRNA sequence

                                  gi|19855238|gb|BQ060289.1|BQ060289 Ts1345
gi|19855238|gb|BQ0
                       Ts1345    Thellungiella salsuginea cDNA similar to zinc finger   clone U20433 putative Dof zinc finger protein (At1g64620)   04.0
60289.1|BQ060289
                                         protein, putative, mRNA sequence
                                    gi|15661092|gb|BI698463.1|BI698463 Ts547
gi|15661092|gb|BI69
                       Ts547     Thellungiella salsuginea cDNA similar to F1N19.19,             putative Dof zinc finger protein (At1g64620)          04.0
  8463.1|BI698463
                                                   mRNA sequence

                                  gi|19913579|gb|BQ079220.1|BQ079220 Ts1488
gi|19913579|gb|BQ0
                       Ts1488    Thellungiella salsuginea cDNA similar to membrane          membrane related protein CP5, putative (At1g64720)        98
79220.1|BQ079220
                                        related protein CP5, mRNA sequence

                                 gi|19684537|gb|BM985871.1|BM985871 6_B10_T3
gi|19684537|gb|BM9
                      6_B10_T3    Ath Thellungiella halophila cDNA clone 6_B10_T3                     expressed protein (At1g64890)                   99
85871.1|BM985871
                                 similar to (AC006193) Hypothetical Protein, mRNA

                                 gi|19684353|gb|BM985687.1|BM985687 3_E01_T3
gi|19684353|gb|BM9                Ath Thellungiella halophila cDNA clone 3_E01_T3
                      3_E01_T3                                                                   type 2 peroxiredoxin -related At1g65980              11.4
85687.1|BM985687                  similar to Brassica rapa subsp. pekinensis type 2
                                         peroxiredoxin (PrxII) mRNA, mRNA

                                  gi|19855312|gb|BQ060362.1|BQ060362 Ts1415
gi|19855312|gb|BQ0
                       Ts1415    Thellungiella salsuginea cDNA similar to beta-1,3-              glycosyl hydrolase family 17 (At1g66250)             98
60362.1|BQ060362
                                  glucanase precursor, putative, mRNA sequence

                                 gi|19684193|gb|BM985527.1|BM985527 1_A03_T3
gi|19684193|gb|BM9                Ath Thellungiella halophila cDNA clone 1_A03_T3
                      1_A03_T3                                                        ribulose-bisphosphate carboxylase small unit-related (At1g67090) 01.5
85527.1|BM985527                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                                   gi|16004589|gb|BI851102.1|BI851102 Ts1039
                                  Thellungiella salsuginea cDNA similar to ribulose
gi|16004589|gb|BI85
                       Ts1039      bisphosphate carboxylase SMALL CHAIN F1             ribulose bisphosphate carboxylase, small subunit (At1g67090)   01.5
  1102.1|BI851102
                                  PRECURSOR (RUBISCO SMALL SUBUNIT F1),
                                                  mRNA sequence
                                  gi|19855158|gb|BQ060210.1|BQ060210 Ts1158
                                  Thellungiella salsuginea cDNA similar to ribulose
gi|19855158|gb|BQ0
                       Ts1158      bisphosphate carboxylase SMALL CHAIN F1             ribulose bisphosphate carboxylase, small subunit (At1g67090)   01.5
60210.1|BQ060210
                                  PRECURSOR (RUBISCO SMALL SUBUNIT F1),
                                                  mRNA sequence

                                    gi|16004587|gb|BI851100.1|BI851100 Ts1033
gi|16004587|gb|BI85
                       Ts1033          Thellungiella salsuginea cDNA similar to                  putative alpha-glucosidase I (At1g67490)             01.5
  1100.1|BI851100
                                  glucosidase I homolog F3I6.26, mRNA sequence

                                    gi|15661108|gb|BI698479.1|BI698479 Ts531
gi|15661108|gb|BI69
                       Ts531           Thellungiella salsuginea cDNA similar to                  putative alpha-glucosidase I (At1g67490)             01.5
  8479.1|BI698479
                                  glucosidase I homolog F3I6.26, mRNA sequence
                                     gi|15661109|gb|BI698480.1|BI698480 Ts58
gi|15661109|gb|BI69
                        Ts58           Thellungiella salsuginea cDNA similar to               putative alpha-glucosidase I (At1g67490)            01.5
  8480.1|BI698480
                                  glucosidase I homolog F3I6.26, mRNA sequence

                               gi|19684631|gb|BM985965.1|BM985965 7_E05_T3
gi|19684631|gb|BM9              Ath Thellungiella halophila cDNA clone 7_E05_T3
                      7_E05_T3                                                                   hypothetical protein (AAG28896.1)                99
85965.1|BM985965                  similar to (AC008113) F12A21.23 [Arabidopsis
                                                  thaliana], mRNA
                               gi|19684652|gb|BM985986.1|BM985986 7_G10_T3
gi|19684652|gb|BM9              Ath Thellungiella halophila cDNA clone 7_G10_T3
                      7_G10_T3                                                                   hypothetical protein (AAG28896.1)                99
85986.1|BM985986                  similar to (AC008113) F12A21.23 [Arabidopsis
                                                  thaliana], mRNA
                               gi|19684673|gb|BM986007.1|BM986007 8_B07_T3
gi|19684673|gb|BM9              Ath Thellungiella halophila cDNA clone 8_B07_T3      between unknown protein (BAB02636.1) and unknown protein
                      8_B07_T3                                                                                                                    99
86007.1|BM986007                  similar to (AC008113) F12A21.23 [Arabidopsis                   (T15D2.20); psuedo (At1g67645)
                                                  thaliana], mRNA
                               gi|19684751|gb|BM986085.1|BM986085 9_C04_T3
gi|19684751|gb|BM9              Ath Thellungiella halophila cDNA clone 9_C04_T3      between unknown protein (BAB02636.1) and unknown protein
                      9_C04_T3                                                                                                                    99
86085.1|BM986085                  similar to (AC008113) F12A21.23 [Arabidopsis                   (T15D2.20); pseudo (At1g67645)
                                                  thaliana], mRNA
                                    gi|15661094|gb|BI698465.1|BI698465 Ts94
gi|15661094|gb|BI69
                        Ts94          Thellungiella salsuginea cDNA similar to                     unknown protein (BAB02636.1)                   99
  8465.1|BI698465
                                            F12A21.26, mRNA sequence
                               gi|19684062|gb|BM985479.1|BM985479 10_C05_T
gi|19684062|gb|BM9              Ath Thellungiella halophila cDNA clone 10_C05_T      between unknown protein (BAB02636.1) and unknown protein
                      10_C05_T                                                                                                                    99
85479.1|BM985479                  similar to (AC008113) F12A21.23 [Arabidopsis                (gene_id:T15D2.20); pseudo (At1g67645)
                                                  thaliana], mRNA

                               gi|19684573|gb|BM985907.1|BM985907 6_G02_T3
                                Ath Thellungiella halophila cDNA clone 6_G02_T3
gi|19684573|gb|BM9
                      6_G02_T3   similar to AF129511 - Arabidopsis thaliana very- very-long-chain fatty acid condensing enzyme(CUT1) (At1g68530) 01.6
85907.1|BM985907
                                  long-chain fatty acid condensing enzyme CUT1
                                               (CUT1) mRNA, mRNA

                                 gi|19684608|gb|BM985942.1|BM985942 7_B10_T3
                                  Ath Thellungiella halophila cDNA clone 7_B10_T3
gi|19684608|gb|BM9
                      7_B10_T3     similar to AF129511 - Arabidopsis thaliana very- very-long-chain fatty acid condensing enzyme CUT1 (AAM65060.1) 01.6
85942.1|BM985942
                                   long-chain fatty acid condensing enzyme CUT1
                                                (CUT1) mRNA, mRNA

                                 gi|19684764|gb|BM986098.1|BM986098 9_D09_T3
                                  Ath Thellungiella halophila cDNA clone 9_D09_T3
gi|19684764|gb|BM9
                      9_D09_T3     similar to AF129511 - Arabidopsis thaliana very- very-long-chain fatty acid condensing enzyme(CUT1) (At1g68530) 01.6
86098.1|BM986098
                                    long-chain fatty acid condensing enzyme CUT1
                                                 (CUT1) mRNA, mRNA
                                 gi|19684782|gb|BM986116.1|BM986116 9_F07_T3
                                  Ath Thellungiella halophila cDNA clone 9_F07_T3
gi|19684782|gb|BM9
                      9_F07_T3     similar to AF129511 - Arabidopsis thaliana very- very-long-chain fatty acid condensing enzyme(CUT1) (At1g68530) 01.6
86116.1|BM986116
                                   long-chain fatty acid condensing enzyme CUT1
                                                (CUT1) mRNA, mRNA

                                   gi|19855338|gb|BQ060388.1|BQ060388 Ts1470
gi|19855338|gb|BQ0               Thellungiella salsuginea cDNA similar to very-long-
                       Ts1470                                                        very-long-chain fatty acid condensing enzyme (CUT1) (At1g68530) 01.6
60388.1|BQ060388                 chain fatty acid condensing enzyme (CUT1), mRNA
                                                       sequence
                                     gi|15661093|gb|BI698464.1|BI698464 Ts509
gi|15661093|gb|BI69              Thellungiella salsuginea cDNA similar to very-long-
                       Ts509                                                         very-long-chain fatty acid condensing enzyme (CUT1) (At1g68530) 01.6
  8464.1|BI698464                 chain fatty acid condensing enzyme CUT1, mRNA
                                                       sequence

                                 gi|19684223|gb|BM985557.1|BM985557 1_D04_T3
gi|19684223|gb|BM9                Ath Thellungiella halophila cDNA clone 1_D04_T3
                      1_D04_T3                                                                       expressed protein (At1g69030)                  99
85557.1|BM985557                      similar to AC011665 - Arabidopsis thaliana
                                           chromosome 1 BAC T6L1 ,mRNA

                                 gi|19684169|gb|BM985516.1|BM985516 10_H01_T
gi|19684169|gb|BM9                Ath Thellungiella halophila cDNA clone 10_H01_T
                      10_H01_T                                                                       expressed protein (At1g69030)                  99
85516.1|BM985516                      similar to (AC011665) hypothetical protein
                                                   [A.thaliana], mRNA
                                     gi|15661359|gb|BI698730.1|BI698730 Ts132
gi|15661359|gb|BI69
                       Ts132      Thellungiella salsuginea cDNA similar to unknown                   unknown protein (At1g69295)                    99
  8730.1|BI698730
                                                protein, mRNA sequence

                                    gi|15661516|gb|BI698887.1|BI698887 Ts875
gi|15661516|gb|BI69
                       Ts875     Thellungiella salsuginea cDNA similar to Eukaryotic      eukaryotic initiation factor 5A , putative (At1g69410)    05.3
  8887.1|BI698887
                                   initiation factor 5A , putative, mRNA sequence

                                 gi|19684331|gb|BM985665.1|BM985665 3_B06_T3
gi|19684331|gb|BM9                Ath Thellungiella halophila cDNA clone 3_B06_T3
                      3_B06_T3                                                             60S ribosomal protein L34 (RPL34B) (At1g69620)           05.1
85665.1|BM985665                    similar to Arabidopsis thaliana chromosome 1
                                               CHR1v12152001 ,mRNA

                               gi|19684510|gb|BM985844.1|BM985844 5_G09_T3
gi|19684510|gb|BM9              Ath Thellungiella halophila cDNA clone 5_G09_T3
                      5_G09_T3                                                                  peptide transporter -related (At1g69870)            07.5
85844.1|BM985844                    similar to AC010675 - Arabidopsis thaliana
                                       chromosome 1 BAC T17F3 ,mRNA

                                    gi|15661216|gb|BI698587.1|BI698587 Ts381
gi|15661216|gb|BI69
                       Ts381      Thellungiella salsuginea cDNA similar to putative             putative peptide transporter (At1g69870)            07.5
  8587.1|BI698587
                                 peptide transporter; 37139-33250, mRNA sequence
                                    gi|19913624|gb|BQ079265.1|BQ079265 Ts762
gi|19913624|gb|BQ0
                        Ts762      Thellungiella salsuginea cDNA similar to putative                  peptide transporter related                06.5
79265.1|BQ079265
                                         peptide transporter, mRNA sequence

                                   gi|19855369|gb|BQ060419.1|BQ060419 Ts1239
gi|19855369|gb|BQ0
                       Ts1239      Thellungiella salsuginea cDNA similar to putative         glutathione transferase, putative(At1g69920)        11.4
60419.1|BQ060419
                                       glutathione transferase, mRNA sequence

                                 gi|19684485|gb|BM985819.1|BM985819 5_D09_T3
gi|19684485|gb|BM9                Ath Thellungiella halophila cDNA clone 5_D09_T3      high affinity potassium transporter (KUP6/HAK6/ McHAK2)
                      5_D09_T3                                                                                                                   12.0
85819.1|BM985819                      similar to AC003671 - Arabidopsis thaliana                               (At1g70300)
                                         chromosome 1 BAC F17O7, mRNA

                                   gi|19913635|gb|BQ079276.1|BQ079276 Ts782
gi|19913635|gb|BQ0
                        Ts782     Thellungiella salsuginea cDNA similar to unknown                  expressed protein (At1g70620)                99
79276.1|BQ079276
                                               protein, mRNA sequence

                                   gi|19855356|gb|BQ060406.1|BQ060406 Ts1104
gi|19855356|gb|BQ0
                       Ts1104     Thellungiella salsuginea cDNA similar to ripening-        major latex protein (MLP)-related (At1g70870)        99
60406.1|BQ060406
                                      induced protein, putative, mRNA sequence

                                 gi|19684661|gb|BM985995.1|BM985995 7_H12_T3
gi|19684661|gb|BM9                Ath Thellungiella halophila cDNA clone 7_H12_T3
                      7_H12_T3                                                                myb family transcription factor (At1g71030)        04.0
85995.1|BM985995                      similar to AC016972 - Arabidopsis thaliana
                                         chromosome 1 BAC F23N20 ,mRNA

                                    gi|15661351|gb|BI698722.1|BI698722 Ts125
gi|15661351|gb|BI69
                        Ts125     Thellungiella salsuginea cDNA similar to unknown                  unknown protein (At1g71900)                  99
  8722.1|BI698722
                                       protein; 34092-36071, mRNA sequence

                                   gi|19855292|gb|BQ060342.1|BQ060342 Ts1386
gi|19855292|gb|BQ0
                       Ts1386     Thellungiella salsuginea cDNA similar to unknown                  expressed protein (At1g71900)                99
60342.1|BQ060342
                                        protein; 34092-36071, mRNA sequence

                                 gi|19684222|gb|BM985556.1|BM985556 1_D03_T3
gi|19684222|gb|BM9                Ath Thellungiella halophila cDNA clone 1_D03_T3
                      1_D03_T3                                                                      expressed protein (At1g71980)                99
85556.1|BM985556                    similar to Arabidopsis thaliana unknown protein
                                               (At1g71980) mRNA, mRNA

                               gi|19684247|gb|BM985581.1|BM985581 1_G08_T3
gi|19684247|gb|BM9              Ath Thellungiella halophila cDNA clone 1_G08_T3
                      1_G08_T3                                                                      expressed protein (At1g71980)                99
85581.1|BM985581                  similar to Arabidopsis thaliana unknown protein
                                             (At1g71980) mRNA, mRNA
                                 gi|19684010|gb|BM985461.1|BM985461 10_A02_T
gi|19684010|gb|BM9                Ath Thellungiella halophila cDNA clone 10_A02_T
                      10_A02_T                                                                      expressed protein (At1g71980)                 99
85461.1|BM985461                    similar to Arabidopsis thaliana unknown protein
                                                  (At1g71980), mRNA

                                  gi|20046889|gb|BQ087688.1|BQ087688 Ts1089
gi|20046889|gb|BQ0
                       Ts1089      Thellungiella salsuginea cDNA similar to T-cell                  expressed protein (At1g71980)                 99
87688.1|BQ087688
                                       receptor beta, type 2, mRNA sequence

                                 gi|19684207|gb|BM985541.1|BM985541 1_B07_T3
gi|19684207|gb|BM9                Ath Thellungiella halophila cDNA clone 1_B07_T3
                      1_B07_T3                                                              40S ribosomal protein SA (RPSaA) (At1g72370)          05.1
85541.1|BM985541                    similar to Brassica napus laminin receptor-like
                                              protein (LRP) mRNA, mRNA

gi|10172567|gb|BE75               gi|10172567|gb|BE758575.1|BE758575 Sc0075           between protein phosphatase 2C (AtP2C-HA) (At1g72770) and
                       Sc0075                                                                                                                     99
  8575.1|BE758575                 Thellungiella salsuginea cDNA, mRNA sequence                           tRNA-Ser (At1g72780)

                                   gi|19913626|gb|BQ079267.1|BQ079267 Ts769
gi|19913626|gb|BQ0
                       Ts769      Thellungiella salsuginea cDNA similar to putative              putative trypsin inhibitor (At1g73260)           06.5
79267.1|BQ079267
                                          trypsin inhibitor, mRNA sequence

                                    gi|15661412|gb|BI698783.1|BI698783 Ts668
gi|15661412|gb|BI69
                       Ts668      Thellungiella salsuginea cDNA similar to putative          putative 60S ribosomal protein L6 (At1g74050)        05.1
  8783.1|BI698783
                                     60S ribosomal protein L6, mRNA sequence

                                  gi|19855159|gb|BQ060211.1|BQ060211 Ts1159
gi|19855159|gb|BQ0
                       Ts1159         Thellungiella salsuginea cDNA similar to                   geranylgeranyl reductase (At1g74470)             01.6
60211.1|BQ060211
                                     geranylgeranyl reductase, mRNA sequence

                                  gi|19855248|gb|BQ060299.1|BQ060299 Ts1356
gi|19855248|gb|BQ0                Thellungiella salsuginea cDNA similar to betaine
                       Ts1356                                                            betaine-aldehyde dehydrogenase (BADH) (At1g74920)        11.1
60299.1|BQ060299                     aldehyde dehydrogenase, putative, mRNA
                                                      sequence

gi|10128314|gb|BE72               gi|10128314|gb|BE727018.1|BE727018 Sc0041
                       Sc0041                                                               wound-responsive protein, putative (At1g75380)        11.3
  7018.1|BE727018                 Thellungiella salsuginea cDNA, mRNA sequence

                                   gi|15661279|gb|BI698650.1|BI698650 Ts595
gi|15661279|gb|BI69
                       Ts595          Thellungiella salsuginea cDNA similar to                       unknown protein (At1g75420)                  99
  8650.1|BI698650
                                       Hypothetical protein, mRNA sequence
                                   gi|15661262|gb|BI698633.1|BI698633 Ts385
gi|15661262|gb|BI69
                       Ts385       Thellungiella salsuginea cDNA similar to Skp1              putative SKP1/ASK1 protein At1 (At1g75950)          10.0
  8633.1|BI698633
                                       homolog [imported], mRNA sequence
                                   gi|15661521|gb|BI698892.1|BI698892 Ts866
gi|15661521|gb|BI69
                       Ts866          Thellungiella salsuginea cDNA similar to                     hypothetical protein (At1g76150)               99
  8892.1|BI698892
                                       hypothetical protein, mRNA sequence
                                  gi|15661201|gb|BI698572.1|BI698572 Ts254
gi|15661201|gb|BI69             Thellungiella salsuginea cDNA similar to probable
                      Ts254                                                                         expressed protein (At1g76200)               11.1
  8572.1|BI698572                pyrroline-5-carboxylate synthetase (EC 1.5.1.-),
                                                 mRNA sequence

                                 gi|15661366|gb|BI698737.1|BI698737 Ts36
gi|15661366|gb|BI69
                       Ts36    Thellungiella salsuginea cDNA similar to unknown                     expressed protein (At1g76590)               99
  8737.1|BI698737
                                    protein; 77280-78196, mRNA sequence

                                  gi|15661087|gb|BI698458.1|BI698458 Ts513
gi|15661087|gb|BI69
                      Ts513    Thellungiella salsuginea cDNA similar to extensin 5,                 expressed protein (At1g76930)               99
  8458.1|BI698458
                                                 mRNA sequence
                                 gi|19913608|gb|BQ079249.1|BQ079249 Ts310
gi|19913608|gb|BQ0             Thellungiella salsuginea cDNA similar to Thylakoid
                      Ts310                                                           contains a PsbP domain AF370571; SIMILAR TO (At1g77090)   02.10
79249.1|BQ079249                lumenal 29.8 kDa protein, chloroplast precursor,
                                                 mRNA sequence
                                  gi|15661027|gb|BI698398.1|BI698398 Ts106
gi|15661027|gb|BI69
                      Ts106     Thellungiella salsuginea cDNA similar to alcohol                 alcohol dehydrogenase (AT1g77120)              02.6
  8398.1|BI698398
                                        dehydrogenase, mRNA sequence

                                gi|19855341|gb|BQ060391.1|BQ060391 Ts1084
gi|19855341|gb|BQ0
                      Ts1084    Thellungiella salsuginea cDNA similar to alcohol              alcohol dehydrogenase (ADH) (AT1g77120)           02.6
60391.1|BQ060391
                                       dehydrogenase, mRNA sequence

                                 gi|19913602|gb|BQ079243.1|BQ079243 Ts227
gi|19913602|gb|BQ0
                      Ts227     Thellungiella salsuginea cDNA similar to alcohol              alcohol dehydrogenase (ADH) (AT1g77120)           02.6
79243.1|BQ079243
                                        dehydrogenase, mRNA sequence
                                  gi|15661035|gb|BI698406.1|BI698406 Ts080
gi|15661035|gb|BI69
                      Ts080    Thellungiella salsuginea cDNA similar to long chain             putative acyl-CoA synthetase (At1g77590)         01.6
  8406.1|BI698406
                                     acyl-CoA synthetase, mRNA sequence

                                gi|19855147|gb|BQ060199.1|BQ060199 Ts1070
gi|19855147|gb|BQ0
                      Ts1070   Thellungiella salsuginea cDNA similar to long chain             putative acyl-CoA synthetase (At1g77590)         01.6
60199.1|BQ060199
                                     acyl-CoA synthetase, mRNA sequence

                                 gi|19855204|gb|BQ060255.1|BQ060255 Ts1225
gi|19855204|gb|BQ0
                      Ts1225    Thellungiella salsuginea cDNA similar to allergen,                  allergen, putative (At1g78040)              98
60255.1|BQ060255
                                            putative, mRNA sequence

                                 gi|15661380|gb|BI698751.1|BI698751 Ts111
gi|15661380|gb|BI69
                      Ts111    Thellungiella salsuginea cDNA similar to unknown            unknown protein, F-box protein family (At1g78100)    99
  8751.1|BI698751
                                    protein; 22671-23675, mRNA sequence

                                gi|19913567|gb|BQ079202.1|BQ079202 Ts1531
gi|19913567|gb|BQ0
                      Ts1531   Thellungiella salsuginea cDNA similar to expressed          unknown protein, F-box protein family (At1g78100)    99
79202.1|BQ079202
                                             protein, mRNA sequence
                                   gi|15661339|gb|BI698710.1|BI698710 Ts169
gi|15661339|gb|BI69
                       Ts169     Thellungiella salsuginea cDNA similar to unknown            unknown protein, F-box protein family (At1g78100)           99
  8710.1|BI698710
                                      protein; 22671-23675, mRNA sequence

                                   gi|15661522|gb|BI698893.1|BI698893 Ts322
gi|15661522|gb|BI69               Thellungiella salsuginea cDNA similar to 14-3-3-
                       Ts322                                                                   14-3-3 protein GF14 omega (grf2) (At1g78300)              10.0
  8893.1|BI698893                   LIKE PROTEIN GF14 OMEGA (GENERAL
                                   REGULATORY FACTOR 2), mRNA sequence

                                 gi|19684068|gb|BM985481.1|BM985481 10_C08_T
gi|19684068|gb|BM9                Ath Thellungiella halophila cDNA clone 10_C08_T
                      10_C08_T                                                         2,4-D-inducible glutathione S-transferase, putative (At1g78370)   11.4
85481.1|BM985481                     similar to (AJ012571) glutathione transferase
                                              [Arabidopsis thaliana], mRNA

                                 gi|19684488|gb|BM985822.1|BM985822 5_E02_T3
gi|19684488|gb|BM9                Ath Thellungiella halophila cDNA clone 5_E02_T3
                      5_E02_T3                                                                  glutathione transferase, putative (At1g78380)            11.4
85822.1|BM985822                 similar to Arabidopsis thaliana At1g78380/F3F9_11
                                                    mRNA, mRNA

                                 gi|19684539|gb|BM985873.1|BM985873 6_C01_T3
gi|19684539|gb|BM9                Ath Thellungiella halophila cDNA clone 6_C01_T3
                      6_C01_T3                                                           NAD-dependent epimerase/dehydratase family (At1g78570)          98
85873.1|BM985873                      similar to AC007260 - Arabidopsis thaliana
                                         chromosome I BAC T30F21 ,mRNA

                                 gi|19684612|gb|BM985946.1|BM985946 7_C03_T3
gi|19684612|gb|BM9                Ath Thellungiella halophila cDNA clone 7_C03_T3
                      7_C03_T3                                                           NAD-dependent epimerase/dehydratase family (At1g78570)          98
85946.1|BM985946                      similar to AC007260 - Arabidopsis thaliana
                                         chromosome I BAC T30F21 ,mRNA

                                  gi|10128308|gb|BE727012.1|BE727012 Sc0028
gi|10128308|gb|BE72              Thellungiella salsuginea cDNA similar to Similar to
                       Sc0028                                                                  dTDP-D-glucose 4,6-dehydratase (At1g78570)                01.5
  7012.1|BE727012                     dTDP-D-glucose 4,6-dehydratase, mRNA
                                                      sequence

gi|10172574|gb|BE75               gi|10172574|gb|BE758582.1|BE758582 Sc0123
                       Sc0123                                                          similar to dTDP-D-glucose 4,6-dehydratase (At1g78570), E=0.10     01.5
  8582.1|BE758582                 Thellungiella salsuginea cDNA, mRNA sequence

                                  gi|10172586|gb|BE758594.1|BE758594 Sc0133
gi|10172586|gb|BE75              Thellungiella salsuginea cDNA similar to Similar to
                       Sc0133                                                             similar to dTDP-D-glucose 4,6-dehydratase (At1g78570)          01.5
  8594.1|BE758594                     dTDP-D-glucose 4,6-dehydratase, mRNA
                                                      sequence

                                   gi|15661312|gb|BI698683.1|BI698683 Ts109
gi|15661312|gb|BI69
                       Ts109     Thellungiella salsuginea cDNA similar to dTDP-D-              dTDP-D-glucose 4,6-dehydratase (At1g78570)                01.5
  8683.1|BI698683
                                    glucose 4,6-dehydratase, mRNA sequence
                                  gi|19855237|gb|BQ060288.1|BQ060288 Ts1344
gi|19855237|gb|BQ0                Thellungiella salsuginea cDNA similar to dTDP-
                       Ts1344                                                       NAD-dependent epimerase/dehydratase family (At1g78570)   98
60288.1|BQ060288                      glucose 4,6-dehydratase, putative, mRNA
                                                     sequence
                                  gi|19855305|gb|BQ060355.1|BQ060355 Ts1407
gi|19855305|gb|BQ0                Thellungiella salsuginea cDNA similar to dTDP-
                       Ts1407                                                             dTDP-D-glucose 4,6-dehydratase (At1g78570)         01.5
60355.1|BQ060355                      glucose 4,6-dehydratase, putative, mRNA
                                                     sequence
                                  gi|19855317|gb|BQ060367.1|BQ060367 Ts1429
gi|19855317|gb|BQ0                Thellungiella salsuginea cDNA similar to dTDP-
                       Ts1429                                                        similar to dTDP-D-glucose 4,6-dehydratase (At1g78570)   01.5
60367.1|BQ060367                      glucose 4,6-dehydratase, putative, mRNA
                                                     sequence

                                   gi|15661310|gb|BI698681.1|BI698681 Ts185
gi|15661310|gb|BI69
                       Ts185     Thellungiella salsuginea cDNA similar to dTDP-D-         dTDP-D-glucose 4,6-dehydratase (At1g78570)         01.5
  8681.1|BI698681
                                    glucose 4,6-dehydratase, mRNA sequence

                                   gi|15661313|gb|BI698684.1|BI698684 Ts225
gi|15661313|gb|BI69
                       Ts225     Thellungiella salsuginea cDNA similar to dTDP-D-         dTDP-D-glucose 4,6-dehydratase (At1g78570)         01.5
  8684.1|BI698684
                                    glucose 4,6-dehydratase, mRNA sequence

                                   gi|15661311|gb|BI698682.1|BI698682 Ts370
gi|15661311|gb|BI69
                       Ts370     Thellungiella salsuginea cDNA similar to dTDP-D-         dTDP-D-glucose 4,6-dehydratase (At1g78570)         01.5
  8682.1|BI698682
                                    glucose 4,6-dehydratase, mRNA sequence

                                   gi|15661309|gb|BI698680.1|BI698680 Ts523
gi|15661309|gb|BI69
                       Ts523     Thellungiella salsuginea cDNA similar to dTDP-D-         dTDP-D-glucose 4,6-dehydratase (At1g78570)         01.5
  8680.1|BI698680
                                    glucose 4,6-dehydratase, mRNA sequence

                                   gi|15661314|gb|BI698685.1|BI698685 Ts573
gi|15661314|gb|BI69
                       Ts573     Thellungiella salsuginea cDNA similar to dTDP-D-         dTDP-D-glucose 4,6-dehydratase (At1g78570)         01.5
  8685.1|BI698685
                                    glucose 4,6-dehydratase, mRNA sequence

                                  gi|10172584|gb|BE758592.1|BE758592 Sc0122
gi|10172584|gb|BE75
                       Sc0122     Thellungiella salsuginea cDNA similar to Strong                 unknown protein (At1g78830)                99
  8592.1|BE758592
                                  similarity to glycoprotein EP1, mRNA sequence

                                  gi|10128312|gb|BE727016.1|BE727016 Sc0037
gi|10128312|gb|BE72                    Thellungiella salsuginea cDNA similar to
                       Sc0037                                                              putative latex-abundant protein (At1g79340)       13.16
  7016.1|BE727016                     hypothetical protein YUP8H12R.4, mRNA
                                                       sequence

                                 gi|19684065|gb|BM985480.1|BM985480 10_C06_T
gi|19684065|gb|BM9                Ath Thellungiella halophila cDNA clone 10_C06_T
                      10_C06_T                                                                   expressed protein (At1g79510)               99
85480.1|BM985480                      similar to AC007202 - Arabidopsis thaliana
                                    chromosome 1 BAC T8K14 sequence, mRNA
                                 gi|19684553|gb|BM985887.1|BM985887 6_D10_T3
gi|19684553|gb|BM9                Ath Thellungiella halophila cDNA clone 6_D10_T3
                      6_D10_T3                                                               expressed protein (At1g79510)           99
85887.1|BM985887                      similar to AC007202 - Arabidopsis thaliana
                                    chromosome 1 BAC T8K14 sequence, mRNA

                                  gi|10172578|gb|BE758586.1|BE758586 Sc0076
gi|10172578|gb|BE75                Thellungiella salsuginea cDNA similar to ESTs
                       Sc0076                                                                 unknown protein (At1g79510)            99
  8586.1|BE758586                gb|T22000 and gb|AA585765 come from this gene,
                                                  mRNA sequence

                                  gi|11457348|gb|BF440067.1|BF440067 Sc0119
gi|11457348|gb|BF44
                       Sc0119      Thellungiella salsuginea cDNA similar to ESTs              unknown protein (At1g79510)            99
  0067.1|BF440067
                                  gb|T22000 and gb|AA585765, mRNA sequence

                                     gi|15661340|gb|BI698711.1|BI698711 Ts122
gi|15661340|gb|BI69
                       Ts122      Thellungiella salsuginea cDNA similar to unknown            unknown protein (At1g79510)            99
  8711.1|BI698711
                                               protein, mRNA sequence
                                   gi|19855249|gb|BQ060300.1|BQ060300 Ts1357
gi|19855249|gb|BQ0
                       Ts1357    Thellungiella salsuginea cDNA similar to expressed          expressed protein (At1g79510)           99
60300.1|BQ060300
                                               protein, mRNA sequence
                                   gi|19913570|gb|BQ079211.1|BQ079211 Ts1539
gi|19913570|gb|BQ0
                       Ts1539    Thellungiella salsuginea cDNA similar to expressed          expressed protein (At1g79510)           99
79211.1|BQ079211
                                               protein, mRNA sequence
                                     gi|15661322|gb|BI698693.1|BI698693 Ts591
gi|15661322|gb|BI69
                       Ts591      Thellungiella salsuginea cDNA similar to unknown            unknown protein (At1g79510)            99
  8693.1|BI698693
                                               protein, mRNA sequence
                                     gi|15661323|gb|BI698694.1|BI698694 Ts598
gi|15661323|gb|BI69
                       Ts598      Thellungiella salsuginea cDNA similar to unknown            unknown protein (At1g79510)            99
  8694.1|BI698694
                                               protein, mRNA sequence
                                     gi|15661328|gb|BI698699.1|BI698699 Ts636
gi|15661328|gb|BI69                 Thellungiella salsuginea cDNA similar to ESTs
                       Ts636                                                                  unknown protein (At1g79510)            99
  8699.1|BI698699                gb|T22000 and gb|AA585765 come from this gene.,
                                                   mRNA sequence
                                     gi|15661464|gb|BI698835.1|BI698835 Ts951
gi|15661464|gb|BI69
                       Ts951      Thellungiella salsuginea cDNA similar to unknown            unknown protein (At1g79510)            99
  8835.1|BI698835
                                               protein, mRNA sequence
                                     gi|15661455|gb|BI698826.1|BI698826 Ts968
gi|15661455|gb|BI69
                       Ts968      Thellungiella salsuginea cDNA similar to unknown            unknown protein (At1g79510)            99
  8826.1|BI698826
                                               protein, mRNA sequence

                                   gi|15661209|gb|BI698580.1|BI698580 Ts524
                                   Thellungiella salsuginea cDNA similar to Is a
gi|15661209|gb|BI69              member of the PF|00162 Phosphoglycerate kinase
                       Ts524                                                          putative phosphoglycerate kinase (At1g79550)   01.5
  8580.1|BI698580                family. ESTs gb|N38721, gb|T22178, gb|R90345,
                                  gb|R90715, gb|T21140, gb|T46295, gb|H37082,
                                           gb|T46076,, mRNA sequence
                                    gi|15661258|gb|BI698629.1|BI698629 Ts325
gi|15661258|gb|BI69
                       Ts325      Thellungiella salsuginea cDNA similar to receptor                unknown protein (At1g79620)                 99
  8629.1|BI698629
                                        protein kinase-like, mRNA sequence

                                    gi|15661103|gb|BI698474.1|BI698474 Ts326
gi|15661103|gb|BI69
                       Ts326          Thellungiella salsuginea cDNA similar to )                   unknown protein (At1g79620)                 99
  8474.1|BI698474
                                             F20B17.5, mRNA sequence

                                 gi|19684015|gb|BM985462.1|BM985462 10_A03_T
gi|19684015|gb|BM9                Ath Thellungiella halophila cDNA clone 10_A03_T
                      10_A03_T                                                                 MutT/nudix family protein (At1g79690)           98
85462.1|BM985462                    similar to gb|AC010793.3|AC010793 genomic
                                            sequence for A.thaliana, mRNA

                                 gi|19684500|gb|BM985834.1|BM985834 5_F06_T3
gi|19684500|gb|BM9                Ath Thellungiella halophila cDNA clone 5_F06_T3
                      5_F06_T3                                                                 MutT/nudix family protein (At1g79690)           98
85834.1|BM985834                    similar to (AC010793) F20B17.11 [A.thaliana],
                                                          mRNA
                                     gi|15661426|gb|BI698797.1|BI698797 Ts710
gi|15661426|gb|BI69
                       Ts710      Thellungiella salsuginea cDNA similar to unknown                 unknown protein (At1g79690)                 99
  8797.1|BI698797
                                                protein, mRNA sequence
                                     gi|15661156|gb|BI698527.1|BI698527 Ts584
gi|15661156|gb|BI69              Thellungiella salsuginea cDNA similar to KRAB-zinc
                       Ts584                                                                     hypothetical protein (AAF68111.1)             99
  8527.1|BI698527                   finger protein SZF1-1 [Homo sapiens], mRNA
                                                        sequence

                                 gi|19684366|gb|BM985700.1|BM985700 3_F06_T3
gi|19684366|gb|BM9
                      3_F06_T3    Ath Thellungiella halophila cDNA clone 3_F06_T3     similar to heat-shock proteins GB:CAA94389 (At1g79930)   11.1
85700.1|BM985700
                                 similar to A.t. mRNA for heat-shock protein, mRNA

                                 gi|19684695|gb|BM986029.1|BM986029 8_D10_T3
gi|19684695|gb|BM9                Ath Thellungiella halophila cDNA clone 8_D10_T3
                      8_D10_T3                                                                  nodulin-related protein (At1g80530)            99
86029.1|BM986029                      similar to (AC018849) nodulin-like protein
                                                  [A.thaliana], mRNA

                                 gi|19684773|gb|BM986107.1|BM986107 9_E07_T3
gi|19684773|gb|BM9                Ath Thellungiella halophila cDNA clone 9_E07_T3
                      9_E07_T3                                                                  nodulin-related protein (At1g80530)            99
86107.1|BM986107                      similar to (AC018849) nodulin-like protein
                                            [Arabidopsis thaliana], mRNA

                                  gi|19855144|gb|BQ060196.1|BQ060196 Ts1066
gi|19855144|gb|BQ0
                       Ts1066     Thellungiella salsuginea cDNA similar to nodulin-             putative nodulin protein (At1g80530)           98
60196.1|BQ060196
                                            like protein, mRNA sequence

                                   gi|16004592|gb|BI851105.1|BI851105 Ts1046
gi|16004592|gb|BI85               Thellungiella salsuginea cDNA similar to CCR4-      putative CCR4-associated factorCCR4-associated factor
                       Ts1046                                                                                                                  04.4
  1105.1|BI851105                  associated factor, putative\0CCR4-associated                           (At1g80780)
                                         factor, putative, mRNA sequence
                                 gi|15661051|gb|BI698422.1|BI698422 Ts529
gi|15661051|gb|BI69                 Thellungiella salsuginea cDNA similar to   putative CCR4-associated factorCCR4-associated factor
                      Ts529                                                                                                            04.4
  8422.1|BI698422             gb|U21855 CCR4-associated factor 1 (CAF1) from                       (At1g80780)
                                       Mus musculus, mRNA sequence
Closest At
            Funct.     remarks (in
homolog (if
            Cat.        progress)
applicable)

                     also: protein kinase,
  6.00E-71   04.4    putative,At3g57770,
                         e=.41; 96%


                      also: At3g57770,
  6.00E-71   04.4       protein kinase,
                     putative, e=.41; 96%




 At1g01230    99




 At1g01250   04.0



 At1g01720   15.0




 At1g01720   15.0




 At1g01720   15.0




 At1g01730    99




 At1g01800    98
At1g01800   98




At1g01800   98




At1g01800   98




At1g01800   98




At1g01960   99




At1g01960   99




At1g02280   99




At1g02710   99



At1g03400   03.7



At1g03410   03.7



At1g03410   03.7
At1g03410   03.7



At1g03410    3.7



At1g03600   02.10



At1g03610    99




At1g04480   05.1




At1g04480   05.1



At1g06430   06.5




At1g06430   06.5




At1g06430   06.5




At1g06430   06.5




At1g06570   01.0    only bp 2-46
                   no good blastX
At1g06890   99
                       result




At1g07040   99




At1g07590   99




At1g07890   11.4




At1g07890   11.4




At1g07890   11.4




At1g07940   05.2




At1g08370   99




At1g08370   99



At1g08370   99



At1g09070   99
At1g09310   99     85 ESTs




At1g09310   99



At1g09310   99




At1g09310   99




At1g09310   99




At1g09340   04.4




At1g09590   05.1




At1g09590   05.1



At1g09590   05.1



At1g09690   05.1




At1g09690   05.1
At1g09795   01.1


At1g10090   99



At1g10590   99     13 ESTs   full length




At1g10590   99




At1g10590   99




At1g10590   99




At1g10590   99



At1g10590   99



At1g11060   99




At1g11260   07.3




At1g11840   02.8
At1g11840   02.8




At1g11840   02.8




At1g11910   06.5




At1g12090   99



At1g12090   98



                     5 ESTs-2 root-2     3 ESTs OK, ATG,
At1g12200   99
                       dehydration            89%



At1g12200   99


At1g12200   99


At1g12200   99



At1g12240   01.5



                   4 ESTs-flower stress     OK 93%, in
At1g12450   99
                           mix          chloroplast/prokar.
At1g12450   99




At1g12780   01.5




At1g12840   07.8   e-174, 93%




At1g13170   99




At1g13440   02.1




At1g13440   02.1




At1g13440   02.1




At1g13440   02.1
At1g13440   02.1




At1g13440   02.1




At1g13440   02.1




At1g13930   99




At1g14400   06.5




At1g14460   99



At1g15030   99


At1g15340   99         22 EST         heat shock 90


At1g15340   99
                   MBD:IPR001739(1)


At1g15350   99




At1g15380   02.8
At1g15380   02.8




At1g16080   99         13 ESTs          full length




                   TrkA_Kuptake:IPR0   possible K+-
At1g16080   99
                        06036(2)       transporter?
                   ApbA:IPR003710(1)


At1g16080   99




At1g16080   99




At1g16560   99




At1g16810   99




At1g17100   98


At1g17340   99


At1g17490   99


At1g18730   99
At1g19110   99



At1g19130   99          9 ESTs




At1g19130   99



At1g19130   99




At1g19180   99




At1g19380   99          4 ESTs                 OK


At1g19380   99


                                        OK 89% At 2 close
At1g19740   99          8 ESTs                genes,
                                        chloroplast/prokar.

                    ATP-dependent
At1g19740   99     protease La (LON)
                        domain

At1g19740   99



                     vacuolar ATP
At1g20260   02.4
                   synthase subunit B
At1g20340   02.4




At1g20410   99



                                  At Cor (40) and
At1g20440   11.1
                                    ERD10(50)



At1g20440   11.1


                                Th 2 genes also but
At1g20440   11.1   2e-29, 81%    42- 46 aa % wiTh
                                       boTh



At1g20440   11.1



                                   It is ERD most
At1g20440   11.1                highly expressed in
                                          Thel


At1g20440   11.1




At1g20440   11.1




At1g20440   11.1
At1g20450   99     dehydrin (ERD10)      52% aa




At1g20450   99      Thel has 8 ESTs



                   4 ESTs of this type
At1g20620   11.4
                        cat 3




At1g20620   11.4    11cat of this type




At1g20620   11.4




At1g20620   11.4




At1g20620   11.4




At1g20620   11.4




At1g20620   11.4



At1g20620   11.4
At1g20620   11.4


At1g20620   11.4


At1g20620   11.4


At1g20620   11.4


At1g20620   11.4


At1g20620   11.4


At1g20620   11.4


At1g20620   11.4


At1g20620   11.4



At1g21670   99     12 ESTs   87%, OK




At1g21670   99               72% aa




At1g21750   06.1




At1g21900   99
At1g22050   06.5



At1g22050   99



                                  OK, 89%, H.
At1g22270   99     4 ESTs root
                                 sapiens PC152




At1g22270   99




At1g22610   99




At1g22840   02.4




At1g22910   98




At1g23310   01.1




At1g23740   98



At1g25260   99
At1g25275   99     OK, 89%




At1g25275   99




At1g27130   11.4




At1g27130   11.4




At1g27130   11.4



At1g27130   11.4



At1g27290   99



At1g27350   99


At1g27435   99


At1g27560   99




At1g28190   99
At1g28250   99           4 ESTs              OK, 87%


                                         68% aa full length
At1g28250   99      flower-stress -mix
                                            102 aa prt


At1g28250   99



At1g28280   99     P_rich_extensn:IPR        OK, 85 %
                       002965(3?)


At1g28280   99



At1g28330   98




At1g28330   98




At1g29150   06.5




At1g29150   06.5


                   end of protein 42%
At1g29370   99                            1 B. napus EST
                           aa


At1g29395   99




At1g29850   98
At1g29850    98




At1g29850    98




At1g29920   02.10




At1g29920    99




At1g29920   02.10




At1g29920   02.10




At1g29920   02.10




At1g29930   02.10




At1g29930   02.10
At1g29930   02.10




At1g29930   02.10




At1g29930   02.10




At1g29930   02.10




At1g29930   02.10




At1g29930   02.10



At1g29930   02.10



At1g29930   02.10




At1g29930   02.10




At1g29930   02.10
At1g29930   02.10




At1g29930   02.10




At1g29930   02.10




At1g30210    98




At1g30230   05.2



At1g30260    99


At1g30820   01.3


                                          start at 365bp
                    ParBc:IPR003115
At1g31170    99                         attached to lamin,
                          (2)
                                            full length


                                        chloroplast/prokar.,
At1g31170    99
                                            H. sapiens


                    1 EST-dehydration
At1g31170    99
                       rehydration


At1g31170    99
At1g31170   99


At1g31580   99




At1g31817   05.1




At1g32350   98




At1g32350   98




At1g33590   98




At1g33690   99     66% aa KH domain




At1g33690   99          8ESTs



At1g34030   05.1




At1g34030   05.1




At1g34570   99
At1g35340   99     5ESTs        OK 87%




At1g35340   99



At1g35680   05.1



                                 putative
At1g42690   99     no EST   transposase from
                                  232bp




At1g42690   99




At1g42690   99




At1g43580   99




At1g47128   06.5




At1g47128   06.5




At1g47128   06.5
At1g47128   06.5




At1g47128   06.5




At1g49140   02.4




At1g49500   99




At1g49700   99




At1g50480   01.5



At1g50740   99



                   At 4-5 ESTs end of
At1g51140   98
                         protein



At1g51140   98



At1g51580   98




At1g51580   98
At1g51580   98




At1g51680   01.8




At1g51680   01.8




At1g51680   01.8




At1g51680   01.8




At1g52140   99




                                  from 232 bp, only
At1g52565   99     1 EST flower
                                      At, 88%




At1g52565   99



                                  protein starts at
At1g52565   99
                                       438??


At1g52740   13.9
At1g53170   11.1




At1g53170   11.1




At1g53170   11.1




At1g53170   11.1




At1g53310   01.5



At1g53310   01.5



At1g53580   02.8




At1g53670   04.0




At1g54030   02.9




At1g54220   02.11
At1g54290   05.2




At1g54440   99               OK, 92%; 1 EST




At1g54440   99




At1g54440   99



At1g54710   99




At1g55840   08.4




At1g55840   08.4




At1g55840   98



                              OK 88%, 1 At
At1g56580   99     20 ESTs
                              related gene


At1g56580   99
At1g56580   99




At1g56600   11.1




At1g56600   11.1




At1g56600   11.1



At1g56600   11.1



At1g58270   99




At1g58380   05.1




At1g60140   01.5




At1g60140   01.5



At1g60420   99




At1g60700   99
At1g60950   11.4




At1g60950   11.4




At1g60950   11.4




At1g61180   11.3




At1g61360   99



At1g62480   99     80 ESTs


At1g62480   99



At1g62570   01.1




At1g62570   01.1



At1g62600   01.8




At1g63940   11.4
At1g63940   11.4




At1g63940   11.4




At1g64060   02.4




At1g64370   99     At: 22 ESTs   Thel has 17 ESTs




At1g64370   99                         aa 49%




At1g64370   99                     only37-135 At




                                 Thel presents a 19
At1g64370   99                   aa addition which is
                                  not present in At


                                   B. napus also
At1g64370   99                   presents a change
                                      in region


At1g64370   99


At1g64370   99
At1g64370   99


At1g64370   99


At1g64370   99



At1g64370   99




At1g64370   99




At1g64370   99




At1g64370   99




At1g64370   99



At1g64370   99



At1g64440   01.5



At1g64620   04.0



At1g64620   04.0
At1g64620   04.0



At1g64720   98




At1g64890   99




At1g65980   11.4




At1g66250   98




At1g67090   01.5




At1g67090   01.5




At1g67090   01.5




At1g67490   01.5




At1g67490   01.5
At1g67490   01.5


                    wrong annotation;    very weak homol. at
At1g67645   99      not At1g67645 at        EST level (for
                     nucleotide level          length)


At1g67645   99      Thel has 9 ESTs          F box type        At 8 ESTs; dehydration



                   At1g27540 with only
At1g67645   99                              3 ESTs in At
                       52% identity



At1g67645   99



At1g67645   99



At1g67645   99




At1g68530   01.6




At1g68530   01.6




At1g68530   01.6
At1g68530   01.6




At1g68530   01.6




At1g68530   01.6




                              possibly
At1g69030   99     4 ESTs
                            At1g26300?




At1g69030   99               OK, 86%



At1g69295   99



At1g69410   05.3




At1g69620   05.1




At1g69870   07.5




At1g69870   07.5
At1g69870   06.5        2.00E-60




At1g69920   11.4




At1g70300   12.0




At1g70620   99



At1g70870   99




At1g71030   04.0




                   3 ESTs -dehydration   OK, 90% At 3 rel
At1g71900   99
                          root           genes H. sapiens


                                         purine permease -
At1g71900   99
                                               related



                                         only from195-265
At1g71980   99          19 ESTs
                                             bp with At




                    zinc finger, C3HC4
At1g71980   99
                            type
At1g71980   99     artifact?-no ORF




At1g71980   99     no blastX results




At1g72370   05.1




At1g72780   99


At1g73260   06.5



At1g74050   05.1




At1g74470   01.6




At1g74920   11.1



At1g75380   11.3


At1g75420   99


At1g75950   10.0


At1g76150   99
At1g76200   11.1




At1g76590    99



At1g76930    99



At1g77090   02.10



AT1g77120   02.6



AT1g77120   02.6



AT1g77120   02.6


At1g77590   01.6



At1g77590   01.6



At1g78040    98



At1g78100    99     20 ESTs      OK


                              related to
At1g78100    99
                              At1g22220
At1g78100   99




At1g78300   10.0




At1g78370   11.4




At1g78380   11.4




At1g78570   98




At1g78570   98




At1g78570   01.5



At1g78570   01.5



At1g78570   01.5




At1g78570   01.5
At1g78570    98




At1g78570   01.5




At1g78570   01.5




At1g78570   01.5




At1g78570   01.5




At1g78570   01.5




At1g78570   01.5




At1g78570   01.5




At1g78830    99




At1g79340   13.16




At1g79510    99     5 ESTs   OK, 85%
                   root - dehydration   closely related to
At1g79510   99
                      rosette+deh          At1g16320




At1g79510   99                          chloroplast/prokar.




At1g79510   99                            13 Thel ESTs



At1g79510   99                           also At2g46220


At1g79510   99


At1g79510   99


At1g79510   99


At1g79510   99



At1g79510   99



At1g79510   99


At1g79510   99




At1g79550   01.5
                   leucine-rich repeat
                     transmembrane
At1g79620   99                              OK, 91%
                     protein receptor
                         kinase,

                                         At-3 members in
At1g79620   99          2 ESTs
                                              family



At1g79690   98




At1g79690   98



At1g79690   99


                   only 21 aa of 1 zn
At1g79780   99     protein no EST or
                    protein from At


At1g79930   11.1




At1g80530   99




At1g80530   99




At1g80530   98




At1g80780   04.4                          atg at 177bp
At1g80780   04.4
                      gi|15661110|gb|BI698481.1|
                      BI698481 Ts61 Thellungiella
                                                          Homo sapiens BAC clone RP11-768F19 from 2,
           Ts61       salsuginea cDNA similar to ATCCTAACAAAAACAAGATAAGCTTAGCTTTTAAGCAGGCCTGGAGAAGTTACCTT
gi|15661110|gb|BI698481.1|BI698481
                                                                           E=.020
                      probable G protein-coupled
                      receptor, mRNA sequence


                      gi|16004598|gb|BI851111.1|
                      BI851111 Ts1134
                                                         Homo sapiens BAC clone RP11-468N14 from 4,
           Ts1134     Thellungiella
gi|16004598|gb|BI851111.1|BI851111salsuginea     ATCACAGGAGAGTTCGCCCTAACTCTTTTCTCCCAGGCACATTTACCCAGGCAGC
                                                                          E=.023
                      cDNA similar to Ig lambda
                      light chain, mRNA sequence

                      gi|15661440|gb|BI698811.1|
                      BI698811 Ts732
                      Thellungiella salsuginea
                                                            Homo sapiens chromosome 5 clone RP11-
           Ts732      cDNA similar
gi|15661440|gb|BI698811.1|BI698811 to hypothetical GCGAGACAGAAACGTGAGGCTATAATTTCCTTCACATCTACAATTTCATTTCTCCTC
                                                                        125H10, E=.18
                      protein F14B6.5 -
                      Caenorhabditis elegans,
                      mRNA sequence

                      gi|16004612|gb|BI851125.1|
                      BI851125 Ts972
                      Thellungiella salsuginea
                                                          Escherichia coli K12 MG1655 section 72 of 400
                      cDNA similar to Probable
           Ts972
gi|16004612|gb|BI851125.1|BI851125                        of the complete genome, E=0.0 looks like pure
                                                 CCACCACTTCCGCTTCCTGAATCTCCCGACGAGCGACAAAAAACGGGCATTCACG
                      ATP-dependent helicase
                                                                               vector
                      ding (DNA-damage-
                      inducible protein G), mRNA
                      sequence
                      gi|16004586|gb|BI851099.1|
                      BI851099 Ts1031
                      Thellungiella salsuginea
                                                         Escherichia coli K12 MG1655 section 74 of 400
                      cDNA similar to
           Ts1031
gi|16004586|gb|BI851099.1|BI851099                        of the complete genome, E=0.0 probably pure
                                                 TGCTGAACGAGCGTGACAGCACCATGATCATCATCTCCGCACGACCGTTCACTTC
                      HYPOTHETICAL ABC
                                                                              vector
                      TRANSPORTER ATP-
                      BINDING PROTEIN YBIT,
                      mRNA sequence
                      gi|15661029|gb|BI698400.1|
                      BI698400 Ts478
                      Thellungiella salsuginea
                                                         Escherichia coli K12 MG1655 section 74 of 400
                      cDNA similar to
           Ts478
gi|15661029|gb|BI698400.1|BI698400                        of the complete genome, E=0.0, many vector
                                                 TGCTGAACGAGCGGGACAGGACCATGATCATCATCTCCGCACGACCGTCACTTCC
                      HYPOTHETICAL ABC
                                                                matches, no arabidopsis matches
                      TRANSPORTER ATP-
                      BINDING PROTEIN YBIT,
                      mRNA sequence
                     gi|19913600|gb|BQ079241.
                     1|BQ079241 Ts084
                                                      Escherichia coli genomic sequence of minutes 9
           Ts084     Thellungiella salsuginea
gi|19913600|gb|BQ079241.1|BQ079241            CCTCGTGCCGGGGTCAAACCTGGCGGCTTTTTTATGGCATTAAAAAGCCCCGCCG
                                                               to 12, E=0.0, no Arabadopsis
                     cDNA similar to Unknown
                     protein, mRNA sequence
                     gi|19855264|gb|BQ060314.
                     1|BQ060314 Ts1280
                                                        Expression vector pExchange 2, complete
           Ts1280    Thellungiella salsuginea
gi|19855264|gb|BQ060314.1|BQ060314            CCAAGGCTCCTTCAGGCCCCTCAGTCCTCACAGTCTGTTCCTGATCCTAATCAGC
                                                            sequence, E=0.0, no Arabadopsis
                     cDNA similar to ORF,
                     mRNA sequence
                     gi|19855345|gb|BQ060395.
                     1|BQ060395 Ts1090
                     Thellungiella salsuginea
                                                           Chlamys farreri clone iolscfcl363ct379cn399
           Ts1090    cDNA similar to
gi|19855345|gb|BQ060395.1|BQ060395 B.             CCTCGTGCCGAATCGGCACGAGGGTTTGTAACTTCAACCTTAGGAAGTTTTTCTCT
                                                                ribosomal protein S20, E=0.002
                     burgdorferi predicted coding
                     region BB0212, mRNA
                     sequence
                      gi|15661049|gb|BI698420.1|
                      BI698420 Ts149
                      Thellungiella salsuginea
                                                           Mus musculus chromosome 6 clone RP23-
           Ts149      cDNA similar
gi|15661049|gb|BI698420.1|BI698420 to brain-     CCTCGTGATAACATATTCCAAAGGAAATCTCTCTTTCTCACTCTCTCTTCGTCTCCA
                                                               208N9 strain C57BL6/J, E=0.002
                      enriched guanylate kinase-
                      associated, mRNA
                      sequence

                     gi|19855318|gb|BQ060368.
                     1|BQ060368 Ts1432
                     Thellungiella salsuginea                Homo sapiens chromosome 5 clone CTC-
           Ts1432
gi|19855318|gb|BQ060368.1|BQ060368                AAAAAAAATCTTTTGTGGTATGGAGAGGAGATCGCACGGGGTGATTATTATTTTTT
                     cDNA similar to pregnancy                 550M4, complete sequence, E=0.004
                     specific beta-1-glycoprotein
                     2, mRNA sequence

                      gi|10172575|gb|BE758583.1
                      |BE758583 Sc0129
           Sc0129
gi|10172575|gb|BE758583.1|BE758583                        Homo sapiens 12 BAC RP11-515A6, E=0.007
                                                 GTCTCGAGTTTTTTTTTTTTTTTTTTGAAAGAGAAGAAAAATATATTGAAGAATGTAT
                      Thellungiella salsuginea
                      cDNA, mRNA sequence
                      gi|16004580|gb|BI851093.1|
                      BI851093 Ts1017
                                                         Danio rerio calcium channel, voltage-dependent,
           Ts1017     Thellungiella
gi|16004580|gb|BI851093.1|BI851093salsuginea     GATTAACCCATCCAATGTCAAGACTGTTCTGGCCCGGTGTGGTGCTAACACTCCC
                                                           L type, alpha 1C subunit (cacna1c), E=0.015
                      cDNA similar to unknown
                      protein, mRNA sequence

                     gi|19684594|gb|BM985928.
                     1|BM985928 7_A04_T3 Ath
                     Thellungiella halophila
                                                          Pyrococcus abyssi complete genome; segment
           7_A04_T3 cDNA clone 7_A04_T3
gi|19684594|gb|BM985928.1|BM985928                GGCACGAGGCCTTGTTACTGGTTTTTATCAAGAAAAAAAAATTATAAGTCAATTCAC
                                                                         3/6, E=0.017
                     similar to Pyrococcus abyssi
                     complete genome; segment
                     3/6, mRNA

                      gi|15661227|gb|BI698598.1|
                      BI698598 Ts461
                      Thellungiella salsuginea              Homo sapiens BAC clone CTD-3220I23 from 2,
           Ts461
gi|15661227|gb|BI698598.1|BI698598                  GTGACCAACAAACGTAGAAGCAAGATGGGGTCGGCTAAAGCCTCTCCTTCCGTGA
                      cDNA similar to putative cell                         E=0.020
                      division control protein,
                      mRNA sequence

                      gi|15661515|gb|BI698886.1|
                      BI698886 Ts878
                      Thellungiella salsuginea              Mus musculus chromosome 17 clone RP24-
           Ts878
gi|15661515|gb|BI698886.1|BI698886                 GACGAGTAAGAGCGAGAGGGGAGAGAAATAGAGGAGAATCTCTCAAATTCTGGG
                      cDNA similar to hypothetical                      96P15, E=0.022
                      protein W09C3.3, mRNA
                      sequence
                     gi|10172580|gb|BE758588.1
                     |BE758588 Sc0080
                     Thellungiella salsuginea            Mus musculus chromosome X clone RP21-
           Sc0080
gi|10172580|gb|BE758588.1|BE758588             GTTCTTCTTCTTCTTCTCGTGTTTCCACATGGCGAACAAAGGGAGCTCCAGAAACT
                     cDNA similar to pathogen-                      124C16, E=0.026
                     inducible protein CXc750
                     precursor, mRNA sequence

                     gi|10172537|gb|BE758545.1
                     |BE758545 Sc0097
                                                          Human DNA sequence from clone RP11-440G5
           Sc0097    Thellungiella salsuginea
gi|10172537|gb|BE758545.1|BE758545                CAAAAAAAAAAATACACAACAATTTCCCAAAACAGCTAAATTCGAATCTCTCTTTCT
                                                                 on chromosome 9, E=0.032
                     cDNA similar to hypothetical
                     protein, mRNA sequence

                      gi|10172573|gb|BE758581.1
                      |BE758581 Sc0117
           Sc0117
gi|10172573|gb|BE758581.1|BE758581                         Homo sapiens 3 BAC RP11-744G4, E=0.033
                                                 GTAAACCGCCACCAAACCGAAAGAGGAAAAAAACAGTAATAGTGTGTGCATTTTTT
                      Thellungiella salsuginea
                      cDNA, mRNA sequence
                      gi|19913564|gb|BQ079199.
                      1|BQ079199 Ts1523
                                                            Candida glabrata complete mitochondrial
           Ts1523     Thellungiella salsuginea
gi|19913564|gb|BQ079199.1|BQ079199               ACAAACCTTACCTCCCAAAACGATGCAAAAAAAAAAACAAAAAAACAAAAATTGTG
                                                                       genome, E=0.034
                      cDNA similar to ymf74,
                      mRNA sequence
                      gi|15661169|gb|BI698540.1|
                      BI698540 Ts526
                                                           Mus musculus chromosome 16 clone RP24-
           Ts526      Thellungiella
gi|15661169|gb|BI698540.1|BI698540salsuginea     CTTTTTCACTCTCTTCATCCGAACATCTCCACCGGAATCGTTCACCGTTAATCGGA
                                                                        405F4, E=0.036
                      cDNA similar to LAMIN A,
                      mRNA sequence

                     gi|19913603|gb|BQ079244.
                     1|BQ079244 Ts242
                     Thellungiella salsuginea               Rattus norvegicus phosphatidylinositol-4-
           Ts242     cDNA similar to
gi|19913603|gb|BQ079244.1|BQ079244 Similar to              phosphate 5-kinase, type II, alpha (Pip5k2a),
                                                  GAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTGGATAACAAACTTGCCT
                     ribosomal protein L30, clone                   E=0.040, no arabadopsis
                     MGC: 4467IMAGE:
                     2961149, mRNAsequence

                      gi|15661171|gb|BI698542.1|
                      BI698542 Ts336
                                                             Mus musculus chromosome 16 clone RP24-
           Ts336      Thellungiella
gi|15661171|gb|BI698542.1|BI698542salsuginea       CTTTTTCACTCTCTTCATGCGAACATCTCCACCGGAATCGTTCACCGTTAATCGGA
                                                                         405F4, E=0.042
                      cDNA similar to LAMIN A,
                      mRNA sequence
                      gi|11457342|gb|BF440061.1
                      |BF440061 Sc0040                       Homo sapiens PAC clone RP4-603O16 from
           Sc0040
gi|11457342|gb|BF440061.1|BF440061                 CTCCCTCTCACATCTCCTCTCTGATTCTTCGCCTTTGGAAAAGTAAACAGAAAAAG
                      Thellungiella salsuginea                          7q31-q35, E=0.046
                      cDNA, mRNA sequence
                      gi|15661170|gb|BI698541.1|
                      BI698541 Ts398
                                                             Mus musculus chromosome 16 clone RP24-
           Ts398      Thellungiella
gi|15661170|gb|BI698541.1|BI698541salsuginea       CTTTTTCACTCTCTTCATCCGAACATCTCCACCGGAATCGTTCACCGTTAATCGGA
                                                                         405F4, E=0.055
                      cDNA similar to LAMIN A,
                      mRNA sequence
                      gi|10172566|gb|BE758574.1
                      |BE758574 Sc0070                      Drosophila melanogaster AT31848 full insert
           Sc0070
gi|10172566|gb|BE758574.1|BE758574                 CCTCGNGCCGAACTCGGCACGAGGCGAATCGTAGCGGCTGCGATCTCCGAGGA
                      Thellungiella salsuginea                           cDNA, E=0.068
                      cDNA, mRNA sequence
                     gi|10172565|gb|BE758573.1
                     |BE758573 Sc0064                  Human DNA sequence from clone RP11-437J19
           Sc0064
gi|10172565|gb|BE758573.1|BE758573             CTCAAAAAGTGTGACTCGCACTAAAGACTCACTATTGACTCGTTAATCGGCGAGAG
                     Thellungiella salsuginea                  on chromosome 6, E=0.079
                     cDNA, mRNA sequence

                     gi|19684256|gb|BM985590.
                     1|BM985590 1_H07_T3 Ath
                     Thellungiella halophila             Buchnera aphidicola str. Bp (Baizongia
           1_H07_T3 cDNA clone 1_H07_T3
gi|19684256|gb|BM985590.1|BM985590                      pistaciae), section 2 of 2 of the complete
                                              GGCACGAGGTGGTTCTCTCTGAAAATCTTATATTTTTTTATTGAAAAAAAAATGTAA
                     similar to Arabidopsis                         genome, E=0.082
                     thaliana chromosome 1
                     BAC T3M13 ,mRNA

                      gi|15661286|gb|BI698657.1|
                      BI698657 Ts631
                      Thellungiella salsuginea
           Ts631
gi|15661286|gb|BI698657.1|BI698657                          Homo sapiens X BAC RP11-699A7, E=0.088
                                                   AACACAACAAAACAAACCAGAAGCTTTTAATTTCATTTTTTGGTACTCAACAAAAAA
                      cDNA similar to Hypothetical
                      protein F40E12.2, mRNA
                      sequence

                      gi|15661303|gb|BI698674.1|
                      BI698674 Ts367
                      Thellungiella salsuginea
                      cDNA similar to chromos
                      Human ome 14 DNA
           Ts367
gi|15661303|gb|BI698674.1|BI698674                         Homo sapiens 3 BAC RP11-510K16, E=0.12
                                                 TCTGTGAAAATTTTTTTCTTCACCACTCATCTATCTTCCTCAAGTATTCCTTCTTTGT
                      sequence BAC R-818K5 of
                      library RPCI-11 from
                      chromosome 14 of Homo
                      sapiens (Human), complete
                      sequence, mRNA sequence

                     gi|11457347|gb|BF440066.1
                     |BF440066 Sc0109                  Human DNA sequence from clone RP5-1092A3
           Sc0109
gi|11457347|gb|BF440066.1|BF440066             GATGGCGATTCGTACAGAGATTGTTTTGGAGTTTATATCCGGTATAGCATTCGTGT
                     Thellungiella salsuginea                  on chromosome 1, E=0.16
                     cDNA, mRNA sequence

                      gi|15661396|gb|BI698767.1|
                      BI698767 Ts306
                                                           Homo sapiens novel C2H2 type zinc finger
           Ts306      Thellungiella
gi|15661396|gb|BI698767.1|BI698767salsuginea     AGCCTCGTGCCGAATTGGCACGAGGCTGCTGCTGAGACAACACCTTCGCCGATC
                                                                protein (MGC10715), E=0.22
                      cDNA similar to unknown,
                      mRNA sequence

                      gi|15661289|gb|BI698660.1|
                      BI698660 Ts484
                      Thellungiella salsuginea
           Ts484
gi|15661289|gb|BI698660.1|BI698660                          Homo sapiens 12q BAC RP11-324H9, E=0.22
                                                   GAGAAGCAGTCGGGTCCAGGGGCTTTGTCAGGGGGTGAAGTGCCCTCTCCACCG
                      cDNA similar to hypothetical
                      protein T24H24.17, mRNA
                      sequence

                      gi|15661476|gb|BI698847.1|
                      BI698847 Ts939
                      Thellungiella salsuginea
           Ts939      cDNA similar
gi|15661476|gb|BI698847.1|BI698847 to UDP-                Homo sapiens 12 BAC RP11-159A18, E=0.22
                                                 GGAGTAGAGACTTACCATCCTGGTCAAGTGACGGTCCAAGCAAGGGGCATTCCG
                      glycose:flavonoid
                      glycosyltransferase, mRNA
                      sequence
                     gi|19913646|gb|BQ079287.
                     1|BQ079287 Ts798
                     Thellungiella salsuginea          Homo sapiens ribosomal protein S6 kinase,
           Ts798
gi|19913646|gb|BQ079287.1|BQ079287            CCTCGTGCCGAATGGCACGAGGCTGCTGCTGAGACAACACCTTCGCCGATCTATT
                     cDNA similar to NADH               70kDa, polypeptide 2 (RPS6KB2), E=0.25
                     dehydrogenase subunit 4,
                     mRNA sequence

                     gi|10128304|gb|BE727008.1
                     |BE727008 Sc0016
                                                          Clostridium acetobutylicum ATCC824 section 75
           Sc0016    Thellungiella salsuginea
gi|10128304|gb|BE727008.1|BE727008                CTTTTCGGTGGAAAAAAAGCCTCGAGTTCTCTGGAGGCAATTTTCTTCTCCGAGAA
                                                              of 356 of the complete genome, E=0.26
                     cDNA similar to polyprotein,
                     mRNA sequence

                      gi|15661217|gb|BI698588.1|
                      BI698588 Ts76 Thellungiella
                                                           Homo sapiens chromosome 1 clone RP11-
           Ts76       salsuginea cDNA similar to GATGATGACTTTATGAGTCCGATGGTACCGCTTGGTTGTTTCTAGGCGAGACTCAT
gi|15661217|gb|BI698588.1|BI698588
                                                                       32I17, E=0.28
                      putative WD-repeat protein,
                      mRNA sequence

                      gi|15661111|gb|BI698482.1|
                      BI698482 Ts256
                      Thellungiella salsuginea              Mus Musculus Strain C57BL6/J chromosome 5
           Ts256
gi|15661111|gb|BI698482.1|BI698482                  GCAGGTGAAGCAACTCCTTGTGTCTCTGTTCCTATTGAAGTCAGGAATGCTCTAGA
                      cDNA similar to putative                      BAC, RP23-137N6, E=0.31
                      retroelement pol polyprotein,
                      mRNA sequence

                      gi|15661362|gb|BI698733.1|
                      BI698733 Ts423
                                                          Methanococcus jannaschii section 53 of 150 of
           Ts423      Thellungiella
gi|15661362|gb|BI698733.1|BI698733salsuginea     CGAAGGTTGTGTCTGCATAAGATCGGATTTGAAGGGATCTGCATTGGTCCTAGAT
                                                            the complete genome, E=0.32 best match
                      cDNA similar to UNKNOWN
                      PROTEIN, mRNA sequence

                     gi|19684786|gb|BM986120.
                     1|BM986120 9_G02_T3 Ath
                     Thellungiella halophila
                                                          Human DNA sequence from clone RP11-261A1
                     cDNA clone 9_G02_T3
           9_G02_T3
gi|19684786|gb|BM986120.1|BM986120                          on chromosome 13, complete sequence,
                                                  GGCACGAGGCGAAGGTTGTGTCTGCATAAGATCGGATTTGAAGGGATCTGCATTG
                     similar to Methanococcus
                                                                   E=0.56, no Arabadopsis
                     jannaschii section 53 of 150
                     of the complete genome,
                     mRNA

                     gi|10172583|gb|BE758591.1
                     |BE758591 Sc0100
                     Thellungiella salsuginea
           Sc0100    cDNA similar to                       Mus musculus clone RP23-151I7, E=0.6
gi|10172583|gb|BE758591.1|BE758591 hypothetical GTTTAAAAACCAAGCGAGTGAATGTCTTGGTGCGAATAATTCTGCAATGACTCGTT
                     protein P-5 - Chlamydia
                     trachomatis plasmid
                     pLGV440, mRNA sequence

                     gi|19855372|gb|BQ060422.
                     1|BQ060422 Ts1243
                                                       Human DNA sequence from clone RP1-242N11
           Ts1243    Thellungiella salsuginea
gi|19855372|gb|BQ060422.1|BQ060422            CTAAGATCTCAGAGATACAGAAATCAAGCTCTCGAGGATTCAAGTATTTACCAAGA
                                                           on chromosome 6p22.3-23, E=0.68
                     cDNA similar to SAG101,
                     mRNA sequence
                     gi|19855298|gb|BQ060348.
                     1|BQ060348 Ts1394
                                                          Drosophila melanogaster chromosome X section
                     Thellungiella salsuginea
           Ts1394
gi|19855298|gb|BQ060348.1|BQ060348                         55 of 74 of the complete sequence, E=0.95, no
                                                  GAGGATTGGGAAAGCAGAAACCCTATTTCACGAGGTGAAGATGATGAAGCACACG
                     cDNA similar to hypothetical
                                                                             Arabadopsis
                     protein XP_087623, mRNA
                     sequence

                      gi|16004605|gb|BI851118.1|
                      BI851118 Ts1144
                      Thellungiella salsuginea
                                                         Homo sapiens BAC clone RP11-731D1 from 4,
           Ts1144     cDNA similar
gi|16004605|gb|BI851118.1|BI851118 to VON        GAAGAGAGAGTAGAATCTTCTACCTCTAATGGGTGGCATCATCCTACCTGACCAG
                                                                          E=1.1
                      WILLEBRAND FACTOR
                      PRECURSOR (VWF),
                      mRNA sequence

                     gi|19913581|gb|BQ079222.
                     1|BQ079222 Ts1500
                                                            Homo sapiens chromosome 1 clone RP4-
           Ts1500    Thellungiella salsuginea
gi|19913581|gb|BQ079222.1|BQ079222                CTTTTCGGTGGAAAAAAAGCCTCGAGTTCTCTGGAGGCAATTTTCTTCTCCGAGAA
                                                              549L20, complete sequence, E=1.1
                     cDNA similar to polyprotein,
                     mRNA sequence

                     gi|10172576|gb|BE758584.1
                     |BE758584 Sc0130                   Mus musculus chromosome 15 clone RP23-
           Sc0130
gi|10172576|gb|BE758584.1|BE758584             GAGAGAGAGAGTAGAATCTTCTACCTCTAATGGTGGCATCATCCTACCTGACCAG
                     Thellungiella salsuginea                        354B8, E=1.3
                     cDNA, mRNA sequence
                     gi|10128294|gb|BE726998.1
                     |BE726998 Sc0001                  Human DNA sequence from clone RP11-14E8
           Sc0001
gi|10128294|gb|BE726998.1|BE726998             GGGAGCTGCTTTGGTCCTAGCCCTGTTAATCTTTGATTATCCTCTTTGTTCAGCCG
                     Thellungiella salsuginea                  on chromosome 1, E=1.4
                     cDNA, mRNA sequence

                     gi|19913622|gb|BQ079263.
                     1|BQ079263 Ts760
                                                        Rattus norvegicus phosphatidylinositol-4-
                     Thellungiella salsuginea
           Ts760
gi|19913622|gb|BQ079263.1|BQ079263                     phosphate 5-kinase, type II, alpha (Pip5k2a),
                                              GAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTTTTTTT
                     cDNA similar to Contains
                                                                E=1e-04, no arabidopsis
                     similarity to extensin
                     (atExt1), mRNA sequence

                      gi|15661435|gb|BI698806.1|
                      BI698806 Ts726
                                                           Human mariner-like element-containing mRNA,
           Ts726      Thellungiella
gi|15661435|gb|BI698806.1|BI698806salsuginea       GTCCCGAACNCTTGAACAGACGGCGTTNGGCGGAGNGGNCGACACTAGTGGATC
                                                                              E=1e-5
                      cDNA similar to hypothetical
                      protein, mRNA sequence

                     gi|20046887|gb|BQ087686.
                     1|BQ087686 Ts366
                     Thellungiella salsuginea                Myriophyllum heterophyllum small subunit
           Ts366     cDNA similar to                     ribosomal RNA gene, complete sequence, E=1e-
gi|20046887|gb|BQ087686.1|BQ087686 rRNA intron- GTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGNATACCGTC
                     encoded homing                                     71, no arabadopsis
                     endonuclease, mRNA
                     sequence
                      gi|15661074|gb|BI698445.1|
                      BI698445 Ts578
                      Thellungiella salsuginea             Homo sapiens BAC clone CTA-331C24 from
           Ts578
gi|15661074|gb|BI698445.1|BI698445               GTTTTTCCCTGCCTCTTCTGAGCGCAACGATGGGACCGNNNNNNNNNNNCTGAAA
                      cDNA similar to CG9411                             7q21, E=2.1
                      gene product, mRNA
                      sequence
                     gi|19913565|gb|BQ079200.
                     1|BQ079200 Ts1527
                     Thellungiella salsuginea           Homo sapiens chromosome 5 clone CTC-
           Ts1527
gi|19913565|gb|BQ079200.1|BQ079200            GGGAGCTGCTTTGGTCCTAGCCCTGTTAATCTTTGATTATCCTCTTTGTTCAGCCG
                     cDNA similar to putative                      540O12, E=2.3
                     transmembrane-transport
                     protein, mRNA sequence

                     gi|19684643|gb|BM985977.
                     1|BM985977 7_F09_T3 Ath
                     Thellungiella halophila
                                                       Pan troglodytes chromosome 7 clone RP43-
           7_F09_T3 cDNA clone 7_F09_T3
gi|19684643|gb|BM985977.1|BM985977            GGCACGAGGTTTGTGTGTTGCTTTATGTTGAATAACATCAATACTTTGGTTTATCCC
                                                            66C5, complete sequence, E=2.9
                     similar to Arabidopsis
                     thaliana chromosome 1
                     BAC F9N12 ,mRNA

                     gi|19913653|gb|BQ079294.
                     1|BQ079294 Ts814
                     Thellungiella salsuginea           Shuttle expression vector pBKCMV, E=2e-
           Ts814
gi|19913653|gb|BQ079294.1|BQ079294            GAGTACTTCTAGAGCGGCCGCGGGCCCATCGATTTTCCACCCGGGTGGGGTACC
                     cDNA similar to putative                   53,many vector sequences
                     ubiquitin carrier, mRNA
                     sequence

                      gi|15661402|gb|BI698773.1|
                      BI698773 Ts655
                      Thellungiella salsuginea            Escherichia coli genomic sequence of minutes 9
           Ts655
gi|15661402|gb|BI698773.1|BI698773               ATTCCATTAACATCCCACCGTAGCCGATAAAGCACGCCTGCCCTTCGTTCGCCAG
                      cDNA similar to (AE005239)              to 12, E=2e-96 no Arabidopsis match
                      carbon starvation protein,
                      mRNA sequence

                     gi|10128305|gb|BE727009.1
                     |BE727009 Sc0018                   Homo sapiens 3 BAC RP11-454C18, E=3e-5, no
           Sc0018
gi|10128305|gb|BE727009.1|BE727009             ATAAAATTGGGAACTATAATTTCCCTTTTTTATTAATTCGTTCGTGGTTTCAAATAAG
                     Thellungiella salsuginea                       Arabidopsis matches
                     cDNA, mRNA sequence
                     gi|19855331|gb|BQ060381.
                     1|BQ060381 Ts1461
                                                          Expression vector pExchange 2, complete
           Ts1461    Thellungiella salsuginea
gi|19855331|gb|BQ060381.1|BQ060381             TCTAATTGTTTGTGTATTTTAGATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAG
                                                            sequence, E=e-130, no Arabadopsis
                     cDNA similar to ORF,
                     mRNA sequence
                      gi|15661032|gb|BI698403.1|
                      BI698403 Ts156
                      Thellungiella salsuginea            E.coli genomic DNA, Kohara clone #304(34.6-
           Ts156      cDNA similar
gi|15661032|gb|BI698403.1|BI698403 to altronate           34.9 min.), E=e-168, many vector matches, no
                                                 CCTCGAGCCGAATTCAGATCGGTGTGCTCATTCAGGAGATCGATTTGTCAGTCAA
                      oxidoreductase                                   arabidopsis matches
                      (tagaturonate reductase ),
                      mRNA sequence

                      gi|15661349|gb|BI698720.1|
                      BI698720 Ts68 Thellungiella           Thermobacillus xylanilyticus xynA and abfA
           Ts68       salsuginea cDNA similar to GAGTACTTCTAGAGCGGCCGCGGGCCCATCGATTTTCCACCCGGGTGGGGTACC
gi|15661349|gb|BI698720.1|BI698720                        genes and ORF1, strain D3, Many matches, no
                      putative ubiquitin carrier,                    arabidopsis E=1e-24
                      mRNA sequence
                      gi|15661229|gb|BI698600.1|
                      BI698600 Ts006
                                                            Thermobacillus xylanilyticus xynA and abfA
                      Thellungiella salsuginea
           Ts006
gi|15661229|gb|BI698600.1|BI698600                           genes and ORF1, strain D3, many vector
                                                 AATCGCTGAGAGATCAGCCTCCACTGCATCTCGAAAAGCTTCGAACAGAGCTCCT
                      cDNA similar to putative
                                                                              matches
                      ubiquitin carrier, mRNA
                      sequence
                      gi|10128299|gb|BE727003.1
                      |BE727003 Sc0010                    Shuttle expression vector pBKCMV, many vector
           Sc0010
gi|10128299|gb|BE727003.1|BE727003               CTTTTGTTTGGAACAGCATATGTCTCAGAGACCTCAAGTTCCTCATTCTTCCTCAAT
                      Thellungiella salsuginea                    matches, no arabidopsis matches
                      cDNA, mRNA sequence
                      gi|10172561|gb|BE758569.1
                      |BE758569 Sc0163
                      Thellungiella salsuginea            Shuttle expression vector pBKCMV, many vector
           Sc0163
gi|10172561|gb|BE758569.1|BE758569               GAGTACTTCTAGAGCGGCCGCGGGCCCATCGATTTTCCACCCGGGTGGGGTACC
                      cDNA similar to beta-                       matches, no arabidopsis matches
                      galactosidase, mRNA
                      sequence
                      gi|15661397|gb|BI698768.1|
                      BI698768 Ts011
                                                          Thermobacillus xylanilyticus xynA and abfA
                      Thellungiella salsuginea
           Ts011
gi|15661397|gb|BI698768.1|BI698768                         genes and ORF1, strain D3, many vector
                                                 AGAGAGAGAGAGAGAGAACTAGTCTCGAGAGTACTTCTAGAGCGGCCGCGGGCC
                      cDNA similar to putative
                                                              matches, no arabidopsis matches
                      ubiquitin carrier, mRNA
                      sequence

                      gi|15661398|gb|BI698769.1|
                      BI698769 Ts97 Thellungiella
                                                          Shuttle expression vector pBKCMV, many vector
           Ts97       salsuginea cDNA similar to TACTTCTAGAGCGGCCGCGGGCCCATCGATTTTCCACCCGGGTGGGGTACCAGG
gi|15661398|gb|BI698769.1|BI698769
                                                                  matches, no arabidopsis matches
                      putative ubiquitin carrier,
                      mRNA sequence

                      gi|15661197|gb|BI698568.1|
                      BI698568 Ts191
                      Thellungiella salsuginea           Shuttle expression vector pBKCMV, many vector
           Ts191
gi|15661197|gb|BI698568.1|BI698568               GAGTACTTCTAGAGCGGCCGCGGGCCCATCGATTTTCCACCCGGGTGGGGTACC
                      cDNA similar to putative               matches, no good arabidopsis matches
                      ubiquitin carrier, mRNA
                      sequence
                      gi|16004579|gb|BI851092.1|
                      BI851092 Ts1013
                      Thellungiella salsuginea            Babesia divergens mRNA for ran binding-like
           Ts1013
gi|16004579|gb|BI851092.1|BI851092               GAGTACTTCTAGAGCGGCCGCGGGCCCATCGATTTTCCACCCGGGTGGGGTACC
                      cDNA similar to putative                   protein 1, most match vectors
                      ubiquitin carrier, mRNA
                      sequence
                     gi|19913566|gb|BQ079201.
                     1|BQ079201 Ts1529
                                                          Clostridium acetobutylicum ATCC824 section 75
                     Thellungiella salsuginea
           Ts1529
gi|19913566|gb|BQ079201.1|BQ079201                           of 356 of the complete genome,E=0.28, no
                                                  CTTTTCGGTGGAAAAAAAGCCTCGAGTTCTCTGGAGGCAATTTTCTTCTCCGAGAA
                     cDNA similar to early growth
                                                                             arabadopsis
                     response 2; krox-20, mRNA
                     sequence
                      gi|15661348|gb|BI698719.1|
                      BI698719 Ts158
                                                           Thermobacillus xylanilyticus xynA and abfA
                      Thellungiella salsuginea
           Ts158
gi|15661348|gb|BI698719.1|BI698719                         genes and ORF1, some vector matches, no
                                                 GAGTACTTCTAGAGCGGCCGCGGGCCCATCGATTTTCCACCCGGGTGGGGTACC
                      cDNA similar to putative
                                                                     arabidopsis matches
                      ubiquitin carrier, mRNA
                      sequence
                      gi|15661482|gb|BI698853.1|
                      BI698853 Ts933
                                                            Homo sapiens chromosome 5 clone RP11-
           Ts933      Thellungiella
gi|15661482|gb|BI698853.1|BI698853salsuginea     CATATATATATACACACACGCTTTGGATAAAAACTCTCTGATTCGATAAATCAGAAG
                                                                          215P8 E=.013
                      cDNA similar to putative
                      protein, mRNA sequence
                      gi|19855198|gb|BQ060249.
                      1|BQ060249 Ts1215
                                                           All poor matches .32 lowest E; Homo sapiens
           Ts1215     Thellungiella salsuginea
gi|19855198|gb|BQ060249.1|BQ060249               CTCCTCATGTATGTTCGCCATCGACCAAAGCTCTACATTCTCAATCCCTTAACCCG
                                                                 chromosome 5 clone CTC-558O2
                      cDNA similar to putative
                      protein, mRNA sequence

                     gi|19684564|gb|BM985898.
                     1|BM985898 6_E11_T3 Ath
                     Thellungiella halophila             Zea mays subsp. mays B transcriptional activator
           6_E11_T3 cDNA clone 6_E11_T3
gi|19684564|gb|BM985898.1|BM985898                         (b1) gene, b1-B' allele, E=0.0, no arabidopsis
                                                  GGGCGCTAAGGCGCTGGAAGCCCGCGGTGGGTGGCGCGCCTTGAACTTCGGGC
                     similar to Zea mays cultivar                             matches
                     B73 putative gag protein,
                     mRNA




gi|1566111          gi|15661114|gb|BI698485.1| Arabidopsi
4|gb|BI698                 BI698485 Ts032        s thaliana
             Ts032     Thellungiella salsuginea     T-DNA          01.1
485.1|BI69
    8485               cDNA similar to Glycine     flanking
                     dehydrogenase subunit 1, sequence,
gi|1991355          gi|19913553|gb|BQ079208. Clostridium
3|gb|BQ07                1|BQ079208 Ts1479       acetobutyli
            Ts1479     Thellungiella salsuginea       cum          99
9208.1|BQ
  079208            cDNA similar to polyprotein, ATCC824
                           mRNA sequence         section 75
                    gi|15661288|gb|BI698659.1| Arabidopsi
gi|1566128                 BI698659 Ts280          s lyrata
8|gb|BI698             Thellungiella salsuginea     subsp.
             Ts280                                                 01.5
659.1|BI69          cDNA similar to hypothetical petraea
    8659              protein aq_1618, mRNA      PgiC gene
                              sequence                 for
gi|1566107          gi|15661078|gb|BI698449.1|       Oryza
8|gb|BI698   Ts205         BI698449 Ts205            sativa        07.4
449.1|BI69             Thellungiella salsuginea   (japonica
    8449            cDNA similar to D-ALANINE- cultivar-
                    gi|19855206|gb|BQ060257.       all poor
gi|1985520                                        matches
                         1|BQ060257 Ts1233
6|gb|BQ06                                        2.0 lowest
            Ts1233     Thellungiella salsuginea                    99
0257.1|BQ                                              E;
                      cDNA similar to unknown
  060257                                         Caenorhab
                      protein, mRNA sequence
                                                      ditis
gi|1968431          gi|19684319|gb|BM985653. Possibly
9|gb|BM98           1|BM985653 2_H03_T3 Ath misannotat
           2_H03_T3     Thellungiella halophila       ion:         07.6
5653.1|BM
  985653               cDNA clone 2_H03_T3       Thellungiel
                        similar to Arabidopsis          la
gi|1566108          gi|15661082|gb|BI698453.1| Possibly
2|gb|BI698          BI698453 Ts67 Thellungiella misannotat
             Ts67    salsuginea cDNA similar to       ion:         07.6
453.1|BI69
    8453               developmental protein -   Thellungiel
                          slime mold, mRNA              la
gi|1985513            gi|19855139|gb|BQ060191.       Rf:25S
9|gb|BQ06                 1|BQ060191 Ts1059           rDNA
             Ts1059      Thellungiella salsuginea  contained    06.5
0191.1|BQ
  060191               cDNA similar to hemolysin, within the
gi|1600460
                            mRNA sequence
                      gi|16004609|gb|BI851122.1| 10.5 kbp
                            BI851122 Ts810          external
9|gb|BI851
             Ts810       Thellungiella salsuginea transcribed   01.7
122.1|BI85
                       cDNA similar to THIAMINE      spacer
    1122
                    BIOSYNTHESIS PROTEIN
gi|1968458          gi|19684584|gb|BM985918. Zea mays
4|gb|BM98           1|BM985918 6_H04_T3 Ath         subsp.
           6_H04_T3    Thellungiella halophila     mays B       99
5918.1|BM
  985918               cDNA clone 6_H04_T3       transcriptio
                    similar to Zea mays cultivar      nal
gi|1968458          gi|19684581|gb|BM985915. Zea mays
1|gb|BM98           1|BM985915 6_H01_T3 Ath         subsp.
           6_H01_T3    Thellungiella halophila     mays B       99
5915.1|BM
  985915               cDNA clone 6_H01_T3       transcriptio
                        similar to AL049659 -         nal
                                          98        98
     probable G protein-coupled receptor, mRNA sequence              E=.020




                                        sequence 13.16
            Ig lambda light chain, mRNA 13.16                        E=.023




                    99                      99        99    X
othetical protein F14B6.5 - Caenorhabditis elegans, mRNA sequence    E=.18




                                       11.2        11.2     X        E=0.0
-dependent helicase ding (DNA-damage-inducible protein G), mRNA sequence looks like pure vector




                                 PROTEIN YBIT, mRNA sequence
ICAL ABC TRANSPORTER ATP-BINDING07.9      07.9   X         E=0.0 probably pure vector




                                 PROTEIN YBIT, mRNA sequence
ICAL ABC TRANSPORTER ATP-BINDING07.9      07.9   X         E=0.0, many vector matches, no arabidopsis matches




                                       99
              unknown protein, mRNA sequence        99               E=0.0, no Arabadopsis




                   ORF, mRNA sequence99             99               E=0.0, no Arabadopsis
                                           99        99
B. burgdorferi predicted coding region BB0212, mRNA sequence     E=0.002




                                         10.1      10.1
 brain-enriched guanylate kinase-associated, mRNA sequence       E=0.002




                                          99        99
  pregnancy specific beta-1-glycoprotein 2, mRNA sequence        E=0.004




                99                    99          99              E=0.007
BE758583.1|BE758583 Sc0129 Thellungiella salsuginea cDNA, mRNA sequence




                07.1                   99
              unknown protein, mRNA sequence         07.1        E=0.015




                                       99         99
  Pyrococcus abyssi complete genome; segment 3/6, mRNA           E=0.017




                                             03.5     03.5
     putative cell division control protein, mRNA sequence       E=0.020




                 99                    99        99
       hypothetical protein W09C3.3, mRNA sequence           X   E=0.022
                                       11.3       11.3   X
pathogen-inducible protein CXc750 precursor, mRNA sequence       E=0.026




                99                      99
           hypothetical protein, mRNA sequence   99     X        E=0.032




                99                    99          99              E=0.033
BE758581.1|BE758581 Sc0117 Thellungiella salsuginea cDNA, mRNA sequence




                                    9
                 ymf74, mRNA sequence9           99              E=0.034




                                   13.0
                LAMIN A, mRNA sequence           13.0            E=0.036




                                      05.1       05.1            E=0.040, no arabadopsis
omal protein L30, clone MGC: 4467IMAGE: 2961149, mRNA, mRNA sequence




                                   13.0
                LAMIN A, mRNA sequence           13.0            E=0.042




                99                     99         99              E=0.046
BF440061.1|BF440061 Sc0040 Thellungiella salsuginea cDNA, mRNA sequence




                                   13.0
                LAMIN A, mRNA sequence           13.0            E=0.055




                99                    99          99              E=0.068
BE758574.1|BE758574 Sc0070 Thellungiella salsuginea cDNA, mRNA sequence
                99                    99          99              E=0.079
BE758573.1|BE758573 Sc0064 Thellungiella salsuginea cDNA, mRNA sequence




                                       genomic sequence, mRNA
dopsis thaliana chromosome 1 BAC T3M13 99        99                E=0.082




                 99                     99        99
       Hypothetical protein F40E12.2, mRNA sequence          X     E=0.088




                   99                  99         99      X          E=0.12
818K5 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence, mRNA sequence




                99                     99         99              E=0.16
BF440066.1|BF440066 Sc0109 Thellungiella salsuginea cDNA, mRNA sequence




                 unknown, mRNA sequence
                04.4                 99           04.4             E=0.22




                  99                     99        99
       hypothetical protein T24H24.17, mRNA sequence         X     E=0.22




                                         01.8      01.8
  UDP-glycose:flavonoid glycosyltransferase, mRNA sequence         E=0.22
                                     02.4     02.4
      NADH dehydrogenase subunit 4, mRNA sequence                    E=0.25




                 99                    99
                polyprotein, mRNA sequence         99      X         E=0.26




                                        10.0
         putative WD-repeat protein, mRNA sequence10.0               E=0.28




                                           mRNA     16.0
    putative retroelement pol polyprotein, 16.0 sequence   x         E=0.31




                99                    99
             unknown protein, mRNA sequence        99      X         E=0.32 best match




                                           99          99
nococcus jannaschii section 53 of 150 of the complete genome, mRNA   E=0.56, no Arabadopsis




                    99                     99        99    X
al protein P-5 - Chlamydia trachomatis plasmid pLGV440, mRNA sequence E=0.6




                                   11.6
                 SAG101, mRNA sequence             11.6              E=0.68
                                        99       99
      hypothetical protein XP_087623, mRNA sequence              E=0.95, no Arabadopsis




              99               99       99    X
N WILLEBRAND FACTOR PRECURSOR (VWF), mRNA sequence               E=1.1




                                       99
                polyprotein, mRNA sequence          99           E=1.1




                99                    99          99              E=1.3
BE758584.1|BE758584 Sc0130 Thellungiella salsuginea cDNA, mRNA sequence




                99                    99          99              E=1.4
BE726998.1|BE726998 Sc0001 Thellungiella salsuginea cDNA, mRNA sequence




                                           11.3      11.3
   Contains similarity to extensin (atExt1), mRNA sequence       E=1e-04, no arabidopsis




                16.0                     99
            hypothetical protein, mRNA sequence     16.0     x   E=1e-5




                                      04.1      04.1
 rRNA intron-encoded homing endonuclease, mRNA sequence          E=1e-71, no arabadopsis




               99                   99
          CG9411 gene product, mRNA sequence        99       X   E=2.1
                                        07.11     07.11
  putative transmembrane-transport protein, mRNA sequence        E=2.3




                                       genomic sequence, mRNA
dopsis thaliana chromosome 1 BAC F9N12 99        99              E=2.9




                                          06.0
          putative ubiquitin carrier, mRNA sequence 06.0         E=2e-53,many vector sequences




                                          mRNA sequence
    (AE005239) carbon starvation protein,11.1     11.1      X    E=2e-96 no Arabidopsis match




                99                    99          99              E=3e-5,
BE727009.1|BE727009 Sc0018 Thellungiella salsuginea cDNA, mRNA sequence no Arabidopsis matches




                   ORF, mRNA sequence99             99           E=e-130, no Arabadopsis




                                         01.0       01.0
ronate oxidoreductase (tagaturonate reductase ), mRNA sequence   E=e-168, many vector matches, no arabidopsis matches




                                          06.0
          putative ubiquitin carrier, mRNA sequence 06.0         Many matches, no arabidopsis E=1e-24
                                          06.0
          putative ubiquitin carrier, mRNA sequence 06.0            many vector matches




                99                    99          99              many
BE727003.1|BE727003 Sc0010 Thellungiella salsuginea cDNA, mRNA sequence vector matches, no arabidopsis matches




                                      01.5
            beta-galactosidase, mRNA sequence      01.5             many vector matches, no arabidopsis matches




                                          06.0
          putative ubiquitin carrier, mRNA sequence 06.0            many vector matches, no arabidopsis matches




                                          06.0
          putative ubiquitin carrier, mRNA sequence 06.0            many vector matches, no arabidopsis matches




                                          06.0
          putative ubiquitin carrier, mRNA sequence 06.0            many vector matches, no good arabidopsis matches




                                          06.0
          putative ubiquitin carrier, mRNA sequence 06.0            most match vectors




                                         99        99
      early growth response 2; krox-20, mRNA sequence               no arabadopsis




                                          06.0
          putative ubiquitin carrier, mRNA sequence 06.0            some vector matches, no arabidopsis matches
           99                     99
        putative protein, mRNA sequence       99    X




           99                     99
        putative protein, mRNA sequence       99    X




                                   99          99
Zea mays cultivar B73 putative gag protein, mRNA        E=0.0, no arabidopsis matches




         E=0.36




         E=0.42




         E=0.59




         E=1.7




         E=2.0




           no
       arabidopsi
       s matches

           no
       Arabidopsi
       st matches
 no good
Arabidopsi
s matches


 no good
Arabidopsi
s matches

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:8
posted:10/16/2011
language:English
pages:103