Biochemistry

Document Sample
Biochemistry Powered By Docstoc
					Biochemistry

The Chemistry of Life
You are chemistry.
 BIOCHEMISTRY: The study of the
  molecular basis of life and its processes.
 Biochemists have to understand both the
  living and chemical world well.
 KEY: Many biological processes are the
  same in different organisms Their basic
  building blocks and pathways are the
  same.
BIOMOLECULES
1.   Carbohydrates
2.   Lipids
3.   Proteins
4.   Nucleic Acids
CARBOHYDRATES

                Bread

                Pasta

                Rice
Carbohydrates
   ―Hydrates of carbon‖ (C, H, & O)
   Polyhydroxy aldehydes
    (ALDOSES) or ketones
    (KETOSES)
   Usually Cx(H2O)y
   ―Sugars‖
   Single unit: Monosaccharide
   Two units: Disaccharide
   Three units: Trisaccharide, etc.
   Many units: Polysaccharide
    Some Common Disaccharides
   Sucrose: Table Sugar
        Glucose+Fructose




   Lactose: Milk sugar
        Glucose+Galactose




   Maltose: Malt/Barley sugar
        Glucose+Glucose
Some Common Polysaccharides

   Starch: glucose polymer (alpha)
        Potato, rice, wheat, corn

   Glycogen: branched glucose
    polymer
        Animal storage

   Cellulose: glucose polymer (beta)
        Plant structures, paper, cotton,
         wood

   Chitin: Modified glucose (N-Acetyl
    Glucose)
        Fungi cell wall, insect exoskeleton
http://www.bmb.psu.edu/courses/bisci004a/chemtutor/polysac2.jpg
http://www.bmb.psu.edu/courses/bisci004a/chemtutor/polysac1.jpg
CARBOHYDRATES
 Extra carbohydrates is stored in the liver
  and muscle tissues as glycogen
 Large excess are converted to fat
 Carbohydrates supply 4 kcal of energy per
  gram
On the ―Sugarfree‖ Phenomenon
   Saccharin
     Oldestartificial
      sweetener
   Aspartame and
    Acesulfame-K
     Not   carbohydrates
   Sucralose
     ―Splenda‖
LIPIDS
   Lipid – a cellular
    constituent that is soluble
    in organic solvents (e.g.
    hexane); insoluble in water
   Lipid family
       Fatty acids (long chain
        carboxylic acids)
       Phospholipids - forms the cell
        membrane
       Steroids (e.g. cholesterol and
        sex hormones)
       Fat soluble vitamins
Fatty Acids




              http://biology.clc.uc.edu/graphics/bio104/fat.jpg
Fatty Acids




              http://biology.clc.uc.edu/graphics/bio104/fatty%20acid.jpg
Fatty Acids




              http://biology.clc.uc.edu/graphics/bio104/cistrans.jpg
 Phospholipids
 Made   from glycerol, two fatty acids, and
  (in place of the third fatty acid) a
  phosphate group with some other
  molecule attached to its other end
 Contains a ―hydrophobic‖ and
  ―hydrophillic‖ group
  Hydrophobic   – water hating, not soluble in
   water
  Hydrophilic – water loving, soluble in water
Phospholipids




                http://biology.clc.uc.edu/graphics/bio104/lecithin.jpg
Phospholipids




                http://www.sirinet.net/~jgjohnso/membranebilayer.jpg
Cell Membrane




                http://www.sirinet.net/~jgjohnso/cellmembranes15.jpg
 Steroids                                               CH3    OH


        Biological molecules                     CH3

         that perform diverse
         functions                                      testosterone
                                             O
        Consists of four
         fused rings
                                                         CH3    O
                           CH3
                 H3C                   CH3

                  CH3
                                 CH3

           CH3


                        cholesterol          HO          estrogen
HO
Functions of Fats
   Used to build cells and parts of the cell (e.g.
    brain cells, nerve tissues, cell membrane)
   Stored in the body in adipose tissue
     Adipose    tissue are called fat depots
   Surround vital organs (e.g. heart, kidney,
    spleen) to serve as protective cushion
   Stored under the skin for insulation
   Fat reserves are converted to glycerol and fatty
    acids ( 9 kcal per gram)
     Glycerol   is burned for energy or converted to glucose
Fats and Health
   Lipoproteins
     Group  of proteins with a triglyceride or cholesterol
     Very-low density lipoprotein (VLDL)
          Transport triglycerides
     Low    density lipoprotein (LDL)
          Transport cholesterol to cells
     High   density lipoprotein (HDL)
          Transport cholesterol to liver
   On Coconut Oil
C8 ...... 8.86 (Caprylic)
C10......6.17 (Capric)
C12......48.83 (Lauric)
C14......19.97 (Myristic)
C15......Traces (0.01)
C16.......7.84 (Palmitic)
C18.......3.06 (Stearic)
C18:2 ....0.76
C18:1.....4.44
C20........0.05 (Arachidic)
Regular Coconut Oil (RBD) vs.
VCO
• RBD
  • Refined, bleached, deodorized
  • From highly processed copra
• VCO
  1. Quick drying of fresh coconut meat
     which is then used to press out the
     oil.
  2. Wet-milling. "Coconut milk" is
     expressed first by pressing. The oil
     is then further separated from the
     water. Methods which can be used
     to separate the oil from the water
     include boiling, fermentation,
     refrigeration, enzymes, and
     mechanical centrifuge.
 Crisco and Olestra (by P&G)
1911: Shortening




           ―To eat, or not to eat - fat is the question.”
           - from the Introduction of Mary Enig, Know your Fats: The
           Complete Primer for Understanding the Nutrition of Fats, Oils,
           and Cholesterol, Bethesda Press, USA, 2000.
Olestra
 1998, Proctor and Gamble introduced a
  new fat/oil substitute called Olestra (brand
  name Olean®
 material replaces fats in snack foods such
  as potato chips
 claimed that food using Olestra in place of
  digestible fats provide less calories since
  the Olestra is not digested and passes
  through the body unchanged
 Some side effects include abdominal
  cramping and loose stools
Olestra
How does Olestra work?




          http://www.cnn.com/HEALTH/9802/10/fakefat.olestra/olestra.large.jpg
Olean®
Olean®




         http://static.howstuffworks.com/gif/question526-fat-chips.jpg
         http://static.howstuffworks.com/gif/question526-olestra-chips.jpg
Proteins
   Made up of amino acids
   The side groups are
    what make each amino
    acid different from the
    others. Of the 20 used to
    make proteins, there are
    three groups. The three
    groups are ionic, polar
    and non-polar.
   Amino Acid Peptide 
    Polypeptide  Protein
  SIDE
  CHAIN    R       O
       +
H3 N       C   C
                   -
           H       O
      R1       O          R1       O
                      +
H2N   C    C        H3N   C    C
                                   -
      H        OH         H        O
  AMINO ACID         ZWITTERION



 AMINO ACIDS ARE ZWITTERIONS
 Synthesis of Proteins
           R1       O                     R2        O
       +                              +
H3 N       C    C
                    -
                        +     H3 N        C     C
                                                        -
           H        O                     H         O

                                              peptide
                                  R1 O        bond
                              +
                        H3N       C       C         R2          O
                                  H           NH C          C       + H2O
                                                                -
                                                    H           O
  Synthesis of Proteins
           R1 O          R2          O                  R3          O
       +                                            +
H3 N       C   C   NH C          C       +   H 3N       C       C
                                     -                                  -
           H             H           O                  H           O



                             R1 O               R2 O
                         +                                                  R3
                   H3N       C       C   NH     C           C                        O

                             H                  H               NH          C    C
                                                                                     -
                                                                            H        O
 Synthesis of Proteins
          R1 O               R2 O
      +                                    R3       O                   R4       O
H3N       C      C   NH      C    C
                                                                    +
          H                  H        NH   C    C       +    H 3N       C    C
                                                    -                                -
                                           H        O                   H        O


                     R1 O             R2 O
                 +                                      R3
          H 3N       C   C       NH   C    C                 O
                                               NH       C    C               R4          O
                     H                H
                                                        H           NH       C       C
  N-Terminal End                                                                         -
                                                                             H           O

                                                                    C-Terminal End
 Synthesis of Proteins
          R1 O         R2 O         R3   O        R4       O
      +
H3N       C   C   NH   C   C   NH   C    C   NH   C    C
                                                           -
          H            H            H             H        O


                               ≠
                               =
          R4 O         R2 O         R3   O        R1       O
  +
H3N       C   C   NH   C   C   NH   C    C   NH   C    C
                                                               -
          H            H            H             H        O
 Synthesis of Proteins
          R1 O         R2 O         R3   O        R4       O
      +
H3N       C   C   NH   C   C   NH   C    C   NH   C    C
                                                           -
          H            H            H             H        O


                               ≠
                               =
          R1 O         R3 O         R2   O        R4       O
      +
H3N       C   C   NH   C   C   NH   C    C NH     C    C
                                                               -
          H            H            H             H        O
Synthesis of Proteins
           R1 O         R2 O         R3    O             R4          O
       +
 H3N       C   C   NH   C   C   NH   C     C       NH    C       C
                                                                         -
           H            H            H                   H           O

                                ≠
           R4 O         R2 O          R3       O             R1          O
       +
 H3N       C   C   NH   C   C   NH    C        C    NH       C       C
                                                                             -
           H            H             H                      H           O

                                ≠
           R1 O         R3 O         R2    O             R4           O
       +
 H3N       C   C   NH   C   C   NH   C     C NH          C        C
                                                                         -
           H            H            H                   H            O
Proteins




      http://chemed.chem.purdue.edu/genchem/topicreview/bp/1biochem/graphics/20.gif
   Why
    is
sinigang
  tasty?
Structure of Proteins
   Primary Structure
       sequence of the amino acids in the protein
   Secondary Structure
       polypeptide chain folds back on itself to form a secondary
        structure
   Tertiary Structure
       interactions between amino acid side chains that leads to
        the three-dimensional structure of the polypeptide chain
   Quaternary Structure
       interactions between individual polypeptide chains
Protein Structure




                    25.3
Proteins
Protein Structure
Hydrogen Bonds in Parallel and Antiparallel b-pleated Sheets




                                                          25.3
                        Protein Structure
          Intermolecular Forces in a Protein Molecule




ionic forces
                     hydrogen
                      bonds              dispersion
                                           forces




        dispersion                                       ionic forces
          forces
                            dispersion   dipole-dipole
                              forces        forces

  CYSTEINE bonds and Hair rebonding
                                                               25.3
Sickle cell anemia




  HEMOGLOBIN of a                          HEMOGLOBIN of a person
  HEALTHY PERSON                              w/ SICKLE CELL
                                                  ANEMIA

            http://www.concord.org/~barbara/workbench_web/unitIV_mini/images/normHB.jpeg
            http://www.concord.org/~barbara/workbench_web/unitIV_mini/images/sickleHB.jpg
Sickle cell anemiaO
 HO
                       OH
      O         NH2

 Aspartic Acid (E)

           to

          CH3 O

  H3 C            OH
           NH2

      Valine (V)

                            http://www.pueblo.gsa.gov/cic_text/health/sicklecell/sickle.gif
THE ENZYME GLYCOSIDASE

Q: WHAT IS AN ENZYME?
A: They are proteins which act as biological catalysts that enhance
reaction rates as they provide an alternative reaction pathway that
requires less energy than an uncatalyzed reaction.

*Catalysis can happen at mild temperatures
*Very specific to the reactions they catalyze
*SUBSTRATES
*ACTIVE SITE
ENZYME CATALYSIS




            FROM: http://www.nd.edu/~aostafin/CRCD/index7.htm
ENZYME CATALYSIS




            FROM: http://www.nd.edu/~aostafin/CRCD/index7.htm
GLYCOSIDASE ACTION
                GLYCOSIDE                      Eg.
                                               GLUCOSE
                                               XYLOSE
   MOLECULE         O        SUGAR             ARABINOSE
                                               GALACTOSE
                                               RHAMNOSE, etc.
(may be inactive)
                        Hydrolysis by Enzyme




    MOLECULE        OH          HO         SUGAR
PROTEINS
   Humans can synthesize all amino acids
    except
     Isoleucine,leucine, lysine, methionine,
      phenylalanine, threonine, tryptophan, valine
   Humans have to eat food with proteins to
    get the amino acids
Sources of proteins
 Corn protein – lacks lysine and tryptophan
 Rice protein – lacks lysine and threonine
 Wheat protein – lacks lysine
 Soy protein – lacks methionine
 Lean meat, milk, fish, eggs, cheese –
  adequate proteins
Proteins and Health
   Can combine different vegetables and grains to
    have all essential amino acids
     Grains(lacks tryptophan and lysine but with
      methionine)
     Legumes (enough tryptophan and lysine but no
      methionine)
   Extreme vegetarianism
     May   lack vitamin B12, calcium, iron, riboflavin, vitamin
      D
   Modified vegetarianism
     Eg.   No red meat
NUCLEIC ACIDS
   ―We wish to suggest a
    structure for the salt of
    deoxyribonucleic acid (DNA)‖
    – 1953
   ―DNA Technology is the most
    awesome skill acquired by
    man since the splitting of the
    atom.‖-1983
   2000: Human Genome Project
    completed. 30K genes now
    expected unlike the 80K
    before.
   1860‘s: Gregor Mendel proposed heredity is
    based on the transfer of several ―factors‖
    between parents and offspring
   Early 1900‘s: T.H. Morgan et.al. proved eye
    color (as in fruit flies) depends on the transfer of
    a single chromosome from parent to offspring.
    ―Factors‖ and chromosomes are one and the
    same.
     CHROMOSOMES:       ―Colored-bodies‖
   James Watson, Francis Crick, with experimental
    data from Rosalind Franklin and Maurice Wilkins
Nucleic Acids
   Carry genetic information.
   DNA (deoxyribonucleic acids) have molecular
    weights around 6 - 16  106 amu and are found
    inside the nucleus of the cell.
   RNA (ribonucleic acids) have molecular weights
    around 20,000 to 40,000 amu and are found in
    the cytoplasm outside the nucleus of the cell.
   Nucleic acids are made up of nucleotides.
   There are three important parts to a nucleic acid:
     phosphoric  acid unit,
     five carbon sugar (e.g. deoxyribose), and
     nitrogen containing organic base (e.g. adenine).
             Nucleic Acids
                               NH2
        OH               N           Organic
Phosphoric                         N
Acid    -                            Base
      O P    O                       Unit
Unit                     N     N
        O     CH2
                    O
             HC          CH
                  CH    CH2 Deoxyribose
                            Unit
                  OH
Nitrogen Bases in Nucleic Acids
                                            O
                      NH2
                                    N
             N                                  NH
                          N
                                    NH      N    NH2
             NH       N

              Adenine               Guanine

                               O
         O                                           NH2
   H3C                             NH
             NH                                        N
                               NH       O
         NH       O                                  NH    O

     Thymine                  Uracil             Cytosine
     Nucleic Acids
   DNA consists of two deoxyribonucleic
    acid strands wound together in a
    double helix.
   The phosphate chains are wrapped
    around the outside of the DNA
    molecule.
   Complementary base pairs are formed
    from bases which optimize H-bonding:
    T and A or C and G.
   The complementary base pairs are
    held together by hydrogen bonding.
   During cell division, the DNA double
    helix unwinds.
 Base-Pair Formation by Adenine and Thymine and by
               Cytosine and Guanine




Chargaff‘s   rules
                                                     25.4
DNA & RNA Differences
   Sugar: DNA-
    deoxyribose
    RNA-ribose
   Uracil replaces
    thymine in RNA
   RNA can exist
    stably as a single
    strand)
Strand direction
   The phosphate group
    is connected at
    carbon 5 of the sugar,
    while the oxygen at
    carbon 3 forms a
    bond with the
    phosphate group of
    the next nucleotide.
   Nucleotides are liked,
    therefore, by
    phosphodiester
    bonds.
Watson-Crick DNA model (B-DNA)
1.   2 polynucleotide chains
     twisted into a right-
     handed double-helix;
     diameter of 2.4nm;
     each helical turn occurs
     at 3.4nm; 10.4bp per
     turn
2.   Base-pairing
3.   Antiparallel chains
4.   Bases on inside,
     phosphate-sugar on
     outside
Variations on DNA structure
   B-DNA: Base pairs at
    right angles; 10.4bp/turn;
    2.4nm diameter; sodium
    salt of DNA, humid
    conditions
   A-DNA: bp tilt 20 degrees
    from horizontal, 11bp per
    turn, helical turn at
    2.5nm, 2.6nm diameter;
    dehydrated DNA
   Z-DNA: bp in zigzag; left-
    handed helix; 12bp per
    turn, turn at 4.5nm; 1.8nm
    diameter
Higher-order structures
   Cruciforms: cross-like
    structures that are likely
    when DNA sequence has
    a palindrome (similar in
    principle to a hairpin
    structure)
   H-DNA: triple helix; bet.
    Polypurine strand and
    Polypyrimidine strand;
    non-conventional base-
    pairing
   Supercoiling: packages
    DNA into a compact form
PROBLEM
 Determine the complementary DNA and
  RNA sequence of the following
  sequences:
 A. 5‘ACCTTGAGTAACCAGATACCAGA3‘
 B. 3‘GGCATCGGACTAGCAAGCCAGA5‘
PROBLEM
Examine these two DNA strands. Imagining
  that they are paired to their
  complementary strand, one can tell which
  will have the higher BP. Which one is it?
A.AGTTGAGATGCCGCTGATGCCGATGC
  CCGTCGCTCGGCGCTAAGCACCATGC
B.ATATCTAATCGATTCTATTATTTCTATAT
  AGGCTAGCTAGCTATGCTTAGCTAGGC
The Genetic Code
      GENOME – ENGLISH analogy

 Nitrogenous Bases (ATCG)   Letters (a,s,f,t,r,e,…)
 Codons                     Words
 Gene                       Sentences
 Chromosome                 Chapters
 Genome                     Book
 The Central Dogma

replication


         DNA                                         Protein
                transcription          translation
                                mRNA
              RNA polymerase           Ribosome
                                       tRNA
USING THE CODE
    Messages from mRNA read from 5‘->3‘
Problem 1
What is the peptide encoded by the
 following mRNA?

3‘-AGAAUAUCGAAGCAGGGGUAGUGA-5‘
Answer 1
What is the peptide encoded by the following
 mRNA?

3‘-AG//AAU/AUC/GAA/GCA/GGG/GUA//GUGA-5‘

Met-Gly-Thr-Lys-Leu
Problem
  The following is the parent DNA strand. Assuming
    that splicing does not occur after transcription, give
    the peptide it expresses.


5’-CTATAGAATCCCCCAATGACCACGCAT-3’
  Answer 2
    The following is the parent DNA strand. Assuming
      that splicing does not occur after transcription, give
      the peptide it expresses.
 DNA: 5’-CTATAGAATCCCCCAATGACCACGCAT-3’
mRNA: 3’-GAUAUCUUAGGGGGUUACUGGUGCGUA-5’
           READ mRNA from 5’ -> 3’

     Met-Arg-Gly-His-Trp-Gly-Ile-Leu
On Cancer and Genetic Control
   Cancer: Problem of cell persistence
   Common: CLONALITY, AUTONOMY (proliferation), ANAPLASIA
    (loss of function), METASTASIS/INVASION
   Cancer cells do not die a natural death. (Apoptosis)
   They build up and ―steal‖ nutrients normal healthy cells should
    have
   As they increase in number, they may also impinge on other
    normal processes
On Cancer and Genetic Control
• We still cannot pinpoint exactly WHY one gets cancer.
• One way of explaining it is by MUTATIONS that occur in
  one‘s genetic code.
• We all have proto-oncogenes. What matters is if these
  are ―turned on‖ by some mutations.
• However, we know genetics and environment both play
  a role — different factors contribute (Bullets analogy)
   •   Diet
   •   Vices
   •   Chemical exposure
   •   Radiation exposure
   •   Heredity
• Treatment: Stop their division, kill the cells
   •   Cut off nutrients/life supply
   •   Chemicals
   •   Radiation
   •   Induce programmed cell death (apoptosis)
Some interesting genetics: Scent Compatibility




         From the 2006 Natural Products Lecture Class of Dr. Fabian Dayrit
Some interesting genetics: Scent Compatibility




         From the 2006 Natural Products Lecture Class of Dr. Fabian Dayrit
Some interesting genetics: Nature vs. Nurture
   ―Epigenetics‖: The DNA is not the only important thing. What is
    ―around it‖ is also important. (eg. Twin study) it is not just the genes
    that influence the traits and functions of an organism but also
    ‗epigenetic‘ or non-gene factors.
   These epigenetic factors are features within the cell that can be
    inherited when cells divide but they don‘t change the genes
    themselves
   Chimps and Humans are 99% similar genetically.
   Humans have similar DNA (We have same general characteristics).
    The only difference: 1 in 1000 nucleic acids!
   We take note of the ENVIRONMENT and PROTEINS, along with
    their functions
   GENOMICS PROTEOMICS,
                   METABOLOMICS
Newborn Screening
   The presence or levels of some
    markers (genes or proteins) are
    determined to check for possible
    diseases.
   Disease effects are established,
    not just correlations.
   Already being done here.
    Hopefully routine in the
    Philippines. (500-800 pesos)
   Is the extreme presented in
    GATTACA possible?                  ?
Chemistry In Action: DNA Fingerprinting
―The capacity to blunder slightly is the real marvel of DNA.
  Without this special attribute, we would still be anaerobic
  bacteria and there would be no music.‖
                                           – Lewis Thomas

―In the transmission of human culture, people always
   attempt to replicate, to pass on to the next generation
   the skills and values of the parents, but the attempt
   always fails because cultural transmission is geared to
   learning, not DNA.‖
                                           -Gregory Bateson

―There is no gene for the human spirit.‖
                                           -GATTACA

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:28
posted:9/22/2011
language:English
pages:86