Supporting Online Material for by mmcsx

VIEWS: 3 PAGES: 30

									                                               www.sciencemag.org/cgi/content/full/1116804/DC1




                    Supporting Online Material for
    Herpesviral Protein Networks and Their Interaction with the Human
                               Proteome

     Peter Uetz, Yu-An Dong, Christine Zeretzke, Christine Atzler, Armin Baiker,
 Bonnie Berger, Seesandra Rajagopala, Maria Roupelieva, Dietlind Rose, Even Fossum,
                                   Jürgen Haas*

 *To whom correspondence should be addressed. E-mail: haas@lmb.uni-muenchen.de

                   Published Published 8 December 2005 on Science Express
                               DOI: 10.1126/science.1116804

This PDF file includes:

       Materials and Methods
       Figs. S1 to S10
       Tables S1 to S10
       References and Notes
SUPPLEMENTAL DATA

Material and Methods

Cloning of the KSHV and VZV ORFeomes

To clone the KSHV and VZV ORFeomes, viral genes were selected from published sequences (1, 2). For

KSHV, 113 full-length and partial ORFs (including 15 cytoplasmic and 5 external domains derived from

transmembrane proteins) and for VZV 96 full-length and partial ORFs (including 13 cytoplasmic and 10

external domains derived from transmembrane proteins) were amplified by nested polymerase chain

reaction     (PCR).   The     internal   forward    AAAAAGCAGGCTCCGCCATGX18-21                  and   reverse

AGAAAGCTGGGTT/C/ATAX18-21 primers contained the internal part of attB1 and attB2 recombination

sites,     the   external   forward      GGGGACAAGTTTGTACAAAAAAGCAGGCT                         and    reverse

GGGGACCACTTTGTACAAGAAAGCTGGGT primers the external parts. As PCR templates for the

KSHV ORFeome, either genomic DNA isolated from BCBL-1 cells, KSHV phage or cosmid clones from

BC-1 cells, KSHV BAC DNA generated from virus of BCP-3 cells, or cDNA prepared from BC-1 cells

was used for the amplification of spliced genes. As PCR template for the VZV ORFeome, chromosomal

DNA from VZV pOKA-infected MeWo melanoma cells was used (3). The PCR products were cloned by

BP clonase into the gentamycin resistent entry vector pDONR207 (Gateway, Invitrogen). The destination

vectors pDEST-GADT7 and pDEST-GBKT7 were created by inserting the conversion cassette into the

EcoRV and Sma I restriction sites of the kanamycin resistent bait vector pGBKT7 and the ampicillin

resistent prey vector pGADT7 (Clontech), respectively. The bait and prey arrays were transformed into

the two haploid yeast strains Y187 and AH109 which are of the a and α mating type, respectively.

Subsequently, each yeast bait transformant was mated with each yeast prey transformant in quadruplicates

as described before (4). Positive diploid yeasts were selected as described in detail by Cagney et al. (5)

Power-law distribution of viral node degrees




Uetz.SOM.doc                                          1
The power-law distribution was determined as follows: Let k be node degree and P (k ) its probability

(i.e. relative frequency). The power-law degree distribution is of the form P (k ) ~ k              −γ
                                                                                                         , or

log P (k ) ~ − γ log (k ) . For each network, the observations of k and P (k ) were collected, log-

transformed, and fitted via linear regression.

Local clustering in viral networks

To assess the level of local clustering in viral networks, suitable random models were generated. Random

networks generated by the Erdös-Rényi (ER) model follow a Poisson distribution with a background

probability of interaction between any two nodes being a constant, p = 2 E/N (N-1) (E and N are the

number of edges and nodes in the network, respectively). Since a protein interaction network is sparse, we

have E ~ N and hence p ~ 1/N. Thus, under the ER model a larger network appears to be more locally

clustered simply because of its smaller background interaction probability. To filter out the bias due to

degree distribution and network size, the KSHV network was compared to an ensemble of simulated

networks generated through an edge-swapping (ES) strategy, in which each node has the same number of

interaction partners as in the original network. The results show that the level of local clustering of KSHV

and VZV is low, in fact comparable to equivalent random networks, and thus these viral networks cannot

be classified as small-world.




Uetz.SOM.doc                                         2
Figure S1: Viral protein interactions in KSHV.

(a) Distribution of the number of protein interaction partners within the KSHV genome. There are two

clusters of viral hubs between Orf23 and Orf31 and between Orf52 and Orf67.5 within the KSHV

genome. (b) Interaction matrix of KSHV. 123 positive protein interactions are indicated by black boxes,

self-activating baits as yellow boxes and the mirror axis by red boxes.

Figure S2: Verification of Y2H interactions by coimmunoprecipitation.

Cloned KSHV ORFs were expressed from pDEST-GBKT7 and pDEST-GADT7 bait and prey vectors as

myc- or HA-tagged proteins by transfection into 293 cells and simultaneous infection with recombinant

vaccinia virus vTF-7 expressing the T7 RNA polymerase. Cell lysates were split and precipitated with

protein G-sepharose (GE Amersham) and either anti-myc (Santa Cruz) or anti-HA (Roche) antibodies.

Each precipitate was separated by two 8 to 15% SDS polyacrylamide gels. Western Blots were reacted

with either anti-myc or anti-HA antibodies as well as secondary, peroxidase-conjugated anti-mouse IgG or

anti-rat IgG antibodies (Jackson). On the left side of each Western Blot precipitating and on the right side

co-precipitating proteins (marked by asterisks) are indicated. The CoIP was scored positive if a

coprecipitate was detected in at least one direction.

Figure S3: Correlation between viral protein interactions and expression profile.

(a) Interacting proteins share more similar expression profiles. All pairwise expression profile correlations

determined based on results by Jenner et al. (6) were plotted in a matrix for 81 KSHV ORFs. Interacting

protein pairs are indicated as circles. Standard Pearson correlation of two vectors was used to compute the

expression profile correlation of any two KSHV ORFs. The average expression correlation [AEC] for

random pairs of ORFs was determined to be 0.804 for random pairs and 0.839 for interacting pairs

[p=0.0004]. Self-interactions had been excluded from this analysis since they artificially inflate the

measure. (b) The correlation between AEC and the clustering coefficient C proposes either static or

dynamic interactions for viral hubs. The size of the circles indicates the number of interaction partners, the

colors refer to the functional class. If interactions are static as in a large complex, proteins are more likely



Uetz.SOM.doc                                            3
to interact with each other (hence high C) and to be expressed at the same time as their interaction partners

(hence high AEC). On the other hand, if interactions take place at different time or place, both C and AEC

should be lower. In contrast to previous studies on party versus date hubs which used raw c values, we

evaluated clustering based on its significance (p-value adjusted), which enabled us to use the smaller virus

datasets, and to filter out the considerable effect of the underlying degree distribution on clustering (Table

1) (7). The Orf9 polymerase and the Orf41 helicase, which are both involved in replication and most likely

form a stable complex, are both high in C and AEC values, whereas the Orf 36 kinase possesses low C

and AEC values as anticipated for an enzyme. This analysis implies, for example, that K10, one of the

major KSHV hubs, probably participates in a stable complex.

Figure S4: VZV protein interaction network.

VZV proteins are indicated as nodes, protein interactions detected by Y2H as hatched edges. Orthologous

interactors in VZV and KSHV are marked by circled nodes, orthologous interactions detected in both

viruses by red edges. VZV ORFs were assigned into five functional classes depicted in different colours

based on GenBank annotations for the corresponding ORF or its orthologs.

Figure S5: Degree distribution of herpesviral protein interaction networks.

The empirical KSHV degree distribution is shown on a bilogarithmic scale. The power-law fit is

compared with two other major classes relevant in our current context, Poisson and exponential. As in

previous studies, each point in the degree distribution is given equal weight (homoscedastic fit). For each

distribution fitted curves are indicated. Since homoscedastic fitting ignores variance, we also

experimented with maximum likelihood fitting, where each point is weighted by either the number of

nodes (ML1) or the sum of node degrees (ML2). Clearly the assumption of variance plays a role in fitting

the degree distribution and merits further investigation. The power-law model is fitted through linear

regression, while the Poisson and exponential models are fitted via nonlinear least squares (statistics see

Table S5). In conclusion, the power-law degree distribution is only an approximation and other

distributions also fit to some extent, similar to other networks (8).



Uetz.SOM.doc                                           4
Figure S6: Degree correlation of the KSHV network.

Two-dimensional heat maps depicting the degree correlation of the KSHV network using ER (a) and ES

(b) models show that in KSHV hubs do not tend to avoid each other and to connect to low-degree nodes,

in contrast to S.cerevisiae. In both heat maps, the square at position (I, j) corresponds to the degree

correlation between node degrees ki and kj, while the color intensity corresponds to the amplitude of the

statistics, with green denoting suppression and red denoting enrichment. The statistics under a random

model is based on log odds, i.e. the log ratio of observed over background frequencies of the degree pair

(ki, kj). Since the random model does not preserve the underlying degree distribution, we also generated

simulated networks in which each node preserves its original degree using an edge-swapping strategy

similar as described by Maslov and Sneppen. The corresponding statistics is based on the empirical z-

score of the observed frequency of the degree pair (ki, kj) over the ensemble of those in the simulated

networks.

Figure S7: Sequence conservation of viral interactors.

(a) Interacting proteins are not more conserved than non-interacting proteins, but a core set of viral

proteins that have orthologs in HSV-1, VZV, CMV, EBV and KSHV are. 54 Orfs have orthologs in EBV

(35.1% sequence identity on average), among which 30 have protein interactions (34.5%). 22 Orfs are

conserved in all herpesviruses (40.9%), among which 10 have intra-viral protein interactions (43.1%). (b)

Relationship between the number of protein interactions and sequence conservation between KSHV and

EBV proteins. KSHV encodes 31 proteins with orthologs in the α-herpesvirus HSV-1, 38 with orthologs

in the β-herpesvirus CMV and 54 with orthologs in the γ-herpesvirus EBV. The 54 KSHV Orfs with

orthologs in EBV possess an average sequence identity of 35.1%. Among these 54 proteins 30 are

involved in viral protein interactions as shown in our data set, but their average similarity to their

orthologs is not increased (34.5%) when compared to the 24 non-interacting proteins (36.0%). However,

for interacting proteins there is a statistically significant correlation between the number of interactions




Uetz.SOM.doc                                         5
and sequence conservation between KSHV and EBV (p=0.046), suggesting that for these proteins there is

an evolutionary selection pressure.

Figure S8: Viral protein interactions between functional and phylogenetic groups.

(a) Correlation between functional and phylogenetic classes in herpesviruses. The KSHV Orfs were

partitioned into the following five functional classes: 1. DNA replication and nucleotide metabolism, 2.

gene regulation and signalling, 3. virus-host interaction, 4. virion structure and morphogenesis and 5.

proteins with unknown function. Phylogenetic classes were partitioned depending on whether they are

specific for KSHV or possess orthologs in the γ (γ), β and γ (βγ) or α, β and γ (αβγ) subfamilies. As

anticipated, the KSHV-specific phylogenetic class is dominated by proteins involved in virus-host

interaction, whereas the αβγ phylogenetic class (containing proteins present in all three subfamilies) by

structural proteins and proteins involved in replication. (b) Viral protein interactions between functional

classes. The left histogram depicts the number of proteins within the functional class, the right histogram

the number and functional class of the interactors. More than 70% of all protein interactions occured

between viral proteins belonging to different functional classes. In general, interacting proteins are not

more likely to belong to the same functional class than random pairs of proteins (only 1.1-fold enrichment

over random pairs of proteins, p=0.334), suggesting that the majority of viral proteins either have multiple,

previously unknown functions, or are assigned incorrectly. Significantly increased numbers of intra-class

interactions were only identified between proteins belonging to the gene regulation and unknown

functional classes (statistics see Table S7). Whereas interactions between proteins involved in host

interaction were most highly suppressed (as expected), interactions between proteins involved in both

host interaction and replication were significantly increased. Interactions between proteins with unknown

function are significantly overrepresented, implying that they are within the same functional group (other

than host interaction) and parts of identical complexes or processes. (c) Viral protein interactions between

phylogenetic classes. The β and αγ subclasses, which contain only 1 member each, do not provide

additional information and are thus not shown. KSHV-specific protein interactions were (significantly)




Uetz.SOM.doc                                         6
underrepresented and interactions between conserved proteins present in all three subfamilies (αβγ) (non-

significantly) overrepresented. Statistically significant over- or underrepresentations are indicated by

asterisks in (b) and (c) (statistics see Table S8).

Figure S9: Power coefficient of a combined KSHV-human network.

To assess the impact of the human on the herpesviral network, we performed a combined virus-host

network analysis by increasing the level of interactions. Starting with the KSHV network (level 0), we

first added in their direct human targets, subsequently we added in those human targets’ own interactions

partners (level 2), and so on, until the viral network is completely assimilated into the host network. To

evaluate the topology of the combined virus-host network, we reasoned that a correctly combined system

should be able to distinguish itself from randomly combined networks. The combined virus-host network

was compared to random networks which were generated by rewiring fixed virus interactors to swapped

cellular proteins with the same degree as the actual target. As the level elevates, the viral-host system

exhibits an increasing power coefficient indicating that the KSHV network more and more assimilates to

the human network. At level 2, the correctly assembled viral-host system not only possesses a bigger

power coefficient than simulated systems as shown here, but its power-law fit is also more significant

(Fig. 2c). Thus, at the level carrying most biological relevance (KSHV’s human targets and their own

interaction partners in turn) and suffering from minimal noise (level 3 already includes a sizable fraction

of the human network and many of the interactions are conceivably no longer relevant to the viral-host

context), the combined virus-host network significantly assimilates human network properties.

Figure S10: Local view of the combined VZV-human network.

Local view of the interplay between the VZV and a predicted high-confidence human interaction network

consisting of 10,636 edges among 3,169 nodes. Viral proteins are depicted as red nodes, cellular

interacting proteins (level 1 and 2) as blue nodes and cellular proteins (level >2) as grey nodes.

Interactions between viral proteins are depicted as red edges, between viral and cellular proteins as green

edges and between cellular level 1 and 2 proteins as blue edges.



Uetz.SOM.doc                                          7
Table S1: Viral protein interactions in KSHV.
                            orthologs in                                      orthologs in
     KSHV                                            KSHV                                               G   C
               VZV      HSV-1      CMV         EBV              VZV      HSV-1       CMV       EBV
 1   Orf 6     Orf 29   UL 29    UL 57     BALF-2    K5         ---      ---      ---        ---        1   1
 2   Orf 6     Orf 29   UL 29    UL 57     BALF-2    Orf 52     ---      ---      ---        BLRF-2     1   0
 3   Orf 6     Orf 29   UL 29    UL 57     BALF-2    K 15       ---      ---      ---        ---        1   0
 4   Orf 9     Orf 28   UL 30    UL 54     BALF-5    Orf 39     Orf 50   UL 10    UL 100     BBRF-3     0   0
 5   Orf 9     Orf 28   UL 30    UL 54     BALF-5    Orf 41     ---      ---      ---        ---        0   0
 6   Orf 9     Orf 28   UL 30    UL 54     BALF-5    Orf 47     ---      ---      ---        BKRF-2     0   0
 7   Orf 9     Orf 28   UL 30    UL 54     BALF-5    K 10       ---      ---      ---        ---        1   0
 8   Orf 9     Orf 28   UL 30    UL 54     BALF-5    Orf 67.5   Orf 25   UL 33    UL 51      BFRF-4     0   1
 9   Orf 9     Orf 28   UL 30    UL 54     BALF-5    Orf 68     Orf 26   UL 32    UL 52      BFLF-1     0   0
10   Orf 2     ---      ---      ---       ---       K 10       ---      ---      ---        ---        0   1
11   K3        ---      ---      ---       ---       K3         ---      ---      ---        ---        0   0
12   K7        ---      ---      ---       ---       K3         ---      ---      ---        ---        0   0
13   K7        ---      ---      ---       ---       K5         ---      ---      ---        ---        1   1
14   K7        ---      ---      ---       ---       Orf 74     ---      ---      US28       ---        0   1
15   Orf 23    ---      ---      UL 117    BTRF-1    Orf 28     ---      ---      ---        ---        0   0
16   Orf 23    ---      ---      UL 117    BTRF-1    Orf 30     ---      ---      ---        ---        0   0
17   Orf 23    ---      ---      UL 117    BTRF-1    Orf 45     ---      ---      ---        BKRF-4     0   0
18   Orf 23    ---      ---      UL 117    BTRF-1    Orf 67.5   Orf 25   UL 33    UL 51      BFRF-4     0   1
19   Orf 23    ---      ---      UL 117    BTRF-1    K9         ---      ---      ---        ---        1   1
20   Orf 25    Orf 40   UL 19    UL 86     BcLF-1    Orf 65     ---      ---      ---        BFRF-3     0   1
21   Orf 27    ---      ---      ---       BDLF-2    Orf 74     ---      ---      US28       ---        0   1
22   Orf 28    ---      ---      ---       ---       K5         ---      ---      ---        ---        2   1
23   Orf 28    ---      ---      ---       ---       Orf 28     ---      ---      ---        ---        0   0
24   Orf 28    ---      ---      ---       ---       Orf 30     ---      ---      ---        ---        1   0
25   Orf 28    ---      ---      ---       ---       Orf 41     ---      ---      ---        ---        0   1
26   Orf 28    ---      ---      ---       ---       K 10       ---      ---      ---        ---        1   0
27   Orf 28    ---      ---      ---       ---       K 11       ---      ---      ---        ---        1   0
28   Orf 28    ---      ---      ---       ---       Orf 67.5   Orf 25   UL 33    UL 51      BFRF-4     1   0
29   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 23     ---      ---      UL 117     BTRF-1     0   1
30   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 28     ---      ---      ---        ---        0   0
31   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 28     ---      ---      ---        ---        1   1
32   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 30     ---      ---      ---        ---        0   0
33   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 41     ---      ---      ---        ---        0   1
34   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 50     ---      ---      ---        BRLF-1     0   0
35   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    K 8.1      ---      ---      ---        ---        1   0
36   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 54     Orf 8    UL 50    UL72       BLLF-3     1   0
37   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    K 10       ---      ---      ---        ---        0   0
38   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    K10.5      ---      ---      ---        ---        0   0
39   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    K 11       ---      ---      ---        ---        0   1
40   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    K 12       ---      ---      ---        ---        0   0
41   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 67.5   Orf 25   UL 33    UL 51      BFRF-4     0   1
42   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 68     Orf 26   UL 32    UL 52      BFLF-1     0   0
43   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 72     ---      ---      ---        ---        0   0
44   Orf 29b   Orf 42   UL 15    UL 89     BDRF-1    Orf 74     ---      ---      US28       ---        0   0
45   Orf 31    ---      ---      UL 92     BDLF-4    Orf 30     ---      ---      ---        BDLF-3,5   0   0
46   Orf 31    ---      ---      UL 92     BDLF-4    Orf 31     ---      ---      UL 92      BDLF-4     1   1
47   Orf 31    ---      -        UL 92     BDLF-4    Orf 41     ---      ---      ---        BBLF-3     0   1
48   Orf 31    ---      -        UL 92     BDLF-4    K 11       ---      ---      ---        ---        1   1
49   Orf 31    ---      ---      UL 92     BDLF-4    Orf 67.5   Orf 25   UL 33    UL 51      BFRF-4     0   1
50   Orf 31    ---      ---      UL 92     BDLF-4    Orf 68     Orf 26   UL 32    UL 52      BFLF-1     0   1
51   Orf 34    ---      ---      UL95      BGLF-3    K5         ---      ---      ---        ---        0   0
52   Orf 34    ---      ---      UL 95     BGLF-3    Orf 52     ---      ---      ---        BLRF-2     1   0
53   Orf 34    ---      ---      UL 95     BGLF-3    K 11       ---      ---      ---        ---        0   0
54   Orf 34    ---      ---      UL 95     BGLF-3    Orf 67.5   Orf 25   UL 33    UL 51      BFRF-4     0   0
55   Orf 36    Orf 47   UL 13    UL 97     BGLF-4    Orf 45     ---      ---      ---        BKRF-4     0   0
56   Orf 36    Orf 47   UL 13    UL 97     BGLF-4    Orf 48     ---      ---      ---        ---        0   0
57   Orf 36    Orf 47   UL 13    UL 97     BGLF-4    Orf 54     Orf 8    UL 50    UL72       BLLF-3     1   0
58   Orf 36    Orf 47   UL 13    UL 97     BGLF-4    Orf 61     Orf 19   UL 39    UL 45      BORF-2     0   1
59   Orf 37    Orf 48   UL 12    UL 98     BGLF-5    K8         ---      ---      ---        ---        1   1
60   Orf 37    Orf 48   UL 12    UL 98     BGLF-5    K 10       ---      ---      ---        ---        1   0
61   Orf 37    Orf 48   UL 12    UL 98     BGLF-5    Orf 72     ---      ---      ---        ---        0   1
62   Orf 45    ---      ---      ---       BKRF-4    Orf 50     ---      ---      ---        BRLF-1     1   0



Uetz.SOM.doc                                             8
 63   Orf 45    ---      ---     ---     BKRF-4   Orf 72     ---      ---     ---      ---      1   0
 64   Orf 49    ---      ---     ---     BRRF-1   Orf 52     ---      ---     ---      BLRF-2   1   0
 65   Orf 49    ---      ---     ---     BRRF-1   K 10       ---      ---     ---      ---      1   0
 66   Orf 52    ---      ---     ---     BLRF-2   Orf 52     ---      ---     ---      BLRF-2   0   1
 67   Orf 53    ---      ---     UL 73   BLRF-1   K3         ---      ---     ---      ---      1   1
 68   Orf 53    ---      ---     UL 73   BLRF-1   K5         ---      ---     ---      ---      1   1
 69   Orf 54    Orf 8    UL 50   UL72    BLLF-3   Orf 62     ---      ---     ---      BORF-1   0   1
 70   Orf 56    Orf 6    UL 52   UL 70   BSLF-1   Orf 36     Orf 47   UL 13   UL 97    BGLF-4   0   1
 71   Orf 56    Orf 6    UL 52   UL 70   BSLF-1   K 10.5     ---      ---     ---      ---      1   1
 72   Orf 57    Orf 4    UL 54   UL 69   BMLF-1   Orf 23     ---      ---     UL 117   BTRF-1   0   1
 73   Orf 57    Orf 4    UL 54   UL 69   BMLF-1   Orf 50     ---      ---     ---      BRLF-1   0   0
 74   Orf 57    Orf 4    UL 54   UL 69   BMLF-1   K8         ---      ---     ---      ---      1   1
 75   Orf 57    Orf 4    UL 54   UL 69   BMLF-1   Orf 52     ---      ---     ---      BLRF-2   0   0
 76   Orf 57    Orf 4    UL 54   UL 69   BMLF-1   Orf 57     Orf 4    UL 54   UL 69    BMLF-1   2   1
 77   Orf 57    Orf 4    UL 54   UL 69   BMLF-1   Orf 61     Orf 19   UL 39   UL 45    BORF-2   1   1
 78   Orf 57    Orf 4    UL 54   UL 69   BMLF-1   Orf 68     Orf 26   UL 32   UL 52    BFLF-1   0   1
 79   Orf 58    ---      ---     ---     BMRF-2   Orf 27     ---      ---     ---      BDLF-2   0   0
 80   Orf 59    ---      ---     ---     BMRF-1   K5         ---      ---     ---      ---      0   0
 81   Orf 59    ---      ---     ---     BMRF-1   Orf 52     ---      ---     ---      BLRF-2   2   0
 82   Orf 59    ---      ---     ---     BMRF-1   K 10       ---      ---     ---      ---      0   0
 83   Orf 59    ---      ---     ---     BMRF-1   K 11       ---      ---     ---      ---      0   1
 84   Orf 59    ---      ---     ---     BMRF-1   Orf 67.5   Orf 25   UL 33   UL 51    BFRF-4   1   0
 85   Orf 59    ---      ---     ---     BMRF-1   Orf 68     Orf 26   UL 32   UL 52    BFLF-1   0   1
 86   K 10      ---      ---     ---     ---      Orf 31     ---      ---     UL 92    BDLF-4   1   1
 87   K 10      ---      ---     ---     ---      Orf 39     Orf 50   UL 10   UL 100   BBRF-3   0   1
 88   K 10      ---      ---     ---     ---      Orf 41     ---      ---     ---      ---      1   1
 89   K 10      ---      ---     ---     ---      Orf 47     ---      ---     ---      BKRF-2   1   0
 90   K 10      ---      ---     ---     ---      Orf 67.5   Orf 25   UL 33   UL 51    BFRF-4   1   1
 91   K 10      ---      ---     ---     ---      Orf 68     Orf 26   UL 32   UL 52    BFLF-1   1   1
 92   Orf 60    Orf 18   UL 40   ---     BaRF-1   K1         ---      ---     ---      ---      1   0
 93   Orf 60    Orf 18   UL 40   ---     BaRF-1   K3         ---      ---     ---      ---      1   1
 94   Orf 60    Orf 18   UL 40   ---     BaRF-1   K5         ---      ---     ---      ---      2   0
 95   Orf 60    Orf 18   UL 40   ---     BaRF-1   Orf 23     ---      ---     UL 117   BTRF-1   2   0
 96   Orf 60    Orf 18   UL 40   ---     BaRF-1   Orf 52     ---      ---     ---      BLRF-2   1   0
 97   Orf 60    Orf 18   UL 40   ---     BaRF-1   K8         ---      ---     ---      ---      1   0
 98   Orf 60    Orf 18   UL 40   ---     BaRF-1   Orf 56     Orf 6    UL 52   UL 70    BSLF-1   3   1
 99   Orf 60    Orf 18   UL 40   ---     BaRF-1   K 10       ---      ---     ---      ---      1   0
100   Orf 60    Orf 18   UL 40   ---     BaRF-1   K 11       ---      ---     ---      ---      1   1
101   Orf 60    Orf 18   UL 40   ---     BaRF-1   K 12       ---      ---     ---      ---      2   0
102   Orf 60    Orf 18   UL 40   ---     BaRF-1   Orf 60     Orf 18   UL 40   ---      BaRF-1   3   1
103   Orf 60    Orf 18   UL 40   ---     BaRF-1   Orf 61     Orf 19   UL 39   UL 45    BORF-2   3   1
104   Orf 60    Orf 18   UL 40   ---     BaRF-1   Orf 67.5   Orf 25   UL 33   UL 51    BFRF-4   1   1
105   Orf 60    Orf 18   UL 40   ---     BaRF-1   Orf 68     Orf 26   UL 32   UL 52    BFLF-1   0   1
106   Orf 61    Orf 19   UL 39   UL 45   BORF-2   K 10       ---      ---     ---      ---      0   1
107   Orf 61    Orf 19   UL 39   UL 45   BORF-2   K 11       ---      ---     ---      ---      0   0
108   Orf 61    Orf 19   UL 39   UL 45   BORF-2   Orf 61     Orf 19   UL 39   UL 45    BORF-2   2   0
109   Orf 63    ---      ---     ---     BOLF-1   Orf 23     ---      ---     UL 117   BTRF-1   0   1
110   Orf 63    ---      ---     ---     BOLF-1   Orf 41     ---      ---     ---      BBLF-3   0   1
111   Orf 63    ---      ---     ---     BOLF-1   K9         ---      ---     ---      ---      1   1
112   Orf 63    ---      ---     ---     BOLF-1   Orf 65     ---      ---     ---      BFRF-3   0   1
113   Orf 63    ---      ---     ---     BOLF-1   Orf 67.5   Orf 25   UL 33   UL 51    BFRF-4   2   1
114   Orf67.5   Orf 25   UL 33   UL 51   BFRF-4   Orf 75     ---      ---     ---      BNRF-1
115   Orf 69    Orf 27   UL 31   UL 53   BFLF-2   K9         ---      ---     ---      ---      0   1
116   Orf 69    Orf 27   UL 31   UL 53   BFLF-2   K 11       ---      ---     ---      ---      0   0
117   Orf 69    Orf 27   UL 31   UL 53   BFLF-2   Orf 52     ---      ---     ---      BLRF-2   0   0
118   Orf 69    Orf 27   UL 31   UL 53   BFLF-2   Orf 67.5   Orf 25   UL 33   UL 51    BFRF-4   0   1
119   K 12      ---      ---     ---     ---      K 10       ---      ---     ---      ---      1   1
120   K 12      ---      ---     ---     ---      K 12       ---      ---     ---      ---      3   1
121   Orf 75    ---      ---     ---     BNRF-1   Orf 50     ---      ---     ---      BRLF-1   2   1
122   Orf 75    ---      ---     ---     BNRF-1   K 8.1      ---      ---     ---      ---      0   0
123   Orf 75    ---      ---     ---     BNRF-1   K 10.5     ---      ---     ---      ---      2   0

Blue = orthologous protein pairs in KSHV and VZV
Red = othologous interactions, predicted in VZV from KSHV data and detected in VZV




Uetz.SOM.doc                                          9
The table includes viral protein interactions detected in KSHV by Y2H analysis, as well as orthologous

proteins in HSV-1, VZV, CMV and EBV. All proteins interactions were verified by β-galactosidase

assay (G) and coimmunoprecipitation (C) for KSHV proteins. 51.7% (66/123) of the Y2H interactions

were positive in the β-galactosidase assay and 48.0% (59/123) positive by CoIP (52.0% or 64/123

negative). The qualitative β-galactosidase filter assay was performed according to standard protocols. In

brief, colonies were transferred onto blotting paper. Yeast cells on the blotting paper were lysed in liquid

nitrogen, and it was transferred onto a blotting paper of similar size presoaked with an X-Gal buffer

solution. The intensity of the color reaction was scored after 10 hours from 1 to 3. Genome sequences

were taken from public databases (GenBank, PDB, etc.) and compared by standard BLAST programs for

orthologous relationships limited to E-values <0.1 or <0.01 for SCOP comparisons.

Table S2: Previously reported protein interactions in KSHV.

Of the 123 unique interactions detected in KSHV, 4.1% (5/123) were previously reported (additional 2

were known by personal communication) and 95.9% (118/123) novel, of which 50% (59/118) could be

confirmed by CoIP. 71.4% (5/7) of the previously known KSHV interactions were captured by the Y2H

screen.

          interaction      Protein                     reference                    Y2H        CoIP

 1.       Orf25 –          major and small             Lo et al. (9)                yes        yes
          Orf65            capsid proteins
 2.       Orf36 –          kinase – immediate          von Geelen et al.            yes        no
          Orf45            early protein               personal
                                                       communication
 3.       Orf45 - K8       immediate early             Ueda et al. personal         no         n.d.
                           proteins                    communication
 4.       Orf50 (RTA)      immediate early             Malik et al. (10)            yes        no
          – Orf57          transcriptional
                           activators
 5.       Orf50 (RTA)      immediate early             Izumiya et al. (11)          no         n.d.
          – K8             transcriptional
                           activators
 6.       Orf60 –          ribonucleotide              Sun and Conner (12)          yes        yes
          Orf61            reductase subunits
 7.       K12 – K12        homodimerization of         Kliche et al. (13)           yes        yes
                           kaposin
n.d. not done


Uetz.SOM.doc                                         10
Table S3: Verfication of predicted interactions in other herpesvirus species.

The HSV-1, mCMV and EBV ORFs were cloned by recombinatorial cloning from herpesviral BAC

clones into entry as well as Y2H bait and prey vectors (14–16). Subsequently, the clones were confirmed

by restriction digest and Western Blot. The Y2H analysis was performed in quadruplicates similar as

described in Material and Methods and the CoIP as described in the legend to Figure S2.

                     HSV-1             VZV              mCMV             EBV                total
   predicted
   by KSHV              19              16                 21             56                 112
  interactions

   confirmed
                    6 (31.6%)        6 (37.5%)          4 (19.0%)     19 (33.9%)          35 (31.3%)
    by Y2H

   confirmed
                    10 (53.6%)          n.d.         20 (95.3%)       44 (78.5%)          74 (77.8%)
    by CoIP




Uetz.SOM.doc                                       11
Table S4: Viral protein interactions in VZV.

                             orthologs in                                     orthologs in
     VZV                                                VZV
                 HSV-1     CMV        EBV    KSHV                 HSV-1     CMV         EBV    KSHV
 1   Orf 1     ---       ---       ---      ---        Orf 25   UL33      UL51      BFRF4     Orf 67.5
 2   Orf 1     ---       ---       ---      ---        Orf 27   UL31      UL53      BFLF2     Orf 69
 3   Orf 1     ---       ---       ---      ---        Orf 60   UL1       ---       ---       ---
 4   Orf 1     ---       ---       ---      ---        Orf 62   ICP4      RL1       ---       ---
 5   Orf 2     ---       ---       ---      ---        Orf 25   UL33      UL51      BFRF4     Orf 67.5
 6   Orf 3     UL55      ---       ---      ---        Orf 16   UL42      UL82      ---       ---
 7   Orf 3     UL55      ---       ---      ---        Orf 25   UL33      UL51      BFRF4     Orf 67.5
 8   Orf 3     UL55      ---       ---      ---        Orf 39   UL20      ---       ---       ---
 9   Orf 3     UL55      ---       ---      ---        Orf 46   UL14      ---       ---       ---
10   Orf 3     UL55      ---       ---      ---        Orf 60   UL1       ---       ---       ---
11   Orf 4     UL54      UL69      BMLF1    Orf 57     Orf 38   UL21      ---       ---       ---
12   Orf 4     UL54      UL69      BMLF1    Orf 57     Orf 62   ICP4      RL1       ---       ---
13   Orf 7     UL51      ---       ---      ---        Orf 7    UL51      ---       ---       ---
14   Orf 8     UL50      UL72      BLLF3    Orf 54     Orf 19   UL39      UL45      BORF2     Orf 61
15   Orf 8     UL50      UL72      BLLF3    Orf 54     Orf 25   UL33      UL51      BFRF4     Orf 67.5
16   Orf 8     UL50      UL72      BLLF3    Orf 54     Orf 39   UL20      ---       ---       ---
17   Orf 9     UL49      ---       ---      ---        Orf 9a   ---       ---       ---       ---
18   Orf 9     UL49      ---       ---      ---        Orf 56   UL4       ---       ---       ---
19   Orf 9     UL49      ---       ---      ---        Orf 67   US7       ---       ---       ---
20   Orf 9a    ---       ---       ---      ---        Orf 22   UL36      UL48      BPLF1     Orf 64
21   Orf 9a    ---       ---       ---      ---        Orf 23   UL35      ---       ---       ---
22   Orf 9a    ---       ---       ---      ---        Orf 25   UL33      UL51      BFRF4     Orf 67.5
23   Orf 9a    ---       ---       ---      ---        Orf 27   UL31      UL53      BFLF2     Orf 69
24   Orf 9a    ---       ---       ---      ---        Orf 56   UL4       ---       ---       ---
25   Orf 9a    ---       ---       ---      ---        Orf 60   UL1       ---       ---       ---
26   Orf 11    UL47      ---       ---      ---        Orf 27   UL31      UL53      BFLF2     Orf 69
27   Orf 11    UL47      ---       ---      ---        Orf 38   UL21      ---       ---       ---
28   Orf 12    UL46      ---       ---      ---        Orf 25   UL33      UL51      BFRF4     Orf 67.5
29   Orf 12    UL46      ---       ---      ---        Orf 60   UL1       ---       ---       ---
30   Orf 14    UL44      ---       ---      ---        Orf 56   UL4       ---       ---       ---
31   Orf 15    ---       US21      ---      ---        Orf 25   UL33      UL51      BFRF4     Orf 67.5
32   Orf 15    ---       US21      ---      ---        Orf 60   UL1       ---       ---       ---
33   Orf 16    UL42      UL82      ---      ---        Orf 16   UL42      UL82      ---       ---
34   Orf 18    UL40      ---       BARF1    Orf 60     Orf 19   UL39      UL45      BORF2     Orf 61
35   Orf 18    UL40      ---       BARF1    Orf 60     Orf 23   UL35      ---       ---       ---
36   Orf 18    UL40      ---       BARF1    Orf 60     Orf 25   UL33      UL51      BFRF4     Orf 67.5
37   Orf 19    UL39      UL45      BORF2    Orf 61     Orf 16   UL42      UL82      ---       ---
38   Orf 19    UL39      UL45      BORF2    Orf 61     Orf 19   UL39      UL45      BORF2     Orf 61
39   Orf 19    UL39      UL45      BORF2    Orf 61     Orf 25   UL33      UL51      BFRF4     Orf 67.5
40   Orf 19    UL39      UL45      BORF2    Orf 61     Orf 27   UL31      UL53      BFLF2     Orf 69
41   Orf 19    UL39      UL45      BORF2    Orf 61     Orf 38   UL21      ---       ---       ---
42   Orf 19    UL39      UL45      BORF2    Orf 61     Orf 62   ICP4      RL1       ---       ---
43   Orf 21    UL37      US29      ---      ---        Orf 22   UL36      UL48      BPLF1     Orf 64
44   Orf 21    UL37      US29      ---      ---        Orf 23   UL35      ---       ---       ---
45   Orf 21    UL37      US29      ---      ---        Orf 27   UL31      UL53      BFLF2     Orf 69
46   Orf 23    UL35      ---       ---      ---        Orf 27   UL31      UL53      BFLF2     Orf 69
47   Orf 23    UL35      ---       ---      ---        Orf 39   UL20      ---       ---       ---
48   Orf 23    UL35      ---       ---      ---        Orf 60   UL1       ---       ---       ---
49   Orf 24    UL34      UL50      BFRF1    Orf 67     Orf 16   UL42      UL82      ---       ---
50   Orf 24    UL34      UL50      BFRF1    Orf 67     Orf 25   UL33      UL51      BFRF4     Orf 67.5
51   Orf 24    UL34      UL50      BFRF1    Orf 67     Orf 27   UL31      UL53      BFLF2     Orf 69
52   Orf 24    UL34      UL50      BFRF1    Orf 67     Orf 39   UL20      ---       ---       ---
53   Orf 24    UL34      UL50      BFRF1    Orf 67     Orf 52   UL8       UL102     BBLF2     Orf 40
54   Orf 24    UL34      UL50      BFRF1    Orf 67     Orf 60   UL1       ---       ---       ---
55   Orf 24    UL34      UL50      BFRF1    Orf 67     Orf 62   ICP4      RL1       ---       ---
56   Orf 25    UL33      UL51      BFRF4    Orf 67.5   Orf 25   UL33      UL51      BFRF4     Orf 67.5
57   Orf 25    UL33      UL51      BFRF4    Orf 67.5   Orf 38   UL21      ---       ---       ---
58   Orf 25    UL33      UL51      BFRF4    Orf 67.5   Orf 39   UL20      ---       ---       ---
59   Orf 26    UL32      UL52      BFLF1    Orf 68     Orf 26   UL32      UL52      BFLF1     Orf 68
60   Orf 26    UL32      UL52      BFLF1    Orf 68     Orf 38   UL21      ---       ---       ---
61   Orf 27    UL31      UL53      BFLF2    Orf 69     Orf 16   UL42      UL82      ---       ---




Uetz.SOM.doc                                             12
62    Orf 27     UL31   UL53    BFLF2   Orf 69    Orf 22   UL36   UL48   BPLF1   Orf 64
63    Orf 27     UL31   UL53    BFLF2   Orf 69    Orf 25   UL33   UL51   BFRF4   Orf 67.5
64    Orf 27     UL31   UL53    BFLF2   Orf 69    Orf 27   UL31   UL53   BFLF2   Orf 69
65    Orf 27     UL31   UL53    BFLF2   Orf 69    Orf 33   UL26   UL80   BVFR2   Orf 17
66    Orf 27     UL31   UL53    BFLF2   Orf 69    Orf 34   UL25   UL77   BVRF1   Orf 19
67    Orf 27     UL31   UL53    BFLF2   Orf 69    Orf 60   UL1    ---    ---     ---
68    Orf 27     UL31   UL53    BFLF2   Orf 69    Orf 62   ICP4   RL1    ---     ---
69    Orf 28     UL30   UL54    BALF5   Orf 9     Orf 60   UL1    ---    ---     ---
70    Orf 30     UL28   UL56    BALF3   Orf 7     Orf 25   UL33   UL51   BFRF4   Orf 67.5
71    Orf 32     ---    ---     ---     ---       Orf 25   UL33   UL51   BFRF4   Orf 67.5
72    Orf 32     ---    ---     ---     ---       Orf 39   UL20   ---    ---     ---
73    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 12   UL46   ---    ---     ---
74    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 16   UL42   UL82   ---     ---
75    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 21   UL37   US29   ---     ---
76    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 22   UL36   UL48   BPLF1   Orf 64
77    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 25   UL33   UL51   BFRF4   Orf 67.5
78    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 33   UL26   UL80   BVFR2   Orf 17
79    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 56   UL4    ---    ---     ---
80    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 60   UL1    ---    ---     ---
81    Orf 33     UL26   UL80    BVFR2   Orf 17    Orf 66   US3    ---    ---     ---
82    Orf 33.5   ---    ---     ---     ---       Orf 12   UL46   ---    ---     ---
83    Orf 33.5   ---    ---     ---     ---       Orf 18   UL40   ---    BARF1   Orf 60
84    Orf 33.5   ---    ---     ---     ---       Orf 21   UL37   US29   ---     ---
85    Orf 33.5   ---    ---     ---     ---       Orf 22   UL36   UL48   BPLF1   Orf 64
86    Orf 33.5   ---    ---     ---     ---       Orf 25   UL33   UL51   BFRF4   Orf 67.5
87    Orf 33.5   ---    ---     ---     ---       Orf 27   UL31   UL53   BFLF2   Orf 69
88    Orf 33.5   ---    ---     ---     ---       Orf 33   UL26   UL80   BVFR2   Orf 17
89    Orf 33.5   ---    ---     ---     ---       Orf 56   UL4    ---    ---     ---
90    Orf 33.5   ---    ---     ---     ---       Orf 60   UL1    ---    ---     ---
91    Orf 33.5   ---    ---     ---     ---       Orf 66   US3    ---    ---     ---
92    Orf 34     UL25   UL77    BVRF1   Orf 19    Orf 22   UL36   UL48   BPLF1   Orf 64
93    Orf 34     UL25   UL77    BVRF1   Orf 19    Orf 34   UL25   UL77   BVRF1   Orf 19
94    Orf 36     UL23   ---     BXLF1   Orf 21    Orf 25   UL33   UL51   BFRF4   Orf 67.5
95    Orf 36     UL23   ---     BXLF1   Orf 21    Orf 36   UL23   ---    BXLF1   Orf 21
96    Orf 36     UL23   ---     BXLF1   Orf 21    S/L      ---    ---    ---     ---
97    Orf 38     UL21   ---     ---     ---       Orf 27   UL31   UL53   BFLF2   Orf 69
98    Orf 38     UL21   ---     ---     ---       Orf 44   UL16   UL94   BGLF2   Orf 33
99    Orf 39     UL20   ---     ---     ---       Orf 39   UL20   ---    ---     ---
100   Orf 41     UL18   UL85    BDLF1   Orf 26    Orf 18   UL40   ---    BARF1   Orf 60
101   Orf 41     UL18   UL85    BDLF1   Orf 26    Orf 22   UL36   UL48   BPLF1   Orf 64
102   Orf 41     UL18   UL85    BDLF1   Orf 26    Orf 25   UL33   UL51   BFRF4   Orf 67.5
103   Orf 41     UL18   UL85    BDLF1   Orf 26    Orf 56   UL4    ---    ---     ---
104   Orf 41     UL18   UL85    BDLF1   Orf 26    Orf 60   UL1    ---    ---     ---
105   Orf 42     UL15   UL89    BDRF1   Orf 29b   Orf 16   UL42   UL82   ---     ---
106   Orf 42     UL15   UL89    BDRF1   Orf 29b   Orf 21   UL37   US29   ---     ---
107   Orf 42     UL15   UL89    BDRF1   Orf 29b   Orf 25   UL33   UL51   BFRF4   Orf 67.5
108   Orf 42     UL15   UL89    BDRF1   Orf 29b   Orf 27   UL31   UL53   BFLF2   Orf 69
109   Orf 42     UL15   UL89    BDRF1   Orf 29b   Orf 34   UL25   UL77   BVRF1   Orf 19
110   Orf 42     UL15   UL89    BDRF1   Orf 29b   Orf 39   UL20   ---    ---     ---
111   Orf 42     UL15   UL89    BDRF1   Orf 29b   Orf 60   UL1    ---    ---     ---
112   Orf 43     UL17   UL93    BGLF1   Orf 32    Orf 19   UL39   UL45   BORF2   Orf 61
113   Orf 43     UL17   UL93    BGLF1   Orf 32    Orf 22   UL36   UL48   BPLF1   Orf 64
114   Orf 43     UL17   UL93    BGLF1   Orf 32    Orf 25   UL33   UL51   BFRF4   Orf 67.5
115   Orf 43     UL17   UL93    BGLF1   Orf 32    Orf 27   UL31   UL53   BFLF2   Orf 69
116   Orf 43     UL17   UL93    BGLF1   Orf 32    Orf 60   UL1    ---    ---     ---
117   Orf 43     UL17   UL93    BGLF1   Orf 32    Orf 65   ---    ---    ---     ---
118   Orf 44     UL16   UL94    BGLF2   Orf 33    Orf 25   UL33   UL51   BFRF4   Orf 67.5
119   Orf 44     UL16   UL94    BGLF2   Orf 33    Orf 61   ICP0          ---     ---
120   Orf 44     UL16   UL94    BGLF2   Orf 33    Orf 62   ICP4   RL1    ---     ---
121   Orf 46     UL14   ---     ---     ---       Orf 17   UL41   ---    ---     ---
122   Orf 46     UL14   ---     ---     ---       Orf 24   UL34   UL50   BFRF1   Orf 67
123   Orf 46     UL14   ---     ---     ---       Orf 26   UL32   UL52   BFLF1   Orf 68
124   Orf 46     UL14   ---     ---     ---       Orf 38   UL21   ---    ---     ---
125   Orf 46     UL14   ---     ---     ---       Orf 45   ---    ---    BGRF1   Orf 29a
126   Orf 49     ---    ---     ---     ---       Orf 25   UL33   UL51   BFRF4   Orf 67.5
127   Orf 50     UL10   UL100   BBRF3   Orf 39    Orf 25   UL33   UL51   BFRF4   Orf 67.5




Uetz.SOM.doc                                        13
128   Orf 50   UL10    UL100    BBRF3    Orf 39   Orf 27    UL31     UL53     BFLF2    Orf 69
129   Orf 50   UL10    UL100    BBRF3    Orf 39   Orf 50    UL10     UL100    BBRF3    Orf 39
130   Orf 50   UL10    UL100    BBRF3    Orf 39   Orf 61    ICP0              ---      ---
131   Orf 50   UL10    UL100    BBRF3    Orf 39   Orf 62    ICP4     RL1      ---      ---
132   Orf 51   UL9     ---      ---      ---      Orf 25    UL33     UL51     BFRF4    Orf 67.5
133   Orf 52   UL8     UL102    BBLF2    Orf 40   Orf 25    UL33     UL51     BFRF4    Orf 67.5
134   Orf 53   UL7     UL103    BBRF2    Orf 42   Orf 7     UL51     ---      ---      ---
135   Orf 55   UL5     UL105    BBLF4    Orf 44   Orf 25    UL33     UL51     BFRF4    Orf 67.5
136   Orf 55   UL5     UL105    BBLF4    Orf 44   Orf 61    ICP0              ---      ---
137   Orf 56   UL4     ---      ---      ---      Orf 25    UL33     UL51     BFRF4    Orf 67.5
138   Orf 57   ---     ---      ---      ---      Orf 10    UL48     ---      ---      ---
139   Orf 57   ---     ---      ---      ---      Orf 25    UL33     UL51     BFRF4    Orf 67.5
140   Orf 59   UL2     UL114    BKRF3    Orf 46   Orf 16    UL42     UL82     ---      ---
141   Orf 59   UL2     UL114    BKRF3    Orf 46   Orf 18    UL40     ---      BARF1    Orf 60
142   Orf 59   UL2     UL114    BKRF3    Orf 46   Orf 22    UL36     UL48     BPLF1    Orf 64
143   Orf 59   UL2     UL114    BKRF3    Orf 46   Orf 25    UL33     UL51     BFRF4    Orf 67.5
144   Orf 59   UL2     UL114    BKRF3    Orf 46   Orf 39    UL20     ---      ---      ---
145   Orf 60   UL1     ---      ---      ---      Orf 60    UL1      ---      ---      ---
146   Orf 61   ICP0             ---      ---      Orf 61    ICP0              ---      ---
147   Orf 61   ICP0             ---      ---      Orf 62    ICP4     RL1      ---      ---
148   Orf 64   US10    UL25     ---      ---      Orf 16    UL42     UL82     ---      ---
149   Orf 64   US10    UL25     ---      ---      Orf 25    UL33     UL51     BFRF4    Orf 67.5
150   Orf 64   US10    UL25     ---      ---      Orf 27    UL31     UL53     BFLF2    Orf 69
151   Orf 64   US10    UL25     ---      ---      Orf 39    UL20     ---      ---      ---
152   Orf 65   ---     ---      ---      ---      Orf 18    UL40     ---      BARF1    Orf 60
153   Orf 65   ---     ---      ---      ---      Orf 21    UL37     US29     ---      ---
154   Orf 65   ---     ---      ---      ---      Orf 22    UL36     UL48     BPLF1    Orf 64
155   Orf 65   ---     ---      ---      ---      Orf 23    UL35     ---      ---      ---
156   Orf 65   ---     ---      ---      ---      Orf 25    UL33     UL51     BFRF4    Orf 67.5
157   Orf 65   ---     ---      ---      ---      Orf 27    UL31     UL53     BFLF2    Orf 69
158   Orf 65   ---     ---      ---      ---      Orf 39    UL20     ---      ---      ---
159   Orf 65   ---     ---      ---      ---      Orf 42    UL15     UL89     BDRF1    Orf 29b
160   Orf 65   ---     ---      ---      ---      Orf 56    UL4      ---      ---      ---
161   Orf 65   ---     ---      ---      ---      Orf 60    UL1      ---      ---      ---
162   Orf 65   ---     ---      ---      ---      Orf 67    US7      ---      ---      ---
163   Orf 67   US7     ---      ---      ---      Orf 25    UL33     UL51     BFRF4    Orf 67.5
164   Orf 68   US8     ---      ---      ---      Orf 22    UL36     UL48     BPLF1    Orf 64
165   Orf 68   US8     ---      ---      ---      Orf 23    UL35     ---      ---      ---
166   Orf 68   US8     ---      ---      ---      Orf 25    UL33     UL51     BFRF4    Orf 67.5
167   Orf 68   US8     ---      ---      ---      Orf 27    UL31     UL53     BFLF2    Orf 69
168   Orf 68   US8     ---      ---      ---      Orf 39    UL20     ---      ---      ---
169   Orf 68   US8     ---      ---      ---      Orf 60    UL1      ---      ---      ---
170   Orf 68   US8     ---      ---      ---      Orf 61    ICP0              ---      ---
171   S/L      ---     ---      ---      ---      Orf 25    UL33     UL51     BFRF4    Orf 67.5
172   S/L      ---     ---      ---      ---      Orf 39    UL20     ---      ---      ---
173   S/L      ---     ---      ---      ---      Orf 62    ICP4     RL1      ---      ---

Blue = orthologous protein pairs in KSHV and VZV
Red = orthologous interactions, predicted in KSHV from VZV data and detected in KSHV


Table S5: Degree distribution of herpesviral protein interaction networks (statistics).

To evaluate which distribution models fit best to the viral networks, we used the leave-one-out cross

validation (CV) approach, as well as the theoretical Bayesian Information Criterion (BIC), which takes

into account model complexity. For comparison, the degree distributions of VZV and S. cerevisiae protein

interaction networks are also fitted under the three models. For each network-model combination the sum

of squared errors (SSE) from CV and the BIC are given (SSE/BIC). The results indicate that a power-law



Uetz.SOM.doc                                         14
distribution is an approximation for the two viral (and some cellular) networks but that other distributions

also fit to some extent.

                                 power-law                   poisson                 exponential

            KSHV                 4.41/23.05                 5.24/26.72                2.33/15.30

            VZV                  3.92/27.20                 12.85/40.28               10.21/32.65

      S. cerevisiae              12.67/56.32                10.86/48.69               27.02/68.50




Table S6: Validation of viral protein interactions in KSHV (statistics).

Protein pairs that were confirmed by β-Gal assays (Gal +) or not (Gal -) or by CoIP (CoIP +) or not (CoIP

-) were tested for their average expression correlation (AEC). The number of viral proteins investigated in

total was restricted to 77 since only for these published expression profiling data were available. The AEC

is the average of all Pearson correlations of the two expression profiles of the interacting pairs

(respectively non-interacting pairs). Unlike mRNA experiments for cells, where diverse conditions lead to

diverse expression levels among different genes, the KSHV expression analysis essentially measure the

latency to lytic transition and hence all genes share a positive expression correlation. Despite this general

background, the subtle effect of protein interactions could still be detected and used to validate different

datasets.

   Interactions/AEC*                  all                      CoIP -                    CoIP +

             all                   77/0.804                   41/0.822                  36/0.858

            Gal -                  46/0.834                   26/0.821                  20/0.849

            Gal +                  31/0.847                   15/0.824                  16/0.868

*AEC...average expression correlation; CoIP...co-immunoprecipitation; Gal...β-galactosidase assay. AEC for
random pairs of Orfs was determined to be 0.804, for interacting pairs 0.839 [p=0.0004].




Uetz.SOM.doc                                           15
Table S7: Interaction between functional classes (statistics).

   rate ratio/
                     replication      gene regulation         structure     host interaction     unknown
    p-value
  replication        0.652*0.320        0.815*0.496          0.869*0.366      1.839*0.998       0.815*0.391

gene regulation                         4.076*0.993          0.543*0.192      0.418*0.138       1.019*0.659

   structure                                                 1.062*0.660      1.059*0.664       0.905*0.448

host interaction                                                              0.514*0.105       0.836*0.375

   unknown                                                                                      2.038*0.971

Significantly over- or underrepresented interactions between functional classes are indicated in red.


For each pair of functional classes, over- or underrepresentation of interactions between them is quantified

by both rate ratio and p-value. The rate ratio is given by the observed frequency of interactions divided by

the background frequency, while the p-value is the probability of having no more interactions than

observed under the binomial model. To filter out a potential bias due to network topology, simulated

networks with a similar size and degree distribution were generated to estimate the empirical p-value,

which closely approximates the theoretical p-value (data not shown).

Table S8: Interaction between phylogenetic classes (statistics).

      rate ratio/
                              KSHV                       γ                     βγ                       αβγ
       p-value
       KSHV                 0.492*0.021            0.689*0.065             1.494*0.927           1.067*0.690

          γ                                        0.962*0.547             0.781*0.416           0.893*0.369

          βγ                                                               1.270*0.813           1.088*0.686

         αβγ                                                                                     1.451*0.941
Significantly over- or underrepresented interactions between proteins with orthologs in the indicated
herpesvirus subfamilies or KSHV are indicated in red.


Table S9: Predicted and verified KSHV-human protein interactions.
The cellular ORFs were cloned by recombinatorial cloning from different cDNA libraries or RZPD clones
using proof-reading Taq polymerase into entry as well as Y2H bait and prey vectors, and subsequently
confirmed by restriction digest and Western Blot. The Y2H analysis was performed in quadruplicates
similar as described in Material and Methods, the CoIP as described in the legend to Figure S2.


Uetz.SOM.doc                                                 16
                      viral                                                 Y2H      CoIP
                     protein              cellular protein
                1.    ORF2         ENSG00000132581            SDF2        +            +
                2.    ORF9         ENSG00000106628            DPD2        +            +
                3.   ORF18         ENSG00000121022           121022        -           +
                4.   ORF18         ENSG00000126561            ST5A         -           +
                5.   ORF18         ENSG00000173757            ST5B       n.d.         n.d.
                6.   ORF18         ENSG00000174444             RL4         -            -
                7.   ORF36         ENSG00000092621           SERA          -            -
                8.   ORF36         ENSG00000104884            XPD          -           +
                9.   ORF36         ENSG00000131459            GFA2        +            +
               10.   ORF36         ENSG00000149554           CHK1          -           +
               11.   ORF36         ENSG00000175324           LSM1          -            -
               12.   ORF46         ENSG00000132646           PCNA          -           +
               13.   ORF60         ENSG00000100242            U84B         -           +
               14.   ORF60         ENSG00000105011              -         +            +
               15.   ORF60         ENSG00000149100              -          -           +
               16.   ORF60         ENSG00000171848            RIR2         -            -
               17.   ORF61         ENSG00000167325            RIR1         -           +
               18.   ORF72         ENSG00000105810           CDK6          -           +
               19.   ORF72         ENSG00000108504           CDK3         +             -
               20.   ORF72         ENSG00000123975            CKS2         -            -
                                confirmed interactions                   5/19        13/19
                                     (percentage)                      (26.3%)      (68.4%)
                     n.d. not done


Table S10: Predicted VZV-human protein interactions.
                                viral
                                                         cellular protein
                               protein
                      1.       ORF17           ENSG00000167740                 -
                      2.       ORF18           ENSG00000100242               U84B
                      3.       ORF18           ENSG00000105011                 -
                      4.       ORF18           ENSG00000149100                 -
                      5.       ORF18           ENSG00000171848               RIR2
                      6.       ORF19           ENSG00000167325               RIR1
                      7.       ORF28           ENSG00000106628               DPD2
                      8.       ORF31           ENSG00000094804                 -
                      9.       ORF31           ENSG00000108504               CDK3
                      10.      ORF31           ENSG00000115942               ORC2
                      11.      ORF31           ENSG00000115947               ORC4
                      12.      ORF31           ENSG00000164815               ORC5
                      13.      ORF36           ENSG00000101347               SAD1
                      14.      ORF59           ENSG00000132646               PCNA
                      15.      ORF61           ENSG00000180573               H2AL




Uetz.SOM.doc                                     17
                      16.     ORF61          ENSG00000188486          H2AX
                      17.     ORF66          ENSG00000072062          KAPA
                      18.     ORF66          ENSG00000075785          RAB7
                      19.     ORF66          ENSG00000100504          PHS1
                      20.     ORF66          ENSG00000114302          KAP2
                      21.     ORF66          ENSG00000117054          ACDM
                      22.     ORF66          ENSG00000122741             -
                      23.     ORF66          ENSG00000139668             -
                      24.     ORF66          ENSG00000142875          KAPB
                      25.     ORF66          ENSG00000167323          STM1
                      26.     ORF66          ENSG00000168724             -
                      27.     ORF66          ENSG00000171497           PPID
                      28.     ORF66          ENSG00000184432          COPP


References

  1. A. J. Davison and J. E. Scott, J.Gen.Virol. 67 ( Pt 9), 1759-1816 (1986).

  2. J. J. Russo et al., Proc.Natl.Acad.Sci.U.S.A. 93, 14862-14867 (1996).

  3. M. Takahashi, T. Otsuka, Y. Okuno, Y. Asano, T. Yazaki, Lancet 2, 1288-1290 (1974).

  4. P. Uetz et al., Nature 403, 623-627 (2000).

  5. G. Cagney, P. Uetz, S. Fields, Methods Enzymol. 328, 3-14 (2000).

  6. R. G. Jenner, M. M. Alba, C. Boshoff, P. Kellam, J Virol 75, 891-902 (2001).

  7. J. D. Han et al., Nature 430, 88-93 (2004).

  8. R. Tanaka, T. M. Yi, J. Doyle, FEBS Lett. 579, 5140-5144 (2005).

  9. P. Lo, X. Yu, I. Atanasov, B. Chandran, Z. H. Zhou, J.Virol. 77, 4291-4297 (2003).

10. Y. Izumiya et al., J.Virol. 77, 1441-1451 (2003).

11. P. Malik, D. J. Blackbourn, M. F. Cheng, G. S. Hayward, J. B. Clements, J Gen.Virol. 85,
    2155-2166 (2004).

12. Y. Sun and J. Conner, Biochem.J. 347 Pt 1, 97-104 (2000).

13. S. Kliche et al., Mol.Cell 7, 833-843 (2001).

14. M. Tanaka, H. Kagawa, Y. Yamanashi, T. Sata, Y. Kawaguchi, J.Virol. 77, 1382-1391
    (2003).




Uetz.SOM.doc                                   18
15. M. Messerle, I. Crnkovic, W. Hammerschmidt, H. Ziegler, U. H. Koszinowski,
    Proc.Natl.Acad.Sci.U.S.A. 94, 14759-14763 (97 A.D.).

16. H. J. Delecluse, T. Hilsendegen, D. Pich, R. Zeidler, W. Hammerschmidt, Proc Natl Acad
    Sci U S A 95, 8245-8250 (1998).




Uetz.SOM.doc                                19
Figure S1:


 a



 b
Figure S2:
Figure S3:




             a                        b




                 distinct   similar
Figure S5:
Figure S6:




      a      b




                 low   high
                                                                         Figure S7:




                                                                 b
                                                                     a
                  # of interaction partners




      0
          2
                      4
                              6
                                               8
                                                     10
                                                           12
 ORF 6
 ORF 9
ORF 22
ORF 23
ORF 25
ORF 27
ORF 29b
ORF 31
ORF 34
ORF 36
ORF 37
ORF 39
ORF 45
ORF 47
ORF 49
ORF 50
ORF 52
ORF 53
ORF 54
ORF 56
ORF 57
ORF 58
ORF 59
ORF 60
ORF 61
ORF 62
ORF 63
ORF 65
ORF 68
ORF 69
ORF 75




      0
          0,1
                      0,2
                              0,3
                                               0,4
                                                     0,5
                                                           0,6




                homology (% id) to EBV ortholog




                             Reihe1
                                      Reihe2
Figure S8:
             a
                     20
                                             replication
                                             gene regulation
                 #                           morphogenesis,structure
                     15                      virus-host interaction
                                             unknown


                     10



                      5



                      0
                                 KSHV              γ                 βγ          αβγ
                                                                     phylogenetic class




             b            size        functional group               interaction with


                                        replication
                                                                          *
                                      gene regulation
                                                             *
                                         structure


                                      host interaction           *
                                         unknown
                                                                          *
                     30 20 10     0          #           0       10 20 30 40 50 60 70




             c            size    phylogenetic group                 interaction with


                                           KSHV              *
                                              γ


                                             βγ


                                             αβγ


                      30 20 10    0          #           0       10 20 30 40 50 60 70
Figure S9:
Figure S10:

								
To top