Docstoc

Translation

Document Sample
Translation Powered By Docstoc
					 Translation
Linking amino acids to make
          proteins
           Translation
• the translation process takes
  place on ribosomes

• the mRNA fix themselves to
  the ribosomes to form a mRNA
  ribosome complex
           Translation
• only a short section of an
  mRNA molecule is in contact
  with a single ribosome
• mRNA usually fixes itself to
  several ribosomes at once
• the entire complex is termed a
  polysome
                Translation
• This allows several proteins of
  the same kind to be made at
  once.
• The assembly of proteins
  requires the action of another
  kind of RNA- tRNA
               Translation
• tRNA
  – collects the free amino acids
    from the cytoplasm
  – delivers them to the
    polysome, where they are
    assembled into proteins.
                 Translation
• There is a special tRNA
  molecule for every amino acid.
• •tRNA is a large molecule that
  is folded to form a cloverleaf
• •On the cloverleaf is a special
  sequence of three bases called
  the anticodon
Translation
Translation
           Translation
• The anticodon on tRNA
  compliments the codons on
  the mRNA
• The anticodon of the tRNA
  is the key to the correct
  sequencing of amino acids
            Translation
• there is a special activating
  enzyme that accompanies each
  tRNA
• These enzymes are called
  activation enzymes
• They are necessary for the
  sorting out and attachment of
  the correct amino acid to each
  tRNA
             Translation
• This process is called loading
• The entire process is started
  and stopped by special codons
• The codon to start is AUG
• The codons to stop are UAA,
  UAG, UGA
Translation Summary
• TTTATTTACCGGTGCACGGGG
• AAATAAATGGCCACGTGCCCC

TTT ATT TAC CGG TGC ACG GGG
        AUG GCC ACG UGC CCC
AUG

Find
the A
in
the
inner
circle
AUG
Now find
the
second
letter, U
in the
second
circle
AUG
Now find
the third
letter, G
in the
third
circle
AUG
Now that
you have
isolated the
AUG region
of the wheel
you can
name the
amino acid
AUG GCC ACG UGC CCC
• AUG-methionine
• GCC- alanine
• ACG- theronine
• UGC- cysteine
• CCC- proline

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:9
posted:10/10/2011
language:English
pages:21