Construction and validation of the APOCHIP_ a spotted oligo

Document Sample
Construction and validation of the APOCHIP_ a spotted oligo Powered By Docstoc
					 G.A.N.        Gene
              Name
1.0 Metabolism
 1.1 Carbohydrates
 1.2 Arginine Metabolism and NO formation
1.3 Aminoacids (others than arginine)
1.4 Lipids
1.5 ATP production and processing
1.6 Miscelaneous
2.0 Proteins synthesis, modification, and secretion
3.0 Ionic channels, ions transporters and related proteins
4.0 Hormones and growth factors related genes
5.0 Cytokines, chemokines and related receptors
6.0 Cytokine processing and signal transduction
7.0 MHC and related genes
8.0 Cell adhesion, cytoskeleton and related genes
9.0 Transcription factors and related genes
10.0 RNA syntheis and splicing factors
11.0 Cell cycle
12.0 Defense/repair
13.0 Apoptosis/ER stress
15.0 ESTs (non related)
          Probe            APOCHIP Gene Symbol Genename
Unique probe ID ID APOCHIP Sequence Sequence based upon Geneontology                  Locuslink
                                                                        CLASSIFICATION ID
                           NM_017094Ghr        growth hormone receptor
                                                            extracellular space; hematopoietin/interferon-class
                                                                                4.0 25235
RN00001 seq00001 ACAAATTAACGTATCATACACCAAACAGTAACAGAAGTGATTATAATAATGGAAGAAACAGT (D200-
                           NM_017094Ghr        growth hormone receptor
                                                            extracellular space; hematopoietin/interferon-class (D200-
RN00002 seq00001 TTCCTATCTTTAATGGCAAAAGAAATGACTGGGCACGAACGCCTAAACCAAAACTATG     4.0 25235
                           NM_017094Ghr        growth hormone receptor
                                                            extracellular space; hematopoietin/interferon-class (D200-
RN00003 SEQ00001 TTTCCATTCAAGCCACAAGGCTGTGTGTAAGAGAAGTAGAAGTGATGTGGTGTGACTG     4.0 25235
                           Z48225   Eif2b      eukaryotic translation initiation factor 2B factor 2B
                                                            eukaryotic translation initiation
                                                                        Normalisation
RN00004 SEQ00002 CAGCATGTGTAACGCCATCAAGTTCTTTAACAAGGAAGTCACTGGTATGAGCAGCcomplex       117019
                           Z27118   Hspa1a     heat shock ATP binding; chaperone activity; defense
                                                             70kD protein 1A 12.0
RN00005 SEQ00216 CACTTCGTGGAGGAGTTCAAGAGGAAGCACAAGAAGGACATCAGCCAGAACAAGCresponse; heat s
                           Z27118   Hspa1a     heat shock ATP binding; chaperone activity; defense response; heat s
                                                             70kD protein 1A 12.0
RN00006 seq00216 CAGGGGCGTGCCCCAGATCGAGGTGACCTTCGACATCGAACCCCAACGGCATCCTGAA
                           Z27118   Hspa1a     heat shock ATP binding; chaperone activity; defense response;
                                                             70kD protein 1A 12.0
RN00007 seq00216 TACGGGCTGGACCGGACCGGCAAGGGCGAGCGCAACGTGCTCATCTTCGACCTGGGGG heat s
                           Y09507   Hif1a      "hypoxia inducible factor 1, alpha subunit" of transcription, DNA-de
                                                            DNA binding; nucleus; regulation
RN00008 SEQ00004 AGAAACCTACCATCACTGTCACTGCCGCAACTGCCACCACCGCCACCACCACTGA        9.0 29560
                           Y09507   Hif1a      "hypoxia inducible factor 1, alpha subunit" of transcription, DNA-de
                                                            DNA binding; nucleus; regulation
RN00009 seq00004 CATGATGCTGTTGATCTTATAATGATTCTTAAACTGTATGGTTTCTTTATATGGGTAAA    9.0 29560
                           Y09507   Hif1a      "hypoxia inducible factor 1, alpha subunit" of transcription, DNA-de
                                                            DNA binding; nucleus; regulation
RN00010 seq00004 GCCTAGTATGTTAATTTGTTGAAAATACGATGTTTGGTTTTATGCACTTTGTCGCTATT    9.0 29560
                           Y08355   Sqstm1     sequestosome 1
RN00011 SEQ00005 CACAGGTGAACTCCAGTCTCTACAGATGCCAGAATCGGAAGGGCCAAGCTCTCTAGAC     1.1 113894
                           Y07704   Best5      Best5 protein
RN00012 SEQ00006 ACATTTGTTAAGTGTGACCAGCAGATACCTTGTGTCCCATGATTGATTTATGCAGAGCAGTA15.0 65190
                           Y07534   Cyp27      "cytochrome P450, family 27, subfamily a, polypeptide 1"
RN00013 seq00007 GAGAAGTGAAGTCTGTGTCCCGCATCGTCCTGGTTCCCAGCAAGAAGGTGAGCCTACG     4.0 301517
                           Y07534   Cyp27      "cytochrome P450, family 27, subfamily a, polypeptide 1"
RN00014 seq00007 GCGTAGTCTCTGGCTCTAAACTCTTGGCTTCTCAGACACGATCTATGGCTGTGTTGAG     4.0 301517
                           Y07534   Cyp27      "cytochrome P450, family 27, subfamily a, polypeptide 1"
RN00015 SEQ00007 GTCTGGCACAATCTCTACTGAGCAGCACCCATTTAAGACATTAGAGCACCTCATATCA     4.0 301517
                           Y00497   Sod2       superoxide copper, zinc superoxide dismutase activity;
                                                             dismutase 2       12.0 24787
RN00016 SEQ00008 CTCTACCTCACTACTGAACAAATCAACAGACCCAAGCTAGGCTCCTGACTGACAA iron superoxid
                           Y00396   Myc        v-myc avian myelocytomatosis9.0 24577
                                                            DNA binding; apoptosis regulator activity; cell growth and/
RN00017 SEQ00009 AAAGGCAAGTGAGGTTAGATACAAGGAACAGGGAAGCAAGAGGTTAAAGATAGCAGACAG     viral oncogene homolog
                           Y00396   Myc        v-myc avian myelocytomatosis9.0 24577
                                                            DNA binding; apoptosis regulator activity; cell
                                                                                  viral oncogene homolog
RN00018 seq00009 GGTGCCTCAAGACCTCTAAGTTCCCAGTGTTATGAGATCCTTTCTGTGGATGCTGATA growth and/
                           Y00396   Myc        v-myc avian myelocytomatosis9.0 24577
                                                            DNA binding; apoptosis regulator activity; cell
                                                                                  viral oncogene homolog
RN00019 seq00009 TTTCCTCCAATTTCTCTTCCTCAACTATAGATGAACAGAACTGACCGTCTTCCCAGGAC growth and/
                           XM_237169casp8      Rattus norvegicus CASP8 and FADD-like apoptosis regulator
RN00020 SEQ00010 GCCTTTCTTGTTTCCCAGTTCACATGAAATAACCCAGATTGTTCGCCGATTCTCCAATAT  13.0
                           XM_236690Myd88      myeloid differentiation primary 6.0 301059
RN00021 SEQ00011 CTTGTTAGACCGTGAGGATATACTGTATGAACTGAAGGACCGCATCGAGGAGGACTGC      response gene 88
                                    Pdcd7_predicted
                                               PREDICTED: Rattus norvegicus programmed cell death
RN00022 SEQ00012 GCTCATTCAAATAAGGCATGATTGGGATCAGTACCTGGTGCCGTCTGATCATCCTAAA protein 7
                           XM_236349                                           13.0
                                               Rattus norvegicus similar to Bcl-2-associated transcription
RN00023 SEQ00013 TGACCCCTCACAGTTACCAACATCACTTCCTTAGAGCTCACCTAGCCTTCCCCAACAG factor [Mus
                           XM_235965                                           13.0
                           XM_235661                    [Mus musculus] (LOC300456),
RN00024 SEQ00014 TCTCAACAAACTCTTGCCTGACGACTGTAACCGTAAGGAGCCTGAACGCGAAGACTTC    13.0 315308
                           XM_234555           "similar to protein phosphatase 1, regulatory (inhibitor)
                                                                               13.0 314465
RN00025 SEQ00015 AAAGTCTCAAACCGTTGTCCTTTCTCACATCGCCTCTCACAAAATCCTTTCCTTTCACsubunit 13B; a
                           XM_234428           similar to Maternal antigen that embryos require (Mater protein) (Oop
RN00026 SEQ00016 CACAGGGAGGGAGCAGAGTGTCAGTCCTTGGAGCTTTCTCTTCTAAACCCACCTTCAC    13.0 314328
                           XM_234132           PREDICTED: Rattus norvegicus similar to ubiquitin-conjugating enzym
RN00027 SEQ00017 CTGGCACAGTGTCAGAATTCCCACAGCATTGAGAGGTTTGAACAGGGCTC
                           XM_233843           similar to ubiquitin-conjugating enzyme
RN00028 SEQ00018 CCATTCGGAGATTTAAGAAGACTTCAATTTGTAAGGAAAGGGTTCAGCGTTGTGCCAT    13.0 313877
                           XM_231740           Rattus norvegicus similar to RIKEN cDNA G430041M01
RN00029 SEQ00019 TTTCTCGATATGGACCTCTGAGTGGTGTTAATGTGGTTTATGATCAGCGAACTGGGAG    13.0
                           XM_231067           PREDICTED: Rattus norvegicus Tnf receptor-associated factor 2
                                    Traf2_predicted
RN00030 SEQ00020 AGCCAGTGAGTGAGGTGACTTTGATGTTGCTGGACCATAACAACCGAGAG             6.0
                           XM_230377           Tnf                               6
                                    Traf6_predictedreceptor-associated factor 6.0 311245
RN00031 SEQ00021 ACGATCAAAGCTGTCCTCTGGCAAATATCATCTGTGAATACTGTGGTACAATCCTCAT
                                               Rattus norvegicus similar to mitogen-activated kinase
RN00032 SEQ00022 TTGACATGGCTAATAATGTAATTCTGTACTACGATACTGATGCTGACACTGCTCTGT kinase kinase 1
                           XM_228969
                           XM_228967           mus
RN00033 SEQ00023 TTAATTCAACGCTTCAAGAAACCCATTACAGAACATTCACCCAGGCAGGAACGGCTTA
                           XM_227484           similar to apoptosis inhibitor 6
RN00034 SEQ00024 GTTCTCAGTGAGCTGGTGAACATCAATGTCAGAGTGTCTCGCCCTGTCCTTACATTTG    13.0 310693
                           XM_226743           similar to neuronal apoptosis 13.0 294691
RN00035 SEQ00025 AGAGAGATTGAGTTTTCTGGACGATGCTTTGAAGCCATGCCATTTGTCACCTTGTTGC    inhibitory protein
                                               Rattus norvegicus neuronal apoptosis inhibitory
RN00036 SEQ00026 GTCTTTGCTAATGAAGGACTAAGAATGGACACGTTTAAGGACTGGCCCCAC protein
                           XM_226741                                           13.0
                           XM_226116           similar to Apoptosis inhibitor 5
RN00037 SEQ00027 ACGTAGCCCATCAGTCCCTGGTGTGCATTTCAGCTCTAGCCAATCCCCTCATCTTACT    13.0 291756
                           XM_225180Sptlc1     "serine palmitoyltransferase, long chain base subunit 1"
RN00038 SEQ00028 AAGGACTACAGGCATCACGCAGTGACATTAAGTTATTCAAGCACAATGACGTAGCTGA     1.4 306780
                           XM_222871           similar to Cyclic-AMP-dependent transcription factor ATF-6 alpha (Ac
RN00039 SEQ00029 GTGAAGAACCATTACTTTATATCCCTCCACCTCCATGTCAGCCCCTCATTAACACGAC    13.0 304962
                           XM_221378Tfrc       PREDICTED: Rattus norvegicus Transferrin receptor (Tfrc)
RN00040 SEQ00030 TCACTTACATTAATCTGGATAAAGTCGTCCTGGGTACTAGCAACTTCAAGGTTTCTGCCA
                           XM_221041           PREDICTED: Rattus norvegicus similar to protein kinase/endoribonuc
RN00041 SEQ00031 CTTCGAGAATCAGACGAGCATCCGAATGTGATCCGCTACTTTTGCACAGAGAAGGACC    13.0
                           XM_219857           similar to conserved helix-loop-helix ubiquitous kinase
RN00042 SEQ00032 CCATTCACTATTCTGAGGTTGGTGTCATTGGATACCTTGAGGATCAAATTATGTCTTTGC   9.0 309361
                           XM_219769Ikbkg      "inhibitor of kappa light polypeptide309295
RN00043 SEQ00033 CTACCAAGGAACGACAAACTTTAGAGGGAAGGATTCGAGCAGTTAGTGAGCAGGTCAG     9.0 gene enhancer in B-cells, kinase g
                           XM_217588           Rattus norvegicus monoamine6.0
RN00044 SEQ00034 GCACGATCATCGCATGTGAAAGAAAGTGTGGATAAATTACAGCCTATGGTTTGGG          oxidase A (Maoa), mRNA
                           XM_217368           mus
RN00045 SEQ00035 GTGGCTAACCTGGCTAGAAACTGCTGAAGAAGAAGAATCAGAGGAAGAAGCTGACTAAAG  13.0
                                               PREDICTED: Rattus norvegicus neural precursor cell
RN00046 SEQ00036 AGATGTGAATACCTGTGCCCGCCCTCTCTGTCTCTAAAGGCTATGTTAAGTTCTT expressed,dev
                           XM_217190Nedd4a
                           XM_216989SREBP-2 sterol regulatory element binding protein 2
RN00047 SEQ00037 AGCCCTCTGCTGGATGATGCAAAGTCCTAGAAAGAAGAGTGGTCCTGCTTTTGTGGAC    13.0 300095
                           XM_216792Kns2       Rattus norvegicus kinesin 2 (Kns2), mRNA
RN00048 SEQ00038 GTCTTGACAATGTTCACAAACAGAGAGTGGCTGAAGTGCTAAATGACCCTGAGAA        2.0
RN00049                    XM_216685         Rat type II cAMP-dependent protein kinase regulatory subunit
          SEQ00039 ACAACGGTGGTGGAAAGAAGTCTGTGTATAAGCAAAGCCATACATGAGTATTAATGGGA  6.0
RN00050                    XM_216650         similar to apoptosis related protein298841 p18
          SEQ00040 CTTCGTTGACAAACAGTACAGGCCAGTGAGCGACCGGCTTAAGGCTGAAG protein 13.0 APR-3;
RN00051                    XM_216640         "similar to Caspase recruitment domain protein 12 (Ice-protease activ
          SEQ00041 CTGAAGAGTTCTTACCAGACGCAGCGCTGGTGAGGAAACTCGGTCAAGTGTTATCTAA 13.0 298784
RN00052                    XM_216534
          SEQ00042 GTGAGATGGAAGAACAAATGAGACGCCAACGAGAAGAAAGCTACAGCAGGATGGG
                                   Sfpq      NonO/p54nrb homolog              10.0
RN00053                                      PREDICTED: Rattus norvegicus receptor (TNFRSF)-interacting serin
                                   Ripk2_predicted
                           XM_216360
          SEQ00043 TGCCATTTGATATACCTCATCGAGGTCTCATGATCTCTCTAATACAAAGTGGATGGGCAC
RN00054                                      Rattus norvegicus interleukin-1 receptor-associated kinase
          SEQ00044 CCGCAATATCGACACGCTCAGTGAGTGGGACTGGATGCAGTTCGCTTCCTATGTGATC 2
                           XM_216234                                            6.0
RN00055                                      Rattus norvegicus proteasome (prosome, macropain)
          SEQ00045 CCAAGTCGGTGCGTGAATTTCTGGAGAAGAACTACACAGATGATGCCATTGAAAC subunit, alpha t
                                   Psma7
                           XM_215962
RN00056                            Vars2
                           XM_215340         PREDICTED: Rattus norvegicus valyl-tRNA synthetase 2
          SEQ00046 CTTATGATTTCCCAGCCGTCACCACTGCCCAGTACAGCTTTTGGCTCTATGAGCT      2.0
RN00057                    XM_214967         similar to Bcl-2-associated transcription factor
          SEQ00047 GAATGTAGATGGCTAAACGATTCTTCCTCAGTGTGGTGTATATTTCAACAGGGACCC  13.0 293017
RN00058                    XM_214953         similar to p53 apoptosis-associated target
          SEQ00048 CAGAGAGAATGGGTTGTTTCTACAGGGAATGGGTTGGCTACAGAGCAGGAAAGCTACT 13.0 292949
RN00058                    XM_214953         similar to p53 apoptosis-associated target
          SEQ00048 CAGAGAGAATGGGTTGTTTCTACAGGGAATGGGTTGGCTACAGAGCAGGAAAGCTACT 13.0 292949
RN00059                            PFK-C
                           XM_214502         Rattus sp. phosphofructokinase C (PFK-C)
          SEQ00049 TGTAAATTACACCACGGACTTCATCTACCAGCTCTACTCAGAGGAAGGGAAAGGAG     1.1
RN00060                    XM_213869         Rattus norvegicus 5-hydroxytryptamine receptor (5HT5b)
          SEQ00050 AGCATATTCCTGTGGCTTGGCTATTCAAATTCGTTCTTCAATCCCTTAATCTACACGGC  6.0 5HT5b
RN00061                    XM_213814         similar to direct IAP binding protein288753 PI
          SEQ00051 CTCTGAGGAGTTGGATGACTCGGAGCGTAACCTTTCTGTTCAGGTACGGACAGCGTTT 13.0 with low
RN00062                    XM_213481
          SEQ00052 CCTGGAGATGCAGATAGAGAACCTGAAGGAGGAGCTGGCCTACCTGAAGAAGAAC
                                   Krt1-19   keratin complex 1, acidic, gene 19 8.0
RN00063                    XM_213466
          SEQ00053 GTCTGTAAAATAACCATCAGTTCCTTCACCCACCCTCTTCCCCTTAACACTCAGC
                                   Cnp1                                         8.0
                                                          cyclic nucleotide catabolism
                                             cyclic nucleotide phosphodiesterase 1
RN00064                    XM_213371         Rattus norvegicus similar to death effector filament-forming Ced-4-like
          SEQ00054 CCATCTGAGTTCCCTTTCTTGTGGCAGTGCTTCCATGACATTTCTTGGTGATC      13.0
RN00065                    X99267  Psen2     presenilin-2Golgi apparatus; endoplasmic reticulum; integral
                                                                                6.0 81751
          seq00055 CTAGCTGTCTTGTCACCAGACTGAGGCTTGCCCGTCAGAGCATCTGTGGCACCCGCAG to memb
RN00066                    X99267  Psen2     presenilin-2Golgi apparatus; endoplasmic reticulum; integral
                                                                                6.0 81751
          seq00055 GCTCTACATCTGACAGAAGAGCTGCGGCTCTGAGAGCTGTAGGACGCTTCGCCGAATG to memb
RN00067                    X99267  Psen2     presenilin-2Golgi apparatus; endoplasmic reticulum; integral
                                                                                6.0 81751
          SEQ00055 TGTTTGTGATGTCTGTTACCTTTAGTATCTTAGAAGCTGAGTCCTGTTCTTATTTCTGCA to memb
RN00068                    X98225  Hadha     "hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A hi
                                                          3-hydroxyacyl-CoA1.4 170670
          SEQ00056 AAATGTTTGAGACACTTGAAAAGTCACCAAAGCCTGTTGTTGCCGCCATCAGTGGATC   dehydrogenase activity; catalytic activi
RN00069                    X98225  Hadha     "hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A hi
                                                          3-hydroxyacyl-CoA1.4 170670
          seq00056 AGATGAAGTAGGGATAGATGTAGCACAGCACGTAGCAGAAGATCTAGGCAAAGCCTTC   dehydrogenase activity; catalytic activi
RN00070                    X98225  Hadha     "hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A hi
                                                          3-hydroxyacyl-CoA1.4 170670
          seq00056 GTCGCAAGTCTGGGAAGGGCTTCTACATCTATCAGTCGGGCTCAAAGAATAAGAATTT   dehydrogenase activity; catalytic activi
RN00071                    X96437
          SEQ00057 ACGATTTATAGGGTCCGTGAGACAGAGTTGTGGGAGGATTAGTTTAGTCTTGGTCG
                                   RGD:1303321            regulation of 3     11.0
                                             immediate early responseT-cell proliferation
RN00072                    X95578  Prkag1    "protein kinase, AMP-activated, gamma 1 non-catalytic subunit"
                                                          SNF1A/AMP-activated 25520 kinase activity;
                                                                                1.4 protein
          SEQ00058 CACTACACCTGTCTATGTGGCTCTGGGCATCTTTGTACAGCACCGAGTCTCCGCCTTG fatty acid bio
RN00073                    X95578  Prkag1    "protein kinase, AMP-activated, gamma 1 non-catalytic fatty acid bio
                                                          SNF1A/AMP-activated 25520 kinase activity;
                                                                                1.4 protein
          seq00058 CACTTGTCTGCATTTCTCCAAATGCCAGCTTGTTCGATGCTGTCTCTTCATTAATTCG subunit"
RN00074                    X95578  Prkag1    "protein kinase, AMP-activated, gamma 1 non-catalytic subunit"
                                                          SNF1A/AMP-activated 25520 kinase activity;
                                                                                1.4 protein
          seq00058 CTACACTTAGAGAAAACACTTGTCAGCCTAGCCAGCCCCAGTCGCTCGTCACAGCCCCfatty acid bio
RN00075                    X89968  Napa      N-ethylmaleimideapparatus; endoplasmic attachmentintracellular prote
                                                          Golgi sensitive fusion protein reticulum; protein alpha
                                                                       Normalisation
          SEQ00059 CAGTCCCATCTCCTGACCAGCAGTGTACTAAGGCTATTTCCATATCTCCTACCTTGTAC      140673
RN00076                    X89968  Napa      N-ethylmaleimideapparatus; endoplasmic attachmentintracellular prote
                                                          Golgi sensitive fusion protein reticulum;
                                                                       Normalisation140673
          SEQ00059 GAAGCCCATGAGGAACAGAATGTGGACAGCTACACAGAGTCGGTGAAGGAATATGprotein alpha
RN00077                    X83094  Hsf1      heat shock defense response; 9.0 79245 of transcription,
                                                          transcription factor regulation
                                                                                1
          seq00061 CTTCTGACGGGCACTGAACCCCACAAAGCCAAGGACCCCACTGTCTCCTAGAGGTTTCDNA-depen
RN00078                    X83094  Hsf1      heat shock defense response; 9.0 79245 of transcription, DNA-depen
                                                          transcription factor regulation
          seq00061 GAGAAGTGCCTCAGCGTAGCCTGCCTAGACAAGAACGAGCTAAGTGATCACCTGGATG   1
RN00079                    X83094  Hsf1      heat shock defense response; 9.0 79245 of transcription,
                                                          transcription factor regulation
                                                                                1
          SEQ00061 GATACCCCTTTGTCCCCAACTGCCTTCATTGACTCCATCCTTCGAGAGAGCGAACCTA DNA-depen
RN00080                    X78167  Rpl15     ribosomal protein L15 Normalisation protein biosynthesis; ribosome;
                                                          RNA binding; intracellular;
          SEQ00062 AGGTTATCCTCATTGATCCATTCCATAAAGCTATCAGAAGAAATCCCGACACCCAA         245981
RN00081                    X78167  Rpl15     ribosomal protein L15 Normalisation protein biosynthesis; ribosome;
                                                          RNA binding; intracellular;
          SEQ00062 CCTGATAAGGCTCGAAGGCTGGGATACAAGGCTAAGCAAGGTTATGTCATTTACAG         245981
RN00082                    X74227  Itpkb     "inositol 1,4,5-trisphosphate 3-kinase B"
                                                          calmodulin binding;6.0 54260
          seq00064 CTACCTAGAACAGAGCCTCCCATCTGCACTACAGGACACTTTGGAGAAGAGAAGAGAG    inositol-trisphosphate 3-kinase activity
RN00083                    X74227  Itpkb     "inositol 1,4,5-trisphosphate 3-kinase B"
                                                          calmodulin binding;6.0 54260
          SEQ00064 CTTCAGGATCGAGGGCATCAAGAAGGAAGATGGCTCTGTGAACCGTGACTTCAAGAAG    inositol-trisphosphate 3-kinase activity
RN00084                    X74227  Itpkb     "inositol 1,4,5-trisphosphate 3-kinase B"
                                                          calmodulin binding;6.0 54260
          seq00064 GGCCTTCAGAGAATTCACTAAAGGAAACCAGAACATCCTGATTGCCTACCGGGACCGG    inositol-trisphosphate 3-kinase activity
RN00085                    X68283  Rpl29     ribosomal protein L29 Normalisation Eukarya); intracellular; protein b
                                                          cytosolic ribosome (sensu
          SEQ00065 GAACCACACCACACACAACCAGTCCCGCAAATGGCACAGAAATGGCATCAAGAAA          29283
RN00086                    X67788  Vil2      villin 2     cytoskeleton; structural54319
          SEQ00066 TTCTATGAAGGATCCATCTCTGTGTGTTGAGGGGTGAAAATGATTTTGAAATTTGAGTCT 8.0 molecule activity
RN00087                    X66539  Tnf       "tumor necrosis factor cell growth and/or maintenance; cell
                                                          apoptosis; superfamily,24835
                                                                                5.0 member 2"
          SEQ00067 CAAGTACTTAGACATCACGGAGTCCGGGCAGGTCTACTTTGGAGTCATTGCTCTGTGA proliferatio
RN00087                    X66539  Tnf       "tumor necrosis factor cell growth and/or maintenance; cell
                                                          apoptosis; superfamily,24835
                                                                                5.0 member 2"
          SEQ00067 CAAGTACTTAGACATCACGGAGTCCGGGCAGGTCTACTTTGGAGTCATTGCTCTGTGA proliferatio
RN00088                    X63854  Tap2      "transporterATP binding; ATP-binding sub-family B (MDR/TAP)"
                                                           2, ATP-binding cassette, cassette (ABC)
                                                                                7.0 24812
          SEQ00068 CATAGGGGAAATGACGAATGGAATAAACACAGAAATCGGGGAGAAAGGGAGCCAG transporter acti
RN00089                    X63594  Nfkbia    "nuclear factor of kappa light chain25493 enhancer in B-cells inhibitor,
                                                          cytoplasm; cytosol;9.0 geneprotein binding; protein-nucle
          SEQ00069 AAATCTTCAGACGCTGCCCGAGAGTGAGGATGAGGAGAGCTATGACACGGAGTCAGAATT  nucleus;
RN00090                    X62875  Hmga1     high mobility group AT-hook 1 9.0 117062
          SEQ00070 CAGCAGTGTGGTCAGTGCAGGGGAAGCTTAGGTCCCAGCATGTATGTCCC
RN00091                    NM_133524
                                   Tcfe2a    transcription factor E2a
                                                          positive regulation of transcription; transcription
                                                                                9.0 171046
          seq00071 AGGTTCCGCCTGGTCTTCCTTCCTCGGTATATCCATCCAGCTCAGGTGATAACTACAG regulator
RN00092                    NM_133524
                                   Tcfe2a    transcription factor E2a
                                                          positive regulation of transcription; transcription regulator
          SEQ00071 CATAACCATGCCAGCCTTCCCAGCCAGCCCAGCTCCCTCCCTGACCTCTCACAGA      9.0 171046
RN00093                    NM_133524
                                   Tcfe2a    transcription factor E2a
                                                          positive regulation of transcription; transcription
                                                                                9.0 171046
          seq00071 TTCGGGAGAGACACCAGTGTTGGCACCCTGAGTCAGGCTGGCTTCCTACCAGGTGAGC regulator
RN00094                    X62313  Map2k1    mitogen activated proteinMAP 6.0 170851 activity; cytosol;
                                                          ATP binding; kinase kinase 1
                                                                                kinase kinase
          seq00072 ACTGTGTGGGATACTTAGTGGTATATGTCTCTGAGTTTGGATTAGTGTTTCTAAATTGGT protein a
RN00095                    X62313  Map2k1    mitogen activated proteinMAP 6.0 170851 activity; cytosol; protein a
                                                          ATP binding; kinase kinase 1
          SEQ00072 GTATTGTCAGGATTCTCGGACCCTTGGTACTTCACTCTTGCTGGTGACCTCTCAGTCT   kinase kinase
RN00096                    X62313  Map2k1    mitogen activated proteinMAP 6.0 170851 activity; cytosol; protein a
                                                          ATP binding; kinase kinase 1
          seq00072 TTTTAATATTGTCTTTATCGCTATGGTTACTCCCCTAAGTGGATTGGCTTTGTGCTTGG  kinase kinase
RN00097                    X59737 Ckmt1   "creatine kinase, mitochondrial1.1 ubiquitous" space;
                                                       creatine kinase activity;29593
                                                                              1, extracellular
          SEQ00073 CCGAGGAATCTGGCACAACAATGAGAAGAGTTTCTTGATCTGGGTGAATGAGGAG kinase activity
RN00098                    X58465 Rps5    ribosomal protein S5ribosome (sensu Eukarya); intracellular; protein b
                                                       cytosolic Normalisation
          SEQ00074 TTAATGCTCGCAAGGGCTCCTCCAACTCCTATGCTATCAAGAAGAAAGATGAACTG      25538
RN00099                    X58465 Rps5    ribosomal protein S5ribosome (sensu Eukarya); intracellular; protein b
                                                       cytosolic Normalisation
          SEQ00074 CACTGATGATGTGCAGATCAACGATATTTCTCTACAGGATTACATTGCTGTGAAGGAGA   25538
RN00100                    X57523 Tap1    "transporterATP binding; ATP-binding sub-family B (MDR/TAP)" acti
                                                        1, ATP-binding cassette, cassette (ABC) transporter
                                                                            7.0 24811
          SEQ00076 CCACGGAGATAGTTGAGGAGCGATGGTGTTTGTTACATGAGGAAAATGTAACCTCTAGG
RN00101                    X57405 Notch1  "Notch gene homolog 1, (Drosophila)" calcium ion binding; cell differe
                                                       ATP binding; DNA 6.0 25496
          SEQ00077 GCCCGATACACAGCAGCCTCTCCACCAATACCTTGTCCCCGATTATCTACCAGGG  binding;
RN00102                    X55955 Hnf3a   "hepatocyteDNA binding; nucleus; regulation of transcription, DNA-de
                                                        nuclear factor 3, alpha"
                                                                            9.0 25098
          SEQ00078 CTACTACCAAGGTGTGTATTCCAGACCCGTGCTAAATACTTCCTAGCTCCCAGAACTG
RN00103                    X55955 Hnf3a   "hepatocyteDNA binding; nucleus; regulation of transcription, DNA-de
                                                        nuclear factor 3, alpha"
                                                                            9.0 25098
          seq00078 GTTTGAAAGAATAATATATAACCGAAGACTAAGAAAGTGTGTGAGCCCAGTATGCATT
RN00104                    X55955 Hnf3a   "hepatocyteDNA binding; nucleus; regulation of transcription, DNA-de
                                                        nuclear factor 3, alpha"
                                                                            9.0 25098
          seq00078 TTTGTGGGAACTGAGTGACTTTGGAAGTGAAAGCAGATGCAGCAGCATTGGAAAGTAG
RN00105                    X55153         ribosomal protein, large P2
                                                       MACROMOLECULE METABOLISM(LL), METABOLISM(L
                                                                    Normalisation
          SEQ00079 CTTCAGACACACGAGAAGAGGGCATCAGATCTCATCATAGATGGTTGTAAGCCACC
RN00106                    X55153         ribosomal protein, large P2
                                                       MACROMOLECULE METABOLISM(LL),
                                                                    Normalisation
          SEQ00079 TTTAGAGTGAAAGCAGGTGGCAGTGGTGTTCCTTGTGTTGGTGAGTCTACCCTTA METABOLISM(L
RN00107                    X53588 Gck     glucokinase  ATP binding; cell glucose homeostasis;
                                                                            1.1 24385
          SEQ00081 GCTAGAATCAACTACAGAAAATGGCGGAAAATACTCAGGACTTGCACTTTCACGAglucokinase activi
RN00108                    X53565 Ttgn1   trans-golgi network protein 1 2.0 192152
                                                       Golgi to endosome transport; endosome; integral to memb
          seq00082 ACTCTTCTTCAGTTCCCCACCTCTTCCATTCTCTCTTCCTCTTTAGCCCTGTTTGTAC
RN00109                    X53565 Ttgn1   trans-golgi network protein 1 2.0 192152
                                                       Golgi to endosome transport; endosome; integral to memb
          SEQ00082 AGTAGGTAAGATAGACATTTAGAAACTCCGTGCGTTCTCCACATTCCTCCACACTGT
RN00110                    X53565 Ttgn1   trans-golgi network protein 1 2.0 192152
                                                       Golgi to endosome transport; endosome; integral to memb
          seq00082 AGTAGGTAAGATAGACATTTAGAAACTCCGTGCGTTCTCCACATTCCTCCACACTGTT
RN00111                    X53377 Rps7    ribosomal protein S7 Normalisation
                                                       RNA binding; cytosolic 29258
          SEQ00083 AAAGTTCAGTGGGAAACACGTAGTCTTCATTGCTCAGAGGAGGATTCTGCCCAAG       ribosome (sensu Eukarya); cytosol
RN00112                    X53363 Calr    calreticulin calcium ion binding; calcium ion storage activity; endoplas
                                                                           13.0 64202
          SEQ00084 AAGAGGATGAGGATGACAGAGATGAAGATGAAGATGAAGAGGATGAGAAGGAAGAAGATGAGGAG
RN00113                    X53052 Mip     major intrinsic protein of eye lens fiberspace; gap junction; integral to
                                                       ATP binding; extracellular
                                                                    Normalisation
          SEQ00085 CTCAAGAGTGTTTCTGAGAGACTGTCTATCCTCAAGGGAGCCAGACCCAGTGACT       25480
RN00114                    X53052 Mip     major intrinsic protein of eye lens fiberspace; gap junction; integral to
                                                       ATP binding; extracellular
                                                                    Normalisation
          SEQ00085 TCAAGAGTGTTTCTGAGAGACTGTCTATCCTCAAGGGAGCCAGACCCAGTGACTC       25480
RN00115                    X52733         60S ribosomal protein L27aNormalisation
          SEQ00087 AACCTGGATAAATTATGGACGTTGGTCAGCGAGCAGACACGGGTCAATGCAGCAAA
RN00116                    X52733         60S ribosomal protein L27aNormalisation
          SEQ00087 TTTGACAAATATCATCCAGGTTACTTCGGCAAAGTTGGCATGAGGCATTACCACTTGAA
RN00117                    X52713 Mx2     myxovirus (influenza virus) resistance 2 defense response; immune
                                                       GTP binding; GTPase activity;
          SEQ00089 AGTCCAAACTTGAAGACATCAGATTAGAACAGGAAACGGAAGCAGAGAAGGCGAT 14.0 286918
RN00118                    X52711 Mx1     myxovirus (influenza virus) resistance
                                                       GTP binding; GTPase activity; defense response; immune
          SEQ00090 CAATGACCCTTTAGCTGTTTACCTTATGTTAGTATGTTGCCTTTAGACTGTGGAAG12.0 24575
RN00119                    X51536 Rps3    ribosomal protein S3 Normalisationbinding; protein
                                                       intracellular; nucleic acid
                                                                                 140654
          SEQ00091 TCCGAGTTACGCCGACCAGAACAGAAATCATTATTTTAGCCACCAGAACACAGAA biosynthesis; rib
RN00120                    X17665 Rps16   ribosomal protein S16 Normalisation
                                                       RNA binding; cytosolic 140655
          SEQ00092 GTACAAGTTACTGGAGCCTGTTCTGCTTCTGGGCAAGGAGAGATTTGCTGGTGTG       small ribosomal subunit (sensu Eu
RN00121                    X17163 Jun     v-jun sarcoma virus 17 oncogene homolog (avian)
                                                       DNA binding; cell growth and/or maintenance;
                                                                            9.0 24516
          seq00093 GAGTGTCTGTATGCTGGGGTGAGAGCCTGTAGTCCCTCCCGTCTGGTTGTAGGAATAGintracellular
RN00122                    X17163 Jun     v-jun sarcoma virus 17 oncogene homolog (avian)
                                                       DNA binding; cell growth and/or maintenance;
                                                                            9.0 24516
          seq00093 GGTGTCCTACCCAGTGTTTGTAAATAAGAGATTTGAAGCATTCTGAGTTTACCATTTGT intracellular
RN00123                    X17163 Jun     v-jun sarcoma virus 17 oncogene homolog (avian)
                                                       DNA binding; cell growth and/or maintenance; intracellular
                                                                            9.0 24516
          SEQ00093 TGTGATCGTTTATAATAATAATAAAGACTTCAGCAATTAGATGTTTATCTCAAAGCAGGGACCCA
RN00124                    X17053 Scya2   small inducible cytokine A2 receptor binding; chemokine activity; ch
                                                       G-protein-coupled 5.0 24770
          SEQ00094 GTCATAAACTCTTTGAGACAGGGTCCAGTCAGGGATGCTAGTACCATAGTTCCAATC
RN00125                    X17013         diaminopimelate decarboxylase
                                                                    Spike
          SEQ00095 CGCATACGCATGACTACATTACAACGGGCCAGGAAGATTCAAAGTTTGGTTTCGATCT
RN00126                    X13722 Ldlr    low density calcium ionreceptor cholesterol metabolism;
                                                       lipoprotein binding; 300438
                                                                            1.4
          SEQ00096 GAGGAACATTAACAGCATAAACTTTGACAACCCAGTCTACCAGAAGACCACGGAGG coated pit; en
RN00127                    X13044 Cd74    CD74 antigen (invariant polpypeptide of response; integral to membra
                                                       chaperone activity; 7.0 25599
          SEQ00097 CCTGCTCCTCAGCCCTTCTTACACTCCCTAACATCACACCCATTCCGTCTTCCTG   immune major histocompatibility class
RN00128                    X12459 Ass     arginosuccinate synthetase 1.2 biosynthesis; argininosuccinate syn
                                                       ATP binding; arginine 25698
          SEQ00098 CAGGCTCCAGCATTAATTGTTGTGATAAATTTGTAATTGTAGCTTGTTCTCCTACCACCTGACTG
RN00129                    X07467 G6pdx   glucose-6-phosphate dehydrogenase glucose metabolism; glucose-6
                                                       apoptosis inhibitor activity;
                                                                    Normalisation
          SEQ00099 ACCACTGTCCCTATCTGAGCCACCCATCTTTCCACAAGACCTGAATCACCTCCTC       24377
RN00130                    X07467 G6pdx   glucose-6-phosphate dehydrogenase glucose metabolism;
                                                       apoptosis inhibitor activity;
                                                                    Normalisation24377
          SEQ00099 CATCTGCCCTTCTCACCATCTAACCCTCTATTAGGACTATTGACCTCATATTGGAAAGACTglucose-6
RN00131                    X06889 Rab3a   "RAB3A, member RAS oncogene family"
                                                       ATP binding; GTP binding; GTPase activity; RAB
                                                                            2.0 25531
          seq00101 CGATATGGGCAGAAGGAGTCCTCAGACCAGAACTTCGACTATATGTTCAAGATCCTGAT small m
RN00132                    X06889 Rab3a   "RAB3A, member RAS oncogene family"
                                                       ATP binding; GTP binding; GTPase activity; RAB small m
          SEQ00101 GCAGTGTGGGCAAAACCTCATTCCTTTTCCGCTACGCAGACGACTCTTTTACTCC  2.0 25531
RN00133                    X06889 Rab3a   "RAB3A, member RAS oncogene family"
                                                       ATP binding; GTP binding; GTPase activity; RAB small m
                                                                            2.0 25531
          seq00101 GTAACAGCAGTGTGGGCAAAACCTCATTCCTTTTCCGCTACGCAGACGACTCTTTTAC
RN00134                    X06107 Igf1    insulin-like growth factor 1
                                                       apoptosis inhibitor activity; extracellular; glial cell differenti
          SEQ00102 CACTGACATGCCCAAGACTCAGAAGTCCCAGCCCCTATCGACACACAAGA       4.0 24482
RN00135                    X04603         homoserineCARBOXYLIC ACID METABOLISM(NF), THREONINE M
                                                         kinase     Spike
          SEQ00103 GAACTGGCTGATGAATTATGCGGCTTAAAGCTGTCTGAAGCGGACAAGCTGCATTTAG
RN00136                    X04439 Prkcb1  "protein kinase C, beta 1"cAMP-dependent protein kinase
                                                       ATP binding;         6.0 25023
          SEQ00104 GAGATTCAGCCACCTTATAAACCAAAAGCTAGAGACAAGCGAGACACCTCCAACTTCG activity; calc
RN00137                    X03453         cre associated functionSpike
          SEQ00105 GTAACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGATGATCCGAATAA
RN00138                    X02918 P4hb    "prolyl 4-hydroxylase, beta polypeptide"transporter activity; endoplasm
                                                       electron transport; electron
                                                                            4.0 25506
          SEQ00298 CTTTAGAGCCAGATATGGAAGAAGACGACGATCAGAAAGCCGTGAAGGATGAACTGTAG
RN00139                    X00722         Rattus norvegicus genes for 18S, 5.8S, and 28S ribosomal RNAs
          SEQ00107 GCTAAATACCGGCACGAGACCGATAGCCAACAAGTACCGTAAGGGAAAGTTGAAA  2.0
RN00140                    V01217 Actb    "actin, beta"actin cytoskeleton; actin filament; axon; axonogenesis; ce
                                                                    Normalisation
          SEQ00108 TTTAATAGTCACTCCAAGTATCCACGGCATAGATGGTTACAGGAAGTCCCTCACCCT     81822
RN00141                    U93692 Prei2   preimplantation proteinNormalisation
                                                       nuclear pore2
          SEQ00109 CATCCTGAAAGAAGAGGGTGAACACATACGAGAAATGGTGAAGCAAATCAATGAT       113929
RN00142                    U91847 Mapk14  mitogen activated proteinMAP 6.0 81649
                                                       ATP binding; kinase 14 activity; angiogenesis; cAMP-de
          SEQ00233 ACATGAAGCACGAGAATGTGATTGGTCTGTTGGATGTGTTTACACCTGCAAGGTC  kinase
RN00143                    U90725 Hdlbp   lipoprotein-binding protein
                                                                    Normalisation
          SEQ00111 CAACAGCAGTGAGAAGGCTCCTGATATGAGCAGCTCTGAAGAAATTCCCACCTTT       64474
RN00144                    U82612         fibronectin 1RESPONSE TO PEST/PATHOGEN/PARASITE(LL), MET
          SEQ00112 GACAGAGTCATTAGGACAAGTGCTTCCCACAATCCTTTACCCTCTCATGCGTTAC  8.0
RN00145                    U77829 Gas5    growth arrest specific 5
          seq00113 ATGTGGGTCCCTTTAACTGAAGGCATGGCAAGCTCCACACAAGGTCCTTC      12.0 81714
RN00146                    U77829 Gas5    growth arrest specific 5         12.0 81714
          SEQ00113 GCTAAGGACTCATGAGGAAGCTGGATAACTGAACAAAGCCATGTACAAGAATGGGAAG
RN00147                    U77829 Gas5    growth arrest specific 5
          seq00113 TTTGAATCAGGTGGACAGTTCTAAAAGTACAAATGATTTCGTATAAAGGTAC    12.0 81714
RN00148                    U75404 Akap12  A kinase (PRKA) anchor protein (gravin) 12
                                                       signal transduction6.0 83425
          SEQ00114 TGATTGTACTCTTCTATGCTGGACCGAATTCATATGCAGATCGAAGTCACTCCTGTTCT
RN00149                    U75210  Kcnh2  "potassium cation channelchannel,117018
                                                        voltage-gated activity; cation transport;
                                                                    Normalisationsubfamily H (eag-related), membr
          SEQ00115 GCTGTAGTGGACCTCCTCGTGGACATCATGTTCATTGTGGACATCCTTATCAATT integral to membe
RN00150                    U72995  Madd   MAP-kinase activating death domain2.0 94193
          seq00116 AAAGTGCAATACAGTTCGAGGCGTCTTTGTCCTGGAAGAATTTGTTCCTGAAATTAAAG
RN00151                    U72995  Madd   MAP-kinase activating death domain2.0 94193
          seq00116 GTGATCTCTCCATCCGATCCAGTGGCAGCAGGCACATGAAGAAGCAGACGTTCGTTGT
RN00152                    U72995  Madd   MAP-kinase activating death domain
          SEQ00116 TGGGCGTGATCTCTCCATCCGATCCAGTGGCAGCAGGCACATGAAGAAGCAGACG  2.0 94193
RN00153                    U72350  Bcl2l1 Bcl2-like 1 anti-apoptosis; apoptosis; apoptosis inhibitor activity; apop
          SEQ00117 CTGCCTTGTTGGTGGGACCCTGATTACCCCTGAGCCTCTCGGGAATGCTTTTCTG 13.0 24888
RN00154                    U72349  Bcl2l1 Bcl2-like 1 anti-apoptosis; apoptosis; apoptosis inhibitor activity; apop
                                                                           13.0 24888
          seq00118 CCATAGGAAATTAAGATTTGGTGACAGACTGGACGTGGGTGTGAGTCCTGACCCTGTC
RN00155                    U72349  Bcl2l1 Bcl2-like 1 anti-apoptosis; apoptosis; apoptosis inhibitor activity; apop
          SEQ00118 GCAAGTTCTCCCTGTGTTCTGCTCACTCTCACGTAATGGGTCACCTTGGCTGGGG 13.0 24888
RN00156                    U72349  Bcl2l1 Bcl2-like 1 anti-apoptosis; apoptosis; apoptosis inhibitor
                                                                           13.0 24888
          seq00118 GCTGAATATTGTCTGATTTTAGAGAAGGTGGTCTGAGCCAATTGTGTTTGTGCTGTGCactivity; apop
RN00157                    U70050  Jag2   jagged 2 Notch binding; Notch signaling pathway;
                                                                    Normalisation
                                                                                29147
          SEQ00119 TACCTGTGCTGTGTAGCGTGTTCAGTGTGCTGTGGCTTGCCTGTATGGTTATCTGT-cell differentiat
RN00158                    U69272  Il15   interleukin 15
                                                       cytokine activity; extracellular; hematopoietin/interferon-cla
          SEQ00120 TCTAACAAGAATGTAATAGAGTCTGGCTGCAAGGAATGTGAGGAGCTGGAGGAGAG 5.0 25670
RN00159                    U68272         hypothetical gene supported by NM_053783
                                                                            5.0 360301
          SEQ00121 AAGAATCAATTTGGATGCTGCTCGTTGCTCCTCTTCTCTTCCTTACAATAGTTGTCCC
RN00160                    U68272         hypothetical gene supported by NM_053783
                                                                            5.0 360301
          seq00121 CAGTGACAACTCCAGACAGCCTAGAAGCACCAGAGCAGGAAGAACTTTCTAAAGGAAC
RN00161                    U68272         hypothetical gene supported by NM_053783
                                                                            5.0 360301
          seq00121 TCTGACTCTGACTTTCTCCCAAACAACGACTCGGAAACAAAGATGGCAGACCCAGCCC
RN00162                    NM_012863
                                   Mist1  "muscle, intestine and stomach expression 1"
                                                       DNA binding; G-protein25334 receptor protein
                                                                            9.0 coupled
          seq00122 CCTTTTGTCCGACCTTGCAGGAAGCACAGGGGAAGGAAGCTGTCCGCCCAAACTTCTG signaling
RN00163                    NM_012863
                                   Mist1  "muscle, intestine and stomach expression 1"
                                                       DNA binding; G-protein25334 receptor protein signaling
                                                                            9.0 coupled
          SEQ00122 CTTTATCTGTTGTGCTGGGGCTGATTAGAGGTAGGCATTCCACATCCAGTTTAGACAG
RN00164                    NM_012863
                                   Mist1  "muscle, intestine and stomach expression 1"
                                                       DNA binding; G-protein25334 receptor protein
                                                                            9.0 coupled
          seq00122 GGGCTCGGAGCATCCTCAGTAACTACTCTACACCCCTAGTGTGGTCTCTTCTGTCCTG signaling
RN00165                    U56261  Snap25 synaptosomal-associated protein 25012 kinesin complex;
                                                       cellular_component unknown;
                                                                            2.0
          SEQ00123 GCAATGAGATTGACACCCAGAATCGCCAGATTGACAGGATCATGGAGAAGGCTGACTC molecular
RN00166                    U53922  Hsj2   DnaJ-like proteindamage response, perception of DNA damage
                                                       DNA          Normalisation
          SEQ00124 AAGCCAATATCTACTCTTGACAACCGAACCATAGTCATCACCTCTCATCCAGGTCAGAT  65028
RN00167                    U53486         corticotropin releasing hormone receptor 1
                                                       CYCLIC-NUCLEOTIDE-MEDIATED SIGNALING(LL), INT
          SEQ00125 CCTCAATTTCTATGCCTGGGTCTCCGGACCGCTCAGGGCTGATATAGACCTTCTG  4.0
RN00168                    U48288  Akap11 A kinase (PRKA) anchor protein 11
                                                       peroxisomeNormalisation
          SEQ00126 CCCAATCTTTAAGCTCGTACATACTGCATTAGTGACTTAGGTTTCTGTGAACACCGT    25228
RN00169                    U40627  Nol3   nucleolar protein 3 (apoptosis13.0 85383with CARD domain)
                                                                            repressor
          SEQ00127 CAGAATATCCTTACCTGTCCAAATCTGATTCAAGCTGGATAAGATCTGGAAACCTGCCA
RN00170                    U40627  Nol3   nucleolar protein 3 (apoptosis13.0 85383with CARD domain)
                                                                            repressor
          seq00127 CAGGCTCTTTACTCAAGAATGGTCTGAATCCCACTGACCTGAGCAGGCTTGTGTGAAA
RN00171                    U40627  Nol3   nucleolar protein 3 (apoptosis13.0 85383with CARD domain)
                                                                            repressor
          seq00127 GAAACCTGCCAGAACTGGACCAAGTCAATGCAGCAAGACTCCATTTACTGCCAAATGA
RN00172                    XM_346538
                                   Lipe   "lipase, hormone sensitive" diacylglycerol catabolism; hydrolase activ
                                                       catalytic activity; 1.4 25330
          SEQ00128 CTGGGCACAGATTCCTTGAAGAAGCTAACAATAAAGGACTTGAGCTTTAAGGGCAACT
RN00173                    XM_346538
                                   Lipe   "lipase, hormone sensitive" diacylglycerol catabolism; hydrolase activ
                                                       catalytic activity; 1.4 25330
          seq00128 GAAACACAAGCACTACTGGGATACAGCCTCGGCATTCTCACACAGCATGGATTTACGC
RN00174                    XM_346538
                                   Lipe   "lipase, hormone sensitive" diacylglycerol catabolism; hydrolase activ
                                                       catalytic activity; 1.4 25330
          seq00128 GCTGGACCTGCACTCTACCACTGCCTTCTACTGCTGCTGTGACCGACCACCGCTAGTC
RN00175                    U36994  Ddit3  DNA-damage inducible transcript 3arrest; nucleus; regulation
                                                       DNA binding; cell 13.0 29467
                                                                           cycle
          SEQ00129 TCAGGAAGAAGAAGAGGAAGATCAAGGAAGAACTAGGAAACGGAAACAGAGTGGTCAGT of trans
RN00176                    U30186  Ddit3  DNA-damage inducible transcript 3arrest; nucleus; regulation of trans
                                                       DNA binding; cell 13.0 29467
                                                                           cycle
          SEQ00129 CTCTGATCGACCGCATGGTCAGTCTGCACCAAGCATGAACTGTTGGCATCACCTCCTG
RN00177                    U26310  Tns    tensin       actin binding; cell migration; cell-matrix junction; cell-subs
                                                                    Normalisation
          SEQ00131 GTGGAGGGAGGGAGGGGAACAGGAGGAAGAGGAAGGAAGGAAGAAGAGAGGAACT      29136
RN00178                    NM_080782
                                   Cdkn1a cyclin-dependent kinase inhibitor 1A
          seq00132 CACGAGCAGTGCCCGAGTTAAGGGGAATTGGAGGCAGGCGCCGATCCACAG     11.0 114851
RN00179                    NM_080782
                                   Cdkn1a cyclin-dependent kinase inhibitor 1A
          seq00132 GACAGTGAGCAGTTGAGCCGCGATTGCGATGCGCTCATGGCGAGCTGTCTC     11.0 114851
RN00180                    NM_080782
                                   Cdkn1a cyclin-dependent kinase inhibitor 1A
                                                                           11.0 114851
          SEQ00132 GCCTCTTCCCCATCTTCTGCCTTAGCCTTCATTCAGTGTGTCTTAATTATTATTTGTGT
RN00181                    U22830  P2ry1  "purinergic receptor P2Y,G-protein25265 receptor
                                                       ATP binding; G-proteincoupled 1"
                                                                            6.0 coupled
          SEQ00133 CTGTAAATCTCTGCTCACCCAACCAGGACACTAATCCATCTTGATATGACAAATA activity; G-protein
RN00182                    U22830  P2ry1  "purinergic receptor P2Y,G-protein25265 receptor activity; G-protein
                                                       ATP binding; G-proteincoupled 1"
                                                                            6.0 coupled
          seq00133 GAACGGACAAGTTGAAACCTGTAAATCTCTGCTCACCCAACCAGGACACTAATCCATC
RN00183                    U22830  P2ry1  "purinergic receptor P2Y,G-protein25265 receptor activity; G-protein
                                                       ATP binding; G-proteincoupled 1"
                                                                            6.0 coupled
          seq00133 TCAGTACTCAGTAGCAACTAGAATTCAATTAGTGACAGGACATAGACAGTGTGATACT
RN00184                    U18942  Adar   "adenosine RNA binding; RNA 6.0 81635 adenosine deaminase acti
                                                        deaminase, RNA-specific"
          seq00134 CTGTTGACACACTTCCTACAGCCTGTGTACCTGAAATCTGTGACATTAGGTTACCTTTprocessing;
RN00185                    U18942  Adar   "adenosine RNA binding; RNA 6.0 81635 adenosine deaminase acti
                                                        deaminase, RNA-specific"
          seq00134 CTTCATCAGGTTTCTCTACAGTGAGCTGATGAAGTACAACCACCACACTGCCAAGAACprocessing;
RN00186                    U18942  Adar   "adenosine RNA binding; RNA 6.0 81635 adenosine deaminase acti
                                                        deaminase, RNA-specific"
          SEQ00134 GAAATCTGTGACATTAGGTTACCTTTTCAGCCAAGGGCATCTGACCCGTGCTATTTGCprocessing;
RN00187                    U17035  Cxcl10 chemokine cell motility; chemokine245920 chemotaxis; cytokine activ
                                                       (C-X-C motif) ligand 10 activity;
                                                                            5.0
          SEQ00135 TGGGTAGTTAAAGTTTACATAGGCAAATGCTTTGAATGCTACATATTACAAGATGTGTTGGATGG
RN00188                    U14010  Il1r1  "interleukin integral to membrane; interleukin-1 receptor activity; interl
                                                       1 receptor, type I" 5.0 25663
          SEQ00136 TTGAATGGGACGATCCAATCCTAGCCGAAGACTATCAGTTGTGAGTTTGCCAATC
RN00189                    U13396  Jak2   Janus kinase 2 binding; JAK-STAT cascade; Janus kinase activity; S
                                                       ATP
          SEQ00137 GCATGAAAGAGGTGACCTTTACTCAGAGACCAAGTAGACTTCCAGAACCAGAGCAAA6.0 24514
RN00190                    U07181  Ldhb   lactate dehydrogenase B L-lactate dehydrogenase activity; glycolysis;
                                                       ATP binding;
          SEQ00138 GAACGGACAATGACAGCGAGAACTGGAAGGAGGTGCATAAGATGGTGGTGGACAG  1.1 24534
RN00191                    U04835  Crem   cAMP responsive element modulator
          seq00139 AAAGCAGAGTAACTGTGTTTGACTTGGACCTGGTTGACTGTGAACTCTAATCGGG  9.0 25620
RN00192                    U04835  Crem   cAMP responsive element modulator
          seq00139 GTCTCTTAACCCTTGCTTAAGAATACAGTCTGCTGTAGAGTGTGAATTGGGAATTC 9.0 25620
RN00193                    U04835  Crem   cAMP responsive element modulator
          SEQ00139 TTTATTGCCATAAAGCAGAGTAACTGTGTTTGACTTGGACCTGGTTGACTGTGAACT9.0 25620
RN00194                    U03699  Nos2   "nitric oxideG-protein signaling, coupled to cGMP nucleotide second m
                                                        synthase 2, inducible" 24599
                                                                            1.2
          SEQ00140 CCCAAACCCCTCACATCATCTCCCCTCCTCTACCCTACCAAGTAGTATTGTACTATTG
RN00194                    U03699  Nos2   "nitric oxideG-protein signaling, coupled to cGMP nucleotide second m
                                                        synthase 2, inducible" 24599
                                                                            1.2
          SEQ00140 CCCAAACCCCTCACATCATCTCCCCTCCTCTACCCTACCAAGTAGTATTGTACTATTG
RN00195                    S79903         opioid receptor, mu 1
                                                       BEHAVIOR(LL), CYCLIC-NUCLEOTIDE-MEDIATED SIG
                                                                            6.0
          SEQ00141 CATTTAATTGCATATGGGCAGTTGAGTCGGAAGAGTGTTTAAGTATAAGGGTCATTGAC
RN00196                    S77528  Cebpb  "CCAAT/enhancer binding protein 24253apoptosis activator
                                                       DNA binding; anti-apoptosis;
                                                                            9.0 (C/EBP), beta"
          SEQ00142 GACGCAACACACGTGTAACTGTCAGCCGGGCCCTGAGTAATCACTTAAAGATGTTCCT activity; c
RN00197                    S77528  Cebpb  "CCAAT/enhancer binding protein 24253apoptosis activator
                                                       DNA binding; anti-apoptosis;
                                                                            9.0 (C/EBP), beta"
          seq00142 GCAGAAGAAGGTGGAGCAGCTGTCGCGAGAGCTCAGCACGCTGCGGAACTTGTTCAAG activity; c
RN00198                    S77528  Cebpb  "CCAAT/enhancer binding protein 24253apoptosis activator
                                                       DNA binding; anti-apoptosis;
                                                                            9.0 (C/EBP), beta"
          seq00142 GCTACCAGGCGACGCCGAGCGGCAGCAGCGGCAGCCTGTCCACGTCGTCGTCGTCCAGactivity; c
RN00199                    S76511  Bax    Bcl2-associated X protein
                                                       apoptosis; apoptosis activator activity; apoptosis
                                                                           13.0 24887
          seq00143 CAAGAAGCTGAGCGAGTGTCTCAGGCGAATTGGCGATGAACTGGACAACAACATGGAG inhibitor a
RN00200                    S76511   Bax     Bcl2-associated X protein
                                                         apoptosis; apoptosis activator activity; apoptosis
                                                                             13.0 24887
          seq00143 GATCAGAACCATCATGGGCTGGACACTGGACTTCCTCCGGGAGCGGCTGTTTGTCTGG inhibitor a
RN00201                    S76511   Bax     Bcl2-associated X protein
                                                         apoptosis; apoptosis activator activity; apoptosis inhibitor a
          SEQ00143 TGAGCGAGTGTCTCAGGCGAATTGGCGATGAACTGGACAACAACATGGAGCTGCA   13.0 24887
RN00202                    S74351   Ptpn16  protein tyrosine phosphatase, non-receptor type 16
          SEQ00200 CAAGGCAGACATCAGCTCCTGGTTCAACGAGGCGATTGACTTTATAGACTCCATC    6.0
RN00203                    S70011           Sideroflexin 1
          SEQ00145 TTTCCCAATGTTTCCAGATTGAATTTCCTCATAAAGAAAATATGGTGTGCCTTGTGTCT1.4
RN00204                    S69874   Fabp5   "fatty acid binding protein 5, epidermal"
                                                         binding; lipid binding; transport; transporter activity
          SEQ00146 CAGAAGTGGGAAGGGAAAGAAAGCACGATAACGAGAAAACTGAAGGACGGGAAGAT   1.4 140868
RN00205                    S69329   Isl1    "ISL1 transcription factor, RNA 9.0 64444 II transcription factor activ
                                                         DNA binding; LIM/homeodomain 1"
          SEQ00147 ATGCGGCATGTTTGAAATGTGCGGAGTGTAATCAGTATTTGGACGAAAGCTGTAC    polymerase
RN00206                    S69329   Isl1    "ISL1 transcription factor, RNA 9.0 64444 II transcription
                                                         DNA binding; LIM/homeodomain 1"
                                                                              polymerase
          seq00147 GCGGCATGTTTGAAATGTGCGGAGTGTAATCAGTATTTGGACGAAAGCTGTACCTGCT factor activ
RN00207                    S69329   Isl1    "ISL1 transcription factor, RNA 9.0 64444 II transcription
                                                         DNA binding; LIM/homeodomain 1"
                                                                              polymerase
          seq00147 TGCGGTAATCAAATTCACGATCAGTATATTCTGAGGGTTTCTCCGGATTTGGAATGGC factor activ
RN00208                    S69315   Grp94   tumor rejection antigen gp96 13.0 298957
          SEQ00148 TTTGTGAGAGCTGACGATGAAGTCGATGTGGATGGCACGGTAGAAGAGGACCTGGGTAAA
RN00209                    S67435   Pdx1    pancreatic and duodenal homeobox gene 1 maintenance; developme
                                                         DNA binding; cell growth and/or
          SEQ00149 CATGAAGTGGAAGAAAGAGGAAGATAAGAAACGTAGTAGCGGGACAACGAGCGGG    9.0 29535
RN00210                    S67435   Pdx1    pancreatic and duodenal homeobox gene 1 maintenance;
                                                         DNA binding; cell growth and/or
                                                                              9.0 29535
          seq00149 CTGGAAGAGCCCAGCCGCGTTCATCTCCCTTTCCCGTGGATGAAATCCACCAAAGCTC developme
RN00211                    S67435   Pdx1    pancreatic and duodenal homeobox gene 1 maintenance;
                                                         DNA binding; cell growth and/or
                                                                              9.0 29535
          seq00149 GGACCAATTTAGAGAATCAGGCTCCCAACTGAGGACAATGAAAAGGTTACAAACTTGAGdevelopme
RN00212                    S66024   Crem    cAMP responsive element modulator
          SEQ00150 CTTGAGAGTCGAGTCGCAGTGCTGGAAGTTCAGAACAAGAAGCTTATAGAGGAGC    9.0 25620
RN00213                    S49003           Growth hormone receptor/binding protein
          SEQ00151 CAAAGAATTAATCCAAGCCTGAGGGAAAGTTCCTCTGGAAAGCCTCGATTCACCAA   4.0
RN00214                    S40669   Pcsk2   proprotein convertaseactivity; proprotein convertase 2 activity; proteol
                                                         hydrolase subtilisin/kexin type 2
          SEQ00344 CCAGACCTGGCCTACAACTATAACTCTGATGCAAGTTATGACTTCAGCAGCAATGAC  2.0
RN00215                    NM053365 Fabp4   Rattus norvegicus fatty acid binding protein 4, adipocyte
          SEQ00153 GATCATCAGCGTAGAAGGGGACTTGGTCGTCATCCGGTCAGAGAGTACTTTTAAA    1.4
RN00216                    NM_175838Eef1a1  eukaryotic translation elongation factor cytoplasm; eukaryotic translat
                                                         DNA binding; GTP 2.0 171361
          seq00154 CTGGAAGCTTTGGACTGCATTCTGCCGCCAACTCGTCCAACTGACAAGCCTCTGCGAC binding; 1 alpha 1
RN00217                    NM_175838Eef1a1  eukaryotic translation elongation factor cytoplasm; eukaryotic translat
                                                         DNA binding; GTP 2.0 171361
          seq00154 GCTCAGAAGGCTAAATGAATATTATCCCTAACACCTGCCACCCCAGTCTTAATCAGTG binding; 1 alpha 1
RN00218                    NM_175838Eef1a1  eukaryotic translation elongation factor cytoplasm; eukaryotic
                                                         DNA binding; GTP 2.0 171361
                                                                              binding; 1 alpha 1
          SEQ00154 TTACCTTTGCTCCAGTCAATGTAACAACTGAAGTCAAGTCTGTGGAAATGCACCATGAAG translat
RN00219                    NM_175762Ldlr    low density calcium ionreceptor cholesterol metabolism; coated pit; en
                                                         lipoprotein binding; 300438
                                                                              1.4
          SEQ00155 TATGAGGACAAAGTGTATTGGACAGATGTCTTAAATGAAGCCATTTTCAGTGCCAACCGC
RN00220                    NM_175754Agrn    agrin        extracellular space; plasma membrane
                                                                              6.0 25592
          SEQ00156 GCCCTGTTTGTGTGTTATTAATGTGTTATTGGATGAGAACTGTATCCCTGAGCAGorganization and b
RN00221                    NM_173837Bbc3    Bcl-2 binding component 3 13.0 317673
          SEQ00157 ACATCGACACCGACCCTCGCCCTGGAGGGTCATGTATAATCTCTTCATGGGACTCCTC
RN00222                    NM_173323LOC286989
                                            UDP-glucuronosyltransferase 1.6 286989
          SEQ00158 CATAACCTTGCCCTGGTATCAGTACACTCTCTGGATGTGATTGGATTCCTGCTTG
RN00223                    NM_173323LOC286989
                                            UDP-glucuronosyltransferase 1.6 286989
          seq00158 GAAGACATTGAGCTAATTGATTTATCTATAGATGTCACACTATAGGTTAAGAAAGTAACCGT
RN00224                    NM_173323LOC286989
                                            UDP-glucuronosyltransferase 1.6 286989
          seq00158 TCTTTAAGAAGGAAGGCTGTGATCTGTGGTCGTGATGGGCATGACTACTCCCTTTATT
RN00225                    NM_172091Gcgr    glucagon receptor
                                                         G-protein coupled receptor activity; G-protein
                                                                              4.0 24953
          seq00159 CTCCCCTGCTGTTTGTCATCCCCTGGGTGGTGGTCAAGTGTCTGTTTGAGAATGTCCAcoupled rece
RN00226                    NM_172091Gcgr    glucagon receptor
                                                         G-protein coupled receptor activity; G-protein coupled rece
          seq00159 GACTCCAGCCAAGTTGGATTCAGAAGGGCCTCACAAGACAACCCAGAAACAGATGCCT 4.0 24953
RN00227                    NM_172091Gcgr    glucagon receptor
                                                         G-protein coupled receptor activity; G-protein
                                                                              4.0 24953
          SEQ00159 GATCTCCCCTGCTGTTTGTCATCCCCTGGGTGGTGGTCAAGTGTCTGTTTGAGAAT coupled rece
RN00228                    NM_171988Bcl2l11 BCL2-like 11 (apoptosis facilitator)64547
                                                         apoptosis; induction of apoptosis; membrane;
                                                                             13.0
          SEQ00160 AATGGTTATCTTACAACTGTTACGATTCATCTTCCGTCTGGTCTGGAGAAGGCACTGA protein hete
RN00228                    NM_171988Bcl2l11 BCL2-like 11 (apoptosis facilitator)64547
                                                         apoptosis; induction of apoptosis; membrane;
                                                                             13.0
          SEQ00160 AATGGTTATCTTACAACTGTTACGATTCATCTTCCGTCTGGTCTGGAGAAGGCACTGA protein hete
RN00228                    NM_171988Bcl2l11 BCL2-like 11 (apoptosis facilitator)64547
                                                         apoptosis; induction of apoptosis; membrane;
                                                                             13.0
          SEQ00160 AATGGTTATCTTACAACTGTTACGATTCATCTTCCGTCTGGTCTGGAGAAGGCACTGA protein hete
RN00229                    NM_152937Fadd    Fas (TNFRSF6)-associated via activitydomain
                                                         apoptosis regulator death
          SEQ00161 CCTATGAGGACTGATTGTAAAGTTCGCCACTAAAATCGCTGCTCTGTGAAGGACTGTG13.0 266610
RN00230                    NM_145880Lhx1    LIM homeobox protein 1 nucleus; regulation of transcription,
                                                         DNA binding;         9.0 257634
          seq00162 AAGTGCCAACGTATCGGATAAGGAAGGTGGTAGCAATGAGAACGATGACCAGAACCTA DNA-de
RN00231                    NM_145880Lhx1    LIM homeobox protein 1 nucleus; regulation of transcription, DNA-de
                                                         DNA binding;
          SEQ00162 AGGATGATGCCAAGGACTCTGAAAGTGCCAACGTATCGGATAAGGAAGGTGGTAG    9.0 257634
RN00232                    NM_145880Lhx1    LIM homeobox protein 1 nucleus; regulation of transcription,
                                                         DNA binding;         9.0 257634
          seq00162 GGACCACCGTCCTCGCAGGCCCAGACACCAGTGGACCTACCCTTTGTGCCATCATCTG DNA-de
RN00233                    NM_145788Tank    TRAF family member-associated Nf-kappa B activator
          SEQ00163 AGCTGGAGACCATAATGTGTTCTATGTAAATACGTTCCCACTTCAAGACCCACCTGAC 6.0 252961
RN00234                    NM_145681Tnfsf10 "tumor necrosis factor (ligand) superfamily, member 10"
                                                         induction of apoptosis 246775
          SEQ00164 AAGACAGTCTCGAAGGACGGAGGGAGGATCAAACAGATGGTGCAGTACAT        13.0
RN00235                    NM_145681Tnfsf10 "tumor necrosis factor (ligand) superfamily, member 10"
                                                         induction of apoptosis 246775
          SEQ00164 AGGTCAAGAGGCAACTGTATCAGCTCATTGAAGAGGTGACTTTGAGAACCTTTGAGAA13.0
RN00236                    NM_139258Bmf     Bcl-2 modifying factor           13.0 246142
          SEQ00166 GTCCTAACTTTTATGTATGTAAGGAAAGACATTGGTGCTAAAATGAAGGGGAGCCAAGGC
RN00237                    NM_139193Gpr10   G protein-coupled receptor 10receptor activity; G-protein coupled rece
                                                         G-protein coupled 6.0 246075
          seq00167 CCATTCTCCTGTCTTACGTCCGGGTGTCGGTGAAGTTGCGGAACCGCGTGGTGCCTGG
RN00238                    NM_139193Gpr10   G protein-coupled receptor 10receptor activity; G-protein coupled rece
                                                         G-protein coupled 6.0 246075
          seq00167 CTTCATCTATGCGTGGCTGCACGACAGCTTCCGAGAGGAGCTACGCAAGATGCTTCTG
RN00239                    NM_139193Gpr10   G protein-coupled receptor 10receptor activity; G-protein
                                                         G-protein coupled 6.0 246075
          SEQ00167 GCTATATGTCTGTTTGTGTGCTTGTGTGAAATGTTAGATAGGCTTTGGAGTAGAAGAG coupled rece
RN00240                    NM_139101LOC245960
                                            potassium channel regulator 13.0 245960
          SEQ00168 CATGATTAAATTGTGTCTCAGATGACGGAACCTAATGCACCCGGCCATGAAACTGTTTA
RN00241                    NM_139100Slc25a3 "solute carrier family 25 (mitochondrial carrier;to membrane;
                                                         binding; inner membrane; integral adenine nucleotide tra
                                                                             13.0 245959
          SEQ00169 ATGTATAAAGAAGAAGGCTTAAATGCGTTCTACAAGGGTGTTGCTCCTGTGTGGATGAGA mitochon
RN00242                    NM_139100Slc25a3 "solute carrier family 25 (mitochondrial carrier;to membrane; mitochon
                                                         binding; inner membrane; integral adenine nucleotide tra
          seq00169 ATTGCCCTGGCTCCTATGGAAGCTGCTAAAGTTCGAATTCAAACCCAGCCTGGCTATG13.0 245959
RN00243                    NM_139100Slc25a3 "solute carrier family 25 (mitochondrial carrier;to membrane;
                                                         binding; inner membrane; integral adenine nucleotide tra
                                                                             13.0 245959
          seq00169 ATTTGACAATGTAGGAAATGTCTGTTCCTGATACAATTACTGTAGTACCCTTGCTTAAAGC mitochon
RN00244                    NM_139096Ppicap  peptidylprolyl isomerase C-associated protein
          SEQ00170 ACAAATACAGACAGTTCTACACATACAACTATGGCTCACAATCCCGCTACAGCAGC  13.0 245955
RN00245                    NM_138913Oas1    25 oligoadenylate synthetase 6.0 192281 activity; antiviral response
                                                         2'-5'-oligoadenylate synthetase
          SEQ00171 CTAGGTCATGTTAGCCTCTACAGCAATCCTGATCCCAAGATCTACACCATCCTCATCT
RN00246                    NM_138910Dad1    defender against cell deathapoptosis; apoptosis inhibitor activity; integ
                                                         anti-apoptosis; 1 13.0 192275
          SEQ00172 CTCCACTCCACAGCGGCTGAAGTTGCTGGATGCCTATCTCCTTTATATAT
RN00247                    NM_138910Dad1    defender against cell deathapoptosis; apoptosis inhibitor
                                                         anti-apoptosis; 1 13.0 192275
          seq00172 CTCCACTCCACAGCGGCTGAAGTTGCTGGATGCCTATCTCCTTTATATATTGCTGACC activity; integ
RN00248                    NM_138910Dad1    defender against cell deathapoptosis; apoptosis inhibitor activity; integ
                                                         anti-apoptosis; 1 13.0 192275
          seq00172 CTTCAACTCTTTCCTCTCTGGCTTCATCTCTTGTGTGGGCAGCTTCATCTTAGCGGTTT
RN00249                    NM_138905Dri42   ER transmembrane protein Dri6.0 192270
          SEQ00173 CATAGTGTTCTTCGTGTCTGACCTCTTCAAGACTAAGACGACCCTCTCACTGCCT     42
RN00250                    NM_138900
                                   C1s      "complement component 1, s14.0 192262
          SEQ00174 GCGAAGTTACCCATAACATCTTTAGAAAAGTGCCAGCAGGTGAAAGTGGAAAACCC  subcomponent"
RN00251                    NM_138542
                                   Arhv     "ras homolog gene family, member V"
                                                                            13.0 171581
          seq00175 GACCTGAGGGACGATGTCAATGTACTAATTCAGTTGGACCAAGGAGGTCGGGAGGGCC
RN00252                    NM_138542
                                   Arhv     "ras homolog gene family, member V"
                                                                            13.0 171581
          SEQ00175 GACTCAGTTCTCTATTGAACACAGGGGATATGGGCCTCAAAGCTGTACACTCTGGTAA
RN00252                    NM_138542
                                   Arhv     "ras homolog gene family, member V"
                                                                            13.0 171581
          SEQ00175 GACTCAGTTCTCTATTGAACACAGGGGATATGGGCCTCAAAGCTGTACACTCTGGTAA
RN00253                    NM_138542
                                   Arhv     "ras homolog gene family, member V"
                                                                            13.0 171581
          seq00175 TACACCTGCAATGGATACCCCTCGCGCTATCGGCCTACAGCACTGGACACTTTCTCCG
RN00254                    NM_134403
                                   Cca3     Cca3 protein                    11.0 171440
          seq00176 CAGTGCCCTCCCTACAAGACTACTAACGAGAGTCTGAACTGGGAATCCCTGAGCACCG
RN00255                    NM_134403
                                   Cca3     Cca3 protein
          SEQ00176 GGGATGTTAGGATCACAGGCATTCTTATGAATGTAGAAAGTGTCCGAGCCCAGGC  11.0 171440
RN00256                    NM_134403
                                   Cca3     Cca3 protein                    11.0 171440
          seq00176 TTATTGCTGTAATATTGTATGATACTGTAACTATACCTTAATGTTGTTACTTACTGTAA
RN00257                    NM_134351
                                   Mat2a    "methionineATP binding; magnesium ion binding; methionine adenosy
                                                          adenosyltransferase II, alpha"
          seq00177 CACATTGCCTTGGTTACGCCCAGATTCTAAAACTCAAGTGACTGTGCAGTATATGCAA1.3 171347
RN00258                    NM_134351
                                   Mat2a    "methionineATP binding; magnesium ion binding; methionine adenosy
                                                          adenosyltransferase II, alpha"
          SEQ00177 GAATGAGGAAGACATTGGTGCAGGAGATCAGGGTTTGATGTTTGGTTATGCCACT   1.3 171347
RN00259                    NM_134351
                                   Mat2a    "methionineATP binding; magnesium ion binding; methionine adenosy
                                                          adenosyltransferase II, alpha"
          seq00177 TTTAACTATTGTCTTAGCACACAAGCTAAATGCTAAACTGGCTGAGCTACGCCGCAAT1.3 171347
RN00260                    NM_133561
                                   Brp44l   brain protein 44-like           14.0 171087
          seq00178 ACTATCTTTAATGACCATGCCAACATTATTGAATAGCCAAGAATCCCCAAACCAACTCTCGG
RN00261                    NM_133561
                                   Brp44l   brain protein 44-like           14.0 171087
          seq00178 CATGTCTACACATAATTTCCAGTGATAACAAGTAGCGGTGTTTTCCATATGTAATTCAG
RN00262                    NM_133561
                                   Brp44l   brain protein 44-like           14.0 171087
          SEQ00178 GTGCTGAGGGGAAAACACGGAAGACTATCTTTAATGACCATGCCAACATTATTGAATA
RN00263                    NM_133546
                                   Myd116   myeloid differentiation primary 9.0 171071
          seq00179 CCCTCCCTTCCAGTGGCCTTCTATTTACCTGGACAGAAGCCAGCACCACCTTGGGCTG response gene 116
RN00264                    NM_133546
                                   Myd116   myeloid differentiation primary 9.0 171071
          seq00179 CTTCCTCTGTCGTCCTCGTCTCTTCCACTGCCTGAGCCTTGCTCTTCCACTGAGGCCA response gene 116
RN00265                    NM_133546
                                   Myd116   myeloid differentiation primary 9.0 171071
          SEQ00179 TGTATCGCCCAGGAGAGGACACAGAGGAGGAAGAAGACAGTGATTTGGATTCAGC    response gene 116
RN00266                    NM_133392
                                   Stk17b   serine/threonine kinase 17b (apoptosis-inducing)
                                                        nucleus; programmed cell death; protein binding; protein s
                                                                            13.0 170904
          SEQ00180 GGTCCAGGCTGTTTCTCTGTAAACTGACATCATTTCCAACTCACATATCTTGCACATGC
RN00267                    NM_133315
                                   Slc39a1 "solute carrier family 39 (iron-regulated transporter), member
                                                                             3.0 170840
          seq00181 AACTACCAAAATACCTGAAACGGAAATGCTTATGTCTAATGTGTCTAATGTTGTCAATACC 1"
RN00268                    NM_133315
                                   Slc39a1 "solute carrier family 39 (iron-regulated transporter),
                                                                             3.0 170840
          SEQ00181 CTTGTTCGGACTGGTCTGTTCTCAGGACTGGCTCAGCTTTCTTGTTTGATCTTGT member 1"
RN00269                    NM_133315
                                   Slc39a1 "solute carrier family 39 (iron-regulated transporter), member 1"
          seq00181 CTTGTTCGGACTGGTCTGTTCTCAGGACTGGCTCAGCTTTCTTGTTTGATCTTGTGTG3.0 170840
RN00270                    NM_133307
                                   Prkcd    "protein kinase C, delta" diacylglycerol binding; intracellular
                                                        ATP binding;         6.0 170538
          SEQ00182 ACCAAAAGAAAAGAGAGCACAAGCTACCTGAACCACAGGATTGTTTATGTGTGTATAAA signaling
RN00271                    NM_133307
                                   Prkcd    "protein kinase C, delta" diacylglycerol binding; intracellular
                                                        ATP binding;         6.0 170538
          seq00182 CCCATCTGCCCTGGTTTGCATCCTCACTGCCCATGAAGAAGAGTGGGTGACTGGTGAT signaling
RN00272                    NM_133307
                                   Prkcd    "protein kinase C, delta" diacylglycerol binding; intracellular
                                                        ATP binding;         6.0 170538
          seq00182 TGGTGATGATGAGGACGAGCTCTTTGAGTCCATCCGGGTGGACACACCACACTACCCG signaling
RN00273                    NM_133307
                                   Prkcd    "protein kinase C, delta" diacylglycerol binding; intracellular signaling
                                                        ATP binding;
          SEQ00182 AACTTTCCTTCAGTGACAAGAACCTCATCGACTCTATGGACCAGACAGCCTTCAA   6.0 170538
RN00274                    NM_130741
                                   Lcn2     lipocalin 2 binding; extracellular space; transport; transporter activity
          SEQ00184 GGTCCAGAAAGAAAGACAAAGCCGCTTTACCATGTACAGCACCATCTATGAGCTA  14.0 170496
RN00275                    NM_130433
                                   Acaa2    acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenz
                                                        acetyl-CoA C-acyltransferase activity; acyltransferase acti
                                                                             1.4 170465
          seq00185 CATTTGACCAAGCCTTGATGGGTTCTGTCTACTTCATACCTGCCTAGCGTGTTAGAATA
RN00276                    NM_130433
                                   Acaa2    acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenz
                                                        acetyl-CoA C-acyltransferase activity; acyltransferase acti
          seq00185 CTCAGTTCTTGGCTGTTCAGAAGAGCTTGGATCTCGACCCCAGTAAAACCAACGTGAG1.4 170465
RN00277                    NM_130433
                                   Acaa2    acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenz
                                                        acetyl-CoA C-acyltransferase activity; acyltransferase acti
          SEQ00185 GGACATGGATTTGATAGACGTGAATGAAGCATTTGCTCCTCAGTTCTTGGCTGTTC  1.4 170465
RN00278                    NM_080906
                                   Rtp801   HIF-1 responsive RTP801 14.0 140942
          SEQ00186 CAAAGTGGAGACAAGGAATTTCTGTGGTGGAGACCCGCAGGCAAGGACTGAAGGACTG
RN00279                    NM_080895
                                   Faim     Fas apoptotic inhibitory molecule 140930
                                                                            13.0
          SEQ00187 AGATCTCGTAGCTGTTTGGGACGTAGCATTAAGTGACGGAGTGCACAAGATTGAATTT
RN00280                    NM_080885
                                   Cdk5     cyclin-dependent kinase 5 11.0 140908 cycle; cell migration; cell-
                                                        ATP binding; axonogenesis; cell
          SEQ00188 CATGACCAAACTGCCAGACTATAAGCCCTACCCAATGTACCCAGCTACAACATCCTTG
RN00281                    NM_080769
                                   Lta      lymphotoxin A
                                                        cytokine activity; immune response; membrane; tumor ne
          SEQ00189 CCTTTCTCCGACATGGCTTCTCTTTGAACAACAACTCTCTCCTGATCCCCACCAG   5.0 25008
RN00282                    NM_080769
                                   Lta      lymphotoxin A
                                                        cytokine activity; immune response; membrane;
                                                                             5.0 25008
          seq00189 GGAGAGATGGAAAGCCGTCGGGTGACAACTAGGTCCCAGACACAAAGGCGTCAGTTAC tumor ne
RN00283                    NM_080769
                                   Lta      lymphotoxin A
                                                        cytokine activity; immune response; membrane; tumor ne
          seq00189 GGGGAGGTTGACTATTTATGAAGAGAAGGGTTAAGTTATTTATTTATAGGGAATAAAA5.0 25008
RN00284                    NM_057204
                                   Ptp-Td14 protein tyrosine phosphatase TD14
          seq00190 CACCTCAAGGTTCTGCCACGAGGCATTGGTGCGACATGTGGAGCAGGTCCTGCAGCGC6.0 117552
RN00285                    NM_057204
                                   Ptp-Td14 protein tyrosine phosphatase TD14
          SEQ00190 CAGCATGAGCGTCAGCTAGAAGAGCCACCTTCCTCAGGACTCCCAGGATCTGGTC   6.0 117552
RN00286                    NM_057204
                                   Ptp-Td14 protein tyrosine phosphatase TD14
          seq00190 GCCAGCATGAGCGTCAGCTAGAAGAGCCACCTTCCTCAGGACTCCCAGGATCTGGTCC6.0 117552
RN00287                    NM_057130
                                   Bid3     BH3 interacting domain 3
                                                        apoptosis; protein13.0 117271
          SEQ00191 CTGAAGACCTCCACGTCTGAGCAAAGTGACTTAGTTATGGTACAGCAACAGTCCTTTTbinding
RN00288                    NM_057103
                                   Akap12   A kinase (PRKA) anchor protein (gravin) 12
                                                        signal transduction6.0 83425
          SEQ00114 CAAGGCTGAACCTGAGATCCTGGAACTTGAGAGTAAGAGCAACAAGATTGTGCTG
RN00289                    NM_057100
                                   Gas6     heat shock apoptosis inhibitor activity; extracellular; extracellular spac
                                                        70kD protein 1A 12.0 58935
          SEQ00193 AGGTGATCGGCTTTAAAGAATATGTTTACATACGCATATCGCTGCACTCAATTGGACTGG
RN00289                    NM_057100
                                   Gas6     heat shock apoptosis inhibitor activity; extracellular; extracellular spac
                                                        70kD protein 1A 12.0 58935
          SEQ00193 AGGTGATCGGCTTTAAAGAATATGTTTACATACGCATATCGCTGCACTCAATTGGACTGG
RN00290                    NM_057100
                                   Gas6     heat shock apoptosis inhibitor activity; extracellular; extracellular spac
                                                        70kD protein 1A 12.0 58935
          seq00193 CAGATTCTCCTGTAGCACAAACCGAACCGGACTCTCCAAAGAGCCTTCCAGAATGACA
RN00291                    NM_057100
                                   Gas6     proprotein convertaseinhibitor activity;type 2
                                                        apoptosis subtilisin/kexin extracellular; extracellular spac
                                                                            12.0 58935
          seq00193 CCCGCCTGTGGAGCACGTCACAGCCTAGACCGAGCTGCAAGAGTTCTCTACACCTAAA
RN00292                    NM_053970
                                   Nln      thyrotropin releasing hormonemetalloendopeptidase
                                                        hydrolase activity; 2.0 117041
          SEQ00194 CTCTCCTGAGACATGATGAAGTGCGGACTTACTTCCACGAGTTCGGTCACGTCAT activity; metallop
RN00293                    NM_053937
                                   Erg2     Eag-relatedintegral to plasma membrane
                                                          gene member 2 3.0 116745
          SEQ00195 AGACCCTAAGCTACGGTGACTTGGACGACCATATTCAGACACCCAGGAATTTCTC
RN00294                    NM_053923
                                   Pik3c2g  "phosphatidylinositol 3-kinase, 6.0 domain containing, intracellular sig
                                                        inositol/phosphatidylinositol kinase activity;
                                                                              C2 116720
          seq00196 AGCTCTTTCTTCTCTACCTTCTCCTTATTTTCTTATCATATTTTCTCCTTGGAATATT gamma polypep
RN00295                    NM_053923
                                   Pik3c2g  "phosphatidylinositol 3-kinase, 6.0 domain containing, gamma polypep
                                                        inositol/phosphatidylinositol kinase activity; intracellular sig
                                                                              C2 116720
          SEQ00196 AGTTCATGTCTTGCCTTAATTGCTTGTTGAGGTCAAAATTATACTTTTAGGGTGTTTTCT
RN00296                    NM_053923
                                   Pik3c2g  "phosphatidylinositol 3-kinase, 6.0 domain containing, gamma polypep
                                                        inositol/phosphatidylinositol kinase activity; intracellular sig
          seq00196 GTGTACAAGCCACATATCTAGTCATGATTGAATTTATTGAGAGAATTGGTGATCTCCA C2 116720
RN00297                    NM_053906
                                   Gsr      glutathione glutathione-disulfide reductase activity; spermatogenesis
                                                         reductase          12.0 116686
          seq00197 ACGTCTCTTATGATCAGGCATGATAAGGTGCTTAGAAGCTTTGATTCACTCATCAGTTCCA
RN00298                    NM_053906
                                   Gsr      glutathione glutathione-disulfide reductase activity; spermatogenesis
                                                         reductase
          SEQ00197 GCTGGCGGTGTTGAGGTTCTCACAGTTAAGAAGTTCTCACAGGTTAAGGAAGTAA  12.0 116686
RN00299                    NM_053906
                                   Gsr      glutathione glutathione-disulfide reductase activity; spermatogenesis
                                                         reductase          12.0 116686
          seq00197 TGGCGGTGTTGAGGTTCTCACAGTTAAGAAGTTCTCACAGGTTAAGGAAGTAAAGAAGAC
RN00300                    NM_053842
                                   Mapk1    mitogen activated proteinMAP 6.0 116590
                                                         ATP binding; kinase 1
          seq00198 AAATGTTGACATTTAACCCTCACAAGAGGATTGAAGTTGAACAGGCTCTGGCCCACCC kinase activity; cAMP-dependent prote
RN00301                    NM_053842
                                   Mapk1    mitogen activated proteinMAP 6.0 116590
                                                         ATP binding; kinase 1
          seq00198 GTCCTGTCTCCAGCCCGTCTCAGCTTACCCACTCTTGACTCCTTTGAGCCGTTCCGAG kinase activity; cAMP-dependent prote
RN00302                    NM_053842
                                   Mapk1    mitogen activated proteinMAP 6.0 116590
                                                         ATP binding; kinase 1
          SEQ00198 TTTGAAGAGACTGCTCGATTCCAGCCAGGATACAGATCTTAAATTGGTCAGGACAAGG kinase activity; cAMP-dependent prote
RN00303                    NM_053826
                                   Pdk1     pyruvate dehydrogenase [pyruvate 116551
                                                         ATP binding; kinase 1 dehydrogenase (lipoamide)] kinase
                                                                              6.0
          SEQ00199 AAATCCAAACTGTGATGTAGTCGAGGTTATTAAAGATGGCTATGAGAATGCGAGACGGCT
RN00304                    NM_053826
                                   Pdk1     pyruvate dehydrogenase [pyruvate 116551
                                                         ATP binding; kinase 1 dehydrogenase (lipoamide)]
                                                                              6.0
          seq00199 ATAAATCCAAACTGTGATGTAGTCGAGGTTATTAAAGATGGCTATGAGAATGCGAGACGGCT kinase
RN00305                    NM_053826
                                   Pdk1     pyruvate dehydrogenase [pyruvate 116551
                                                         ATP binding; kinase 1 dehydrogenase (lipoamide)] kinase
          seq00199 TTTGTATTACGTTAACTCTCCTGAACTAGAACTTGAAGAACTAAATGCGAAATCACCA 6.0
RN00306                    NM_053769
                                   Ptpn16   "protein tyrosine phosphatase,6.0 114856 type 16"
                                                         MAP kinase phosphatase activity; intracellular signaling ca
          SEQ00200 CCTCTACTACAACGGTCTTCAACTTCCCTGTCTCCATCCCTGTTCACCCCACGAA    non-receptor
RN00307                    NM_053769
                                   Ptpn16   "protein tyrosine phosphatase,6.0 114856 type 16"
                                                         MAP kinase phosphatase activity; intracellular
                                                                              non-receptor
          seq00200 GCACCTCTACTACAACGGTCTTCAACTTCCCTGTCTCCATCCCTGTTCACCCCACGAA signaling ca
RN00308                    NM_053769
                                   Ptpn16   "protein tyrosine phosphatase,6.0 114856 type 16"
                                                         MAP kinase phosphatase activity; intracellular
                                                                              non-receptor
          seq00200 GTGCTTGACATACCTACCAGTATTAACCATTCCCGATGACATACACGTTTGAGAGTTT signaling ca
RN00309                    NM_053720
                                   Ded      apoptosis antagonizing transcription factor
                                                         apoptosis inhibitor activity; transcription factor activity
                                                                            13.0 114512
          SEQ00201 GCAGAGAGTGAGGAGATTTCCAGTGAAGATGATGAGCTAGTGGGAGAGAAGAAGAAACAA
RN00310                    NM_053698
                                   Cited2   "Cbp/p300-interacting transactivator, with Glu/Asp-rich
                                                                              9.0 114490
          SEQ00202 CCGCCCAATGTCATAGACACTGATTTCATCGACGAGGAAGTGCTTATGTCCTTAG carboxy-termin
RN00311                    NM_053679
                                   Dffa     "DNA fragmentation factor, alpha subunit"
                                                         apoptosis inhibitor activity; nucleus
                                                                            13.0 114214
          SEQ00203 GGCTCCAGAGCTGAGTCTGTCTAGTCAGGATTTAGAGGTGGGCAAGAACTAGGAACCC
RN00312                    NM_053647
                                   Cxcl2    chemokine chemokine activity;5.0 114105 cytokine
                                                         (C-X-C motif) ligand 2chemotaxis;
          SEQ00204 AAAGATACTGAACAAAGGCAAGGCTAACTGACCTGGAAAGGAAGAACATGGGCTCactivity; extracell
RN00313                    NM_053601
                                   Nnat     neuronatin development
          SEQ00205 GAGATATGGGCGTAGGCACCACATTCTGATCTGGACCAAGTTGGAACAGCACCATC   3.0 94270
RN00314                    NM_053563
                                   Ddxl     "nuclear RNA helicase, DECD variant of DEAD box family"
                                                                            10.0 89827
          seq00206 AGAGCTATAGTTGACTGTGGCTTTGAACATCCTTCAGAGGTCCAGCATGAATGTATTCC
RN00315                    NM_053563
                                   Ddxl     "nuclear RNA helicase, DECD variant of DEAD box family"
                                                                            10.0 89827
          seq00206 ATGTCAAAGGATCTTATGTCTCCATCCACAGTTCTGGCTTCCGGGACTTTCTGCTGAA
RN00316                    NM_053563
                                   Ddxl     "nuclear RNA helicase, DECD variant of DEAD box
                                                                            10.0 89827
          SEQ00206 GATACCAGCAGTTCAAGGACTTCCAGCGTCGCATCCTAGTGGCTACTAATCTGTTfamily"
RN00317                    NM_053424
                                   Slc4a4   "solute carrier family 4, member 4"84484
                                                         anion transport; bicarbonate transport; inorganic anion exc
          SEQ00207 GTATGGACTACCTCTTCTCCCAGCACGACCTCAGCTTCCTTGATGATGTCATTCC    3.0
RN00318                    NM_053420
                                   Bnip3    "BCL2/adenovirus E1B 19 kDa-interacting protein 3, nuclear gene for
                                                         apoptosis activator activity
                                                                            13.0 84480
          SEQ00208 TTGAAGAACTAGCATGATCCTTGGGTGTCTGCACTAAGTGTGTTTATTTGGTTTGGAA
RN00319                    NM_053353
                                   LOC84349 CD40 ligand                     13.0 84349
          SEQ00209 AGGACTCTATTATGTCTACACCCAAGTCACCTTCTGCTCTAATCGGGAACCTTTGAGT
RN00320                    NM_053328
                                   Bhlhb2   "basic helix-loop-helix domain 9.0 79431circadian clock; negative reg
                                                         DNA binding; entrainment of class B2"
          SEQ00210 CTCCTTTAAACTTAGAAACCAAAGACTAAACTCTTGAGGGCGAATCTCCTGCTGCT   containing,
RN00321                    NM_052801
                                   Vhl      von Hippel-Lindau syndrome homologcycle; nucleus; regulation
                                                         negative regulation9.0 cell
                                                                               of 24874
          seq00211 AAAGATGTAATGTTTGTCTTATTTAACTGGAAGTTTGAATACTGTTCTCTGTGCCTTAGGAC of tran
RN00322                    NM_052801
                                   Vhl      von Hippel-Lindau syndrome homologcycle; nucleus;
                                                         negative regulation9.0 cell
                                                                               of 24874
          SEQ00211 CTTTGTAGACCAAACAACTGATTACTGGCCTCAAACGGAGATCTGTCTGCCTCTG regulation of tran
RN00323                    NM_052801
                                   Vhl      von Hippel-Lindau syndrome homologcycle; nucleus; regulation of tran
                                                         negative regulation9.0 cell
          seq00211 TCCCTTTGTAGACCAAACAACTGATTACTGGCCTCAAACGGAGATCTGTCTGCCTCTG  of 24874
RN00324                    NM_033230
                                   Akt1     v-akt murine thymoma viral oncogene homolog 1regulation
                                                         ATP binding; anti-apoptosis; positive
                                                                            11.0 24185
          seq00212 CTGGAGAACCTCATGCTGGACAAGGACGGGCACATCAAGATAACGGACTTCGGGCTGT of cell gro
RN00325                    NM_033230
                                   Akt1     v-akt murine thymoma viral oncogene homolog 1regulation
                                                         ATP binding; anti-apoptosis; positive
                                                                            11.0 24185
          seq00212 CTTCCTTACAGCCCTCAAGTACTCATTCCAGACCCACGACCGCCTCTGCTTTGTCATG of cell gro
RN00326                    NM_033230
                                   Akt1     v-akt murine thymoma viral oncogene homolog 1regulation
                                                         ATP binding; anti-apoptosis; positive
                                                                            11.0 24185
          SEQ00212 CTTTCAAGCCCCAGGTCACCTCTGAGACCGACACCAGGTATTTTGATGAGGAGTTCAC of cell gro
RN00327                    NM_032080
                                   Gsk3b    glycogen synthase kinase 3 beta 84027 protein kinase
                                                         ATP binding; cAMP-dependent
                                                                              1.1
          seq00213 ACACACCTGCCCTCTTCAACTTTACCACTCAAGAACTGTCAAGTAACCCACCTCTGGC activity; est
RN00328                    NM_032080
                                   Gsk3b    glycogen synthase kinase 3 beta 84027 protein kinase
                                                         ATP binding; cAMP-dependent
                                                                              1.1
          seq00213 GAGACCGTGGACAGACCAATAACGCCGCTTCTGCATCAGCCTCCAACTCTACCTGAAC activity; est
RN00329                    NM_032080
                                   Gsk3b    glycogen synthase kinase 3 beta 84027 protein kinase
                                                         ATP binding; cAMP-dependent
                                                                              1.1
          SEQ00213 TATAGTCGAGCCAAGCAGACACTCCCTGTGATCTATGTCAAGTTGTATATGTACCAGCT activity; est
RN00330                    NM_032063
                                   Dll1     delta-like 1 Notch binding; Notch signaling pathway; calcium
                                                         (Drosophila)         6.0 84010
          SEQ00214 AAAGGATGAGTGTGTTATAGCGACTGAGGTTTAAGGTGGAAGTGATGTGGCAAAGTTC ion bindi
RN00331                    NM_031977
                                   Src      tyrosine protein kinase pp60-c-src 83805 kinase activity
                                                         kinase activity; protein-tyrosine
          seq00215 CTAGACGGGAATCAGAGCGGCTACTTCTCAACGCCGAGAACCCCAGAGGGACCTTCCTC6.0
RN00332                    NM_031977
                                   Src      tyrosine protein kinase pp60-c-src 83805 kinase activity
                                                         kinase activity; protein-tyrosine
          seq00215 CTTACTACTCCAAACATGCTGATGGCCTGTGTCACCGTCTCACTACCGTGTGTCCCAC 6.0
RN00333                    NM_031977
                                   Src      tyrosine protein kinase pp60-c-src 83805 kinase activity
                                                         kinase activity; protein-tyrosine
          SEQ00215 CTTTCTAAACCCTGGGTCTGTTTCAAGCTGGCCAAAGAGCCTTTCCAAAGAGGAATAA 6.0
RN00334                    NM_031971
                                   Hspa1a   proprotein convertase subtilisin/kexin type 2 defense response; heat s
                                                         ATP binding; chaperone activity;
          SEQ00216 AACAAGATCACCATCACCAACGACAAGGGCCGCCTGAGCAAGGAGGAGAT       12.0 24472
RN00335                    NM_031971
                                   Hspa1a   thyrotropin releasing hormone
                                                         ATP binding; chaperone activity; defense response; heat s
                                                                            12.0 24472
          seq00216 GCCAACAAGATCACCATCACCAACGACAAGGGCCGCCTGAGCAAGGAGGAGATCGAGC
RN00336                    NM_031971
                                   Hspa1a   heat shock ATP binding; chaperone activity; defense response; heat s
                                                         70kD protein 1A 12.0 24472
          seq00216 TTTATATATTCAAATTAAGGTTGCATGTTCTTTGCGTTTAATCTAAGTAGCTGTGTAAA
RN00337                    NM_031836
                                   Vegf     vascular endothelial growth factor 83785 positive regulation of cell pro
                                                         angiogenesis; neurogenesis;
          SEQ00217 TTAAATCCTGGAGCGTTCACTGTGAGCCTTGTTCAGAGCGGAGAAAGCATTTGTTT   4.0
RN00338                    NM_031802
                                   Gpr51    G protein-coupled receptor 51receptor activity; G-protein
                                                         G-protein coupled 4.0 83633
          seq00218 CTAAAGAATCCTAAAGGCAGCTTCAACAGGCAGGCAATAATCTCTTCCCAGACCACTG coupled rece
RN00339                    NM_031802
                                   Gpr51    G protein-coupled receptor 51receptor activity; G-protein
                                                         G-protein coupled 4.0 83633
          seq00218 GATGTCCTTCTCTGTTTAGGCACCAAAACTCCGTGTTGTCACTCACTGTGTGTGTTAA coupled rece
RN00340                    NM_031802
                                   Gpr51    G protein-coupled receptor 51receptor activity; G-protein coupled rece
                                                         G-protein coupled 4.0 83633
          SEQ00218 GCTCACTCCCTAAAGAATCCTAAAGGCAGCTTCAACAGGCAGGCAATAATCTCTT
RN00341                    NM_031797
                                   Kai1     kangai 1 integral to membrane; plasma membrane
                                                                            14.0 83628
          SEQ00219 GGTTGTTCCTGTCCATATGTTTGTGCCGGTACATTCATTCTGAAGATTACAGCAAGGT
RN00342                    NM_031785
                                   Atp6s1   "ATPase, H+ transporting, lysosomal (vacuolar proton pump), subuni
                                                                              3.0 83615
          seq00220 CTTCTACCAACAAAGTGTATTATTCTTCATAGATAAATCTTCCAGGCTTCATCAAGAGGG
RN00343                    NM_031785
                                   Atp6s1   "ATPase, H+ transporting, lysosomal (vacuolar proton
                                                                              3.0 83615
          SEQ00220 GTTTGTCCTCTTCCTACTATAGCATGAACCCTACATACACCACCCTCAGCCTGTC pump), subuni
RN00344                    NM_031785
                                   Atp6s1   "ATPase, H+ transporting, lysosomal (vacuolar proton pump), subuni
          seq00220 GTTTGTCCTCTTCCTACTATAGCATGAACCCTACATACACCACCCTCAGCCTGTCTTG 3.0 83615
RN00345                    NM_031777
                                   Usf1     upstream transcription factor 19.0 metabolism;
                                                         DNA binding; glucose 83586
          seq00221 CCCCAGGACCCACCCTTATTCCCCGAAGTCAGAGGCTCCCAGGACAACGC regulation of transcript
RN00346                    NM_031777
                                   Usf1     upstream transcription factor 19.0 metabolism; regulation of transcript
                                                         DNA binding; glucose 83586
          SEQ00221 GACAGTGCAGATTCAGGAAGGTGCAGTGGCTACTGGAGAGGACCCAACTAGTGTA
RN00347                    NM_031777
                                   Usf1     upstream transcription factor 19.0 metabolism;
                                                         DNA binding; glucose 83586
          seq00221 TGATGATGTCACCACAAGAAGTGTTACAGGGAGGGAGCCAGCGGTCAATT regulation of transcript
RN00348                    NM_031753
                                   Alcam    activated leukocyte cell adhesion molecule
          SEQ00222 TTATATGGATAGTCTGAGCAGGTGCGGTTCTGATTCTGATTGCTATCAGTAATGCC   1.4 79559
RN00349                    NM_031740
                                   B4galt6  "UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6"
                                                         Golgi apparatus; UDP-galactose-glucosylceramide beta-1
          seq00223 AAATTCCTATTCCTGCCAGTCAATGGTGGAGTTTGCCTTTAATCCAAGCTCTCTGGAA 1.4 65196
RN00350                    NM_031740
                                   B4galt6  "UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase,
                                                         Golgi apparatus; UDP-galactose-glucosylceramide beta-1
                                                                              1.4 65196
          SEQ00223 GAAGGAGAGGACTACCCTGGTACATTGTTCTCAGACTTCTGTATGTGTGCGGCTC polypeptide 6"
RN00351                    NM_031740
                                   B4galt6  "UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6"
                                                         Golgi apparatus; UDP-galactose-glucosylceramide
                                                                              1.4 65196
          seq00223 TGTCATTGTATCTGCCCTGTTTCTTTATAAATAACACTCTAGATTTCTTGCCTTGGGTTTGC beta-1
RN00352                    NM_031731
                                   Aldh3a2 "aldehyde dehydrogenase family 3, subfamily A2"
                                                         aldehyde dehydrogenase (NAD) activity;
                                                                               1.4 65183
          SEQ00224 CCTTCGGGAGTCGGCTCTCAGTCTAAACATCCTTTCTCATTCATAGTGTGTCACC endoplasmic retic
RN00353                    NM_031693
                                   Syt4     synaptotagmin 4 to membrane; membrane; regulation of
                                                         integral              2.0 64440
          seq00225 AACGAACTGTTTGTCTTTGATATTCCTTGTGAGAGTCTTGAAGAAATAAGTGTTGAATTT calcium io
RN00354                    NM_031693
                                   Syt4     synaptotagmin 4 to membrane; membrane; regulation of calcium io
                                                         integral
          SEQ00225 GCACTCCCAACGCAGTGTTCAACGAACTGTTTGTCTTTGATATTCCTTGTGAGAG     2.0 64440
RN00355                    NM_031693
                                   Syt4     synaptotagmin 4 to membrane; membrane; regulation of
                                                         integral              2.0 64440
          seq00225 GGTTAGAAGTGGATTAAATTAGTAGACCAGAAGATAGCTGTAAATGTGTATTATGATAAT calcium io
RN00356                    NM_031626
                                   Nr1h2    "nuclear receptorbinding; ligand-dependent nuclear receptor
                                                         DNA subfamily 1, 9.0 58851
                                                                               group H, member 2"
          seq00226 ATCCACCATCGAGATCATGTTGCTAGAGACAGCCAGACGCTACAACCACGAGACAGAG activity; n
RN00357                    NM_031626
                                   Nr1h2    "nuclear receptorbinding; ligand-dependent nuclear receptor activity; n
                                                         DNA subfamily 1, 9.0 58851
          SEQ00226 CTACAACCACGAGACAGAGTGCATCACGTTCCTGAAGGACTTCACCTACAGCAAG     group H, member 2"
RN00358                    NM_031626
                                   Nr1h2    "nuclear receptorbinding; ligand-dependent nuclear receptor
                                                         DNA subfamily 1, 9.0 58851
                                                                               group H, member 2"
          seq00226 GCCTAGACGATGCAGAGTATGCCTTGCTCATTGCCATCAACATCTTCTCAGCGGACCG activity; n
RN00359                    NM_031622
                                   Mapk6    mitogen-activated proteinMAP 6.0658840
                                                         ATP binding; kinase
          SEQ00227 CCAATGAGACTCGTCCGCCATTTATCAATGTCCTGGTGTTCATCCTTTACAGTGA      kinase activity; cAMP-dependent prote
RN00360                    NM_031575
                                   Akt3     thymoma viral proto-oncogene 3 amino acid phosphorylation;
                                                         ATP binding; protein 29414
                                                                              11.0
          SEQ00228 ACAGACACCAGATATTTCGATGAAGAATTTACAGCTCAGACTATTACAATAACACCACCT protein k
RN00361                    NM_031575
                                   Akt3     thymoma viral proto-oncogene 3 amino acid phosphorylation;
                                                         ATP binding; protein 29414
                                                                              11.0
          seq00228 AGACAGACACCAGATATTTCGATGAAGAATTTACAGCTCAGACTATTACAATAACACCACCTprotein k
RN00362                    NM_031575
                                   Akt3     thymoma viral proto-oncogene 3 amino acid phosphorylation; protein k
                                                         ATP binding; protein 29414
          seq00228 GAGAGAGCGGGTGTTCTCTGAGGACCGCACACGTTTCTATGGTGCAGAAATTGTCTCT 11.0
RN00363                    NM_031510
                                   Idh1     isocitrate dehydrogenase 1 12.0 24479
                                                         cytosol; glutathione metabolism; glyoxylate
          SEQ00229 GCCTGTAAGAACTATGATGGTGATGTGCAGTCAGACTCAGTAGCCCAAGGTTATG cycle; isocitrat
RN00364                    NM_031127
                                   Suox     sulfite oxidase
                                                         electron transport; mitochondrion; molybdenum
                                                                               1.3 81805
          seq00230 AAAGCAGCTCTCAAGACATCACTTTCTTACCCTACCATACCTTTACTTCTCATGCCTCC ion bindin
RN00365                    NM_031127
                                   Suox     sulfite oxidase
                                                         electron transport; mitochondrion; molybdenum
                                                                               1.3 81805
          seq00230 CTCGCCATGTCAAGTGGTTGGGCAGAGTGAGTGTGGAGTCAGAGGAAAGTTATAGTCA ion bindin
RN00366                    NM_031127
                                   Suox     sulfite oxidase
                                                         electron transport; mitochondrion; molybdenum ion bindin
          SEQ00230 GTGTGGAGTCAGAGGAAAGTTATAGTCACTGGCAGAGGCGGGATTACAAAGGCTT     1.3 81805
RN00367                    NM_031120
                                   Ssr3     TRAP-complex gamma subunit 81784 to membrane
                                                         endoplasmic reticulum; integral
          seq00231 CTGTCCGCCAAATCGTCGGCGCTGTTCTTCGGGAATGCGTTCATCGTGTCTGCCATTC 13.0
RN00368                    NM_031120
                                   Ssr3     TRAP-complex gamma subunit 81784 to membrane
                                                         endoplasmic reticulum; integral
          seq00231 GTACAGCGTGATGACGTTAGTAAGCACTTACTTGGTAGCCTTTGCATACAAGAATGTA 13.0
RN00369                    NM_031120
                                   Ssr3     TRAP-complex gamma subunit 81784 to membrane
                                                         endoplasmic reticulum; integral
                                                                              13.0
          SEQ00231 TGCCGATTATGAAGCTACAACATTCTCCATCTTCTATAACAACACTCTGTTCCTGGTTCT
RN00370                    NM_031107
                                   Rps6ka1 S6 protein kinase (Rsk-1)
                                                         ATP binding; cAMP-dependent protein kinase
                                                                               6.0 81771
          seq00232 CCAAGACTCCCGTGATAGCTTTGGGACTCCGCCCCTCTGTTGGTCAAGGAGCCATCTGactivity; pro
RN00371                    NM_031107
                                   Rps6ka1 S6 protein kinase (Rsk-1)
                                                         ATP binding; cAMP-dependent protein kinase
                                                                               6.0 81771
          seq00232 CGTGGATCACCCAGAAAGACAAGCTCCCCCAGAGCCAGTTGTCCCACCAAGACCTGCAactivity; pro
RN00372                    NM_031107
                                   Rps6ka1 S6 protein kinase (Rsk-1)
                                                         ATP binding; cAMP-dependent protein kinase activity; pro
          SEQ00232 GAGGGAGCAAGCCTGAGTCACAGACCAAGTGGAATGGAGTCCTAAAGGAAGCAACTAG  6.0 81771
RN00373                    NM_031020
                                   Mapk14   mitogen activated proteinMAP 6.0 81649
                                                         ATP binding; kinase 14 activity; angiogenesis;
                                                                                kinase
          SEQ00233 ACATGAATCCTCAGGGGTGAAGAACAGTTTGCATAATTTTCTGAATTTCAGGCACTTTGT cAMP-de
RN00374                    NM_031020
                                   Mapk14   mitogen activated proteinMAP 6.0 81649
                                                         ATP binding; kinase 14 activity; angiogenesis; cAMP-de
                                                                                kinase
          seq00233 TGGGGAGAAAGCAATTTTGTCTTGGAATTTTGTATGTTGTAGGAATCCTTAGAGAGTGTGGT
RN00374                    NM_031020
                                   Mapk14   mitogen activated proteinMAP 6.0 81649
                                                         ATP binding; kinase 14 activity; angiogenesis; cAMP-de
                                                                                kinase
          seq00233 TGGGGAGAAAGCAATTTTGTCTTGGAATTTTGTATGTTGTAGGAATCCTTAGAGAGTGTGGT
RN00375                    NM_031003
                                   Abat     4-aminobutyrate aminotransferase81632 activity; aminobutyrate met
                                                         4-aminobutyrate transaminase
          SEQ00234 AGCAAGAGGAGGCCCGCTGTCTAGAAGAGGTGGAGGATCTAATTGTGAAATATCG     1.6
RN00376                    NM_030989
                                   Tp53     tumor protein p53
                                                         DNA binding; DNA damage response, signal transduction
          SEQ00235 ATCCTGTCCCCATCACCAGCCTCCCCGTCCCCTCCTTTCTTGCCATTTTATGACTTTAG11.0 24842
RN00377                    NM_030989
                                   Tp53     tumor protein p53
                                                         DNA binding; DNA damage response, signal transduction
          seq00235 GAATGGGTTGGTAGTTGCTGGGTCTCTGCTGGTCCAGCGAAATCCTATCCGGTCAGTT 11.0 24842
RN00378                    NM_030989
                                   Tp53     tumor protein p53
                                                         DNA binding; DNA damage response, signal transduction
          seq00235 TTTATGACTTTAGGGCTTGTTATGAGAGCTGACAAGACAATGCTAGTCCCTTCACTGCC11.0 24842
RN00379                    NM_030858
                                   Madh7    MAD homolog 7 (Drosophila) 9.0 81516 common-partner
                                                         cellular_component unknown;
          SEQ00236 CTACAAAGGTTTAAATGAACAAGAGAGGCGTTCTCATCGGAAATTTAGCATCGTAGTGC SMAD pro
RN00380                    NM_030845
                                   Gro1     gro          neutrophil chemotaxis 81503
          SEQ00237 CCCAAGTAATGGAGAAAGAAGATAGATTGCACCGATGGCGTCTGTCTGGTGAACG     5.0
RN00381                    NM_023987
                                   Birc2    inhibitor of apoptosis protein 1
                                                         anti-apoptosis       13.0 78971
          SEQ00238 AGGAAATCGACCCTGGGTTGTACAGAGATATATTTGTGCGACAGAACATTAGGAGTCTTC
RN00382                    NM_023950
                                   Rab7     "RAB7, member binding; DNA 2.0 29448
                                                         ATP RAS oncogene family"
                                                                               binding; GTP binding;
          SEQ00239 AAGAAAGTGTTGCTGAAGGTCATCATCCTGGGAGACTCTGGTGTTGGAAAGACAT GTPase activity;
RN00383                    NM_022958
                                   Pik3c3   phosphatidylinositol 3-kinase 6.0 65052 activity; phosphoinositide-me
                                                         phosphatidylinositol 3-kinase
          SEQ00240 GCGAAGGTATTCAAATCTGATTCTGAACTTGTTCTCCTTGATGGTTGATGCAAACATTCC
RN00384                    NM_022921
                                   RT1-M3 "RT1 class defense response; 7.0 24747 space; immune response
                                                         Ib gene, locus M3" extracellular
          SEQ00241 CTCAGATCACGAAGAGCGAGTTAGAGTCAGAAGGTAGAGCAGAATACTTCAGAGCCT
RN00385                    NM_022856
                                   Nab1     Ngfi-A binding protein of transcription, DNA-dependent
                                                         regulation 1
          SEQ00242 CACCAGATCCGAGGATATGCTCCATCGTAGATTAAGCCTTAATAACCAGTGTTGCCT   9.0 64824
RN00386                    NM_022676
                                   Ppp1r1a "protein phosphatasemetabolism; protein phosphatase inhibitor activit
                                                         glycogen 1, regulatory58977
          SEQ00243 AATGTCTCCACGGCAACGGAAGAAGATGACAAGGACTACACCCACCATGAAAGAG1A"  6.0 (inhibitor) subunit
RN00387                    NM_022607
                                   Mipp65   MIPP65 protein
                                                         mitochondrion
          SEQ00244 TGTAGAAGATAGTAAAGAAATCAGGTCCAAGCTCATGACATCCAAGCCACAGTCCAGTG 1.5 64539
RN00388                    NM_022594
                                   Ech1     enoyl coenzyme A hydratase 11.6acid metabolism; isomerase
                                                         catalytic activity; fatty 64526
          seq00245 CAAGGTCATTGGGAACCGGAGCCTGGTCAACGAGCTGACCTTCACCGCCCGCAAGATG activity;
RN00389                    NM_022594
                                   Ech1     enoyl coenzyme A hydratase 11.6acid metabolism; isomerase activity;
                                                         catalytic activity; fatty 64526
          SEQ00245 GAGGAAGTCTCAGACCACAACTACGAGTCTATTCAAGTAACATCTGCCCAGAAGCATG
RN00390                    NM_022594
                                   Ech1     enoyl coenzyme A hydratase 11.6acid metabolism; isomerase activity;
                                                         catalytic activity; fatty 64526
          seq00245 GCGTCCAAAAGAATCCCTGAGGAAGTCTCAGACCACAACTACGAGTCTATTCAAGTAA
RN00391                    NM_022538
                                   Ppap2a   phosphatidate phosphohydrolase type 2a
                                                         phosphatidate phosphatase activity
          SEQ00246 TGAGTCCATCAAGTACCCTTACAGAGAAGACACCATCCCTTATGCGTTATTAGGT     1.4 64369
RN00392                    NM_022509
                                   Smn      survival motor neuron
          SEQ00247 ACAATACAGAACAGAACACTCAGGAGAATGAAAGCCAAGTTTCCACAGACGACAGT   10.0 64301
RN00393                    NM_022508
                                   LOC64300 C1-tetrahydrofolate synthase 1.6 64300
          seq00248 AAATAGTGGAAGTTTCTCTAAAGCCTTTCATAGCCTTAATTCAGATCATGTATAAATT
RN00394                    NM_022508
                                   LOC64300 C1-tetrahydrofolate synthase 1.6 64300
          seq00248 CCCACTGAGGAAGTGTGCAGAGAAGTCTTGAAAGTCTGTGCCTGCCCTGAAGAGCTTC
RN00395                    NM_022508
                                   LOC64300 C1-tetrahydrofolate synthase 1.6 64300
          SEQ00248 CCTGGACCTGGTGGAAAAGGGCTTCAGTAACTTGAGGAAACAGATAGAAAATGCT
RN00396                    NM_022274
                                   Birc5    baculoviral IAP repeat-containing 5 (survivin) activity
                                                         anti-apoptosis; apoptosis inhibitor
                                                                              13.0 64041
          SEQ00249 TGTTGGTTTATATATGTTTGTGCTGATAATTCTTCTTCTGTCCTTCTGATGAGTCCTCCT
RN00397                    NM_022231
                                   Birc4    baculoviral IAP repeat-containing 4 inhibitor activity
                                                         anti-apoptosis; apoptosis
          SEQ00250 TCTTGTGAGTGCTCAGAAAGATAATTCGCAGGATGAGTCAAGTCAGACTTCATTGCAGA13.0 63879
RN00398                    NM_021764
                                   LOC60383 protein kinase C-binding protein Beta15
          seq00251 ATCCGCTGTACTGTCTGCCACACTGAGATCTGCTGGGTCACCAAGGGTCCACGCTGGG  9.0 60383
RN00399                    NM_021764
                                   LOC60383 protein kinase C-binding protein Beta15
          seq00251 CGGGTCAATGGGATTCCATGCCATCCAAGCTGTCAAAACTGCCACTAAGTCAAAGATG  9.0 60383
RN00400                    NM_021764
                                   LOC60383 protein kinase C-binding protein Beta15
          SEQ00251 GTCAATGGGATTCCATGCCATCCAAGCTGTCAAAACTGCCACTAAGTCAAAGATG     9.0 60383
RN00401                    NM_021752
                                   Api2     apoptosis inhibitor 2
                                                         anti-apoptosis
          seq00252 GGGGATGCTTGCTGTGTGTCCTCAGGACTTCCTGGATTTGGGATTTCTGAAAACTTTG 13.0 60371
RN00402                    NM_021752
                                   Api2     apoptosis inhibitor 2
                                                         anti-apoptosis       13.0 60371
          SEQ00252 TGGATGATCTTCTTGAGGCCAGTGTACTTACAAAGGAGGAACATGATATTATCAGACAGA
RN00403                    NM_021752
                                   Api2     apoptosis inhibitor 2
                                                         anti-apoptosis       13.0 60371
          seq00252 TGGATGATCTTCTTGAGGCCAGTGTACTTACAAAGGAGGAACATGATATTATCAGACAGAAA
RN00404                    NM_021699
                                   LOC60328 serine/threonine kinase
          SEQ00253 TTCACCTCCAAGTTTGTCCGCAGGAACCTGAATGAACCTGAAAGCAAAGACCGAG     8.0 60328
RN00405                    NM_021655
                                   Chga     chromogranin A binding; calcium ion binding; extracellular space
                                                         ATP
          seq00254 CAGAGCAGAGGACCAGGAGCTAGAGAGCCTGTCAGCCATCGAGGCAGAGCTGGAGAAG  4.0 24258
RN00406                    NM_021655
                                   Chga     chromogranin A binding; calcium ion binding; extracellular
                                                         ATP                   4.0 24258
          SEQ00254 CTATTCAGGCTACAAGAAGATCCAGAAAGATGATGATGGTCAGTCGGAGTCTCAGGC space
RN00407                    NM_021655
                                   Chga     chromogranin A binding; calcium ion binding; extracellular
                                                         ATP                   4.0 24258
          seq00254 TCTATTCAGGCTACAAGAAGATCCAGAAAGATGATGATGGTCAGTCGGAGTCTCAGGC space
RN00408                    NM_021589
                                   Ntrk1    trk precursorATP binding; integral to membrane; membrane;
                                                                               6.0 59109
          seq00255 CCTGATGCAAAACTGCTGGCTGGCGGCGAGGATGTGGCTCCTGGTCCTTTGGGCCTTG neurogen
RN00409                    NM_021589
                                   Ntrk1    trk precursorATP binding; integral to membrane; membrane; neurogen
          SEQ00255 GTCAAGGCACTGAAGGAGACATCTGAGAATGCTCGTCAGGACTTCCATCGTGAGG     6.0 59109
RN00410                    NM_021589
                                   Ntrk1    trk precursorATP binding; integral to membrane; membrane;
                                                                               6.0 59109
          seq00255 TACGCTTCTTTGGAGTCTGCACGGAGGGTGGCCCATTGCTCATGGTCTTCGAGTACAT neurogen
RN00411                    NM_020306
                                   Adam17 a disintegrin and metalloproteinase domain 17
          SEQ00256 CCAAGATGAAGACTAGCTCTGGAACAGTCTATACAAACAGCCACATGAACTTCAAGATGG6.0 57027
RN00412                    NM_020087
                                   Notch3   Notch 3      Notch signaling pathway; cell differentiation;
                                                                               6.0 56761
          SEQ00257 CTCTCATCCCTTTATCTCTGTACCAGCTTTCCTGAACCTCTCTGTCTTGAAGTGTGAC regulation of
RN00413                    NM_020071
                                   Fgb      "fibrinogen, bloodpolypeptide" 8.0 24366
                                                          beta coagulation
          seq00258 CCTAATCGAAATGGAGGACTGGAAAGGAGACAAGGTGAAGGCACACTATGGAGGCTTC
RN00414                    NM_020071
                                   Fgb      "fibrinogen, bloodpolypeptide" 8.0 24366
                                                          beta coagulation
          seq00258 GACATCCGAAATGTATCTCATTCAGCCTGACACCTCCAGCAAACCATACAGAGTGTAC
RN00415                    NM_020071
                                   Fgb      "fibrinogen, bloodpolypeptide" 8.0 24366
                                                          beta coagulation
          SEQ00258 TAATCGAAATGGAGGACTGGAAAGGAGACAAGGTGAAGGCACACTATGGAGGCTT
RN00416                    NM_019356
                                   Eif2s1   "eukaryotic RNA binding; protein biosynthesis; regulation of
                                                         translation initiation factor 2, subunit 1 (alpha )"
                                                                               2.0 54318
          SEQ00259 CTAAAATTGGGCTTGCGGTTTTCATTTCTGATGTCTCTGGATTGGCACCCTTATGGTTTA protein bi
RN00417                    NM_019335
                                   Prkr     "Protein kinase, interferon-inducible double stranded
                                                         RNA binding; protein kinase activity
                                                                               2.0 54287
          SEQ00260 CAGGGTCTATGCTTTCAGTGGAATTGCCTTCTGTGTTCTAGCCTTGGTGATCTTAGRNA dependent
RN00418                    NM_019284
                                   Cspg5    chondroitin sulfate proteoglycan 5 50568
          SEQ00261 AAGAAACTCTATCTGCTCAAGACTGAGAACACCAAGCTGAGGAGGACCAACAAATTCC  8.0
RN00419                    NM_019281
                                   Gja9     gap junction membrane channelconnexon channel activity; connexon
                                                         cell communication; protein alpha 9
          SEQ00262 CGTAGTGCTCGCTGTGAAGGTCTAGGATACAGATATTAAGAGGTCGTCATCAACAC    8.0 50564
RN00420                    NM_019281
                                   Gja9     gap junction membrane channelconnexon channel activity;
                                                         cell communication; protein alpha 9
                                                                               8.0 50564
          seq00262 GACCACCGGGTAGAGTGACAAGATGGCTAAGTTGGATGTCCTTGGGCCTTCTTCTTTC connexon
RN00421                    NM_019281
                                   Gja9     gap junction membrane channelconnexon channel activity; connexon
                                                         cell communication; protein alpha 9
                                                                               8.0 50564
          seq00262 GTGAAGGTCTAGGATACAGATATTAAGAGGTCGTCATCAACACAAAGGAGAGGTAGAACTG
RN00422                    NM_019277
                                   Sec15    SEC15 homolog (S. cerevisiae) 50556
          SEQ00263 GCTCCTTGACTTGTTTATGGTTTGGGACTGGTCTACTTACCTGGCTGACTATGGG     2.0
RN00423                    NM_019238
                                   Fdft1    farnesyl diphosphate farnesyl transferase cholesterol biosynthesis; en
                                                         biosynthesis; catalytic activity; 1
                                                                               1.4 29580
          seq00264 CTGTCAAAGCTATCATATACCAGTACATAGAAGAGATTTATCACCGGGTCCCCAACTCAGAC
RN00424                    NM_019238
                                   Fdft1    farnesyl diphosphate farnesyl transferase cholesterol biosynthesis; en
                                                         biosynthesis; catalytic activity; 1
          seq00264 CTGTTACAATAACCATCAGGTATTCAAGGGAGTAGTGAAGATTCGGAAGGGGCAAGCA  1.4 29580
RN00425                    NM_019238
                                   Fdft1    farnesyl diphosphate farnesyl transferase cholesterol
                                                         biosynthesis; catalytic activity; 1
                                                                               1.4 29580
          SEQ00264 GCCGTGAAGTGCTTGAATGAACTCATAACCAACGCCCTACAACACATCCCTGACG biosynthesis; en
RN00426                    NM_019234
                                   Dncic1   "dynein, cytoplasmic, intermediate 295641"
          seq00265 AGTGTTTCCCCATATCCTCCCCATGTACCCTACTCACCCGAAATCCACCACAGCATTT  2.0 chain
RN00427                    NM_019234
                                   Dncic1   "dynein, cytoplasmic, intermediate 295641"
          SEQ00265 GGTAAGGAAGTTGCAGTAGGTGACTCAGAAGGCCGCATCTGGATCTACGATGTTG     2.0 chain
RN00428                    NM_019234
                                   Dncic1   "dynein, cytoplasmic, intermediate 295641"
          seq00265 TAAGGAAGTTGCAGTAGGTGACTCAGAAGGCCGCATCTGGATCTACGATGTTGGAGAG  2.0 chain
RN00429                    NM_019232
                                   Sgk      serum/glucocorticoid regulated6.0 29517
                                                         ATP binding; apoptosis; cAMP-dependent
                                                                                kinase
          SEQ00266 GAAGATGCAGGTCTAAGAGGGATCTCCGCAGGTCTGAGCTGTGATCAAGAATATT protein kinase a
RN00430                    NM_019220
                                   Aes      amino-terminal enhancer of split transcription, DNA-dependent
                                                         nucleus; regulation9.0 29466
          SEQ00267 CTGTCACTCTCTGCTCTGGGCTCTCAGACCCACCTCTCCAAGGAGGACAAGAACG     of
RN00431                    NM_019186
                                   Arl4     ADP-ribosylation-like 4 nucleus; small GTPase mediated signal tran
                                                         GTP binding;
          SEQ00268 CAGACTTCCATCCTATCCAGCCTGCCGTCCTTTCAGTCCTTTCACATTGTTATTC     2.0 29308
RN00432                    NM_019186
                                   Arl4     ADP-ribosylation-like 4 nucleus; small GTPase mediated signal tran
                                                         GTP binding;
          seq00268 GACCAGACTTCCATCCTATCCAGCCTGCCGTCCTTTCAGTCCTTTCACATTGTTATTC  2.0 29308
RN00433                    NM_019186
                                   Arl4     ADP-ribosylation-like 4 nucleus; small GTPase mediated signal
                                                         GTP binding;          2.0 29308
          seq00268 TGGGCAATTCCAAAACAGTCACTTTTCACTTCTGGGATGTAGGTGGTCAAGAGAAATTAAGA tran
RN00434                    NM_019182
                                   Rnf4     ring finger protein 4 regulation9.0transcription, DNA-dependent
                                                         nucleus;
          SEQ00269 TTTATATATGAAATGTTCACAACTGCTCAGGATAGACCAATGGACAGACAACCGGGCTGGof 29274
RN00435                    NM_019170
                                   Cbr1     carbonyl reductase 1reductase1.4 29224 activity; metabolism; oxidore
                                                         carbonyl
          SEQ00270 ATGAACAAGTTTATAGAGGATGCAAAGAAAGGAGTCCATGCGAAAGAAGGCTGGC      (NADPH)
RN00436                    NM_019128
                                   Inexa    "internexin, intermediate filament; kinesin complex; neurofilament
                                                          alpha"
          SEQ00271 TTAAGCTGACCTTAGACCTCGTATCGTAAGTAGAGTGAGTGAGTGAGTGCTCTGA     8.0 24503
RN00437                    NM_017361
                                   Nup54    nucleoporinnuclear pore
                                                          p54
          SEQ00272 AAGACGACCTGGAAGATATCAAGCTGGTAGAGCATGGACTGAATGAGACCATCCA     9.0 53372
RN00438                    NM_017354
                                   RNU16845 neurotrimincell adhesion molecule 50864
                                                                               8.0 activity
          seq00273 ATGAAGCAACAAGTCAGAATCAAATGAAATTCCGAGAATCACAGCCAATGAGACAGAAATTC
RN00439                    NM_017354
                                   RNU16845 neurotrimincell adhesion molecule 50864
          SEQ00273 GTACGAAGAGTGAACGTCACCGTGAACTATCCACCATACATCTCAGAAGCTAAGG     8.0 activity
RN00440                    NM_017354
                                   RNU16845 neurotrimincell adhesion molecule 50864
          seq00273 TCAAGGATGACAAAAGACTGGTTGAAGGGAAGAAGGGAGTCAAAGTGGAAAACAGACC  8.0 activity
RN00441                    NM_017347
                                   Mapk3    "protein kinase, mitogen activated 50689
                                                         ATP binding; MAP 6.0 3 (extracellular-signal-regulated kin
                                                                               kinase activity;
          SEQ00274 CATCCTCAGAGCACCCACCCTGGAAGCCATGAGAGATGTTTACATTGTTC cAMP-dependent prote
RN00442                    NM_017326
                                   Calm2    calmodulin 2 -protein coupled receptor protein
                                                         G                     3.0 50663
          SEQ00275 GACGGTAATGGCACAATCGACTTCCCTGAATTTCTGACAATGATGGCAAGA signaling pathway; calc
RN00443                    NM_017326
                                   Calm2    calmodulin 2 -protein coupled receptor protein signaling pathway; calc
                                                         G
          seq00275 TCTAAGCCTTCTGCACATCTACACTTAGATGGAGTTGGTCAAAGGGAACATCTGGGTTAT3.0 50663
RN00444                    NM_017326
                                   Calm2    calmodulin 2 -protein coupled receptor protein signaling pathway; calc
                                                         G
          seq00275 TTAGGAACCGTCGGCATGTTGCTGTTGAAGTGTGGAGTTGTGAGCGTGGACTGTGGAC  3.0 50663
RN00445                    NM_017259
                                   Btg2     "B-cell translocation gene 2, anti-proliferative"
                                                                              11.0 29619
          SEQ00277 TCCTGGATTTCTCAATTCCTCAGTTTCTACTCAAAGGTGCTACTTACCAAACACTCTGCC
RN00446                    NM_017216
                                   Slc3a1   "solute carrier family 3, member 1"29484 acid transport;
                                                         alpha-amylase activity; amino
                                                                               1.2
          SEQ00278 TATGACACTAACGCCCTTCTCTCCAAGTCACCGATGCAGTGGGACAATAGTTCAAAT amino acid tr
RN00447                    NM_017214
                                   Rgs4     regulator ofG-protein coupled receptor protein signaling
                                                          G-protein signaling 4 29480
                                                                               6.0
          SEQ00279 ATCCCATCCCAAACACCAAAGTTAGCAGAGACCAACGGAAGGAGAGAGGAAAGAAA pathway; GTP
RN00448                    NM_017214
                                   Rgs4     regulator ofG-protein coupled receptor protein signaling
                                                          G-protein signaling 4 29480
                                                                               6.0
          seq00279 TTTATAAATGGAGGTACAGGATATTACCCGAATTATTAATGAATGCCCAAGAAGTAAT pathway; GTP
RN00449                    NM_017214
                                   Rgs4     regulator ofG-protein coupled receptor protein signaling
                                                          G-protein signaling 4 29480
                                                                               6.0
          seq00279 TTTGTAATACACAAGTCCACAGTCGTGTCTGTATAACTCTCCGGTCTTGCCCTAATAT pathway; GTP
RN00450                    NM_017180
                                   Tdag     T-cell deathinduction of apoptosis 29380
                                                           associated gene 13.0
          SEQ00280 AAGTATATGTACTTCACTGTGGTGATGGCGGAGGGCAAAGAGATCGACTTTCGGTGTC
RN00451                    NM_017175
                                   Prkcl1   protein kinase C-like 1 intracellular; protein amino acid phosphoryla
                                                         ATP binding;
          seq00281 ACGGAGATCCAGACCTGGGAGCCGTAGAGCTACGCATTGAGGAGCTACGACACCATTT  6.0 29355
RN00452                    NM_017175
                                   Prkcl1   protein kinase C-like 1 intracellular; protein amino
                                                         ATP binding;          6.0 29355
          SEQ00281 GAAGTTGGACAATTTGCTCCTGGATACTGAGGGCTACGTCAAGATCGCAGACTTTacid phosphoryla
RN00453                    NM_017175
                                   Prkcl1   protein kinase C-like 1 intracellular; protein amino acid phosphoryla
                                                         ATP binding;
          seq00281 GGAGCAGGCGGCCTTCCGGGATTTCGACTTTGTGGCAGGAGGCTATTAGCCCTAAGCC  6.0 29355
RN00454                    NM_017155
                                   Adora1   adenosine A1 receptor receptor 29290 G-protein coupled; G-prote
                                                         A1 adenosine
          SEQ00282 CAGTTGGAAGCAAGGTGTCCCTGGTTCTCAAGGAGGTCCCTATGTCTAATAAAAGATT  6.0 activity,
RN00455                    NM_017155
                                   Adora1    adenosine A1 receptor receptor 29290 G-protein coupled;
                                                          A1 adenosine        6.0 activity,
          seq00282 CTCAGTTGGAAGCAAGGTGTCCCTGGTTCTCAAGGAGGTCCCTATGTCTAATAAAAGATT G-prote
RN00456                    NM_017155
                                   Adora1    adenosine A1 receptor receptor 29290 G-protein coupled; G-prote
                                                          A1 adenosine
          seq00282 TCAGATAGGACCAATCCCTACTCTGCTGAGCCTGGATGTCTTCCTTGTATGGACGGCA 6.0 activity,
RN00457                    NM_017093
                                   Akt2      murine thymomabinding; cell growth and/or maintenance;
                                                          ATP viral (v-akt) 11.0 25233
                                                                             oncogene homolog 2
          SEQ00283 CATGAATGAGGTATCTGTCATCAAAGAAGGCTGGCTCCACAAACGTGGTGAATACATC intracellular
RN00458                    NM_017093
                                   Akt2      murine thymomabinding; cell growth and/or maintenance; intracellular
                                                          ATP viral (v-akt) 11.0 25233
          seq00283 GAGAGTGAGCAGCCCTCTGCCACCACAGGACACAGCATGGGCGCCATCCAC 2     oncogene homolog
RN00459                    NM_017093
                                   Akt2      murine thymomabinding; cell growth and/or maintenance; intracellular
                                                          ATP viral (v-akt) 11.0 25233
          seq00283 TCGGTTCTTCCTCAGCATCAACTGGCAGGATGTGGTACAGAAGAAGCTCC        oncogene homolog 2
RN00460                    NM_017070
                                   Srd5a1    steroid 5 alpha-reductase 1 1.44-dehydrogenase activity; integral to
                                                          3-oxo-5-alpha-steroid 24950
          SEQ00284 CTGATGGAGTTGGATGAGCTGTGCCTGCTCGACATGCTGGTCTACTTGGAAGGTT
RN00461                    NM_017060
                                   Hrasls3   HRAS like suppressor
          SEQ00285 GGTCAACAACAAGCACGACAAGGAGTACACTCCGCTGCCTCTGAACAAGATCATC   11.0 24913
RN00462                    NM_017033
                                   Pgm1      phosphoglucomutase 1homeostasis; carbohydrate metabolism; phos
                                                          calcium ion
          SEQ00286 CTTTGATGGTGATGGGGATAGGAACATGATTCTGGGCAAGCACGGGTTCTTTGTG    1.1 24645
RN00463                    NM_017025
                                   Ldha      lactate dehydrogenase A
                                                          L-lactate dehydrogenase activity; glycolysis; lactate dehyd
          seq00287 ACAGCTCTACCCTGCTAAGTGGTACTTGTGTAGTGGTAACCTGGTTAGTGTGACAATC 1.1 24533
RN00464                    NM_017025
                                   Ldha      lactate dehydrogenase A
                                                          L-lactate dehydrogenase activity; glycolysis; lactate
                                                                              1.1 24533
          seq00287 CAGTTAGTTATAAGCTGGCTCCAGTGTGTAAGTCCATCGTGTATATCTTGTGCATAAATGTT dehyd
RN00465                    NM_017025
                                   Ldha      lactate dehydrogenase A
                                                          L-lactate dehydrogenase activity; glycolysis;
                                                                              1.1 24533
          SEQ00287 CTTCTCATCTGAGCTGTGGTTAGTCCAGTTGGTCCAGTTGTGTTGAGGTGGTCTG lactate dehyd
RN00466                    NM_013198
                                   Maob      monoamine oxidase B
          SEQ00288 GACACTTGCCTTCTGTACCAGGTCTACTAAAGCTGCTTGGATTGACCACCATCTT    6.0 25750
RN00467                    NM_013173
                                   Slc11a2 solute carrier familyto membrane; iron ion transport; membrane; trans
                                                          integral 11 member 2 25715
          SEQ00289 TTACAGTGATAGACGGTTCCATTGTGTACGACGGTCTCTGACTCTATGCCTACAGT   3.0
RN00468                    NM_013134
                                   Hmgcr     3-hydroxy-3-methylglutaryl-Coenzyme A reductaseendoplasmic reticu
                                                          biosynthesis; cholesterol biosynthesis;
          seq00290 GATGAACATGATTTCCAAGGGTACGGAGAAAGCACTTCTGAAGCTGCAAGAGGGCGTG 1.4 25675
RN00469                    NM_013134
                                   Hmgcr     3-hydroxy-3-methylglutaryl-Coenzyme A reductaseendoplasmic reticu
                                                          biosynthesis; cholesterol biosynthesis;
          SEQ00290 GCCATAAACTGGATCGAAGGGAGAGGAAAGACTGTGGTTTGTGAAGCTGTCATTC    1.4 25675
RN00470                    NM_013134
                                   Hmgcr     3-hydroxy-3-methylglutaryl-Coenzyme A reductaseendoplasmic reticu
                                                          biosynthesis; cholesterol biosynthesis;
          seq00290 GCTGCCATAAACTGGATCGAAGGGAGAGGAAAGACTGTGGTTTGTGAAGCTGTCATTC 1.4 25675
RN00471                    NM_013119
                                   Scn3a     "sodium channel, voltage-gated,cationIII, alpha polypeptide"
                                                          calcium ion binding; type channel activity;
                                                                              3.0 25657
          SEQ00291 AAAGACGGATGGGAGTTCCTCCACAACCTCTCCTCCTTCCTATGACAGTGTAACAAA cation transpo
RN00472                    NM_013119
                                   Scn3a     "sodium channel, voltage-gated,cationIII, alpha polypeptide" transpo
                                                          calcium ion binding; type channel activity; cation
          seq00291 AAGGGAAGGATTGACTTGCCTATAAAAGGAGATATGGTTATTGACAAATTGAATGGGAA3.0 25657
RN00473                    NM_013119
                                   Scn3a     "sodium channel, voltage-gated,cationIII, alpha polypeptide" transpo
                                                          calcium ion binding; type channel activity; cation
                                                                              3.0 25657
          seq00291 GTAATCAATTGTTTACAGCCTCTGAAGGTAAAGTATCCGTGTCAACTGGACTCTAAGGAGAG
RN00474                    NM_013111
                                   Slc7a1    "solute carrier family 7, permease activity; amino acid transport; amino
                                                          amino acid member 1"25648
          SEQ00292 GTCCAGCAGGGTCAGGAAGCAAGATTTAGGAAGAGACATCATGCAAACTAATTTATTGA1.2
RN00475                    NM_013097
                                   Dnase1    deoxyribonuclease I
          seq00293 GAGCCAGCCATTGTCAAGTTCTTTTCCCCATACACTGAGGTCCGAGAGTTTGCGATTG 9.0 25633
RN00476                    NM_013097
                                   Dnase1    deoxyribonuclease I
          SEQ00293 GGCTGTGAGTGAGATCGATGCCCTCTACGATGTTTATCTAGATGTCCGGC         9.0 25633
RN00477                    NM_013097
                                   Dnase1    deoxyribonuclease I
          seq00293 TCAGAGACACTCACCTGGTTGCTGTTGGGAAGCTACTGGATGAACTCAATCGGGACAT 9.0 25633
RN00478                    NM_013092
                                   Cma1      chymase 1
          seq00294 CCCGGGAGAATGTGCAGGGCAGTTGGCTGGGGCAGAACAAACGTGAATGA        14.0 25627
RN00479                    NM_013092
                                   Cma1      chymase 1
          SEQ00294 GAGAGGATGAATCTCCATGCTCTGTGTCTGCTGCTCCTTCTCCTGGGTTC        14.0 25627
RN00480                    NM_013092
                                   Cma1      chymase 1
          seq00294 GAGGGAGAATTAACTCTGGATCTCGGGCCAGTGTGTGAGGAAATCTGGAG        14.0 25627
RN00481                    NM_013082
                                   Sdc2      syndecan 2cytoskeletal protein6.0 25615
                                                                               binding; integral to membrane;
          seq00295 AAATTGGATTATTACTACGAAACTGTTAGTCCTAGTTATCTAAGCAGTCTTCTCTTGGAGG memb
RN00482                    NM_013082
                                   Sdc2      syndecan 2cytoskeletal protein6.0 25615
          SEQ00295 TCTTTGTTAATTTATCTCTTGTTCCTCTTCTCTGCCCTCCCTTCTTGTCTCCTCCCT   binding; integral to membrane; memb
RN00483                    NM_013082
                                   Sdc2      syndecan 2cytoskeletal protein6.0 25615
          seq00295 TTTAAGCCTTTGAAGTGCCTATGATTCTATGTAACTTGTTGCAGACTGGTGTTAATGAGTbinding; integral to membrane; memb
RN00484                    NM_013016
                                   Ptpns1    "protein tyrosine phosphatase,6.0 25528 migration; cell 1"
                                                          actin filament organization; cell type substrate
                                                                               non-receptor
          SEQ00296 ATTACCATCAGACCTCAGCAGGATCATACTGGAACAGAACCTGATCATACCTGTGACAAmotility; cell
RN00485                    NM_013013
                                   Psap      prosaposin extracellular space; lysosome; sphingolipid metabolism
          seq00297 GCTTTCCAGCTTGCAGAAGTCGCCTACTTGTGGGTCTAGGGTAATGAACACATAGATC 1.4 25524
RN00486                    NM_013013
                                   Psap      prosaposin extracellular space; lysosome; sphingolipid metabolism
          seq00297 GGGTTCTGTGAGGTGTGCAAGAAGCTGGTCATCTATTTGGAACATAACCTGGAGAAAA 1.4 25524
RN00487                    NM_013013
                                   Psap      prosaposin extracellular space; lysosome; sphingolipid
                                                                              1.4 25524
          SEQ00297 GGTTCTGTGAGGTGTGCAAGAAGCTGGTCATCTATTTGGAACATAACCTGGAGAA metabolism
RN00488                    NM_012998
                                   P4hb      "prolyl 4-hydroxylase, beta polypeptide"transporter activity;
                                                          electron transport; electron
                                                                              4.0 25506
          seq00298 AGGGAATCTTTCTGAAGCCACACTCATCTGACACACGTACACTTAAACCTGTCTCTTC endoplasm
RN00489                    NM_012998
                                   P4hb      "prolyl 4-hydroxylase, beta polypeptide"transporter activity; endoplasm
                                                          electron transport; electron
                                                                              4.0 25506
          seq00298 ATTTCACACTGGTAATGTCTTTCCTGTTAGAGAGGTTTATGCTATCACTTCAGATTTCGTCT
RN00490                    NM_012998
                                   P4hb      "prolyl 4-hydroxylase, beta polypeptide"transporter activity; endoplasm
                                                          electron transport; electron
          SEQ00298 TTTAGAGCCAGATATGGAAGAAGACGACGATCAGAAAGCCGTGAAGGATGAACTGT   4.0 25506
RN00491                    NM_012977
                                   Lgals9    "lectin, galactose binding, soluble 9" ion transport;
                                                          heterophilic cell adhesion;
                                                                              8.0 25476
          SEQ00299 CAAGTCCATCAACATATCAGGCGTGGTCTTGCCAGATGCTAAGAGGTTCCATATCsugar binding
RN00492                    NM_012922
                                   Casp3     caspase 3 apoptosis; caspase activity; cysteine-type peptidase activi
          SEQ00300 AGAGAGATTTGGTGCCACTATGAATTTGAAATTACGAAGCAGTGATGATCTTATACCC13.0 25402
RN00493                    NM_012908
                                   Tnfsf6    "tumor necrosis factor (ligand) superfamily, member 6"
          seq00301 CAGTCTTGCAACAGCCAGCCCCTAAGCCACAAGGTCTATATGAGGAACTTTAAGTATC13.0 25385
RN00494                    NM_012908
                                   Tnfsf6    "tumor necrosis factor (ligand) superfamily, member 6"
                                                                             13.0 25385
          seq00301 GGGCAGTATTTAATCTTACCGTTGCTGACCATTTATATGTCAACATATCTCAACTCTCTC
RN00495                    NM_012908
                                   Tnfsf6    "tumor necrosis factor (ligand) superfamily, member 6"
                                                                             13.0 25385
          SEQ00301 TGTGGTATGACTATACAAGGGTGAGAAAGGATGCTAGGTTTCATGGATAAGCTAGAGAC
RN00496                    NM_012882
                                   Sstr5     somatostatin receptorcoupled receptor activity; G-protein coupled rece
                                                          G-protein 5
          seq00302 CCGGAAGGTTCTGTGCCTACGTAGAGGATACGGTATGGAGGATGCGGACGCCATAGAG 4.0 25354
RN00497                    NM_012882
                                   Sstr5     somatostatin receptorcoupled receptor activity; G-protein
                                                          G-protein 5         4.0 25354
          seq00302 CTCCAGGCCTCCACGGTGTTGTCTTCTGGGATCTGAGAGTTTGCTGAGATGCATTCACcoupled rece
RN00498                    NM_012882
                                   Sstr5     somatostatin receptorcoupled receptor activity; G-protein
                                                          G-protein 5         4.0 25354
          SEQ00302 GAAGGTGACTCGCATGGTGGTGGTCGTGGTGCTGGTGTTTGTGGGCTGCTGGCTG coupled rece
RN00499                    NM_012870
                                   Tnfrsf11b "tumor necrosis factor cytokine5.0 25341
                                                          apoptosis; receptor activity; extracellular matrix;
                                                                               superfamily, member
          SEQ00303 CACACACACTGGGGAGTCTGAGTCAGGAGAGTGAGGCAGGCTATTTGATAATTGT 11b" extracellu
RN00500                    NM_012842
                                   Egf       epidermal growth factorbinding; extracellular space; growth
                                                          calcium ion         4.0 25313
          SEQ00304 CTGTTGGGCTCTTTTCCTTGTTGTCTCAGAAGAAATGGGTTAAAGCAGGCGATCACAT factor acti
RN00501                    NM_012842
                                   Egf       epidermal growth factorbinding; extracellular space; growth
                                                          calcium ion         4.0 25313
          seq00304 GGGAGCAGACAGAAGGTACCGAAAGTGAAATAGCAAACCAGGCTGAAGGGTGGTAGAG factor acti
RN00502                    NM_012842
                                   Egf       epidermal growth factorbinding; extracellular space; growth factor acti
                                                          calcium ion
          seq00304 TTTTGCCTTCTGAATTGTGATTAGTGAAAATAATTGTAACTTAGAGTCCGATTTATTC 4.0 25313
RN00503                    NM_012839
                                   Cycs      "cytochrome c, somatic"
                                                          caspase activation via cytochrome c; electron
                                                                             13.0 25309
          seq00305 AAATGATCTTCGCTGGAATTAAGAAGAAGGGAGAAAGGGCAGACCTAATAGCTTATCTTtransport; e
RN00504                    NM_012839
                                   Cycs      "cytochrome c, somatic"
                                                          caspase activation via cytochrome c; electron
                                                                             13.0 25309
          seq00305 GAAGACAGGCCAGGCTGCTGGATTCTCTTACACAGATGCCAACAAGAACAAAGGTATC transport; e
RN00505                    NM_012839
                                   Cycs      "cytochrome c, somatic"
                                                          caspase activation via cytochrome c; electron
                                                                             13.0 25309
          SEQ00305 GCTGGATTCTCTTACACAGATGCCAACAAGAACAAAGGTATCACCTGGGGAGAGGATA transport; e
RN00506                    NM_012804
                                   Abcd3     "ATP-binding cassette, sub-family 25270 member 3"
                                                          ATP binding; ATP-binding cassette (ABC) transporter acti
          SEQ00306 AAACAGTGGCGGATTTCTCTAGCTGCTACATTTATTCTCATTCCTCATACATACCTTGA1.4 D (ALD),
RN00507                    NM_012804
                                   Abcd3  "ATP-binding cassette, sub-family 25270 member 3"
                                                       ATP binding; ATP-binding cassette (ABC) transporter acti
                                                                           1.4 D (ALD),
          seq00306 ACTGAGTCGTTCTGAAGGCTCTCGTGTGGACAGCAGTGTGTGCAGTCTCTTACAGTCC
RN00508                    NM_012804
                                   Abcd3  "ATP-binding cassette, sub-family 25270 member 3"
                                                       ATP binding; ATP-binding cassette (ABC) transporter acti
                                                                           1.4 D (ALD),
          seq00306 CTGGAACCACGAGTGACTTTGCACAAAGGAGGGCTGAGAGCGGACTTGATCAGTAAGT
RN00509                    NM_012801
                                   Pdgfa  "platelet derived growth factor,4.0 25266
                                                       cell growth and/or maintenance; cell proliferation; extracel
          SEQ00307 GAGTATGTCAGGAAGAAGCCAAAATTGAAAGAGGTCCAGGTGAGGTTAGAGGAGCA alpha"
RN00510                    NM_012796
                                   Gstt2  "glutathioneglutathione transferase29487
                                                        S-transferase, theta 2" activity
                                                                          12.0
          seq00308 AAAGGTGGAACGGAACAGAAATAGTATGGTCTTGGCTCTGCAACGTCTGGAGGACAAG
RN00511                    NM_012796
                                   Gstt2  "glutathioneglutathione transferase29487
                                                        S-transferase, theta 2" activity
                                                                          12.0
          seq00308 CATGCTTCTCTTGAGGTACAGTATGCACAACCAATAGGAGACCCAAGTCAATAATATA
RN00512                    NM_012796
                                   Gstt2  "glutathioneglutathione transferase29487
                                                        S-transferase, theta 2" activity
          SEQ00308 GGAACGGAACAGAAATAGTATGGTCTTGGCTCTGCAACGTCTGGAGGACAAGTTC12.0
RN00513                    NM_012762
                                   Casp1  caspase 1 apoptosis; apoptosis regulator activity; caspase
                                                                          13.0 25166
          SEQ00309 AGACTTCTGACAGTACCTTCCTTGTATTCATGTCTCATGGTCTCCAGGAGGGAATATGTGactivity; cy
RN00514                    NM_012762
                                   Casp1  caspase 1 apoptosis; apoptosis regulator activity; caspase activity; cy
                                                                          13.0 25166
          seq00309 CAAGACTTCTGACAGTACCTTCCTTGTATTCATGTCTCATGGTCTCCAGGAGGGAATATGTG
RN00515                    NM_012762
                                   Casp1  caspase 1 apoptosis; apoptosis regulator activity; caspase activity; cy
                                                                          13.0 25166
          seq00309 TCCCTCAAGTTTTGCCCTTTAGAAATAGCCCAGAAGTTATGGAAAGAAAATCATTCAGAGA
RN00516                    NM_012760
                                   Plagl1 pleiomorphic adenoma gene-like 125157
                                                                           9.0
          SEQ00310 ACCCTAACCTTTGAAGACTCTGTATTTCCAGCATTTGTACCCTACCCTTGAAGACTCTGT
RN00517                    NM_012760
                                   Plagl1 pleiomorphic adenoma gene-like 125157
                                                                           9.0
          seq00310 TACCCTAACCTTTGAAGACTCTGTATTTCCAGCATTTGTACCCTACCCTTGAAGACTCTGT
RN00518                    NM_012760
                                   Plagl1 pleiomorphic adenoma gene-like 125157
                                                                           9.0
          seq00310 TTCCCAGCATTTGTACCCTAACCCTTGAAGACCCTGTATTTCGTTTGTAAGACTTTTCCC
RN00519                    NM_012752
                                   Cd24   CD24 antigen defense response; 8.0 25145 space; membrane; plasm
                                                                           extracellular
          seq00311 CACCCCTGAGTAAATCTGATTTCAAAAGTCACAACGGCAAAGCATTTCCCAGTGTCTT
RN00520                    NM_012752
                                   Cd24   CD24 antigen defense response; 8.0 25145 space; membrane;
                                                                           extracellular
          seq00311 CATGGTCACACACTGATGCTTGCCATTCTGGGATCTAATACGGTCACAGTAGTCTTGATAA plasm
RN00521                    NM_012752
                                   Cd24   CD24 antigen defense response; 8.0 25145 space; membrane; plasm
                                                                           extracellular
          SEQ00311 TTTAATAGGCTAAACTCTAGGTGAAGTCCCACGTCGTTGACCTCTAGTTCTTCTCTCCG
RN00522                    NM_012747
                                   Stat3  signal transducerbinding; JAK-STAT cascade; acute-phase
                                                       DNA and activator9.0 transcription 3
                                                                            of 25125
          SEQ00312 CATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGACGCTACCAACATCCTGG response
RN00523                    NM_012739
                                   Adra2a "adrenergicATP binding; G-protein25083 receptor
                                                        receptor, alpha 2a"4.0 coupled
          SEQ00313 CAAGATTAACGACCAGAAGTGGTATGTCATCTCGTCGTCCATCGGCTCCTTCTTC activity; G-protein
RN00524                    NM_012739
                                   Adra2a "adrenergicATP binding; G-protein25083 receptor activity; G-protein
                                                        receptor, alpha 2a"4.0 coupled
          seq00313 CTTCACGTTCGTGCTGGCGGTGGTGATCGGCGTGTTCGTGGTGTGTTGGTTCCCGTTCTTT
RN00525                    NM_012739
                                   Adra2a "adrenergicATP binding; G-protein25083 receptor activity; G-protein
                                                        receptor, alpha 2a"4.0 coupled
          seq00313 GAAGTGGTATGTCATCTCGTCGTCCATCGGCTCCTTCTTCGCGCCTTGCCTCATCATG
RN00526                    NM_012715
                                   Adm    adrenomedullin
                                                       cAMP-mediated signaling; extracellular; hormone activity;
          SEQ00314 CAAGACATCTCCAGAGTCTCTAGGTTATAGGTGCGGGTGGCAGCATTGAACAGTC 4.0 25026
RN00527                    NM_012649
                                   Sdc4   syndecan 4cytoskeletal protein6.0 24771
          SEQ00316 TTTAGGATATAGAATGATACTACAGGTCTCATGTTGGCTGGGTGGCTGCGTGAGTG binding; extracellular space; integral to
RN00528                    NM_012645
                                   RT1Aw2 RT1 class Ib gene(Aw2)
          SEQ00317 CATTGGAGCTATGGTGGTTGTTGTGAGGAGGAGGAGGAGAAACACAGGCAGGTAC 7.0 24737
RN00529                    NM_012637
                                   Ptpn1  "protein tyrosine phosphatase,integral to membrane; phosphoprotein p
                                                       hydrolase activity; 6.0 24697
          SEQ00318 CTTGCTCAGAAGTGTGTGGCTCTTGAGGCTGAAGAGACTGATGATGGTGCTCATG  non-receptor type 1"
RN00530                    NM_012623
                                   Pgy1   P-glycoprotein/multidrug resistance 1 cassette (ABC) transporter
                                                       ATP binding; ATP-binding
                                                                          14.0 24646
          seq00319 AGCCTAATTGGTTAGAAGGAAATGTGAAATTTAATGGAGTCATGTTCAACTATCCCACCCGA acti
RN00531                    NM_012623
                                   Pgy1   P-glycoprotein/multidrug resistance 1 cassette (ABC) transporter acti
                                                       ATP binding; ATP-binding
                                                                          14.0 24646
          seq00319 GTCAGACAGCCTCACATCTTACTTCTGGATGAAGCGACATCAGCTCTGGATACGGAGA
RN00532                    NM_012623
                                   Pgy1   P-glycoprotein/multidrug resistance 1 cassette (ABC) transporter acti
                                                       ATP binding; ATP-binding
                                                                          14.0 24646
          SEQ00319 TGGTTAGAAGGAAATGTGAAATTTAATGGAGTCATGTTCAACTATCCCACCCGACCCAAC
RN00533                    NM_012595
                                   Ldhb   lactate dehydrogenase B L-lactate dehydrogenase activity; glycolysis;
                                                       ATP binding;
          SEQ00138 GGGAGAGTCGGCTCAACCTGGTGCAGAGAAACGTCAATGTATTCAAGTTCATTAT 1.1 24534
RN00534                    NM_012592
                                   Ivd    isovaleryl coenzyme A dehydrogenase
                                                       acyl-CoA dehydrogenase activity; electron
                                                                           1.4 24513
          SEQ00321 CCTGGATGGCATTCAATGTTTAGGTGGAAATGGCTACATCAATGACTTCCCCATG transport; isova
RN00535                    NM_012592
                                   Ivd    isovaleryl coenzyme A dehydrogenase
                                                       acyl-CoA dehydrogenase activity; electron transport; isova
                                                                           1.4 24513
          seq00321 GCTCTTCGTGAAGTCGGATTCTCCAGCCGTGCCAGCCAGTCAATCAAGAAAGCCTAAA
RN00536                    NM_012592
                                   Ivd    isovaleryl coenzyme A dehydrogenase
                                                       acyl-CoA dehydrogenase activity; electron transport; isova
                                                                           1.4 24513
          seq00321 GTACGAGATCGGAGGTGGGACCAGTGAGGTGAGGCGGCTAGTCATTGGCAGAGCTTTC
RN00537                    NM_012586
                                   Iapp   islet amyloid polypeptide extracellular space; hormone activity
                                                       extracellular;      1.4 24476
          SEQ00322 TTTGTAAATTCTTATTCTAAGACGTGCTTTAAACTGAGTGTTGATAAAGGTCAGGGTGAA
RN00538                    NM_012580
                                   Hmox1  heme oxygenasedamage response, signal transduction resulting in in
                                                       DNA 1              12.0 24451
          seq00323 GCAGAGACGCCCCGAGGAAAATCCCAGATCAGCACTAGTTCATCCCAGACACCGCTCC
RN00539                    NM_012580
                                   Hmox1  heme oxygenasedamage response, signal transduction resulting in in
                                                       DNA 1              12.0 24451
          seq00323 TGACAGAGGAACACAAAGACCAGAGTCCCTCACAGACAGAGTTTCTTCGCCAGAGGCC
RN00540                    NM_012580
                                   Hmox1  heme oxygenasedamage response, signal transduction
                                                       DNA 1              12.0 24451
          SEQ00323 TTGTACCATATCTATACGGCCCTGGAAGAGGAGATAGAGCGAAACAAGCAGAACC resulting in in
RN00541                    NM_012570
                                   Glud1  glutamate dehydrogenase 1 1.3 24399
                                                       amino acid metabolism; glutamate dehydrogenase [NAD(P
          SEQ00324 CACTTCCTGACAAGTCTGGGTACTTGAGCACATAAGAAGTAGGCGTGTGGCATTT
RN00542                    NM_012569
                                   Gls    glutaminase  glutaminase activity; glutamine metabolism; hydrolase act
          SEQ00325 GTGTTCCTTCACTAAGACAAGGCACCACTAACGTGTTTCTAAGCTCCAGAGTCTG 1.3 24398
RN00543                    NM_012551
                                   Egr1   early growth response 1 nucleic acid binding; nucleus;
                                                       DNA binding;        9.0 24330
          SEQ00326 TTGAAGCAGCAGTCCTAGGTATTAACTGGAGCATGTGTCAGAGTGTTGTTCCGTTAA regulation of t
RN00544                    NM_012545
                                   Ddc    dopa decarboxylase metabolism; aromatic-L-amino-acid
                                                       amino acid          1.3 24311
          SEQ00327 GGTGAAGAAGAGAACTGACCTAACCGAAGCCTTTAATATGGACCCTGTTTATCTGAGG decarboxy
RN00545                    NM_012540
                                   Cyp1a1 "cytochrome P450, 1a1"
                                                       electron transport; endoplasmic reticulum; extracellular sp
                                                                           1.5 24296
          seq00328 CAAAGAGCACTACAGGACATTTGAGAAGGGCCACATCCGGGACATCACAGACAGCCTC
RN00546                    NM_012540
                                   Cyp1a1 "cytochrome P450, 1a1"
                                                       electron transport; endoplasmic reticulum; extracellular sp
                                                                           1.5 24296
          SEQ00328 CTACAGGACATTTGAGAAGGGCCACATCCGGGACATCACAGACAGCCTCATTGAGCATT
RN00547                    NM_012540
                                   Cyp1a1 "cytochrome P450, 1a1"
                                                       electron transport; endoplasmic reticulum; extracellular sp
                                                                           1.5 24296
          seq00328 GACGTTATGACCACGATGACCAAGAGCTGCTCAGCATAGTCAATCTAAGCAATGAGTT
RN00548                    NM_012529
                                   Ckb    "creatine kinase, brain"
                                                       creatine kinase activity;24264 activity; plasma
                                                                           1.1 kinase
          seq00329 GCGATTCTGCACTGGCCTCACTCAGATTGAAACTCTCTTCAAGTCTAAGAACTATGAG membrane
RN00549                    NM_012529
                                   Ckb    "creatine kinase, brain"
                                                       creatine kinase activity;24264 activity; plasma
                                                                           1.1 kinase
          seq00329 GTGAGCCCCTTAGCCTCGCTGTAGAGACTTCTGTCGCCCTGGGTAGAGCCTTTATTTT membrane
RN00550                    NM_012529
                                   Ckb    "creatine kinase, brain"
                                                       creatine kinase activity;24264 activity; plasma membrane
          SEQ00329 TTGGCACAATGACAATAAGACGTTCCTGGTGTGGATCAACGAGGAGGACCACCTG 1.1 kinase
RN00551                    NM_012523
                                   Cd53   CD53 antigen integral to membrane; plasma membrane
                                                                           8.0 24251
          SEQ00330 CCAGGCTTTAGGGCTGTGATTTACACCTACCTTCTGCTTAAGTGATTTATTTCTCTCT
RN00552                    NM_012523
                                   Cd53   CD53 antigen integral to membrane; plasma membrane
                                                                           8.0 24251
          seq00330 GTCATGGACTTCCCACATCAAGCAGAAGACAAACATTAACCAACTGATAGCAGTAACCA
RN00553                    NM_012523
                                   Cd53   CD53 antigen integral to membrane; plasma membrane
                                                                           8.0 24251
          seq00330 GTTACATCATCCACACATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATAAA
RN00554                    NM_012520
                                   Cat    catalase catalase activity; electron transport; oxidoreductase activit
                                                                          12.0 24248
          seq00331 AAATAACTTTAGCACTGTTGAAACTTAATGTTTATTCCTGTGTAGTTGATTGGATTCCTTT
RN00555                    NM_012520
                                   Cat    catalase catalase activity; electron transport; oxidoreductase
                                                                          12.0 24248
          seq00331 GAAATTATGTTTATGCTGATACACAGTGATTTCACATAGGGTGATTTGTATTTGCTTACATT activit
RN00556                    NM_012520
                                   Cat    catalase catalase activity; electron transport; oxidoreductase activit
          SEQ00331 TGGACCAGTACAACTCCCAGAAGCCTAAGAATGCAATTCACACCTACGTA     12.0 24248
RN00557                    NM_012495
                                   Aldoa  aldolase A fructose-bisphosphate aldolase activity; glycolysis; lyase a
                                                                           1.1 24189
          seq00332 AACGAGGTTCTGTGACCCTAGCCGCGTTCCCTCCTTAGTTCCTTTCGCCTACCCACCC
RN00558                    NM_012495
                                   Aldoa  aldolase A fructose-bisphosphate aldolase activity; glycolysis; lyase a
          SEQ00332 GTTATCAAGTCCAAGGGTGGTGTTGTGGGCATTAAGGTAGATAAGGGTGTAGTGC 1.1 24189
RN00559                    NM_012495
                                   Aldoa  aldolase A fructose-bisphosphate aldolase activity; glycolysis; lyase a
          seq00332 TCTCTTCATCTCTAACCATGCCTACTAACCAGAGCTGATCTAAGGCTGCTCCATCGAC1.1 24189
RN00560                    NM_031512
                                   Il1b   interleukin 1 beta
                                                       cell proliferation; cytokine activity; extracellular;
                                                                             5.0 24494
          SEQ00333 CATAGTTGACTTCACCATGGAACCCGTGTCTTCCTAAAGATGGCTGCACTATTCCTAAT growth fac
RN00561                    NM_031512
                                   Il1b   interleukin 1 beta
                                                       cell proliferation; cytokine activity; extracellular;
                                                                             5.0 24494
          seq00333 CATGGAACCCGTGTCTTCCTAAAGATGGCTGCACTATTCCTAATGCCTTCCCCAGGAC growth fac
RN00562                    NM_031512
                                   Il1b   interleukin 1 beta
                                                       cell proliferation; cytokine activity; extracellular;
                                                                             5.0 24494
          seq00333 TCGACAGAAGAATCTAGTTGTCCGTGTGTATGGGATGAATTGAATTTGGACCAGTGCA growth fac
RN00563                    M96630 Sec61a  "SEC61, alpha subunit (S. cerevisiae)"
                                                                             2.0 80843
          SEQ00334 CATTGTATTCATGCTGGGTTCCTGTGCATTCTTTTCCAAAACATGGATCGAAGTTTCGG
RN00564                    M94555 Nmu     neuromedin   extracellular space; neuropeptide signaling
                                                                    Normalisation63887
          SEQ00335 TCAACTGCATGAGAGAAGAATGAAGAGATACAAAGTGAATGAATACCAGGGTCCTGTpathway; regu
RN00564                    M94555 Nmu     neuromedin   extracellular space; neuropeptide signaling
                                                                    Normalisation63887
          SEQ00335 TCAACTGCATGAGAGAAGAATGAAGAGATACAAAGTGAATGAATACCAGGGTCCTGTpathway; regu
RN00565                    M93661 Notch2  "notch gene homolog 2, (Drosophila)"
                                                       cell fate determination 29492
                                                                             6.0
          SEQ00336 ACAAGCATGAGCAGCATTATTTTCATCTTCACTGAGTATCTGTGCAGTTTAGGGAGGACT
RN00566                    M93661 Notch2  "notch gene homolog 2, (Drosophila)"
                                                       cell fate determination 29492
          seq00336 CTTGCCCTCTATGTACCAGATCCCAGAGATGGCCCGTTTGCCCAGTGTGGCTTTCCCA6.0
RN00567                    M93661 Notch2  "notch gene homolog 2, (Drosophila)"
                                                       cell fate determination 29492
          seq00336 GTCACCTCCAGGGCGAGCACCCGTACCTGACACCATCCCCAGAGTCTCCTGACCAATG6.0
RN00568                    M88592 Ppara   peroxisomeDNA binding; ligand-dependentalpha
                                                        proliferator activated receptor nuclear receptor
                                                                             6.0 25747
          SEQ00337 CCAAGATGGTAGCCAACGGCGTTGAAAACAAGGAGGCAGAGGTCCGATTCTTCCACTG activity; n
RN00569                    M88592 Ppara   peroxisomeDNA binding; ligand-dependentalpha
                                                        proliferator activated receptor nuclear receptor activity; n
          seq00337 GAAGCCATCTTCACGATGCTGTCCTCCTTGATGAACAAAGACGGGATGCT        6.0 25747
RN00570                    M88592 Ppara   peroxisomeDNA binding; ligand-dependentalpha
                                                        proliferator activated receptor nuclear receptor activity; n
          seq00337 GTCATACATGACATGGAGACCTTGTGCATGGCTGAGAAGACGCTTGTGGC        6.0 25747
RN00571                    M88096 Cckar   cholecystokinin A receptor
                                                       G-protein coupled receptor activity; G-protein coupled rece
          SEQ00338 CAAGACTACCACCTACTTCATGGGCACTTCCGTGAGCGTTTCCACCTTCAACCTG   4.0 24889
RN00572                    M86389 Hspb1   heat shock 27kDa protein 1 12.0 24471
          seq00339 CTCGGTTTCCCGATGAGTGGTCTCAGTGGTTCAGCTCCGCTGGTTGGCCCGGCTATGTG
RN00573                    M86389 Hspb1   heat shock 27kDa protein 1 12.0 24471
          seq00339 GGGAGCCGTTCCGGGACTGGTACCCTGCCCACAGCCGCCTCTTCGATCAAGCTTTCGG
RN00574                    M86389 Hspb1   heat shock 27kDa protein 1 12.0 24471
          SEQ00339 GTGGTGGAGATCACTGGCAAGCACGAAGAAAGGCAGGATGAACATGGCTACATCT
RN00575                    M84524 Mgmt    O-6-methylguanine-DNA methyltransferase
                                                       DNA repair; methylated-DNA-[protein]-cysteine S-methyltr
          SEQ00340 ACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGAGAAACGGTTT  12.0 17314
RN00576                    M83745 Pcsk1   proprotein convertaseactivity; proprotein convertase
                                                       hydrolase subtilisin/kexin type 1
                                                                             2.0 25204
          SEQ00341 TTATTTCCAAGCAGTCTTTGCCGTTAATAATTGAATTTGATATGAGCTAGTTAAAT 1 activity; proteol
RN00577                    M83675 Mel     mel transformingsmall monomeric 117103 cell line NK14)-
                                                       RAB oncogene (derived from activity
                                                                             2.0 GTPase
          seq00342 CAGATGTGGAGAAGATGATACTGGGGAATAAGTGTGATGTGAACGACAAGAGGCAGGTRAB8 hom
RN00578                    M83675 Mel     mel transformingsmall monomeric 117103 cell line NK14)- RAB8 hom
                                                       RAB oncogene (derived from activity
                                                                             2.0 GTPase
          seq00342 CTCGACTATGGGATCAAGTTCATGGAGACCAGCGCGAAGGCCAACATCAATGTGGAGAA
RN00579                    M83675 Mel     mel transformingsmall monomeric 117103 cell line NK14)- RAB8 hom
                                                       RAB oncogene (derived from activity
          SEQ00342 GCAGATGTGGAGAAGATGATACTGGGGAATAAGTGTGATGTGAACGACAAGAGGC   2.0 GTPase
RN00580                    M80367 Gbp2    "guanylate binding protein 2, interferon-inducible"
          SEQ00343 GTTGAAACACTTCTAAAGACGGATCAGTCACTCACGGAGGCAGCAAAGGAGATTG   6.0 171164
RN00581                    M76706 Pcsk2   thyrotropin releasing hormoneproprotein convertase 2 activity; proteol
                                                       hydrolase activity; 2.0 25121
          seq00344 CCAGAGAGATTCCACTGTGTGGGAGGCTCGGTGCAGAACCCTGAGAAAATACCACCCA
RN00582                    M76706 Pcsk2   proprotein convertaseactivity; proprotein convertase 2 activity; proteol
                                                       hydrolase subtilisin/kexin type 2
          seq00344 GGTTCATCAGTGGCGACGGAATGGGGTTGGCCTGGAATTCAATCACCTCTTTGGCTAC2.0 25121
RN00583                    M76706 Pcsk2   proprotein convertaseactivity; proprotein convertase 2
                                                       hydrolase subtilisin/kexin type 2
                                                                             2.0 25121
          SEQ00344 TTGGAGGCTAACGTGGATCTGACCTGGCGAGACATGCAACATCTGACAGTGCTCA activity; proteol
RN00584                    M76704 Mgmt    0-6-methylguanine-DNAmethylated-DNA-[protein]-cysteine
                                                       DNA repair; methyltransferase
                                                                            12.0 25332
          SEQ00340 TCTGGCTGAAATTGAGTAACCGTTTGAATGACACATAGATGTAATGCGGTGTTGGAAGC S-methyltr
RN00585                    NM_012504
                                   Atp1a1 "ATPase, Na+K+ transporting, 3.0 activity, coupled to transmembrane
                                                       ATP binding; ATPase 24211
          seq00346 CTTCTTCACTTATTTTGTGATTCTGGCTGAGAACGGTTTCCTGCCCTTTCACCTGTTGalpha 1"
RN00586                    NM_012504
                                   Atp1a1 "ATPase, Na+K+ transporting, 3.0 activity, coupled to transmembrane
                                                       ATP binding; ATPase 24211
          seq00346 GATCAATGATGTGGAGGACAGCTACGGGCAGCAGTGGACCTACGAGCAGAGGAAGATTalpha 1"
RN00587                    NM_012504
                                   Atp1a1 "ATPase, Na+K+ transporting, 3.0 activity, coupled to transmembrane
                                                       ATP binding; ATPase 24211
          SEQ00346 TCCGTGATGGAGATGAGGGAGAAGTACACCAAGATAGTGGAGATTCCTTTCAACTC  alpha 1"
RN00588                    NM_012630
                                   Prlr   prolactin receptor
                                                       hematopoietin/interferon-class (D200-domain) cytokine re
                                                                             4.0 24684
          seq00347 ACTGGTTGGTTTACAATGGAATATGAAATTCGATTAAAGCCTGAAGAAGCAGAAGAGTGGGA
RN00589                    NM_012630
                                   Prlr   prolactin receptor
                                                       hematopoietin/interferon-class (D200-domain) cytokine re
                                                                             4.0 24684
          seq00347 AGGACGCCTGCCTGGTTAGACTTTAAATTTGCTCAATGACAAACGAGATCAGTGTTAATTG
RN00590                    NM_012630
                                   Prlr   prolactin receptor
                                                       hematopoietin/interferon-class (D200-domain) cytokine re
          SEQ00347 GCTAGACTTATGGAACGATTGGCTAAACTGTGATTTCTCTTCAGGTAACACTACA   4.0 24684
RN00591                    NM_012563
                                   Gad2   glutamate decarboxylase 2
                                                       amino acid metabolism; carboxy-lyase activity;
                                                                             1.3 24380
          SEQ00348 AACGCCTGGGACAAGATTTGTAATCACTTTGCTCACCAAACTTTCAGTTCTCTAGGTAGAglutamate
RN00592                    NM_012563
                                   Gad2   glutamate decarboxylase 2
                                                       amino acid metabolism; carboxy-lyase activity; glutamate
          seq00348 GGGTGGAGGGTTACTGATGTCTCGGAAACACAAGTGGAAGCTGAACGGTGTGGAGAGG1.3 24380
RN00593                    NM_012563
                                   Gad2   glutamate decarboxylase 2
                                                       amino acid metabolism; carboxy-lyase activity; glutamate
                                                                             1.3 24380
          seq00348 TGTATTTGTAGTTTGTTCCAGAGTAATTCTATTTCTATATCGTGGTGTCACAGTAGAGTCCA
RN00594                    M65149 Cebpd   "CCAAT/enhancerbinding, protein protein binding; regulation of transc
                                                       DNA binding; nucleus; 25695 delta"
          SEQ00349 ACCCTAGAGTTGTGCCACGACGAGATCTTCGCCGACCTCTTCAACAGCAATCACAAAG9.0 (C/EBP)
RN00595                    M65149 Cebpd   "CCAAT/enhancerbinding, protein protein binding; regulation of transc
                                                       DNA binding; nucleus; 25695 delta"
          SEQ00349 CCGCCCGAATTGCTACAGTTTCTTGGGCACTGGACTGCGAGAGAAGCTATATGAATCC9.0 (C/EBP)
RN00596                    M64795 RT1@    Major histocompatibility locus 7.0 24735
          SEQ00351 GTGTGCTCAGTCAGTTCTTGTCATTGATGGACTCAGGTCTCAGCTCTGTCTCCTC
RN00597                    M63282 Atf3    activating transcription factor 39.0 regulation of transcription, DNA-de
                                                       DNA binding; nucleus; 25389
          SEQ00352 GCATAGGGCATTCATTTCTGAGCCTGGTGTTGTGCTATTTAGATGTTTGTCTTGC
RN00597                    M63282 Atf3    activating transcription factor 39.0 regulation of transcription, DNA-de
                                                       DNA binding; nucleus; 25389
          SEQ00352 GCATAGGGCATTCATTTCTGAGCCTGGTGTTGTGCTATTTAGATGTTTGTCTTGC
RN00598                    M63101 Il1rn   interleukin 1 receptor antagonist gene
                                                                             5.0 60582
          SEQ00353 ACTTACAAGGACCAAATACCAAACTAGAAGAAAAGATAGACATGGTGCCTATTGACTTTC
RN00599                    M38194 Mapk3   "protein kinase, mitogen activated 50689
                                                       ATP binding; MAP 6.0 3 (extracellular-signal-regulated kin
          SEQ00354 GAGAGCCCGTGCCCCTCCCCACCTCCCTGTGCCTGTATCTAATATATAAATATAGAGAkinase activity; cAMP-dependent prote
RN00600                    M36410 Spr     sepiapterin metabolism; oxidoreductase activity; sepiapterin reductase
                                                       reductase Normalisation
          SEQ00355 AGAAGCAGAAACACTGAGCAGATGAGGCAGAGTCTCTCGTCTGTGGTCGTTCTCA       29270
RN00601                    M36410 Spr     sepiapterin metabolism; oxidoreductase activity; sepiapterin reductase
                                                       reductase Normalisation
          SEQ00355 TGTTTCCAAAGGCTTCCTGAACATCAATGACCTAGCTGAGGTGAACAACTACTGG       29270
RN00602                    M36317 Trh     thyrotropin releasing hormone 4.0 25569 activity; thyrotropin-releasing
                                                       extracellular space; hormone
          SEQ00357 GATGATGTAAGCCCTGTATTCCCTATCCTGTTCCCTTCACTAGCTGTCCTCTCTTAGATG
RN00603                    M36151         thyrotropin releasing hormone 7.0
          SEQ00358 GACAGAGGCCCTTAACCACCACAACCTGCTGGTCTGCTCAGTGACAGATTTCTAC
RN00604                    M34253 Irf1    interferon regulatory factor 1 9.0 response; nucleus;
                                                       DNA binding; immune 24508
          SEQ00359 CGTGACTCTGAACATTGGAAACGCCACCTAACTACTAAGTTGTGTCTGATCTCGTG regulation of tra
RN00605                    M34083 Prlr    prolactin receptor
                                                       hematopoietin/interferon-class (D200-domain)
                                                                             4.0 24684
          SEQ00360 ACACACCTAGATCCCGACAGTGACTCTGTTCACGGAAGCTATGACAGCCATTCTCTTT cytokine re
RN00606                    NM_031984
                                   Calb1  calbindin 1 calcium ion binding   13.0 83839
          seq00361 AAACAGCATGTGTGTCTGAGGAAGATTATATTGAGAGAAGAAGAGAAGTTGAAAGTATC
RN00607                    NM_031984
                                   Calb1  calbindin 1 calcium ion binding   13.0 83839
          seq00361 TCTGTCTGATACTATGCCTATATTTCCAAGAAGTCTATTGCAGAGAGTATGACCTTAGCCCA
RN00608                    NM_031984
                                   Calb1  calbindin 1 calcium ion binding   13.0 83839
          SEQ00361 TGTCTGATACTATGCCTATATTTCCAAGAAGTCTATTGCAGAGAGTATGACCTTAGCCCA
RN00609                    M29295 Snrpb    small nuclear ribonucleoprotein polypeptides B and B1
                                                        RNA binding; nucleus; pre-mRNA splicing factor
                                                                     Normalisation171365
          SEQ00362 CTGTTTGTTTGTTATGCTGTTTATGGAGTCTTACTGGAGGTCTGGTTTCTTTCAGGCTC activity; r
RN00610                    M29293 Snrpn    "small nuclear ribonucleoparticle-associated protein (snRNP) mRNA,
                                                        RNA binding; nucleus; pre-mRNA splicing
                                                                     Normalisation81781
          SEQ00363 AGCTTACACTGTGTTAATAGCCTGCATCAAACCTTTATTTATTGCCCTTCTCCAAGT factor activity; r
RN00611                    M29293 Snrpn    "small nuclear ribonucleoparticle-associated protein (snRNP) mRNA,
                                                        RNA binding; nucleus; pre-mRNA splicing
                                                                     Normalisation81781
          SEQ00363 CAGGAATGCGTCCACCAAGACCCTAAGATACAGTTGATAAATCTCAGCCCTTCTCT factor activity; r
RN00612                    M27839 Calb1    calbindin 1 calcium ion binding3.0 83839
          SEQ00365 ACCACATTCTGATCTGGACCAAGTTGGAACAGCAGCCATCTCAGCCGCACAAGAT
RN00613                    NM_012589
                                   Il6     interleukin 6acute-phase response;24498 activity; extracellular; extr
          seq00366 CATCTTGAAAGCACTTGAAGAATTTCTAAAGGTCACTATGAGGTCTACTCGGCAAACC5.0 cytokine
RN00614                    NM_012589
                                   Il6     interleukin 6acute-phase response;24498 activity; extracellular; extr
                                                                             5.0 cytokine
          seq00366 GAAGAACAACTTACAAGATAACAAGAAAGACAAAGCCAGAGTCATTCAGAGCAATACTG
RN00614                    NM_012589
                                   Il6     interleukin 6acute-phase response;24498 activity; extracellular; extr
                                                                             5.0 cytokine
          seq00366 GAAGAACAACTTACAAGATAACAAGAAAGACAAAGCCAGAGTCATTCAGAGCAATACTG
RN00615                    M26594 Me1      malic enzyme 1 dehydrogenase24552
                                                        malate               1.1 (decarboxylating) activity; malate d
          SEQ00367 GTACAGCACTAATTATGACCAGATCCTACCTGATTGTTATTCGTGGCCTGAAGAAGTTCCAGA
RN00616                    NM_145775
                                   Nr1d1   "nuclear receptorbinding; ligand-dependent nuclear receptor activity; n
                                                        DNA subfamily 1, 4.0 252917
          SEQ00368 CAACGGTCTACGGCAAGGCAACACCAAGAATGTTCTGCTGGCATGTCCCATGAAC   group D, member 1"
RN00617                    NM_145775
                                   Nr1d1   "nuclear receptorbinding; ligand-dependent nuclear receptor
                                                        DNA subfamily 1, 4.0 252917
                                                                             group D, member 1"
          seq00368 CATGGACGTAGTGGCCGGACTGTGCAGGAGATCTGGGAAGACTTCTCTATGAGCTTCA activity; n
RN00618                    NM_145775
                                   Nr1d1   "nuclear receptorbinding; ligand-dependent nuclear receptor
                                                        DNA subfamily 1, 4.0 252917
                                                                             group D, member 1"
          seq00368 GTCATTGTTCAACGTGAAGGACCAGACAGTCATGTTCCTGAGCCGCACAACCTACAGC activity; n
RN00619                    M25584 Ins1     insulin 1 extracellular; extracellular space; glucose metabolism; glu
          SEQ00369 CCAACCCTAAGTGACCAGCTACAATCATAGACCATCAGCAAGCAGGTATGTACTCTC 4.0 24505
RN00620                    M24537          prephenateCARBOXYLIC ACID METABOLISM(NF), AROMATIC AM
                                                         dehydratase Spike
          SEQ00370 GTTAATCTAACAATAGACTATTTAATACATGAACAGCCTTTGCCAATCGTGGGTGAAATGAC
RN00621                    XM_343636
                                   Man2a1 "mannosidase 2, apparatus; alpha-mannosidase activity;
                                                        Golgi alpha 1"       2.0 25478
          seq00371 AATTTCTTTCATCACCTCATTATACAACACTGACAGAAGCCAGAAGGAACTTGGGACTGcarbohydrat
RN00622                    XM_343636
                                   Man2a1 "mannosidase 2, apparatus; alpha-mannosidase activity;
                                                        Golgi alpha 1"       2.0 25478
          SEQ00371 TCCCTTTGGACATTCACCCACAATGACTTACCTTCTAAAACGTGCTGGATTTTCACAC carbohydrat
RN00623                    XM_343636
                                   Man2a1 "mannosidase 2, apparatus; alpha-mannosidase activity; carbohydrat
                                                        Golgi alpha 1"       2.0 25478
          seq00371 TGGAGTGGCTACTTCACATCCAGACCTTTCTACAAACGAATGGACAGGATAATGGAATC
RN00624                    NM_012663
                                   Vamp2   vesicle-associated membrane 2.0 kinesin complex; synapse; synapto
                                                        integral to membrane; 24803
          seq00372 CCCTCTAGTCTAGTTTGCTTCCCTTACCCCATTTCCACACCTCTTGTACCCTCCTCTC protein 2
RN00625                    NM_012663
                                   Vamp2   vesicle-associated membrane 2.0 kinesin complex;
                                                        integral to membrane; 24803
                                                                              protein 2
          SEQ00372 CTCTAGTCTAGTTTGCTTCCCTTACCCCATTTCCACACCTCTTGTACCCTCCTCT synapse; synapto
RN00626                    NM_012663
                                   Vamp2   vesicle-associated membrane 2.0 kinesin complex; synapse; synapto
                                                        integral to membrane; 24803
          seq00372 CTGGTGTGTAAGTGTCTTGGAGTTCAGTGTGTTATGATGGGACCAATAATTCTGCCAC protein 2
RN00627                    M23995 Aldh1a4 "aldehyde dehydrogenase family 1, subfamily A4"
                                                                     Normalisation
          SEQ00373 ACATACCCAAGAAGAAAGGGATACATTTAGGTACATGCTCTTTGTAACCCAGTCATG      29651
RN00628                    M23995 Aldh1a4 "aldehyde dehydrogenase family 1, subfamily A4"
                                                                     Normalisation
          SEQ00373 TTCAAGATGTCTGGAAATGGGCGAGAAATGGGTGAACAGGGTGTTTATGAATACA        29651
RN00629                    M23643 Trh      proprotein convertase subtilisin/kexin type 2
                                                        extracellular space; hormone activity; thyrotropin-releasing
          SEQ00357 GACCTTGGTTGCTGCTGGCTCTGGCTTTGATCTTCACCCTAACTGGTATC        4.0
RN00630                                    Rattus norvegicus MHC RT1.B-alpha precursor, gene,
          SEQ00376 CTTCTGGCACTTTCTCGTTCACTGTCACTTCTGGAACAGCATGGCTTCTGGCTTC exons 2-4
                           M22366                                            7.0
RN00631                    NM_017050
                                   Sod1    superoxide DNA fragmentation; activation of MAPK; antioxidant activi
                                                        dismutase 1         12.0 24786
          SEQ00377 CAAGGCTGTACCACTGCAGGACCTCATTTTAATCCTCACTCTAAGAAACATGGCGGTC
RN00632                    NM_017050
                                   Sod1    superoxide DNA fragmentation; activation of MAPK; antioxidant activi
                                                        dismutase 1
          seq00377 CAGAAGGCAAGCGGTGAACCAGTTGTGGTGTCAGGACAGATTACAGGATTAA     12.0 24786
RN00633                    NM_017050
                                   Sod1    superoxide DNA fragmentation; activation of MAPK; antioxidant activi
                                                        dismutase 1
          seq00377 CGTGTGCGTGCTGAAGGGCGACGGTCCGGTGCAGGGCGTCATTCACTTCG       12.0 24786
RN00634                    M20156 Rpl18    ribosomal protein L18 Normalisation
                                                        intracellular; protein biosynthesis; ribosome;
                                                                                  81766
          SEQ00378 GGGACGATCACAGATGATGTGCGGATTCTGGAAGTGCCCAAGCTGAAGGTGTGTG structural con
RN00635                    M17701 Gapd     glyceraldehyde-3-phosphate dehydrogenase
                                                        glyceraldehyde-3-phosphate dehydrogenase (phosphoryla
                                                                     Normalisation
          SEQ00379 CCATGTTTGTGATGGGTGTGAACCACGAGAAATATGACAACTCCCTCAAGATTGT        24383
RN00636                    M15562          "similar to H-2 CLASS II HISTOCOMPATIBILITY ANTIGEN, E-K ALP
          SEQ00380 ATTCTCTGGTCTAATGTCTGGCTGGGGTTCTCCGTCTGCTTCCTGTATCTATATTCT 7.0 294269
RN00637                    M14050 Hspa5    heat shock ATP binding; endoplasmic reticulum; heat shock protein a
                                                        70kD protein 5 13.0 25617
          SEQ00381 TGATCTGCTAGAGCTGTAATATTGTAAATACTGGACTCAGGAACTTTCGTTGGGAGAA
RN00638                    M13979 Slc2a1   "solute carrier family 2,member 1" 24778
                                                        ATP binding; carbohydrate transport; glucose transporter
          SEQ00382 AACACCATGAGAAGGACCTCGGAGGCTGAGAACTTACTGCTGAAGACACGGACAC   1.1
RN00639                    M11794 Mt1a     Metallothionein
                                                        copper ion binding; cytosol; lysosome; metal
                                                                            12.0 24567
          SEQ00383 GGACATCTGAGTTGAGACCCAGTTGTTACTAACCTTATTGTGAATTGCCTGATCTACA ion binding; n
RN00640                    M11596 Calcb    "calcitonin-related polypeptide,4.0 171519
                                                        extracellular; hormone activity
          SEQ00384 TTTGCATCCTGAAAGATACTGAGGGAAAACACCATTGTCACTTGAGAGAAATGAAACCAbeta"
RN00641                    M10068 Por      P450 (cytochrome) oxidoreductase
                                                        NADPH-hemoprotein reductase activity; electron transpor
                                                                     Normalisation
          SEQ00385 CTGTGGACTATGTTAAGAAGCTGATGACCAAGGGCCGCTACTCACTAGATGTGTG        29441
RN00642                    L39010  Gadd45a growth arrest and DNA-damage-inducible 45 alpha
                                                        cell cycle arrest; protein biosynthesis; response to DNA da
          SEQ00386 AAAATGTGTGGTGGGTGGATAGTGTTTTCAGAAAGAAATGTGCTGCTGTCTCGGT  12.0 25112
RN00643                    L38424          alternate gene name: jojG~similar to hypothetical proteins
                                                                     Spike
          SEQ00387 AGTGATGATGTCGAGATCGGAATGGGCGGCACAATAGCGAAGTTTGTCAAACAGGAAA
RN00644                    L36088  Acvrl1  activin A receptor type II-like 1 4.0 25237
                                                        ATP binding; extracellular space; integral to membrane; k
          seq00388 CTGTAGGCAAGGCTTATGGAGGGCAAAGTAGGGCTCGGGCAAGAGACAAGATCAGCATC
RN00645                    L36088  Acvrl1  activin A receptor type II-like 1 4.0 25237
                                                        ATP binding; extracellular space; integral to
          SEQ00388 GGGCTGTAGGCAAGGCTTATGGAGGGCAAAGTAGGGCTCGGGCAAGAGACAAGAT membrane; k
RN00646                    L36088  Acvrl1  activin A receptor type II-like 1 4.0 25237
                                                        ATP binding; extracellular space; integral to
          seq00388 TGACTCCAGCGTGTTCTATCCAGACTTCAATCTAAACAATCTTGATTCCTGTAGCCGGmembrane; k
RN00647                    NM_013155
                                   Vldlr   very low density lipoprotein receptor
                                                        calcium ion binding; cholesterol metabolism; coated pit; en
          SEQ00389 CTCTAGTGTGGACCTGAATGGTCAAGATCGTAGGATAGTGCTCAAGTCTCTGGAGTTC1.4 25696
RN00648                    NM_013155
                                   Vldlr   very low density lipoprotein receptor
                                                        calcium ion binding; cholesterol metabolism; coated pit; en
                                                                             1.4 25696
          seq00389 GACCTCTCAATAGACATTGGTAGACATAGCGCCTCTGTAGGACACACATACCCAGCAAT
RN00649                    NM_013155
                                   Vldlr   very low density lipoprotein receptor
                                                        calcium ion binding; cholesterol metabolism; coated pit; en
          seq00389 TGTCAACACAACAGACATCCTACGAACTAGTGGACTTGTTCCTGGAGGGATCAATGTG1.4 25696
RN00650                    NM_022502
                                   Ppt     palmitoyl-protein locomotory behavior; catalytic activity; extracellular s
                                                        adult thioesterase 2.0 29411
          seq00390 CCACTGCACTCTTGGCTAACTGTCCTTAATATTACAAGTAGCGTAAATGTCACTTACACT
RN00651                    NM_022502
                                   Ppt     palmitoyl-protein locomotory behavior; catalytic activity; extracellular s
                                                        adult thioesterase 2.0 29411
          seq00390 GCATGTTTCTACATCATTTCTTAAAGCTGTTTTCCTATTTTAGTGTTGCCCTCTAGTGG
RN00652                    NM_022502
                                   Ppt     palmitoyl-protein locomotory behavior; catalytic activity; extracellular s
                                                        adult thioesterase 2.0 29411
          SEQ00390 GGAGCAAATAAAAGCCTCATGGTATCCAGTCCTGAGATGTTCACACAAGCAATTTCTC
RN00653                    L32591  Gadd45a growth arrest and DNA-damage-inducible 45 alpha
                                                        cell cycle arrest; protein biosynthesis; response to DNA da
          SEQ00386 CCCGAACGGTGATGGCATCTGAATGGAAATAACTGAACCAAATTGCACTGAAGTTT 12.0 25112
RN00654                    L28126  Slc2a2  "solute carrier family 2, member 2"25351 activity; glucose transporte
                                                        carbohydrate transport; carrier
                                                                             1.1
          seq00392 ATGTGAGTAGAATTTATAGGAAACCCAAGGCTATAACAAACACACTCCCTCTCCCAATCAGG
RN00655                    L28126  Slc2a2  "solute carrier family 2, member 2"25351 activity; glucose
                                                        carbohydrate transport; carrier
                                                                             1.1
          seq00392 CTGTCCTGCAACTCCCATGCCATCCAATGAGCCTCCAACTCAGCCCTCCTGTCCCAGC transporte
RN00656                    L28126  Slc2a2  "solute carrier family 2, member 2"25351 activity; glucose
                                                        carbohydrate transport; carrier
                                                                             1.1
          SEQ00392 TGTATGCCAAACATTTATCGTGCTATTTCGTTTAATCCCCTCAACAAAACAGAATGCCTG transporte
RN00657                    L27129  Mapk8   mitogen-activated proteinJNK cascade; JUN kinase activity;
                                                        ATP binding; kinase 8116554
                                                                             6.0
          SEQ00393 CAGTCAGGCGAGAGATTTGTTATCTAAAATGCTGGTGATAGATGCGTCCAAAAGGATCT MAP kina
RN00658                    NM_017322
                                   Mapk9   stress activated protein kinase6.0 50658
                                                        ATP binding; JNK cascade; JUN kinase activity; MAP kina
          SEQ00394 ACGTACAGCTTTCTGCATGACAAAGTTCCAAGTTGTATTTCACTCTGCTTAACGACTT alpha II
RN00658                    NM_017322
                                   Mapk9   stress activated protein kinase6.0 50658
                                                        ATP binding; JNK cascade; JUN kinase activity; MAP kina
          SEQ00394 ACGTACAGCTTTCTGCATGACAAAGTTCCAAGTTGTATTTCACTCTGCTTAACGACTT alpha II
RN00659                    L27112  Mapk9   stress activated protein kinase6.0 50658
                                                        ATP binding; JNK cascade; JUN kinase activity; MAP kina
          seq00394 ACAAAGTTCCAAGTTGTATTTCACTCTGCTTAACGACTTATGTCACCTTGAATCCTGA  alpha II
RN00660                    L27112  Mapk9   stress activated protein kinase6.0 50658
                                                        ATP binding; JNK cascade; JUN kinase activity;
                                                                               alpha II
          seq00394 CTAACTTGTCTTTCTCACTGACAGAAGCCACCACGTCCAGCCAGAGCACATGGTCTCTTA MAP kina
RN00661                    L27075
          SEQ00395 GTTATTCGGTGTGTGTGAGAGGGCACTGGCGGGAGTCTGGAGGGGTGGTTGGAGAG
                                   Acly    ATP citrate lyase
                                                        Fatty_Acid_Synthesis  1.4
RN00662                    L26267  Nfkb1   nuclear factor kappa B p105 subunit nucleus; regulation of transcriptio
                                                        DNA binding; cytoplasm;
                                                                              9.0 81736
          SEQ00396 CCCACCTGGTGTTCTTTCTAGCCATCTACAGTACAGTCATGCACTCAAATTAAGATTAAGGA
RN00663                    L25785  Tgfb1i4 transforming growth regulation of transcription, DNA-dependent;
                                                        nucleus; factor beta 1 induced transcript 4
                                                                      Normalisation25564
          SEQ00397 CTGATGTCAGTTGAGCTAGTGAATGAATAGATGGAGAAACGTCAGTCAGTTGCTGAGGAAG trans
RN00664                    NM_012714
                                   Gipr    gastric inhibitory peptide receptor 25024
                                                        G-protein coupled receptor activity; G-protein coupled rece
          SEQ00398 CCAGGAGAGGGATCAAAGGAGACAGTCAAGACAAAAGGAGAGCAATCAAAAGTCAAAAG4.0
RN00664                    NM_012714
                                   Gipr    gastric inhibitory peptide receptor 25024
                                                        G-protein coupled receptor activity; G-protein coupled rece
          SEQ00398 CCAGGAGAGGGATCAAAGGAGACAGTCAAGACAAAAGGAGAGCAATCAAAAGTCAAAAG4.0
RN00665                    NM_012714
                                   Gipr    gastric inhibitory peptide receptor 25024
                                                        G-protein coupled receptor activity; G-protein
                                                                              4.0
          seq00398 GATCTCTGGGACCGAATGCTTGTCAGCCTTTATGTAGATGAAGTGAACACAACTCCAT coupled rece
RN00666                    L18889  Canx    calnexin calcium ion binding; calcium ion storage activity; chaperon
                                                                             13.0 29144
          SEQ00399 GTGAAGGACGAAGAAGGGAAGGAAGAAGAGAAGAACAAGGGAGATGAAGAGGAAGAAGA
RN00667                    NM_016993
                                   Bcl2    B-cell leukemia/lymphoma apoptosis; apoptosis inhibitor activity; apop
                                                        anti-apoptosis; 2 13.0 24224
          seq00400 GCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGGGAGCGTCAACAGGGAGATGTCAC
RN00668                    NM_016993
                                   Bcl2    B-cell leukemia/lymphoma apoptosis; apoptosis inhibitor activity; apop
                                                        anti-apoptosis; 2 13.0 24224
          seq00400 GGACAACATCGCTCTGTGGATGACTGAGTACCTGAACCGGCATCTGCACACCTGGATC
RN00669                    NM_016993
                                   Bcl2    B-cell leukemia/lymphoma apoptosis; apoptosis inhibitor
                                                        anti-apoptosis; 2 13.0 24224
          SEQ00400 GGGAGAACAGGGTATGATAACCGGGAGATCGTGATGAAGTACATCCATTATAAGCTG activity; apop
RN00670                    L13237
          SEQ00401 GGAATCAATAAGAGTTGGTTTCAAAGAAGCAGGAGGAGAAGGAGGAACAGGAACAGGA14.0
                                           Polymeric immunoglobulin receptor AATTAA-containing 3'UTR Group 1 mRN
RN00671                    L11007  Cdk4    cyclin-dependent kinase 4
                                                        ATP binding; cAMP-dependent protein kinase activity; cell
                                                                      Normalisation
          SEQ00402 CGGGACCTGAAGCCAGAGAACATTCTAGTGACAAGTAATGGGACAGTTAAGCTGG         94201
RN00672                    L10652  Metap2  methionine aminopeptidase activity; hydrolase activity; metalloexopep
                                                                      Normalisation
                                                                            2
          SEQ00403 CTGAAGAACCTGTGTGACTTGGGCATTGTAGATCCATATCCACCACTCTGTGACATTAAAG   64370
RN00673                    L10652  Metap2  methionine aminopeptidase activity; hydrolase activity; metalloexopep
                                                                      Normalisation
                                                                            2
          SEQ00403 TCAAGAAGTTATGGAGTCCTATGAAGTGGAAATAGATGGGAAGACCTACCAAGTGAAACC    64370
RN00674                    L09647  Hnf3b   "hepatocyteDNA binding; nucleus; regulation of transcription, DNA-de
                                                         nuclear factor 3, beta"25099
          SEQ00405 AATCCAGGTCTCGGGTCTGATTTAATTTATGGTTTCTGCGTGCTTTATTTATGGCTTA 9.0
RN00675                    K02815  Btnl2   butyrophilin-like 2 (MHC class 7.0 116505
          SEQ00376 CTTCCACAAGATGGCTTACCTCACCTTCATCCCTTCCAACGACGACATTTATGAC    II associated)
RN00676                    K01391          anthranilatemain pathways of carbohydrate metabolism
                                                         synthase Spike
          SEQ00407 CATGATGCAACAACGCTAGAACAAATATTGAAAGTATTCACGCCTGATATTCTCGG
RN00677                    J05510  Itpr1   "inositol 1,4,5-triphosphate receptor 1"
                                                        calcium channel activity; calcium ion transport; cation cha
                                                                              3.0 25262
          SEQ00408 GCTGATCTGTTAATACTTATGTAATAAATGGTTAAATATCAAATGATGATGCTGCTGCCAAA
RN00677                    J05510  Itpr1   "inositol 1,4,5-triphosphate receptor 1"
                                                        calcium channel activity; calcium ion transport; cation cha
                                                                              3.0 25262
          SEQ00408 GCTGATCTGTTAATACTTATGTAATAAATGGTTAAATATCAAATGATGATGCTGCTGCCAAA
RN00678                    J05470  Cpt2    carnitine palmitoyltransferase 2 25413
                                                        acyltransferase activity; carnitine O-palmitoyltransferase a
          SEQ00409 GCATACCAGCAGATGAACCACAACATCCTGTCCACCAGCACTCTGAACAGCCCAG    1.4
RN00679                    J04811  Ghr     growth hormone receptor
                                                        extracellular space; hematopoietin/interferon-class (D200-
          SEQ00001 AGACTGTTTGTGGCAGTGATTGTCTGTGCTGTGGGTCTTAACTTTGTGATACTAAGT  4.0 25235
RN00680                    J04793  Slc4a1  "solute carrier family 4,Normalisation anion transport;
                                                        anion exchanger activity;
                                                                      member 1"24779
          SEQ00411 TTTGCCTCCCAGGACTGCCTCACCACAGACTCTTGTTCCCTCATCATAGAAATAG carrier activity; in
RN00681                    J04792  Odc1    ornithine decarboxylase 1 activity; catalytic activity; lyase activity; ornit
                                                        carboxy-lyase         1.2 24609
          seq00412 AAAGTATCTTGAAATGATTGGACATTGGAGAATGTGTGCAAGTATCCCTTACAGAAGGCA
RN00682                    J04792  Odc1    ornithine decarboxylase 1 activity; catalytic activity; lyase
                                                        carboxy-lyase         1.2 24609
          SEQ00412 CAGCCTGTGCTTCTGCTAGTATCAATGTATAGATGCCATTCTTGTAGCTCTTACCTGC activity; ornit
RN00683                    J04792  Odc1    ornithine decarboxylase 1 activity; catalytic activity; lyase activity;
                                                        carboxy-lyase         1.2 24609
          seq00412 GGGACCATTTAACTTAATTACTGCTAGTTTGGAATGTCTTTGTAAGAGTAGGGTTGGCACCA ornit
RN00684                    J04423c                                    clone
                                           Unidentified bacterium Spike zdt-9n2
          SEQ00413 ATTACGCAACAGTAAATCCTTACACCTTCGCAGAACCCACTTCGCCGCACATCATCAG
RN00685                    J04423b                                    clone
                                           Unidentified bacterium Spike zdt-9n2
          SEQ00414 TTTTACGGCAATATCATCACCACACGCACTTATCAGGAACGCCTCGATACGCTGGAAAA
RN00686                    J04423a                                    clone
                                           Unidentified bacterium Spike zdt-9n2
          SEQ00415 GCAGACCATTATCTGGCGGGAGATATCGAATCCCTGCCGTTAGCGACTGCGACGTTCG
RN00687                    J04024  Atp2a2  "ATPase, Ca++ transporting, cardiac muscle, slowto transmembrane
                                                        ATP binding; ATPase activity, coupled twitch
                                                                              3.0 29693
          SEQ00416 CTGGCTGATCTCAGGCTGAAGGAGCTGTATGTATTCCCTCTATTACCAAACTGACAC 2"
RN00688                    J03627  S100a10 "S-100 related protein, clone 42C" 81778
                                                        calcium ion binding2.0
          SEQ00417 TTGGAAAATCAAAAGGACCCTCTGGCTGTGGACAAAATAATGAAAGACCTGGACC
RN00689                    J03179  Dbp     D site albumin promoter binding protein
                                                        DNA binding; circadian24309 nucleus; regulation of tran
          SEQ00418 GAGGTACAAGAACAATGAAGCAGCCAAGAGGTCGAGAGACGCAAGAAGACTCAAG    9.0 rhythm;
RN00690                    NM_012669
                                   Tcf1    transcription factor 1
                                                        DNA binding; nucleus; regulation of transcription, DNA-de
          SEQ00419 CGGTCATGGGCAAGCCTAGATGTTTATTTAACTTTTAGTAAAGCCAGTAAGAAGTGTGT9.0 24817
RN00691                    NM_012669
                                   Tcf1    transcription factor 1
                                                        DNA binding; nucleus; regulation of transcription, DNA-de
                                                                              9.0 24817
          seq00419 CGGTCATGGGCAAGCCTAGATGTTTATTTAACTTTTAGTAAAGCCAGTAAGAAGTGTGTAGT
RN00692                    NM_012669
                                   Tcf1    transcription factor 1
                                                        DNA binding; nucleus; regulation of transcription, DNA-de
          seq00419 CTAGGCTTTCCCCTACTAAGTCGCTCTTCCTCCCGGCCCCAGGACCTCATTTGTTTCC 9.0 24817
RN00693                    J03145  Slc2a2  "solute carrier family 2, member 2"25351 activity;
                                                        carbohydrate transport; carrier
                                                                              1.1
          SEQ00392 TTAGCATCTAAACCATGTTAGTTACTCTCCATTTCAGTCCTTTGTATTGTACTTT glucose transporte
RN00694                    NM_016986
                                   Acadm   "acetyl-coenzyme A dehydrogenase, medium electron transport; fatty
                                                        acyl-CoA dehydrogenase activity; chain"
          seq00421 AAATTAACAGAAATTACTATCGAACGATGCTTCACCCTCATGTAACTACGCTCAGAGC 1.4 24158
RN00695                    NM_016986
                                   Acadm   "acetyl-coenzyme A dehydrogenase, medium electron transport; fatty
                                                        acyl-CoA dehydrogenase activity; chain"
                                                                              1.4 24158
          SEQ00421 GAGATGGAGAAATACCCTGGAGTTCTAATGCTCATTCAAGTGACAAGAAAGGTAGCCTGT
RN00696                    NM_016986
                                   Acadm   "acetyl-coenzyme A dehydrogenase, medium electron transport; fatty
                                                        acyl-CoA dehydrogenase activity; chain"
          seq00421 GATGCGGGACGCCAAGATCTATCAGATTTACGAAGGTACTGCACAAATTCAGAGGCTG 1.4 24158
RN00697                    J02720  Arg1    arginase 1 arginase activity; arginine catabolism; arginine metabolism
          SEQ00422 GTAATCATAAGCCAGAGACTGACTACCTTAAACCACCGAAATAAATGTGAATACA    1.2 29221
RN00698                    J00705  Apoe    apolipoprotein E binding; lipid binding; lipid transport; lipid
                                                        heparin               1.4 25728
          SEQ00423 TCACACAGGAACTGACGGTACTGATGGAGGACACTATGACGGAAGTAAAGGCATACAA transpor
RN00699                    H32966          similar to TNF receptor associated311786
          SEQ00424 TACCCCACCAAAGGGTGTCTCCCTTCCCCAGACAGAAAATACAGCAAGAGAAGAT    6.0 factor 2
RN00700                    H31287          tribbles homolog 3 (Drosophila) 14.0
          SEQ00425 TGCATGAAGCACAATGGCTGTTTCTTCCTCCAGAAAGGCACTTACAGTTTAGCTTGGC
                                   Trib3                activation of MAPK regulation of transcription, DNA-dependent
RN00701                    E13573  Bid3    BH3 interacting domain 3
                                                        apoptosis; protein13.0
          SEQ00191 CAGGTGACCGCGCTGCGGCTGCAGGCGCTGGGCGACGAGCTGCACCGACG         binding
RN00702                    E05489          interleukin 1 alpha of cell cycle inflammatory response immune
                                                                              5.0
          seq00427 AAAGCCTAGTGGAACCAGCCCGACATATGATACTGTTTGTTATTTAAAGAGTACCCTATAGTrespons
                                   Il1a                 regulation
RN00703                    E05489          interleukin 1 alpha of cell cycle inflammatory response immune respons
                                                                              5.0
          SEQ00427 AGCCTAGTGGAACCAGCCCGACATATGATACTGTTTGTTATTTAAAGAGTACCCTATAGTTTGC
                                   Il1a                 regulation
RN00704                    E05489          interleukin 1 alpha of cell cycle inflammatory response immune
                                                                              5.0
          seq00427 CATCATTCAACTCACCTGTAATTAAAGCTAACCATCTAAAGACGGGAAGAACCTAACTGT respons
                                   Il1a                 regulation
RN00705                    E03424
          SEQ00428 CTGAGGCCAGCGTTATCTGTCTCGATTGTACATTCCAGTTCCAGTTGGTATACTTGTC
                                   Gch     GTP cyclohydrolase 1               1.2
                                                        tetrahydrobiopterin biosynthesis
RN00706                    D90109  Facl2   "fatty acid Coenzyme ANormalisation catalytic activity; fatty acid me
                                                        acetate-CoAligase, long chain 2"
                                                                        ligase activity;
          SEQ00429 TCTTTCCCTCCCAGTTAAACTCAGGCACAGCATGTCTTCAGAAGTATCTAGGCAG         25288
RN00707                    NM_012981
                                   Mras    muscle andATP binding; RAS binding; GTPase activity; RAS small m
                                                         microspikes GTP 6.0 25482
          seq00430 ATGGAGACATGGAGACAGCTTCCAAACCCTTGTTGTTGATTGAGCCCAGTTCCCAGTC
RN00708                    NM_012981Mras    muscle andATP binding; RAS binding; GTPase activity;
                                                          microspikes GTP 6.0 25482
          SEQ00430 CGACCAAATACAATATCCCATATATAGAAACCAGTGCCAAGGACCCGCCTCTCAAC RAS small m
RN00709                    NM_012981Mras    muscle andATP binding; RAS binding; GTPase activity; RAS small m
                                                          microspikes GTP 6.0 25482
          seq00430 TGAGTAATGATTATTTTATTAAAGAGGTCTGTGCCCATTGCCTGCAAAGCCCCAAGTCT
RN00710                    D87991           UGTrel1 induction of apoptosis
                                                                      Normalisation
          SEQ00431 CTGACCTGCTCCATCATCACCACGACTCGGAAGTTCTTCACCATCTTGGCTTCTG
RN00711                    D87991           UGTrel1 induction of apoptosis
                                                                      Normalisation
          SEQ00431 GCAGGAGAAGATAACAAGAGGAAAGTATGGAGAAGGACCCAAACAGGAGACATTCACC
RN00712                    D84346   Nckap1  NCK-associated protein 1
                                                         integral to membrane; protein binding
          seq00433 GAATGTTGATGTTCTAACACAAATGAGGACCAGCTTTGACAAACCAGACCAGATGGCT 13.0 58823
RN00713                    D84346   Nckap1  NCK-associated protein 1
                                                         integral to membrane; protein binding
          seq00433 GTGTATGAGCTGTCATCTGCTGCTGGATTACCATGCGAGATTGATCCTGCCTTAGTAG 13.0 58823
RN00714                    D84346   Nckap1  NCK-associated protein 1
                                                         integral to membrane; protein binding
          SEQ00433 TATGAGCTGTCATCTGCTGCTGGATTACCATGCGAGATTGATCCTGCCTTAGTAGTAG 13.0 58823
RN00715                    NM_019163Psen1   presenilin 1Golgi apparatus; endoplasmic reticulum; integral
                                                                               6.0 29192
          seq00434 CAGATGTCTGAGGACAGCCACTCCAGCAGCGTCCGTAGCCAGAATGACAATCAAGAAC to memb
RN00716                    NM_019163Psen1   presenilin 1Golgi apparatus; endoplasmic reticulum; integral
                                                                               6.0 29192
          seq00434 CCCATTCACAGAAGACACCGAGACTGTAGGCCAGAGAGCCCTGCACTCGATCTTGAAT to memb
RN00717                    NM_019163Psen1   presenilin 1Golgi apparatus; endoplasmic reticulum; integral to memb
          SEQ00434 GTGCTACAAGGTCATCCATGCCTGGCTTATTGTTTCATCTCTGTTGTTGCTGTTCTTT  6.0 29192
RN00718                    D63411   LOC266601
                                            outer mitochondrial membrane receptor rTOM20
                                                                      Normalisation
          SEQ00435 CTTGAAGAGATACAGCTTGGTGAAGAGTTATTAGCACAAGGTGACTATGAGAAGG         266601
RN00719                    D63411   LOC266601
                                            outer mitochondrial membrane receptor rTOM20
                                                                      Normalisation
          SEQ00435 GCAAGTGTTACAACAGACTCTTCCACCACCAGTGTTCCAGATGCTTCTGACCAAG         266601
RN00720                    D50608   Cckar   cholecystokinin A receptor
                                                         G-protein coupled receptor activity; G-protein
                                                                               4.0 24889
          SEQ00437 CCTTCCTCCCTCCCTCCCTTCATTCTTCTTCCTTGCACGTTATTGTCTTGTTTACTAA coupled rece
RN00721                    D45250   Psme2   "protease (prosome, macropain) 28 subunit, beta" activator activity;
                                                         cytosol; immune response; proteasome
          SEQ00438 CAAGGATGATGAGATGGAAACCGAGCAGGAGAAGAAAGAAGTCCCTAAGTGTGGC     7.0 29614
RN00722                    D44591   Nos2    "nitric oxideG-protein signaling, coupled to cGMP nucleotide second m
                                                          synthase 2, inducible" 24599
          SEQ00140 GATCAATAACCTGAAGCCCGAAGACCCAGTGCCCTGCTTTGTGCGGAGTGTCAGT     1.2
RN00723                    D26564   Cdc37   cell divisionchaperone activity; (S. cerevisiae) cycle
                                                          cycle 37 homolog regulation of cell
                                                                      Normalisation
          SEQ00441 GAGACAGCCAACTACCTGGTTATCTGGTGCATTGACCTGGAAGTCGAGGAGAAGT         114562
RN00724                    D26154           RB109        biosynthesis Normalisation
          SEQ00442 AGTGGGTTTCATCTGTGCTTTCTCATTGTTGCTGTCATTAACTGTGGGTATGGAT
RN00725                    D26154           RB109                     Normalisation
          SEQ00442 GGGTGTTTGGTCCATTCCCTCCCTGTTAATTCCAACTTCCTGTTGTCTTTATCACA
RN00726                    D25224   Lamr1   "laminin receptor 1 (67kD, ribosomal protein SA)"protein biosynthesis
                                                         intracellular; laminin receptor activity;
                                                                      Normalisation
          SEQ00444 AAAGTGACGGTATCTACATCATCAACCTGAAGAGGACTTGGGAGAAGCTGTTGTTAGC      29236
RN00727                    D16308   Ccnd2   cyclin D2 G1/S transition of 11.0 64033cycle; cell cycle;
                                                                              mitotic cell
          SEQ00445 CAGACCTTCATCGCTCTGTGTGCTACCGACTTCAAGTTTGCCATGTACCCGCCATCGA cell growth
RN00728                    D16302   Mgat1   N-acetylglucosaminyltransferase I 81519
                                                         Golgi apparatus; Golgi membrane; N-linked
                                                                      Normalisation
          SEQ00446 TGCAGTGGAGCAGTGTGTTGTGAGATGGAAAGTAGGAGCTAAAGCAAGACCTCTC glycosylation;
RN00729                    D14688   Mrlcb   myosin regulatory light Normalisation
                                                                      chain
          SEQ00447 CTTCGCTTGCTTCGATGAGGACACGACAGGCACCATCCAGGAGGATTACCTGAGG         50685
RN00730                    NM_022210Max     Max          DNA binding; nucleus; regulation of
                                                                               9.0 60661
          seq00448 ATGAGCGATAACGATGACATCGAGGTGGAGAGCGACGAAGAGCAACCGAG transcription, DNA-de
RN00731                    NM_022210Max     Max          DNA binding; nucleus; regulation of transcription, DNA-de
          SEQ00448 CTCACCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGACAGCTTTCACAG  9.0 60661
RN00732                    NM_022210Max     Max          DNA binding; nucleus; regulation
                                                                               9.0 60661
          seq00448 GACCACATCAAAGACAGCTTTCACAGTTTGCGGGACTCAGTCCCATCACT of transcription, DNA-de
RN00733                    D14014   Ccnd1   cyclin D1 adipocyte differentiation; cell cycle; cyclin-dependent prote
          SEQ00449 TTGTTCTGAGTCTCTGGTGCATCATATAATCTGTTAGGTTCTAGTGTTCTGTCTTGTT 11.0 58919
RN00734                    D13966   Insrr   insulin receptor-related receptor 60663 kinase activity;
                                                         ATP binding; protein-tyrosine
                                                                               4.0
          SEQ00450 CAACCACATTGTTGGGAACAAGCTGGGTGAGGAGTGTGCTGACGTGTGCCCTGGT receptor acti
RN00735                    D13965   Insrr   insulin receptor-related receptor 60663 kinase activity; receptor acti
                                                         ATP binding; protein-tyrosine
          seq00451 CCTGGGATTTTTCAAGAACCTCAAACTAATCCGGGGAGATTCCATGGTGGATGGGTAA  4.0
RN00736                    D13965   Insrr   insulin receptor-related receptor 60663 kinase activity; receptor acti
                                                         ATP binding; protein-tyrosine
          seq00451 CTACAGATCCTCCTCATGTTTGCCGCCACGGGAGAGGACTTCCGAGGCCTCAGCTTTC  4.0
RN00737                    D13965   Insrr   insulin receptor-related receptor 60663 kinase activity;
                                                         ATP binding; protein-tyrosine
                                                                               4.0
          SEQ00451 TGTTGGGAACAAGCTGGGTGAGGAGTGTGCTGACGTGTGCCCTGGTGTGCTGGGG receptor acti
RN00738                    D13122   Atpi    ATPase inhibitor
                                                         ATPase inhibitor activity; mitochondrion
                                                                      Normalisation
          SEQ00452 GAAACGAGAGAAGGCTGAAGAGGATCGGTACTTCCGAGAGAAGACTAGAGAGCAG         25392
RN00739                    D10874   Atp6l   "ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16 kDa"
                                                                      Normalisation
          SEQ00453 TATAGTAATCATTAGTAGACTGTTGCCTTGTGGGGTTCCTGTTGCTGAGACTCCTTGG      170667
RN00740                    D10874   Atp6l   "ATPase, H+ transporting, lysosomal (vacuolar proton
                                                                      Normalisation170667
          SEQ00453 CCCTCAGTAGTTGGTCTTGTAAATGTGCAGTGTCCCTAGTGCCATTGTCTGTTGC pump) 16 kDa"
RN00741                    D10757   Psmb9   "proteosome (prosome, macropain) subunit, beta type 9"
                                                         cytosol; endopeptidase24967 hydrolase
                                                                               7.0 activity;
          SEQ00455 CAGAGGTTGGTGTAATGGGCAGAGGTGAAATGGGTATCAGAGAAACGGAGTGCGTactivity; immune
RN00742                    D10729   Psmb8   "proteosome (prosome, macropain) subunit, beta typeactivity; immune
                                                         cytosol; endopeptidase24968 hydrolase 8"
          SEQ00456 GTAGATGACAATGGGACTCGGCTCTCGGGACAGATGTTCTCCACAGGCAGCGGGAA    7.0 activity;
RN00743                    D10666   Vsnl1   visinin-like 1
                                                         calcium ion binding  15.0 24877
          SEQ00457 GCCAGAACAGCGAGTGGACAAGATTTTCAGCAAGATGGATAAGAACAAAGATGACCAGATTA
RN00744                    D10655   Dlat    dihydrolipoamide acetyltransferase81654
                                                         acyltransferase activity; dihydrolipoamide S-acyltransferas
                                                                      Normalisation
          SEQ00464 CGTTGGAATCTAACAGTTAAAGTCTCCTGTCACATGACCTTAGTTTATCACTCAGTAAGTG
RN00745                    D00913   Icam1   intercellularcell adhesion; cell adhesion molecule activity;
                                                          adhesion molecule 1 25464
                                                                               8.0
          SEQ00459 ATTCCTACCTTTGTTCCCAATGTCAACCACCATGCCTAAATATGGACGCTCACCTTTA cell-cell adh
RN00746                    D00729   Dci     dodecenoyl-coenzyme A delta 1.4 29740
                                                         catalytic activity; dodecenoyl-CoA delta-isomerase activity
          SEQ00460 TGTGACTACAGGATAATGGCGGACAACTCCAAGTATACCATAGGATTGAATGAGAGCCT isomerase
RN00747                    D00680   Gpx3    glutathione glutathione peroxidase 64317 oxidoreductase activity; pe
                                                         peroxidase 3
          SEQ00461 GTCTGACAGACCAATACCTTGAACTGAATGCACTACAAGAAGAACTTGGCCCATT    12.0 activity;
RN00748                    D00636   Dia1    diaphorase cytochrome-b5 reductase activity; electron transport; endo
                                                          1                    1.5 25035
          SEQ00462 ACACACATACACATACAGAGACAGAGAGACAGAGAGACAGAGATAGACAGAGATAGACAGAGAGA
RN00749                    NM_057197Decr1   "2,4-dienoyl2,4-dienoyl-CoA 1, 1.4 117543
                                                           CoA reductase reductase (NADPH) activity;
                                                                               mitochondrial"
          SEQ00463 AAACTGGAAATAAGGTCTATGCGATTCGGTGTGACGTTCGAGATCCTGATATGGTACA metabolism;
RN00750                    NM_057197Decr1   "2,4-dienoyl2,4-dienoyl-CoA 1, 1.4 117543
                                                           CoA reductase reductase (NADPH) activity; metabolism;
          seq00463 CTCTTGGATCAATGGGGCAGTCATTCGATTTGACGGTGGAGAGGAAGTGTTTCTGTCA  mitochondrial"
RN00751                    NM_057197Decr1   "2,4-dienoyl2,4-dienoyl-CoA 1, 1.4 117543
                                                           CoA reductase reductase (NADPH) activity; metabolism;
          seq00463 GACTGTCTCCCAATGGTTGGAGGACCATAACTGACATAGTTCTCAATGGTACAGCCTAT mitochondrial"
RN00752                    D00092   Dlat    dihydrolipoamide acetyltransferase81654
                                                         acyltransferase activity; dihydrolipoamide S-acyltransferas
                                                                      Normalisation
          SEQ00464 CTTTCTGTTGATGTAAATATGGGAGAGGTGCTGTTGGTGCGGAAGGAACTTAATAA
RN00753                    D00092   Dlat    dihydrolipoamide acetyltransferase81654
                                                         acyltransferase activity; dihydrolipoamide
                                                                      Normalisation
          SEQ00464 TTAGGGATGTTCGGAATTAAGAATTTCTCTGCGATTATTAACCCACCTCAGGCAT S-acyltransferas
RN00754                    BG376154         similar to Interleukin-1 receptor-associated kinase 1 (IRAK-1)
                                                                               6.0 363520
          SEQ00466 GAAGCCTGGGCCACTCCTCAAACTTGATTCTCTGGTAGTGCCTCCTTGTGTACAGCTAG (IRAK)
RN00755                    AY208182 Abca1   "ATP-binding cassette, sub-family 313210 member 1"
          SEQ00467 AGCGTTTCTGTGGAGTGGAACAAACTGGATTCTGTACTGACACTATTCAATGCAATGC  1.5 A (ABC1),
RN00756                    AY157758 Bbc3    Bcl-2 binding component 3 13.0 317673
          SEQ00468 GGGACGGCCCAGCCTGTAAAATACTGTACATGCACTGCTGTAGATATACTGGAATGAA
RN00757                    AY029283 Casp11  caspase 11caspase activity 13.0 114555
          SEQ00469 GCCGTACTCGAAAGGCTCTTATCATATGCAATACAGAGTTCAAACATCTCTCCCTGAGA
RN00758                    AY029163 Bcl2l10 BCL2-like 10 (apoptosis facilitator)114552
                                                         apoptosis inhibitor activity
          SEQ00470 CCTCTAAGGGACAATTCTGGGTAGTTGGATAAGAACTGAGGAAATCCTCCTGCCTAGA 13.0
RN00759                    AY027667 Casp9   caspase 9 apoptosis; apoptosis regulator activity; induction
                                                                              13.0 58918
          SEQ00471 GTTGTGTAATCCTGTCATGGGACTGCCCCGTGTGTTGTAGTGTTTTGAGCTGTCTCTG of apopto
RN00760                    AJ243123 Cish1   cytokine inducible SH2-containing 2529711
          SEQ00472 CGCATCCCTCTTAACCCGGTACTCCGTGACTACCTGAGTTCCTTCCCCTTCCAGATCT  6.0 protein
RN00761                    AJ011969 Gdf15   growth differentiation factor 155.0transforming growth
                                                         growth factor activity; 29455
          SEQ00473 CTCTAACCAACACACTCAAGTCCACGAGACCCAGTCAGTCCAGCTTCCGAGCCTC factor beta rece
RN00762                    AJ006064 Coro1b  "coronin, actin-binding protein, 1B"29474
                                                         actin binding; kinesin complex
                                                                      Normalisation
          SEQ00474 ATGCTGATCCAATCCTCATCTCACTACGGGAAGCCTATGTGCCCAGTAAACAACG
RN00763                    AJ000485 Cyln2   cytoplasmicRNA polymerase II2.0 29264 factor activity;
                                                          linker 2              transcription
          SEQ00475 GCTTGACTTCATATGCTGATCCTCTAACACAATGGTACAAGGTCGCTTGGGCCTCTAG cytoplasmi
RN00764                    AI639353 Plrg1   pleiotropic regulator 1 Normalisation
          SEQ00476 CATGAATGACTGGACATCCTCAGCAACACCAAGCTATGAACAGGACAGCCATGAG          60376
RN00765                    AI639353 Plrg1   pleiotropic regulator 1 Normalisation
          SEQ00476 GTACTCCATCCGTATTGACTGCCAGCGTGTTAATAATTGCATTGTGCCCAGAGAG          60376
RN00766                    NM_012598Lpl     lipoprotein lipase activity; extracellular space; heparin binding; hydr
                                                         catalytic             1.4 24539
          seq00478 ATGTAATATAGGACAAAAGTGACTGGTTTCATTAGGCTCAGTGTCATTCTAACAATAAAATG
RN00767                    NM_012598Lpl     lipoprotein lipase activity; extracellular space; heparin binding; hydr
                                                         catalytic             1.4 24539
          seq00478 CATTATTGCTAATTCATGGCAGTATATACGTACATATCTCAATGATGCTTTGACTTTAAATT
RN00768                    NM_012598Lpl     lipoprotein lipase activity; extracellular space; heparin binding; hydr
                                                         catalytic
          SEQ00478 TAATGTGATGTGTTAGACGTGTGACAGAGGTACGGTCAAGATGAGTCTCAAACGAAATGC1.4 24539
RN00769                    AI237016 H2afy   "H2A histone family, member Y" 29384
                                                         DNA binding; chromosome; chromosome
                                                                      Normalisation
          SEQ00479 CTAGGTTAACTAAGTCAGACACGGTCTGGAACGCAGTGCTTAGCAAGGACAATGC organization an
RN00770                    AI236484         hypothetical gene supported by Y16641
                                                                      Normalisation
          SEQ00480 ACTATTGGCAGCAGTTTCAATGTTATCAAGGTAAATGTGGAATGGAGATGTTCTT          292273
RN00771                    AI236484         hypothetical gene supported by Y16641
          SEQ00480 AGCAAACTTGGTGGTTCTATATTAAAAGGCTGTTAAATAGGGAGATGGCATTCAT          292273
RN00772                    AI236284 Facl4   "fatty acid Coenzyme ANormalisation metabolism; integral
                                                         catalytic activity; fatty acid
                                                                       ligase, long chain 4"
                                                                                    113976
          SEQ00482 TTTCACACTTCAAAGGCAAGATGGGAAGCATGAGAATACTCACATAGAACTTCAGGGA to membra
RN00773                    AI232268 Lrpap1  low density heparin binding
                                                         lipoprotein receptor-related protein associated protein 1
                                                                      Normalisation
          SEQ00483 AAATTAGTCCTTGCCAGCCGCAGCAGGATCAGATCGGTATTTCTCCTTGCCACTG          116565
RN00774                    AI232268 Lrpap1  low density heparin binding
                                                         lipoprotein receptor-related protein associated protein 1
                                                                      Normalisation
          SEQ00483 TTAAGCTCCTCCCTGAACGACTCCAGTTCCTTCTCGGTGAAGTTGGCAGACTGAG          116565
RN00775                    AI232256 omb5    "cytochrome b5, outer mitochondrial membrane isoform"
                                                         electron transporter, transferring electrons
                                                                      Normalisation 80773
          SEQ00485 CTAGCAGCCCAGAAGTGACGATACAGGAAACCTATTAGAATAGCACCCACGATGG within CoQH2-
RN00776                    AI232256 omb5    "cytochrome b5, outer mitochondrial membrane isoform"
                                                         electron transporter, transferring electrons
                                                                      Normalisation 80773
          SEQ00485 GGGAATGAGTGGGAACCAGTGAGAAGAAACCCTGACAAGGACACAACGTGAGCAG within CoQH2-
RN00778                    AI230294         "similar to Fanconi anemia, complementation
          SEQ00488 GGAGTGTGCTAGCATGGAGTAATCTGGCAGGAGCCTACACTGGGCTTGTCgroup E"  6.0 309643
RN00779                    AI229620 Cox5b   cytochromecytochrome-c oxidase activity; electron transport; inner me
                                                          c oxidase subunit Vb 94194
                                                                      Normalisation
          SEQ00489 CTCTTCACAGATGCAGCCCACTATTCTCTTGTTGCTAACGGATGGGACTAGATTG
RN00780                    AI227887 Cdc42   cell division cycle 42 homolog (S. cerevisiae)
                                                                      Normalisation
          SEQ00490 GGGTAGAAAGAAGAAATGGGCAATCTGACTTTCAGTATCTCAACAGAACTGGAGTTCATGT    64465
RN00781                    AI180013 Fcgrt   "Fc receptor, IgG, alpha extracellular space; immune
                                                         IgG binding; chain transporter"
                                                                      Normalisation 29558
          SEQ00491 CAAGTTCCCACCAGGCAATAGGTCGCCAGAGTCATCACCACTGAGAGAAAGCCAT response; integr
RN00782                    AI180013 Fcgrt   "Fc receptor, IgG, alpha extracellular space; immune
                                                         IgG binding; chain transporter"
                                                                      Normalisation 29558
          SEQ00491 CCCTAATGCTCCACTTGACATTGGTAATGGTGTTCATCTCCACGTTTGACCTCTAG response; integr
RN00784                    AI178207 Rps21   ribosomal protein S21 Normalisation
                                                         intracellular; protein biosynthesis; ribosome; structural con
          SEQ00494 TTGAGACAATTCCATCAGCCTTAGCCAATCGGAGAATAGAATCATCTGACTCGCC          81775
RN00785                    AI176589 Rpl27   ribosomal protein L27 Normalisation
                                                         intracellular; protein biosynthesis; ribosome; structural con
          SEQ00495 AAACCATTTGTTCTTCCCTGTCTTGTATCGCTCCTCAAACTTGACCTTGGCCTCC          64306
RN00786                    AI176589 Rpl27   ribosomal protein L27 Normalisation
                                                         intracellular; protein biosynthesis; ribosome; structural con
          SEQ00495 GTGGGCATGAGGTGGTTGTAGTTATAAACTTTCACAAAGGACTTGATCTTGGATCGCTTG     64306
RN00787                    AI176456         metallothionein-2 and metallothionein-1 genes
          SEQ00497 AAAAAGGCTAGGTTCCTACGTTGTTTTATTTACACCATTGTGAGGACGCCCCCAC    12.0
RN00788                    AI175486 Rps7    ribosomal protein S7 Normalisation
                                                         RNA binding; cytosolic 29258
                                                                                    ribosome (sensu
          SEQ00083 CTTGGGCAGAATCCTCCTCTGAGCAATGAAGACTACGTGTTTCCCACTGAACTTT Eukarya); cytosol
RN00790                    AI170268 B2m     beta-2 microglobulin I receptor activity; antigen presentation, endog
                                                         MHC class
          SEQ00500 TCTTTACTTTGTGGATAAATTGTATAGCATATTAGAAACCGGATCTGGAGTTAAACTGG 7.0 24223
RN00791                    AI169370 Tuba1   alpha-tubulin TP binding; microtubule; microtubule-based movement;
                                                         G            Normalisation
          SEQ00501 ATGGCAGCATTGACATCTTTGGGGACCACATCACCACGGTACAGCAGGCAGCAAG          64158
RN00792                    AI169370 Tuba1   alpha-tubulin TP binding; microtubule; microtubule-based movement;
                                                         G            Normalisation
          SEQ00501 GAATCCACACCAACCTCCTCATAATCCTTCTCTAGGGCAGCCATGTCCTCACGGG          64158
RN00793                    AI169327 Timp1   tissue inhibitor of metalloproteinase 1
                                                         C21-steroid hormone biosynthesis; extracellular matrix; m
          SEQ00503 CATTTAAGAGAAAGAAAGATGGAGGAAAGGTAAACAGTGTTCAGGCTTCAGCTTT     2.0 116510
RN00794                    AI169327 Timp1   tissue inhibitor of metalloproteinase 1
                                                         C21-steroid hormone biosynthesis; extracellular
                                                                               2.0 116510
          seq00503 CGAGACCACCTTATACCAGCGTTATGAGATCAAGATGACTAAGATGCTCAAAGGATTCG matrix; m
RN00795                    AI169327 Timp1   tissue inhibitor of metalloproteinase 1
                                                         C21-steroid hormone biosynthesis; extracellular
                                                                               2.0 116510
          seq00503 CTGAGAAGGGCTACCAGAGCGATCACTTTGCCTGCCTGCCACGGAATCCAGATTTGTG matrix; m
RN00796                    AI105050 Atp5b   "ATP synthase, H+ transporting, mitochondrial F1 complex, beta poly
                                                         ATP binding; ATP biosynthesis; ATP synthesis coupled pr
                                                                      Normalisation
          SEQ00504 CAACTCAGCAATAGCACGGGACAGCACAGTAGTAGCATCCAAATGGGCAAAGGTA          171374
RN00797                    AI105050 Atp5b   "ATP synthase, H+ transporting, mitochondrial F1 complex, beta poly
                                                         ATP binding; ATP biosynthesis; ATP synthesis coupled pr
                                                                      Normalisation
          SEQ00504 CGCTGTATCTTCCTTGCCCTGGACAAAGTCAATTTATCTTCCTCAGAAAGTTCATCC        171374
RN00798                    AI104012 Dyrk1a  dual-specificity tyrosine-(Y)-phosphorylation regulated spanning
                                                         ATP binding; neurogenesis; non-membrane
                                                                      Normalisation 25255
          SEQ00506 AAAGTCAGCTTTGCCCTCTCGTAGCGGTTCAGTGTGTTAATCTCCTTCTGATTCAA kinase 1A pro
RN00799                    AI073204 Ywhae   "tyrosine 3-monooxygenase/tryptophan 5-monooxygenase protein do
                                                         intracellularNormalisation
                                                                       signaling cascade; protein binding; activation
          SEQ00507 CATTCTTGCCGACTCCTCCCTCTGACGCAGGTTAGCATTGAAGGTGGTATGGAAG          29753
RN00800                    AI059434 Ppargc1 "peroxisome proliferativecoactivatorreceptor, gamma, coactivator 1"
                                                         transcription activated83516
          SEQ00508 GAGTCAGATAGGGATAGTTTATTGAGCATACGCCCCAGGACTGGTTGAGGCCGAAAAG  6.0 activity
RN00801                    NM_013154Cebpd   "CCAAT/enhancerbinding, protein protein binding; regulation of transc
                                                         DNA binding; nucleus; 25695 delta"
          seq00509 CGTGCCCACCCTAGAGTTGTGCCACGACGAGATCTTCGCCGACCTCTTCA          9.0 (C/EBP)
RN00802                    NM_013154Cebpd   "CCAAT/enhancerbinding, protein protein binding;
                                                         DNA binding; nucleus; 25695
                                                                               9.0 (C/EBP)
          seq00509 GGTAGCGTTTTCTACGTCTTATTACCATTGCAGCTAAGGTACATTGTAGA delta" regulation of transc
RN00803                    NM_013154        CCAAT/enhancerbinding,nucleus;(C/EBP)binding; regulation of transc
                                                         DNA binding; protein protein delta
          SEQ00509 TGAAGAGGTCGGCGAAGATCTCGTCGTGGCACAACTCTAGGGTGGGCACG          9.0
RN00804                    NM_019242Ifrd1   interferon-related developmental regulator 1
                                                         neurogenesis; nucleus 29596
          seq00510 AAAGCACACCTATGACACGTTTAAAGAGGCTCTTGGATCAGGGATGCAGTACCACTTG  6.0
RN00805                    NM_019242Ifrd1   interferon-related developmental regulator 1
                                                         neurogenesis; nucleus 29596
          SEQ00510 CAAGTGGTACTGCATCCCTGATCCAAGAGCCTCTTTAAACGTGTCATAAGTGTGC     6.0
RN00806                    NM_019242Ifrd1   interferon-related developmental regulator 1
                                                         neurogenesis; nucleus 29596
          seq00510 CTCCTTTCTTGTGATGATGTAAACATGAGAATTGCTGCTGGCGAATCTTTGGCACTTC  6.0
RN00807                    AI014135         Mss4 protein                       8.0
          seq00511 ACAACCCGGATAACCATTGTCAATTATCGAATCATAGGTACTAACCCAACAATAAAATTACC
RN00808                    AI014135         Mss4 protein
          SEQ00511 ACCTATCCCTAACTCGTTAGCCCAACACAGGCGTGCTTTAAGGAAAGATTAACAA     8.0
RN00809                    AI014135         Mss4 protein                       8.0
          seq00511 AGACCCATAGATGAAATACTGTTAATATGAGTAACAAGAACCAATTCTCCTAGCACAAGTGT
RN00810                    AI014087 Rps26   ribosomal protein S26 Normalisation
                                                         RNA binding; cytosolic 27139ribosomal subunit (sensu Eu
          SEQ00512 CTGACAACCTTGCTATGAATGGCACAGCTCACGCAGTAGTGCAGCTTGACATAGA          small
RN00811                    AI014020 Ins2    insulin 2 activation of MAPK; extracellular; extracellular space; gluc
          SEQ00513 CTCTTTCAAAGGTTTTATTCATTGCAGAGGGGTGGACAGGGTAGTGGTGGGCCTA     4.0 24506
RN00812                    AI014020 Ins2    insulin 2 activation of MAPK; extracellular; extracellular
                                                                               4.0 24506
          seq00513 GATTCTTCTACACACCCATGTCCCGCCGCGAAGTGGAGGACCCACAAGTGGCACAACT space; gluc
RN00813                    AI014020 Ins2    insulin 2 activation of MAPK; extracellular; extracellular space; gluc
          seq00513 GTGACCTTCAGACCTTGGCACTGGAGGTGGCCCGGCAGAAGCGCGGCATCGTGGATCAG 4.0 24506
RN00814                    AI011706         "similar to Splicing factor, arginine/serine-rich 3 (Pre-mRNA splicing f
                                                                      Normalisation
          SEQ00514 CTTTCATTTGACCTAGATCGGCTACGAGACCTAGAGAAGGATCGAGACGGCTTGT         361814
RN00815                    AI010480 Mor1    "malate dehydrogenase, mitochondrial"
                                                          L-malate dehydrogenase activity; malate dehydrogenase a
                                                                      Normalisation
          SEQ00515 ATTAGACTCTCAAGTAGTTCAATGACATGATGCTGAATAAGTTAGGATGCTGCTGCTGCTGC  81829
RN00816                    AI010480 Mor1    "malate dehydrogenase, mitochondrial"
                                                          L-malate dehydrogenase activity; malate
                                                                      Normalisation81829
          SEQ00515 CTTTGGACTGAACAAAAGAGCACTCGATGACTCCTTCCTTCCCATTCATGGCGTC dehydrogenase a
RN00817                    NM_031116Ccl5    chemokine chemokine activity;5.0 81780 cytokine activity; extracell
                                                          (C-C motif) ligand 5chemotaxis;
          seq00517 AAGTGTGTGCCAACCCAGAGAAGAAGTGGGTTCAAGAATACATCAACTATTTGGAGATGAG
RN00818                    NM_031116Ccl5    chemokine chemokine activity;5.0 81780 cytokine activity;
                                                          (C-C motif) ligand 5chemotaxis;
          SEQ00517 GCTGGTTAGGACTAGAGCAAGCAATGACAGGAAAGCTATACAGGATCAGAATGGAGAG extracell
RN00819                    NM_031116Ccl5    chemokine chemokine activity;5.0 81780 cytokine activity; extracell
                                                          (C-C motif) ligand 5chemotaxis;
          seq00517 TTTACACCAGCAGCAAGTGCTCCAACCTTGCAGTCGTCTTTGTCACTCGAAGGAACCG
RN00820                    AF539810 Gpr40   G protein-coupled receptor 40receptor activity; G-protein
                                                          G-protein coupled 6.0 266607
          SEQ00518 GCTCTCCTTCGCTCTCTATGTATCAGCCTTTGCACTAGGCTTTCCATTGAACTTGTTA coupled rece
RN00821                    AF441118 Bnip3l  BCL2/adenovirus E1B 19 kDa-interacting protein 3-like
          SEQ00519 CTGGGAATCCGTGTGGCCTGTGAAGTGGTGTATTGTAGTTTGAATTTGAGACCTATTG13.0 140923
RN00822                    AF378332 Bcl2a1  BCL2-related protein A1
                                                          apoptosis regulator activity
                                                                             13.0 170929
          SEQ00520 TGTGGATACTTACAAGCAAGTTTCCAGTTTTGTGGCGGAATTCATAATGAATAACACAGG
RN00823                    AF372501 Biklk   Bcl2-interacting killer-like
          SEQ00521 CCACACCCCTGTCTGTGAAGCCTTGAGGCACGGAATCTACTGGACTAGATTCCTTTGG13.0 114496
RN00824                    AF363674         Herbicide binding protein D1
                                                          METABOLISM(UP), PHYSIOLOGICAL
                                                                      Spike
          SEQ00522 GCTTCTCTGATGGTATGCCTTTAGGAATATCTGGTACTTTCAACTTTATGATTGT PROCESS(UP), E
RN00825                    AF363673         20S proteasome subunit alpha 3 CATABOLISM(UP), MACROMOLEC
                                                          MACROMOLECULE
                                                                      Spike
          SEQ00523 TTGATGTGGCTTATGATGCCTACTGCTCTTAGATGGCTTAATCAGTTATTATGCTTCTGTTGT
RN00826                    AF361881 Birc1   Baculoviral anti-apoptosis
                                                          IAP repeat-containing 1
          SEQ00524 CATACCAACAGGGTCAGGGACATCCGCCCATATCTAGAGACAGTTCTACAGATCAAAG13.0 191568
RN00827                    AF356817         Histone H2B-1 METABOLISM(UP), CHROMOSOME ORGANIZATI
                                                          DNA         Spike
          SEQ00525 TTCTATCCAGTATCGTGTTATTTAAGTGAACTAAGAGAACAGAATATTGTATCATCTTCG
RN00828                    AF317633 Casp12  caspase 12induction of apoptosis 156117
                                                                             13.0
          SEQ00527 CAAAGGGATAGCCACTGCTGATACAGATGAGGAATGTGTGTTGAGCCATAGATGGAATAATAGT
RN00829                    AF288372 Casp8   caspase-8 caspase activity 13.0 64044
          SEQ00528 GCACAGCAAGTCAAATCCATGAGGTTCTAGTATCCTATCAAAGCAAGGACCACAAGGG
RN00830                    AF286470 Srebf1  sterol regulatory element Golgi apparatus; cholesterol metabolism; en
                                                          DNA binding; binding factor 1
          SEQ00529 GTCAAAACCAGCCTCCCCAGAGCCTTGCACTTCTTGACACGTTTCTTCCTGAGTAGTG13.0 78968
RN00831                    NM_053812Bak1    BCL2-antagonist/killeractivator activity
                                                          apoptosis 1
          seq00530 AACAGTGTCTTGGGTCAGGTGGGTCGGCAGCTTGCTCTCATCGGAGACGATATTAATC13.0 116502
RN00832                    NM_053812Bak1    BCL2-antagonist/killeractivator activity
                                                          apoptosis 1
          SEQ00530 GTGTGTGATCTACCCTGCCCTCCCACCTCATCTTCCACTATCCCCTCCTTTATCC   13.0 116502
RN00833                    NM_053812Bak1    BCL2-antagonist/killeractivator activity
                                                          apoptosis 1        13.0 116502
          seq00530 TTTTAGTTTTATACTCCCCTCTGGATACAATCCTCCCTTTTCATCCGCTCTGCCCAAAG
RN00834                    AF259503 Bid     apoptotic death agonist BID 13.0 64625
                                                          apoptosis activator activity
          SEQ00531 CCAGAACCTATTCTCCTACGTGAGGGACTTGGTTAGAAATGAGATGGACTGAGGGTGC
RN00835                    AF252627 Atf4    activating transcription factor ATF-4
          SEQ00532 CGACCCAAACCTTATGACCCACCTGGAGTTAGTGTGACAGCTAAAGTGAAGACTGAAA 9.0 79255
RN00836                    AF246634 Nfkbib  I-kappa-B-beta transduction9.0 81525
                                                          signal
          SEQ00533 AAACAGCCCTGCACCTAGCAGCCATCCTTGGAGAGGCATCTACAGTAGAGAAACTCTA
RN00837                    AF244366 Cflar   CASP8 and FADD-like apoptosis regulator
          SEQ00534 TTTAAAGTTGTTCACTCCCACCTCGTAGAACCCATGTCCCACTTCCTTTCCATTAAGG13.0 117279
RN00838                    AF218388 Apaf1   apoptotic protease activating 13.0 78963
                                                          ATP binding; apoptosis; 1
                                                                             factor apoptosis regulator activity; intrac
          SEQ00535 GTTACTGGGGAGTCCTCACAGACCTTCTACACCAATGGAACAAACCTCAAGAAAATACA
RN00839                    NM_022522Casp2   caspase 2 apoptosis; apoptosis regulator activity; caspase
                                                                             13.0 64314
          seq00536 GATGAAGTAAGTCTTCTGTACCTCCTTAGGATGGCATCATGTTGGTCCTTGTGCTTAC activity; cy
RN00840                    NM_022522Casp2   caspase 2 apoptosis; apoptosis regulator activity; caspase
                                                                             13.0 64314
          SEQ00536 GGTCACAGACTCCTGCATAGTAGCACTCCTCTCACATGGTGTGGAAGGTGGCATCTAC activity; cy
RN00841                    NM_022522Casp2   caspase 2 apoptosis; apoptosis regulator activity; caspase activity; cy
          seq00536 GTTCCCTTTGGATCTCATTAGATGGTGATTTCTCTCTGTGTTCAGCCCCTCAGTTCCT13.0 64314
RN00842                    AF130881 Ryr3    ryanodine receptor 3
                                                          calcium channel activity; integral to membrane;
                                                                              3.0 170546
          SEQ00537 AAGTTCCATCGACATGAAGTACCATATTTGGAAGCTAGGGGTGGTTTTCACTGACAAC ion chann
RN00843                    XM_341548Ryr2    ryanodine receptor type II
          SEQ00538 ACAGAATCAGCGAGCTTCTGGGCATGGATAAGGTCGCACTGGATTTCAGC         3.0 84025
RN00844                    XM_341548Ryr2    ryanodine receptor type II
          seq00538 GTTAACTGTTGGCTTGTTGGCTGTTGTTGTATACCTGTACACTGTTGTGGCGTTCAATT3.0 84025
RN00845                    XM_341548Ryr2    ryanodine receptor type II
          seq00538 TCCTTCCTCTACCTAGCCTGGTATATGACCATGTCTGTTCTTGGACACTACAACAACT 3.0 84025
RN00846                    AF115380 Mcl1    myeloid cell leukemia sequence 1 60430
          SEQ00539 CATGTTTTCAAAGATGGCGTAACAAACTGGGGCAGGATTGTGACTCTTATTTCTT   13.0
RN00847                    AF115282 Ikbkb   "inhibitor of kinase light polypeptide84351 enhancer in B-cells, kinase b
                                                          kappa activity
          SEQ00540 CTACGCATCCTGAGTCCCAAAGATTACCTGGAGTCAACTGTCATGGAGAGAAATGGAA 9.0 gene
RN00848                    AF112256 Ryr1    ryanodine receptor 1 (skeletal)3.0 114207
          SEQ00541 CAGACAAACCTTATCAACTACGTCACCAGCATCCGTCCCAACATCTTTGTGGGCCGAG
RN00849                    NM_053777Mapk8ip mitogen activated protein kinase 8 116457
                                                          anti-apoptosis; apoptosis inhibitor activity; signal
                                                                              6.0 interacting protein
          SEQ00542 GAGTCTGTGGGGCGTGCATTTCAGCAGTTCTACAAGCAATTTGTGGAATATACCTGTC transduc
RN00850                    NM_053777Mapk8ip mitogen activated protein kinase 8 116457
                                                          anti-apoptosis; apoptosis inhibitor activity; signal
                                                                              6.0 interacting protein
          seq00542 GGGCAGGGGTTTGGGGAGAGGCAGATGCAGTTTATTGTAATATATGGGGTTAGATTAAT transduc
RN00851                    NM_053777Mapk8ip mitogen activated protein kinase 8 116457
                                                          anti-apoptosis; apoptosis inhibitor activity; signal transduc
                                                                              6.0 interacting protein
          seq00542 GGGCGTGCATTTCAGCAGTTCTACAAGCAATTTGTGGAATATACCTGTCCTACAGAAGATAT
RN00852                    NM_053777Mapk8ip mitogen activated protein kinase 8 116457
                                                          anti-apoptosis; apoptosis inhibitor activity; signal
                                                                              6.0 interacting protein
          seq00542 GGGTGTCAAGATAGGTGTCAAAGCTGATGAAGCTCAGGAGGCCAAGGGAAATAAATGT transduc
RN00853                    NM_053777Mapk8ip mitogen activated protein kinase 8 116457
                                                          anti-apoptosis; apoptosis inhibitor activity; signal transduc
          seq00542 TTAATCTATGGAGGACAGTACAGGCTCTCTCGGGGCTGGGGAAGGGCAGGGCTGGGGTG6.0 interacting protein
RN00854                    AF096835 Eif2ak3 eukaryotic translation initiation factor 2 alpha kinase 3
                                                          protein serine/threonine kinase activity
                                                                             13.0 29702
          SEQ00543 GCCTAACCCAGTTTGATCTTAACTAAACTTCAAGGAAAGGGCTATATAAATGACAAGTGG
RN00855                    AF096291 Bcl2l2  Bcl-w protein apoptosis inhibitor activity
          SEQ00544 CGGGCTCTAGTGGCTGACTTTGTAGGCTATAAGCTGAGGCAGAAGGGTTATGTCT   13.0 60434
RN00855                    AF096291 Bcl2l2  Bcl-w protein apoptosis inhibitor activity
          SEQ00544 CGGGCTCTAGTGGCTGACTTTGTAGGCTATAAGCTGAGGCAGAAGGGTTATGTCT   13.0 60434
RN00856                    NM_057186Hadhsc  "L-3-hydroxyacyl-Coenzyme A 1.4 113965
                                                                               dehydrogenase, short chain"
          seq00545 AGTTACGGTAATGGGGTTCTTCCACTGATATCTAATTCTCTAGTTTAGTCTGTTCTCTGTGA
RN00857                    NM_057186Hadhsc  "L-3-hydroxyacyl-Coenzyme A 1.4 113965
          seq00545 GATTTATCGTGAACCGTCTCTTGGTGCCATACCTCATAGAAGCTATCCGGCTGCATGA  dehydrogenase, short chain"
RN00858                    NM_057186Hadhsc  "L-3-hydroxyacyl-Coenzyme A 1.4 113965
          SEQ00545 GCTTCTTGACTATGTTGGACTGGATACTACAAAGTTCATCTTAGACGGGTGGCACGAAA dehydrogenase, short chain"
RN00858                    NM_057186Hadhsc  "L-3-hydroxyacyl-Coenzyme A 1.4 113965
          SEQ00545 GCTTCTTGACTATGTTGGACTGGATACTACAAAGTTCATCTTAGACGGGTGGCACGAAA dehydrogenase, short chain"
RN00859                    NM_057186Hadhsc  "L-3-hydroxyacyl-Coenzyme A 1.4 113965
          seq00545 TTATCGTGAACCGTCTCTTGGTGCCATACCTCATAGAAGCTATCCGGCTGCATGAGCG  dehydrogenase, short chain"
RN00860                    AF093773 Mdh1    malate dehydrogenaseNormalisation
                                                          malate dehydrogenase24551
                                                                       1
          SEQ00546 GTAATCTCTGATGGCAACTCCTATGGTGTCCCTGATGACCTGCTCTACTCGTTCC         activity
RN00861                    AF086624 Pim3    serine threonine binding;pim3 6.0 64534
                                                          ATP kinase autophosphorylation; cAMP-dependent prote
          SEQ00547 AGAGTCTCAAGCCCTTAATTTATTTTAGCAACTGTGTTCTGTGACCCTGGTGTGA
RN00862                    AF086624 Pim3    serine threonine binding;pim3 6.0 64534
                                                          ATP kinase autophosphorylation; cAMP-dependent prote
          seq00547 ATTTTCTGCCTGGGATGTCTCCTGCAAAAGCAGTGACCTCTGACCCCTGGTGACCTTT
RN00863                    AF086624 Pim3    serine threonine binding;pim3 6.0 64534
                                                          ATP kinase autophosphorylation; cAMP-dependent prote
          seq00547 CCATGTTTGTGGGAGGAGGAATTTGTACAGTGGCTAATTTAAGGGGAGTGGGAGACCC
RN00864                    AF086624 Pim3    serine threonine binding;pim3 6.0 64534
                                                         ATP kinase autophosphorylation; cAMP-dependent prote
          seq00547 CCCTCCAGTCTCCTGGTCTTCGTCTGGGCATGTCTGCACAAGCAATGCAACGCTGGGC
RN00865                    AF086624 Pim3    serine threonine binding;pim3 6.0 64534
                                                         ATP kinase autophosphorylation; cAMP-dependent prote
          seq00547 CTGGTGTGAGTAGGCATCAGGGGTGGGGTTGTATAAGTTCAAAAGTGTGAAATGTCTG
RN00866                    AF083269 Arpc1b  "actin related protein 2/3 complex, 54227 1B"
                                                         Arp2/3 protein complexsubunit
                                                                      Normalisation
          SEQ00548 CCTGTGACTTCAAGTGCAGGATCTTCTCTGCCTATATCAAGGAGGTGGAGGAACG
RN00867                    AF083269 Arpc1b  "actin related protein 2/3 complex, 54227 1B"
                                                         Arp2/3 protein complexsubunit
                                                                      Normalisation
          SEQ00548 GATGTGAAGAGCTTGGAGTCAGCCTTGAAGGACCTGAAGATCAGATGAGCTGTGA
RN00868                    NM_031589G6pt1   "glucose-6-phosphatase,reticulum;29573 1"
                                                         endoplasmic transport protein metabolism;
                                                                             15.0 glucose
          seq00550 CCTTTACATATCTGTGTCTACACTGTCTCTCTGGACCTCCGTGGTGCTGCAAGTTACC glycogen me
RN00868                    NM_031589G6pt1   "glucose-6-phosphatase,reticulum;29573 1"
                                                         endoplasmic transport protein metabolism;
                                                                             15.0 glucose
          seq00550 CCTTTACATATCTGTGTCTACACTGTCTCTCTGGACCTCCGTGGTGCTGCAAGTTACC glycogen me
RN00869                    NM_031589G6pt1   "glucose-6-phosphatase,reticulum;29573 1"
                                                         endoplasmic transport protein metabolism;
                                                                             15.0 glucose
          seq00550 GCTGTATTTGGTTTCTCTTCTTATGGTCCCATTGCCTTGTTTGGAGTCATAGCTAATG glycogen me
RN00869                    NM_031589G6pt1   "glucose-6-phosphatase,reticulum;29573 1"
                                                         endoplasmic transport protein metabolism;
                                                                             15.0 glucose
          seq00550 GCTGTATTTGGTTTCTCTTCTTATGGTCCCATTGCCTTGTTTGGAGTCATAGCTAATG glycogen me
RN00870                    NM_031589G6pt1   "glucose-6-phosphatase,reticulum;29573 1"
                                                         endoplasmic transport protein metabolism; glycogen me
          SEQ00550 GGAGCTGTATTTGGTTTCTCTTCTTATGGTCCCATTGCCTTGTTTGGAGTCATAG   15.0 glucose
RN00871                    NM_053565Cish3   cytokine inducible SH2-containing 89829 3
                                                         JAK-STAT cascade; protein kinase cascade; regulation of
          SEQ00551 CAAGAGAGCTTACTACATCTATTCTGGGGGCGAGAAGATCCCGCTGGTACTGAGCCGA  6.0 protein
RN00872                    NM_053565Cish3   cytokine inducible SH2-containing 89829 3
                                                         JAK-STAT cascade; protein kinase cascade; regulation of
          seq00551 CCTTTCTTATCCGCGACAGCTCGGACCAGCGCCACTTCTTCACACTGAGCGTCGAGAC  6.0 protein
RN00873                    NM_053565Cish3   cytokine inducible SH2-containing 89829 3
                                                         JAK-STAT cascade; protein kinase
                                                                               6.0 protein
          seq00551 CGGATTCTACTGGAGTGCCGTAACCGGCGGCGAGGCGAACCTGCTGCTCA cascade; regulation of
RN00874                    NM_053565Cish3   cytokine inducible SH2-containing 89829 3
                                                         JAK-STAT cascade; protein kinase cascade; regulation of
          seq00551 CTCTCCTCCGAGGCACATGGCACAAGCACAAAAATCCAGCCCCAATGGTCGGTAGCTC  6.0 protein
RN00875                    NM_053565Cish3   cytokine inducible SH2-containing 89829 3
                                                         JAK-STAT cascade; protein kinase
                                                                               6.0 protein
          seq00551 TTCTTATCCGCGACAGCTCGGACCAGCGCCACTTCTTCACACTGAGCGTC cascade; regulation of
RN00876                    AF075382 Cish2   cytokine inducible SH2-containing 84607 2
          SEQ00552 CGCCAGAAGGAACTTTCTTGATTAGAGATAGCTCCCACTCAGACTACCTATTAACCAT  6.0 protein
RN00877                    NM_022260Casp7   caspase-7 caspase activity 13.0 64026
          seq00553 ATGGGCAAATGTATCATCATAAATAACAAGAACTTCGACAAAGCGACAGGTATGGACG
RN00878                    NM_022260Casp7   caspase-7 caspase activity 13.0 64026
          seq00553 GGAATGGGACGGACAAAGACGCAGAGGCCCTCTTCAAGTGCTTCCGAAGC
RN00879                    NM_022260Casp7   caspase-7 caspase activity 13.0 64026
          seq00553 GGAATGGGACGGACAAAGACGCAGAGGCCCTCTTCAAGTGCTTCCGAAGCCTGGGTTT
RN00880                    NM_022260Casp7   caspase-7 caspase activity 13.0 64026
          SEQ00553 GGAGAAGAGAATCTGATTTATGGGAAAGACGGCGTGACACCGATAAAGGATCTGACAG
RN00881                    NM_022260Casp7   caspase-7 caspase activity 13.0 64026
          seq00553 TGTATCATCATAAATAACAAGAACTTCGACAAAGCGACAGGTATGGACGT
RN00882                    AF067795 Ctbp1   C-terminal binding protein 1
                                                                      Normalisation
          SEQ00554 CAAGTTGATTGTAGTTGTCCCGTCCTGTGGGCTGGCTCACTGTCCTGTGTCCTTT         29382
RN00883                    NM_022612Bcl2l11 BCL2-like 11 (apoptosis facilitator)64547
                                                         apoptosis; induction of apoptosis; membrane; protein hete
          seq00555 ATCGGAGACGAGTTCAATGAGACTTACACGAGGAGGGCGTTTGCA             13.0
RN00884                    NM_022612Bcl2l11 BCL2-like 11 (apoptosis facilitator)64547
                                                         apoptosis; induction of apoptosis; membrane; protein hete
          seq00555 TGGTTATCTTACAACTGTTACGATTCATCTTCCGTCTGGTATGGAGAAGGCATTGA  13.0
RN00885                    AF053312 Scya20  small inducible cytokine subfamily 29538
                                                                               5.0 A20
          SEQ00556 AATATTTAATGTTCTTCTGTGTGCTTAATTGTTTCTTAAATTGATACGATTTACTTATAAA
RN00886                    NM_013132Anxa5   annexin 5 blood coagulation; calcium ion binding; calcium-dependen
          SEQ00557 CCTACTCCTGACCGACAGCATCATGGCTCTCAGAGGCACCGTGACTGACTTCTCT     6.0 25673
RN00887                    NM_013132Anxa5   annexin 5 blood coagulation; calcium ion binding; calcium-dependen
          seq00557 GAACTTGGAGAACTTACTCCTGGCTGTCGTGAAGTCTATTCGGAGCATACCTGCCTAC  6.0 25673
RN00888                    NM_013132Anxa5   annexin 5 blood coagulation; calcium ion binding; calcium-dependen
                                                                               6.0 25673
          seq00557 TTTGACAAGTACATGACAATATCAGGATTTCAGATTGAGGAAACCATTGACCGAGAGACCT
RN00889                    NM_031353Vdac1   voltage-dependent anion channel 1
                                                         anion channel activity; mitochondrial calcium ion transport
          SEQ00558 CAAGTACAGATGGACCGAGTATGGGCTGACGTTTACTGAGAAGTGGAACACAGAC     3.0 83529
RN00890                    NM_031353Vdac1   voltage-dependent anion channel 1
                                                         anion channel activity; mitochondrial calcium
                                                                               3.0 83529
          seq00558 CATCGTGCCCTGTTCCCATCCTAGCCCATCAGTTACCTGTTTTACACCAAAAGTAGTC ion transport
RN00891                    NM_031353Vdac1   voltage-dependent anion channel 1
                                                         anion channel activity; mitochondrial calcium ion
                                                                               3.0 83529
          seq00558 CTCCAGGCTAAGGATGACTCGGCTTTAAGGTGTTTACCGTTTCAGAGGTACAGCGGAAA transport
RN00892                    AF047707 Ugcg    UDP-glucose:ceramide glycosyltransferase
                                                         ceramide glucosyltransferase activity
          SEQ00559 ACAGTATCCTTCAGTAGGGAAAGTTTCTTACCTGAGTTACTCACTCTGAGGTCCGCAC  1.4 83626
RN00893                    NM_031841Scd2    stearoyl-Coenzyme A desaturase 2
          SEQ00560 CAGTGAGTACCGCTGGCACATCAACTTCACCACGTTCTTCATCGACTGCATGGCC     1.4 83792
RN00894                    NM_031841Scd2    stearoyl-Coenzyme A desaturase 2
          seq00560 CCCACTCTGACAATAATGAGTTCACTCCTTGGATAAGGTTGTTAATGAGGGAAGAGCCC 1.4 83792
RN00895                    NM_031841Scd2    stearoyl-Coenzyme A desaturase 2
          seq00560 TTCTTCCTGGTTTGCTAGTGTTCTGCGTGTCTTCTTTAGTTGAAATAGGTTAGTGGAGA 1.4 83792
RN00896                    AF031657         Zinc-finger protein 94
          SEQ00561 GACAAACCGTATCAGTGCTCAGAGTGTGGGAAGGGCTTCAGTGTAGAGTCTCACC     9.0
RN00897                    AF0303585Cx3cl1  chemokine (C-X3-C motif) ligand 1 (Cx3cl1)
          SEQ00562 CTGCCCTGCCTGAAGAACAAGCCACAGAAGGAAGATTATGACAAGTCCCTGGGAG     5.0
RN00898                    AF029240         Rattus norvegicus chromosome 20, major histocompatibility complex,
                                                         RESPONSE TO EXTERNAL STIMULUS(UP), PHYSIOLO
          SEQ00563 CTGGAGAGATAGCTCAGTGGTTAAGAGTGTTTGCTGCTTCATGGGTGGTGGTGGT     7.0
RN00899                    NM_017312Bok     Bcl-2-related ovarian killer protein 29884
                                                         apoptosis activator activity
          seq00564 ACGTCCTCAAGTGTGTGGTCAGCACAGACCCTGGCTTCCGCTCCCACTGGCTCGTGGC13.0
RN00900                    NM_017312Bok     Bcl-2-related ovarian killer protein 29884
                                                         apoptosis activator activity
          SEQ00564 GCCACATCTTCTCAGCAGGTATCACATGGGGCAAGGTAGTGTCCCTGTACTCGGT   13.0
RN00901                    NM_017312Bok     Bcl-2-related ovarian killer protein 29884
                                                         apoptosis activator activity
          seq00564 GTCTTCGCTGCGGAGATCATGGACGCCTTTGATCGCTCGCCCACAGACAAGGAGCTGG13.0
RN00902                    NM_031775Casp6   caspase 6
          seq00565 AAGAACTACTGCTCAAGATTCACGAGGTGTCGACTTCCAGCCACGTAGATGCCGATTG13.0 83584
RN00903                    NM_031775Casp6   caspase 6
          seq00565 CATCAGACAGACAAGCTGGACGACAACGTGACCCAGGTGGATGCTGCCTCGGTGTACA13.0 83584
RN00904                    NM_031775Casp6   caspase 6
          SEQ00565 GATTCACGAGGTGTCGACTTCCAGCCACGTAGATGCCGATTGCTTCCTGTGTGTCTTC13.0 83584
RN00905                    XM_342006Vegfb   vascular endothelial growth factor B
                                                         cell growth and/or maintenance; cell proliferation; growth f
          SEQ00566 CATGGAATTCATGGGTAATGTGGTCAAACAATTCGTGCCAAGCTGTGTGACTGTG     4.0 89811
RN00906                    XM_342006Vegfb   vascular endothelial growth factor B
                                                         cell growth and/or maintenance; cell proliferation; growth f
          seq00566 CATTGGGCAACACCAAGTCCGAATGCAGATCCTCATGATCCAGTACCCGAGCAGTCAG  4.0 89811
RN00907                    XM_342006Vegfb   vascular endothelial growth factor B
                                                         cell growth and/or maintenance; cell proliferation;
                                                                               4.0 89811
          seq00566 GGTGGTGGTACCTCTGAGCATGGAACTCATGGGTAATGTGGTCAAACAACTCGTGCCC growth f
RN00908                    NM_031743Slc24a2 "solute carrier family 24 (sodium/potassium/calcium exchanger), mem
                                                         antiporter activity; calcium ion transport;
                                                                               3.0 84550
          SEQ00567 AGTTTCTTCATAATAGATATGTAAATAACGGAGCCTTGGACACTGACGGGTCTCT integral to membr
RN00909                    NM_031743Slc24a2 "solute carrier family 24 (sodium/potassium/calcium integral
                                                         antiporter activity; calcium ion transport; exchanger), mem
                                                                               3.0 84550
          seq00567 GCATTGATTATTGGGAGGAAGTCATTTCAAATGGGAGGTCAGAGAAAGGCTTGGGCTC to membr
RN00910                    NM_031743Slc24a2 "solute carrier family 24 (sodium/potassium/calcium integral
                                                         antiporter activity; calcium ion transport; exchanger), mem
                                                                               3.0 84550
          seq00567 TTTCCCTTCGGTTGCAGTTTCTTCATAATAGATATGTAAATAACGGAGCCTTGGACACT to membr
RN00911                    AF017437 Cd47    integrin-associated protein
                                                         cell migration        8.0 29364
          SEQ00568 GGGAAAGTTTGGTATATTAACACTCAAATACAAGTCCAGCCATACGAATAAGAGAATCATTC
RN00912                    NM_133578Cpg21   MAP-kinase phosphatase (cpg21) 171109
                                                         MAP kinase phosphatase activity
          seq00569 CTTGAACCTGTCCCATTGTATCTCTCCCTAAAGCACCTCTGGTGTCATTCAGAAAGTT  6.0
RN00913                    NM_133578Cpg21   MAP-kinase phosphatase (cpg21) 171109
                                                         MAP kinase phosphatase activity
          SEQ00569 GGAGGAGTCCGCCCGTCTGGGAGGAAGCACAAGTTTCACTGTTAATTTGAATTTC     6.0
RN00914                    NM_133578Cpg21   MAP-kinase phosphatase (cpg21) 171109
                                                          MAP kinase phosphatase activity
          seq00569 GGGAGGAGTCCGCCCGTCTGGGAGGAAGCACAAGTTTCACTGTTAATTTGAATTTCGG   6.0
RN00915                    AF003523 Bad     bcl-2 associated deathapoptotic program; induction of
                                                          apoptosis; agonist   13.0 64639
          SEQ00570 GAGACCAGCAGCCCAGAGTATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAG programmed ce
RN00916                    NM_031642Copeb   core promoter element binding9.0 perinuclear space; regulation
                                                          DNA binding; nucleus; 58954
                                                                                  protein
          seq00571 AAAAGCAGTTTGAATGTTTTGTGTGTGAGGAGTATTCCAAGGGATGAGTTGACCACCAATC of tra
RN00917                    NM_031642Copeb   core promoter element binding9.0 perinuclear space; regulation of tra
                                                          DNA binding; nucleus; 58954
          seq00571 AATGGGTGGGAATGACTGACTGTATGTTGAGGATCTATTACTGACTGTATGGCGAGGC     protein
RN00918                    NM_031642Copeb   core promoter element binding9.0 perinuclear space;
                                                          DNA binding; nucleus; 58954
                                                                                  protein
          SEQ00571 GGAATGACTGACTGTATGTTGAGGATCTATTACTGACTGTATGGCGAGGCAGACT regulation of tra
RN00919                    AF000139 Cyp27b1 "cytochrome P450, subfamily 27b, 114700
                                                          calcidiol 1-monooxygenase activity; 1"
          SEQ00572 GTACCTGAGAGGAGCATCCATCTCCAGTTTGTAGACAGATAGTCCTGTGGAAGGCAGC   4.0 polypeptide electron transport; me
RN00920                    NM_053437Dgat1   diacylglycerol O-acyltransferase 1 84497
                                                          acyltransferase activity; diacylglycerol O-acyltransferase a
          seq00573 CAACCATCTGATATGGCTCATCTTCTTCTATTGGCTTTTCCACTCATGTCTCAATGCTGTG1.4
RN00921                    NM_053437Dgat1   diacylglycerol O-acyltransferase 1 84497
                                                          acyltransferase activity; diacylglycerol O-acyltransferase a
          seq00573 GATCTCTATTACTTCATCTTTGCTCCTACTTTGTGTTATGAACTCAACTTTCCTCGATCCC1.4
RN00922                    NM_053437Dgat1   diacylglycerol O-acyltransferase 1 84497
                                                          acyltransferase activity; diacylglycerol O-acyltransferase a
          SEQ00573 TCTCTATTACTTCATCTTTGCTCCTACTTTGTGTTATGAACTCAACTTTCCTCGATCCC  1.4
RN00923                    NM_031356Pdcd8   programmed cellfragmentation; apoptotic chromosome condensation
                                                          DNA death 8 (apoptosis-inducing factor)
          seq00574 GAAATAGATTCCGATTTTGGTGGCTTCCGGGTAAATGCAGAGCTTCAAGCACGTTCTAA 13.0 83533
RN00924                    NM_031356Pdcd8   programmed cellfragmentation; apoptotic chromosome condensation
                                                          DNA death 8 (apoptosis-inducing factor)
          seq00574 GATCACGCTGTTGTGAGTGGAAGACTGGCTGGAGAAAATATGACTGGAGCTGCTAAGC  13.0 83533
RN00925                    NM_031356Pdcd8   programmed cellfragmentation; apoptotic chromosome condensation
                                                          DNA death 8 (apoptosis-inducing factor)
          SEQ00574 TGGCAAGTTACTCATTAAGCTAAAGGACGGAAGGAAGGTAGAAACTGACCACATAGTA  13.0 83533
RN00926                    AB012933 Facl5   "fatty acid Coenzyme A ligase,1.4acid metabolism; ligase activity; long
                                                          catalytic activity; fatty 94340 5"
          SEQ00575 AAACCAGTGTGTAAAGAAAGCCATTTTAGAAGATTTGCAGAAAGTTGGGAAAGAAGGTGG  long chain
RN00927                    AB011365 Pparg   "peroxisome proliferator activated receptor, gamma"
                                                          DNA binding; adipocyte differentiation; cytosol;
                                                                                6.0 25664
          seq00576 CATATTTATAGCTGTCATTATTCTCAGTGGAGACCGCCCAGGCTTGCTGAACGTGAAG inflammato
RN00928                    AB011365 Pparg   "peroxisome proliferator activated receptor, gamma"
                                                          DNA binding; adipocyte differentiation; cytosol;
                                                                                6.0 25664
          SEQ00576 GACCAAAGCCAAGGCGAGGGCGATCTTGACAGGAAAGACAACAGACAAATCACCATTT inflammato
RN00929                    AB011365 Pparg   "peroxisome proliferator activated receptor, gamma"
                                                          DNA binding; adipocyte differentiation; cytosol; inflammato
          seq00576 TCTACGACATGAATTCCTTAATGATGGGAGAAGACAAAATCAAGTTCAAACATATCACCCC6.0 25664
RN00930                    NM_019354Ucp2    uncoupling binding;2inner membrane; integral to membrane; membra
                                                          protein
          seq00577 CGGACCCTGCACCCTCAGTCCTGCTAACAGTTAAGCCCAAATCTTTTGTCCTCATTCC   6.0 54315
RN00931                    NM_019354Ucp2    uncoupling binding;2inner membrane; integral to membrane; membra
                                                          protein
          seq00577 TACTCTCCTGAAAGCCAACCTCATGACAGACGACCTCCCTTGCCACTTCACTTCTGCC   6.0 54315
RN00932                    NM_019354Ucp2    uncoupling binding;2inner membrane; integral to membrane;
                                                          protein               6.0 54315
          SEQ00577 TCGGAGATACCAGAGCACTGTCGAAGCCTACAAGACCATTGCACGAGAGGAAGGGATC membra
RN00933                    AB009999 Cds1    CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1
                                                          endoplasmic reticulum;81925
                                                                                1.4 endoplasmic reticulum
          SEQ00578 TCACAGCGTGTATATTAAAGTGGACTATACTTCAGCAAGCAATCATCCTAAGAGCCATGTmembrane
RN00934                    AB006450 Timm17a translocatorinner membrane; integral to membrane; intracellular prote
                                                           of inner mitochondrial 54311
                                                                       Normalisation
          SEQ00579 AGAGTGTGGAAAAGATACCGAGTTTATTTATTCATGCTTGGATTGCGTCTGTGATC          membrane 17a (yeast)
RN00935                    AB006450 Timm17a translocatorinner membrane; integral to membrane; intracellular prote
                                                           of inner mitochondrial 54311
                                                                       Normalisation
          SEQ00579 TGTATATGAACTTAGAAGATAAAGGACCAAAGGCCACATAACAGTGAAATTCGACT          membrane 17a (yeast)
RN00936                    NM_053922Acacb   acetyl-Coenzyme A carboxylase beta
          seq00581 CACATGCTGAAGAAGGGAATCATTTCTGATGTCCTGGAGTGGAAGACCACACGTACTTA  1.4 116719
RN00937                    NM_053922Acacb   acetyl-Coenzyme A carboxylase beta
          seq00581 CAGTCTCCGTCTGTCCAAGCAGCCAGTCCTCATCTATATCCCTCCCGGTGCCGAACTC   1.4 116719
RN00938                    NM_053922Acacb   acetyl-Coenzyme A carboxylase beta
          SEQ00581 CGGAAGAAAGATTTGGTGAAGACCATAAGGAGGATTGACCCAGTGTGCAAGAAACTCC   1.4 116719
RN00939                    AB003505 Smarcd2 "SWI/SNF related, matrix associated, actin dependent regulator of ch
          SEQ00582 CTACTCCCCAGCTTTAGTTTCATAAGTGTAGTTTTAGAGTCCTCACTGCTTGGTCCCC   9.0 83833
RN00940                    AB000778 Pld1    phospholipase D1
                                                          Golgi apparatus; catalytic activity; endoplasmic reticulum;
          SEQ00583 GATCTCTCCTTTGCTTGTACTGTCAACTACATAGTAACATTCCAACATAGCTTCCAA    1.4 25096
RN00941                    AB000362 Cirbp   cold inducible RNA-binding protein81825
                                                          RNA binding; nucleic acid binding; nucleus;
                                                                               12.0
          SEQ00584 CATGATGGCTATGAATGGGAAGTCTGTGGATGGGAGGCAGATCCGAGTTGACCAG response to c
RN00942                    AA964379 Ap2b1   "adaptor-related protein complex 2,coated pit; transporter activity
                                                          AP-2 adaptor complex;140670 subunit"
                                                                       Normalisation
          SEQ00585 AGTTAAGAGTTCGTGGCTTGCACTGATTACAGGCTGACTGGACCCATTTATTAGT             beta 1
RN00943                    AA957896 Map2k2  mitogen activated proteinkinase activity; 2
                                                          ATP binding; kinase kinase protein amino
                                                                                6.0 58960
          SEQ00586 TCTGCACGCTCTGCTGGGTTCTTAATGAGACATTTATTCACAAACTCCTGGAAGTC acid phosphory
RN00944                    AA945806 Rps14   ribosomal protein S14 Normalisation
                                                          RNA binding; cytosolic 29284
                                                                                     ribosome (sensu
          SEQ00587 CATACGGAGAGGACTCATCTCGGTCAGCCTTCACCTTCATTCCACCAGTTACTCGEukarya); cytosol
RN00945                    AA945806 Rps14   ribosomal protein S14 Normalisation
                                                          RNA binding; cytosolic 29284
                                                                                     ribosome (sensu Eukarya);
          SEQ00587 CCAGAAAGATCAGTAACATGGACAAAGGTATCATTGAAGGATGCAAAGATGTGGCAGACAC cytosol
RN00946                    AA945611 Rpl10   ribosomal protein L10 Normalisation
                                                          intracellular; protein biosynthesis; ribosome; structural con
          SEQ00589 TGTGAGATTTATTATTGAACATGATTTGATAGGGTATAGGAGAGCACTGTGGAAGCCTTC      81764
RN00947                    AA944073         mus                        Normalisation
          SEQ00590 CGACCTCCACATTTACTCTCATCACAGCAGACTAACGGCAATTTCTTCCCTTTCTTTCTA
RN00948                    AA924130 Tlr3    toll-like receptor 3
          SEQ00591 TCCCTTCACTGACTCCAAATCTTCAAATAAGTTTAATGTGCTGAATTCCGAGACCCAAGT 5.0 364594
RN00949                    AA900503 Jag1    jagged 1 Notch binding; negative regulation of cell differentiation
          seq00592 CCTTGATAGCATCACTTTAAGACACATTCTAAGGACTGACTGAGGCAGATTGAGAATT   6.0 29146
RN00950                    AA900503 Jag1    jagged 1 Notch binding; negative regulation of cell differentiation
          SEQ00592 TCAGAATGTGACTGGTTGGATCTCATTAAAAGTATCAGATTGTGTGAAGTTGGAAGCT   6.0 29146
RN00951                    AA900503 Jag1    jagged 1 Notch binding; negative regulation of cell differentiation
          seq00592 TTTCACCATTCGTATGTAATGCTGAACCACTTGTAGATTTGATTTCATTGTTGTTGTCT  6.0 29146
RN00952                    AA893667         mus
          SEQ00593 GGAAGGATAGAGGTCAATTCATTCTTCTCTCAGACTCGCTCTCATCCACTGGGTG      2.0
RN00953                    AA893183                                     5730453I16
                                            similar to RIKEN cDNANormalisation
          SEQ00594 GCCTGTGAGATCTAATGTGAAGAGAGACACAACATGTGAGATGGGACTTGGTGTG
RN00954                    AA893183                                     5730453I16
                                            similar to RIKEN cDNANormalisation
          SEQ00594 GCCTTGACCTTTTGAGGACTGGGATGCTTTTCTCCTTTTGCTATGAGGAATAAAACT
RN00955                    AA893080         similar to selenocysteine lyase2.0 363285
          SEQ00596 AAAGTGTCCTCCAAGAAGACATTTCCTATATAAACATGGGTGTGATGTGTGCCAC       SCLY
RN00956                    AA892842         similar to capping protein alpha 2 subunit
                                                                       Normalisation
          SEQ00597 GAATGAGACCACAAGTCCACCAACTCCTTTATAGTAAATGCCGACGTTCACCGAG           368086
RN00957                    AA892649 Gabarap gamma-aminobutyric acid receptor58974
                                                          Golgi apparatus; actin cytoskeleton;protein
                                                                       Normalisation
          SEQ00598 CAGAAGTCTAAAGCAGAGTGGGAATGGAGGGTAAACAAGGGGAAAGAGAGATGTA            associated lysosome; microtubul
RN00958                    AA892649 Gabarap gamma-aminobutyric acid receptor58974
                                                          Golgi apparatus; actin cytoskeleton;protein
                                                                       Normalisation
          SEQ00598 CCTGAAGAAAGGAGATGGTGTTTGAGCCTGAAGGAGGAACTGGATGCCAAGGAAG            associated lysosome; microtubul
RN00959                    AA892582 Rpl8    ribosomal protein L8 Normalisation
                                                          RNA binding; cytosolic 26962ribosomal subunit (sensu Euk
          SEQ00600 CTTCACTCGGGTCTTCTTGGTCTCTGGGTTGTGGGAGATGACTGTAGCATAGTTC           large
RN00960                    AA892553 Stat1   signal transducer and activator9.0 transcription 1
          SEQ00601 GGGATTCTCTGGTATATTCTCAGCAGCCATGACTTTGTAATTGCGAATAATATCTGGGAAAG of 25124
RN00961                    AA892544 Nedd8   "neural precursor cell expressed, developmentally down-regulatedpro
                                                          NEDD8 class-dependent protein catabolism; nucleus; ge
                                                                       Normalisation
          SEQ00602 ATGTCAATCTCAATCTCCTTTCCAGTCAGCGTCTTCACTTTAATTAGCATCTTCCTCCCAG     25490
RN00962                    AA892544 Nedd8   "neural precursor cell expressed, developmentally down-regulatedpro
                                                          NEDD8 class-dependent protein catabolism; nucleus; ge
                                                                       Normalisation
          SEQ00602 CAGAATCAAGTTTCTTCATTGCCCAAGACCACCACCTCCTCTAAGAGCCAACACC           25490
RN00963                    AA892380 Sptlc1  serine palmitoyltransferase, long chain base subunit 1
                                                                       Normalisation
          SEQ00028 TTTGTATGGAATACAGAGGAGTGCTTATCGAATTGTTCCCACAGGCGGGAGAGGG
RN00964                    AA892318         similar to SRp25 nuclear protein 288656
                                                                       Normalisation
          SEQ00605 CTGAGGAAAGAAACAGGTTGGAAGCATGAGAAACTAAGTGTAGACACAATGAGGGCAGA
RN00965                    AA892287          similar to retinoic acid inducible protein 3
          SEQ00606 GTAGGCATAGAACCAGCCACCATCCCAAGCAGAACACTATTTGGATAGAGTTAGATCAC  6.0 287805
RN00966                    AA892250          similar to Kars protein
          seq00607 CACAGATGAATGTAAGGCTGATGCATGTCACTTCGAGGAACTCTCCCACAAGCTTATC   2.0 292028
RN00967                    AA892250          similar to Kars protein
          seq00607 CTCAGTTAGACCCTCTTTGCAACGGTGCCATTTGGCCAGAGGACTCATGATCTGTGGG   2.0 292028
RN00968                    AA892250          similar to Kars protein
          SEQ00607 GGCAGTACAGAAGTTCTCATCTATGAACATGGCCTCATCGTCACCAGCAGCCTTG      2.0 292028
RN00969                    AA892123 Rpl36    ribosomal protein L36 Normalisation
                                                          intracellular; protein biosynthesis; ribosome; structural con
          SEQ00608 GATGTGCGTGCCCACCCTCTTCTTGATAAACTTGAGTGCTCGCTTGTCCTTGGAC          58927
RN00970                    AA891944          mus
          SEQ00609 ACCACGTTAACAAAAGAACGAGCAGGCAGAAGGGGAGTCTTAGCAGAACTTGGTTCAC   6.0
RN00971                    AA891944          mus
          seq00609 AGAGATTAAGATCACATGTATGTTACATACAATACAGAATAATGTGTATGATGACTAT   6.0
RN00972                    AA891944          mus
          seq00609 GTCTTAGCAGAACTTGGTTCACCCCCAATCCCACTGCCGTGAGACTTCTCAGTTCAAC   6.0
RN00973                    AA891769          similar to Cartilage-associated protein precursor
                                                                       Normalisation
          SEQ00610 CTGTGAGGTATCAACAACCCAGGCACTTGAAGAAGGAGGAACTCGGAAGAGAAGT          363157
RN00974                    AA891769          similar to Cartilage-associated protein precursor
                                                                       Normalisation
          SEQ00610 GACTAAGCAGACTCTTCCATCTCCAACAGGTCATCCACATACTCCACAACCTCTC          363157
RN00975                    AA891666          similar to EAP30 subunit of ELL complex
                                                                       Normalisation
          SEQ00612 CTGCTGCTGTATATCCCTCCACACTCAGTCAAGGAAAGACTTCTTTGGCCTCCTC          287645
RN00976                    AA875620          LOC361797                        12.0 361797
          seq00613 GGCTTGTTATACAATGAGATGATCATGACATTCTAGTCACTTGTAGGAACTCCACCTTAGTC
RN00977                    AA875620          LOC361797
          SEQ00613 TTTATTACATTGGCTAATGCTCATGTTCAAGTGAGGCTCTGGTTCAGTCTGGGCTG   12.0 361797
RN00978                    AA875620          LOC361797
          seq00613 TTTATTACATTGGCTAATGCTCATGTTCAAGTGAGGCTCTGGTTCAGTCTGGGCTGCC 12.0 361797
RN00979                    AA875523          "similar to 17,000 dalton myosin light chain"
                                                                       Normalisation
          SEQ00614 TGACTAGGACATGACGGATTTCAGCACCCATGACAGTGCCATTCCCTTCTTTGTC          362816
RN00980                    AA875327          similar to Wbscr1
          SEQ00615 AAAAGATCATTCACAAAATACCATATCCATAGACTCACTTTCTGTCATAGAACTGA     6.0 288599
RN00981                    AA875263          similar to microspherule protein 1 300222
                                                                       Normalisation
          SEQ00616 AAAGGAGGAATCTAAAGCTGATCCACTGGAGACACAGGAGTGATGTGGCAATGGT
RN00982                    AA875069 H3f3b    "H3 histone, family 3B"Normalisation
          SEQ00617 AAGTGGTGGGGAGTCTTGTCATTAAGGTGTGTGTAATTTAGTCCAGTTGGTATTTCTGA      117056
RN00983                    AA875069 H3f3b    "H3 histone, family 3B"Normalisation
          SEQ00617 TGCATGTTTCTGTATGTTAATGACTTGTTGGGTAGCTATTAAGGTACTAGAATTGATAAATGTGT117056
RN00984                    AA875037          similar to SPI6
          SEQ00619 TTTCCTAGTATCTGTCCTTCTCTCCAGCATTCTTACACATTGATTCAGTTCTACCAGGC14.0 361241
RN00985                    AA874843 Scarb1   "scavenger receptor class B, member 1"
          SEQ00620 CATCTTCACGGAACAGTTCATGGGGATTCCAGTGACCGGGTGGATGTCTAGGAACAAG   1.4 25073
RN00986                    AA859882 Uchl1    ubiquitin carboxy-terminalpeptidase activity; hydrolase activity; intrace
                                                          cysteine-type hydrolase L1
                                                                       Normalisation
          SEQ00621 GCCGTAACTTACAGAAACCAAAGAGACCATAGAGAGCAAGGTACAAGACACAGGAGG        29545
RN00987                    AA859882 Uchl1    ubiquitin carboxy-terminalpeptidase activity; hydrolase
                                                          cysteine-type hydrolase L1
                                                                       Normalisation29545
          SEQ00621 TTTTGCCAGCAGAAAAGTTTTATTCTTCCTCTTGAGGACTAGACAAACCACATCCA activity; intrace
RN00988                    AA859878 Ret      ret proto-oncogene
                                                          ATP binding; calcium ion binding; cell adhesion; cell adhe
          SEQ00623 CCACAGCACCACAGACTATGTTCTTTCAGAAAGCATTGGCTCAGTATTTAGCACT      6.0 24716
RN00989                    AA859827 Uck2     uridine-cytidine kinase 2
                                                          protein deubiquitination171570
          SEQ00624 CAGTTTGTCACTTAAGCTCAGGGTCAAGTTCGGTCAAGATTTGCTGTTCCAAAGTACA   1.5
RN00990                    AA859827 Uck2     uridine-cytidine kinase 2
                                                          protein deubiquitination171570
          seq00624 GCTCAGGGTCAAGTTCGGTCAAGATTTGCTGTTCCAAAGTACAAAAGGGCAGAAAGGA   1.5
RN00991                    AA859827 Uck2     uridine-cytidine kinase 2
                                                          protein deubiquitination171570
          seq00624 GGTTACACGTTGGATTCATAATTAGGCATCACCAGTACTAGTTGGCACAGTTTGTCACT  1.5
RN00992                    AA859783 Rpl36a   large subunit ribosomalNormalisation
                                                                         protein L36a
          SEQ00625 CCTTCTTATACTGGGTCACTTTGTGAGGCTGGTGCTTGCCACATTTCTTACAGAA          81769
RN00993                    AA859740          mus
          SEQ00626 AATGGCTTAATCTTCACGTGTGTGGTATAGGATCAGGCACTGGGCACTTGACCTT      8.0
RN00994                    AA859740          mus
          seq00626 CAATGGCTTAATCTTCACGTGTGTGGTATAGGATCAGGCACTGGGCACTTGACCTTGG   8.0
RN00995                    AA859740          mus
          seq00626 CTGCCTCTGCCTCACTCTGCACTCAGGCTAAGAAGGGGAGGGTCACCACAGACAGGAG   8.0
RN00996                    AA859648          similar to heat shock protein 40 361384
                                                                              12.0
          SEQ00627 GATCCTATCAGGGAAGATGACTTCAAATTCGATAACAAGGTCTCCACGTTTCTCAGGTGT
RN00997                    AA818888 Uba52    ubiquitin A-52 residue ribosomal protein fusion product
                                                                       Normalisation
          SEQ00628 GGTGCAGGCGTGCGTAGCACTTGCGGCAGATCATCTTGTCACAGTTGTACTTCTG 1        64156
RN00998                    AA818843 Cript    postsynaptic protein Cript
                                                          postsynaptic membrane; protein domain
                                                                       Normalisation56725
          SEQ00629 TCTAGTAGACAGTGCGTACAGAAGTAGGGAACACCTTACTCATTAATTATACAGA specific binding
RN00999                    NM_012728Glp1r    glucagon-like peptide coupled receptor activity; G-protein
                                                          G-protein 1 receptor 25051
                                                                                4.0
          seq00630 CACACACCTCATCTGTGACCAGAGTCTATGCTTTGAATCAGAATGGGCTATATCCTCT coupled rece
RN01000                    NM_012728Glp1r    glucagon-like peptide coupled receptor activity; G-protein coupled rece
                                                          G-protein 1 receptor 25051
          SEQ00630 CATCCTGGTCTATGTGCTGCTCATTATGTGTGGGTGGAGTCTGGAGGTGGGACAG      4.0
RN01001                    NM_012728Glp1r    glucagon-like peptide coupled receptor activity; G-protein
                                                          G-protein 1 receptor 25051
                                                                                4.0
          seq00630 GACTTTATCCTTCTTCACTCTGTGTCTATTCAAACGTATAATTCTGGTTTCTCTCACCC coupled rece
RN01002                    AA801130 Grb2     growth factor receptor bound protein 2
                                                          RAS protein signal transduction; SH3/SH2 adaptor protein
                                                                       Normalisation
          SEQ00631 GAGGAGGCTGCGTGGAGAGAAACGGTGGACAGGCACATGACTACGGAGGACTGAG          81504
RN01003                    AA801130 Grb2     growth factor receptor bound protein 2
                                                          RAS protein signal transduction; SH3/SH2 adaptor protein
                                                                       Normalisation
          SEQ00631 TTCACAGTTAATCACTACCTACCAAATTGCTATTCGCAGAAGTTAGAGGCGTAAGTACATAGG  81504
RN01004                    AA800948          similar to Tubulin alpha-4 chain (Alpha-tubulin 4)
          SEQ00633 GCTGTCTATTCTTCTCCCTCATCCTCGTCCTCATAGGAGTCTATGCCTACTTCCTCATA  8.0 316531
RN01005                    AA800613 Zfp36    zinc finger protein 36
                                                          DNA binding; nucleic acid binding; nucleus
          SEQ00634 AATAAATAAAGTCGTCATAAATAAAGGGTCCATTGGTTGGGGCAGGGGCGTGGGG      9.0 79426
RN01006                    AA800587 Gpx2     glutathione peroxidase 2
          seq00635 AGAAGGGTTTAGGAAGATGCCATCATTCTGTGAAGAAGGCCTAGCACCTACC       12.0 29326
RN01007                    AA800587 Gpx2     glutathione peroxidase 2
          seq00635 GTCATAAGGGTACGGCAGCTTGTCTTTCAGGTACGCAAAGACAGGATGCT         12.0 29326
RN01008                    AA800587 Gpx2     glutathione peroxidase 2
          SEQ00635 TTTGATGTCAGGCTCGATGTTGATGGTCTGGAAGGTGCGGCTGTAGCGACGGAAAG   12.0 29326
RN01009                    AA800318 Serping1 "serine (or cysteine) proteinase inhibitor, clade G (C1
                                                                                6.0 295703
          SEQ00636 TCAGTCAGCCCACACAGGTTGAGATCGTAAGTGAAGTCAAAGAATTCCAGTTTCT inhibitor), memb
RN01010                    AA800170          similar to hypothetical protein FLJ14360
                                                                       Normalisation
          SEQ00637 CAGCACATATATCCTGTTGTCTAGCACAGCAATGCCAGGCTCACCATGCCCAGCT          303792
RN01011                    AA800170          similar to hypothetical protein FLJ14360
                                                                       Normalisation
          SEQ00637 GTCTTGGGTCATACCTCCAGCATCGGGACTCAGCTCGGAATCCTTGGACATTATT          303792
RN01012                    AA800054 Rpl19    ribosomal protein L19 Normalisation
                                                          RNA binding; cytosolic 81767ribosomal
                                                                                    large
          SEQ00639 TTCTTGGTCTCTTCCTCCTTGGACAGAGTCTTGATGATCTCCTCCTTCTTGGCTTsubunit (sensu Euk
RN01013                    AA799861          similar to interferon regulatory 9.0 293624
          SEQ00640 GACTCCACAAGGTCCACTAGAGATGACATATAGCCAAGGAATAAGCCTGAGCCAG      factor 7
RN01014                    AA799803          "similar to complement component312705
          SEQ00641 AGGATACGATGCCTGTAGCCACCCAGATATCACGACTGCGGTCCCTGACTGCAAA    15.0 1, r subcomponent"
RN01015                    AA799761          similar to T-cell differentiation antigen
          SEQ00642 AACCATCACCTCCAAAACAGTTCCAGGGCTCAGACCAGGGGCTTCAAGGC           8.0 311635
RN01016                    AA799718 MGC72560Unknown (protein for MGC:72560)308869
          SEQ00643 GCTTCTAGCCTTATTCTTGTCCTCCACATTCTTCTCCGTGATTAGTAGCAGGTTGG  1.4
RN01017                    AA799672 Rpl6    ribosomal protein L6 Normalisation
                                                        intracellular; protein biosynthesis; ribosome; structural con
          SEQ00644 ACCTTTTCTTTCTTCTTCTTCTTCTCAACCTTTGTCTTGGCAGCAGAGTATTTCCTTTTGT  117042
RN01018                    AA799672 Rpl6    ribosomal protein L6 Normalisation
                                                        intracellular; protein biosynthesis; ribosome; structural con
          SEQ00644 GGCTTGCGAAGTGGCTTCTTCTTGAAGTAAGCATCAGTCAGGTGTTTGGGAATTT        117042
RN01020                    AA799276 Atp2a2  "ATPase, Ca++ transporting, cardiac muscle, slowto transmembrane
                                                        ATP binding; ATPase activity, coupled twitch
                                                                             3.0 29693
          SEQ00647 TATTGTGTGCATTTATCGTAATAAAGTGCTCCGCGTCGGTTCAGTTCCTCACAGCTTC 2"
RN01021                    AA108277         similar to heat shock protein 105 kDa alpha
          SEQ00648 CACAGAAGATGGAGAAAATCTAAAGTGAAAGTGCGCGTGACACACATGCA       12.0 288444
                                 RAE230_UniGeneSet ID Affymetrix 11_Signal M061-09 vsM061-10 vsM061-01 vsLog Ratio Log Ratio
                                           Probe ID M061-07 vsM061-08 vsLog Ratio Log Ratio Log Ratio 11_Signal
            Refseq ID Archival UniGene Cluster                   RAE230A 11_Signal 11_Signal 11_Signal
                      Rn.2178 Rn.2178 1368924_AT
            NM_017094.1                             -0.4       -0.8        -1.9      -2.7      1
                      Rn.2178 Rn.2178 1368924_at-0.4
            NM_017094.1                                        -0.8        -1.9      -2.7      1
                      Rn.2178 Rn.2178 1368924_at-0.4
            NM_017094.1                                        -0.8        -1.9      -2.7      1
                      Rn.11060 Rn.11060 1386970_AT
            NM_053950.1                             0          1.7         0.6       0.3       -0.6
                      Rn.1950 Rn.1950 1368247_atA              0.6         0.7       1.3       -1.2
                      Rn.1950 Rn.1950 1368247_atA              0.6         0.7       1.3       -1.2
                      Rn.1950 Rn.1950 1368247_atA              0.6         0.7       1.3       -1.2
                      Rn.10852 Rn.10852 1387076_at-0.3
            NM_024359.1                                        -2          -0.9      -0.3      0.5
                      Rn.10852 Rn.10852 1368149_atA
            NM_024359.1                                        A           A         A         A
                      Rn.10852 Rn.10852 1368149_atA
            NM_024359.1                                        A           A         A         A
                      Rn.3432 Rn.107103
            "NM_175843.2, NM_175843.2" 1371353_at0.2           0.4         -0.3      -0.5      0
                      Rn.14882 Rn.14882 1370913_AT.8
            NM_138881.1                             0          -1.8        1.7       0.7       -1.7
                      Rn.34396 Rn.94956 1387914_AT  2
            "XM_217439.1, XM_217439.1, NM_178847.1" .5         0.1         0         -1.4      -1.5
                      Rn.34396 Rn.94956 1387914_AT  2
            "XM_217439.1, XM_217439.1, NM_178847.1" .5         0.1         0         -1.4      -1.5
                      Rn.34396 Rn.94956 1387914_AT  2
            "XM_217439.1, XM_217439.1, NM_178847.1" .5         0.1         0         -1.4      -1.5
                      Rn.10488 Rn.10488 1370172_at-0.5         0.5         0         -0.4      0.3
                      Rn.12072 Rn.12072 1368308_AT
            NM_012603.1                             -1.7       -3.1        -3.1      -3.2      0.9
                      Rn.12072 Rn.12072 1368308_AT
            NM_012603.1                             -1.7       -3.1        -3.1      -3.2      0.9
                      Rn.12072 Rn.12072 1368308_AT
            NM_012603.1                             -1.7       -3.1        -3.1      -3.2      0.9
                      Rn.44826 Rn.44826 1369260_a_atA          A           1.4       A         A
                      Rn.37341 Rn.37341 1374468_at-
            "XM_236690.2, XM_236690.2, NM_198130.1" 0.2        -1.8        -1.1      -0.4      0.8



              XM_235661.1 Rn.40710 Rn.24286 1377326_atA            A      A         A         A
              XM_234555.2
              XM_234428.2
similar to ubiquitin-conjugating enzyme E2 variant 1 (LOC498326)
              XM_233843.2



             XM_230377.2
gen-activated kinase kinase kinase 15 (LOC501558)

            XM_227484.2
            XM_226743.2

             XM_226116.2
             XM_225180.2 Rn.18996 Rn.18996 1373203_at-0.6          -0.7   -0.5      0.4       0.8
             XM_222871.2
Transferrin receptor (Tfrc)

            XM_219857.2
            "XM_219769.2, XM_219769.2, NM_199103.1"
                         ---       Rn.16867 1370678_s_at1.1        -0.6   1.8       -0.7      -0.7
                         Rn.3992 Rn.121213 1367469_at0             0.2    0.1       0.3       0.3
                                                                    4A
neural precursor cell expressed,developmentally down-regulated gene1.6
                         Rn.25115 Rn.99540 1375119_at0.8                  1.1       0.6       -4.7
            XM_216989.2
                         Rn.6013 Rn.106230 1370886_a_at -1.8       2.4    0.6       -0.3      -0.9
                       Rn.4075 Rn.4075 1371133_a_at     -5.3   -4.2   -2.3   -1.9   1.1
            XM_216650.2Rn.3206 Rn.3206 1371807_at0.8           -0.1   0.2    0.8    0.1
            XM_216640.2
                       Rn.54645 Rn.54645 1388132_at-1.7        -0.7   -0.2   -0.8   0.4
receptor (TNFRSF)-interacting serine-threonine kinase 2

prosome, macropain) subunit, alpha type 7
                       Rn.19891 Rn.105784 1371869_at-0.3       0.8    0.2    0.3    0
                       Rn.12314 Rn.12314 1372578_at-0.5        0.8    0.8    -0.7   0.7
            XM_214967.2Rn.15652 Rn.15652 1373868_at0.1         0.7    A      -0.4   1.1
            XM_214953.1Rn.17238 Rn.101762 1389177_at1.6        -3     1.4    1.8    -2.5
            XM_214953.1Rn.17238 Rn.101762 1389177_at1.6        -3     1.4    1.8    -2.5
                       Rn.2278 Rn.2278 1372182_at-3.4          -4.5   -1.7   -1.5   0.4
                       Rn.10572 Rn.10572 1388219_atA           A      0.6    A      A
            XM_213814.2Rn.9090 Rn.9090 1372017_at-0.9          -0.8   0.3    0.8    0.2
                       Rn.9359 Rn.9359 1388433_at0             A      1.1    2.5    -3.3
                       Rn.31762 Rn.31762 1387897_at-0.8        -1.4   -0.4   -1.3   0.8

                     Rn.11045 Rn.11045 1370064_at1.4
            NM_031087.1                                        A      1.1    0.1    A
                     Rn.11045 Rn.11045 1370064_at1.4
            NM_031087.1                                        A      1.1    0.1    A
                     Rn.11045 Rn.11045
            NM_031087.1
                     Rn.3340 Rn.3340 1370164_at0
            "XM_346786.1, XM_346786.1, NM_130826.1" .3         0.6    1.2    0.1    -0.2
                     Rn.3340 Rn.3340 1370164_at0
            "XM_346786.1, XM_346786.1, NM_130826.1" .3         0.6    1.2    0.1    -0.2
                     Rn.3340 Rn.3340 1370164_at0
            "XM_346786.1, XM_346786.1, NM_130826.1" .3         0.6    1.2    0.1    -0.2
                     Rn.23638 Rn.23638 1388587_AT -0.2         -1.3   -0.4   0.9    0.3
                     Rn.11089 Rn.11089 1367947_at-0.2
            NM_013010.1                                        0.1    1.1    0.3    0.1
                     Rn.11089 Rn.11089 1367947_at-0.2
            NM_013010.1                                        0.1    1.1    0.3    0.1
                     Rn.11089 Rn.11089 1367947_at-0.2
            NM_013010.1                                        0.1    1.1    0.3    0.1
                     Rn.31745 Rn.31745 1398782_AT.1
            NM_080585.1                           0            0.7    0.3    0.4    -0.1
                     Rn.31745 Rn.31745 1398782_AT.1
            NM_080585.1                           0            0.7    0.3    0.4    -0.1
                     Rn.20418 Rn.20418 1370917_at-0.9
            XM_343270.1                                        1.5    0.4    -0.6   0.5
                     Rn.20418 Rn.20418 1370917_at-0.9
            XM_343270.1                                        1.5    0.4    -0.6   0.5
                     Rn.20418 Rn.20418 1370917_at-0.9
            XM_343270.1                                        1.5    0.4    -0.6   0.5
                     Rn.27505 Rn.27505 1398315_AT
            NM_139114.1                           -0.1         0.2    0.1    0      0.2
                     Rn.27505 Rn.27505 1398315_AT
            NM_139114.1                           -0.1         0.2    0.1    0      0.2
                     Rn.44632 Rn.44632 1369757_atA
            NM_019312.1                                        A      A      A      A
                     Rn.44632 Rn.44632 1369757_AT
            NM_019312.1                           A            A      A      A      A
                     Rn.44632 Rn.44632 1369757_atA
            NM_019312.1                                        A      A      A      A
                     Rn.3973 Rn.3973 1367582_AT
            NM_017150.1                           -0.1         0.3    0.1    0.1    0.1
                     Rn.773    Rn.773             -1.9
                                         1370875_AT            -3     0.8    2.3    -3.8
                     Rn.2275 Rn.2275 1387691_atA               A      A      A      A
                     Rn.2275 Rn.2275 1387691_atA               A      A      A      A
                     Rn.10372 Rn.10372 1368732_AT.6
            NM_032056.1                           0            A      0.4    0.2    0.2
                     Rn.12550 Rn.12550 1389538_AT
            XM_343065.1                           -0.5         0.8    0.4    0.3    0.5
                     Rn.3123 Rn.83614 1388309_AT
            NM_139327.1                           -0.8         0.2    1.1    -0.1   0.4
                     Rn.10290 Rn.10290 1369684_atA
            NM_133524.1                                        A      A      A      A
                     Rn.10290 Rn.10290 1369684_atA
            NM_133524.1                                        A      A      A      A
                     Rn.10290 Rn.10290 1369684_atA
            NM_133524.1                                        A      A      A      A
                     Rn.5850 Rn.5850 1367760_at-2.1
            NM_031643.3                                        -0.8   -1.3   -1.9   0.9
                     Rn.5850 Rn.5850 1367760_at-2.1
            NM_031643.3                                        -0.8   -1.3   -1.9   0.9
                     Rn.5850 Rn.5850 1367760_at-2.1
            NM_031643.3                                        -0.8   -1.3   -1.9   0.9
         Rn.24682 Rn.24682 1390566_A_AT
"XM_342505.1, XM_342505.1"             A      A      A      2.8    -0.7
         Rn.2100 Rn.2100 1398882_AT
XM_341788.1                            -0.2   0.4    -0.1   0.3    0.2
         Rn.2100 Rn.2100 1398882_AT
XM_341788.1                            -0.2   0.4    -0.1   0.3    0.2
         Rn.10763 Rn.10763 1388149_at-0.2
NM_032055.1                                   -4.9   -1.2   -0.6   0.8
         Rn.21221 Rn.25046 1390426_AT
XM_342392.1                            A      0.2    2.2    0.4    -0.8
         Rn.10470 Rn.10470 1369834_AT
NM_012742.1                            2      A      A      A      A
         Rn.10470 Rn.10470 1369834_at2
NM_012742.1                                   A      A      A      A
         Rn.10470 Rn.10470
NM_012742.1
         Rn.976
XM_344443(LL)      Rn.128114 1371340_AT0      0.3    0.2    0.2    0
         Rn.976
XM_344443(LL)      Rn.128114 1371340_AT0      0.3    0.2    0.2    0
         Rn.10447 Rn.10447 1387312_A_AT
NM_012565.1                            2.6    A      -0.1   -0.8   -1.2
         Rn.11349 Rn.11349 1371028_at-0.7
NM_138840.1                                   -1.4   -1.2   -1     0.8
         ---
NM_138840.1                            -1.8
                   Rn.11349 1387755_S_AT      -4.7   -1.5   -3.9   0.7
         Rn.11349 Rn.11349 1371028_at-0.7
NM_138840.1                                   -1.4   -1.2   -1     0.8
         Rn.2050 Rn.119388 1398751_AT  0
"XM_343041.1, XM_343041.1, NM_031570.1" .2    0.1    0.1    0.2    0.2
         Rn.974
NM_022399.1        Rn.974    1398750_at0.8    -0.8   -0.3   0.1    0.1
         Rn.23532 Rn.23532 1390230_AT
XM_343137.1                            A      A      A      A      A
         Rn.23532 Rn.23532 1390230_AT
XM_343137.1                            A      A      A      A      A
         Rn.2722 Rn.2722 1371344_AT.3  0      0.1    0.2    0.5    0.3
         Rn.2722 Rn.2722 1371344_AT.3  0      0.1    0.2    0.5    0.3
         Rn.82719 Rn.10374 1387283_AT.5
"NM_017028, NM_017028"                 1      -0.3   0.4    0.6    A
         Rn.10373 Rn.10373 1371015_at0.3
NM_173096.1                                   -0.8   0.1    1.2    0.2
         Rn.2171 Rn.127805 1371299_AT.3
XM_341888.1                            0      -0.2   -0.3   0.4    0.1
         Rn.29791 Rn.29791 1371318_AT.3
XM_341815.1                            0      0.2    0.1    0.4    0.3
         Rn.44320 Rn.93714 1369788_s_at
NM_021835.2                            A      1.2    0.8    0.6    0
         Rn.44320 Rn.93714 1369788_s_at
NM_021835.2                            A      1.2    0.8    0.6    0
         Rn.44320 Rn.93714 1369788_s_at
NM_021835.2                            A      1.2    0.8    0.6    0
         Rn.4772 Rn.4772 1367973_AT
NM_031530.1                            -5.8   -6.7   -2.3   -1.7   0.4

         Rn.10483 Rn.10483 1388218_at0
"XM_217091.1, XM_217091.1, NM_175762.2" .6    A      A      A      0.7
         Rn.33804 Rn.33804 1367679_AT
NM_013069.1                           -0.2    -1.2   1.4    1.5    -5.2
         Rn.5078 Rn.5078 1370964_AT.8
NM_013157.2                           1       -6.3   -4.4   0.6    -6.4
         Rn.11040 Rn.11040 1367856_AT -
"XM_346880.1, XM_346880.1, NM_017006.1" 3.7   -5.1   -3.3   -2.6   0.5
         Rn.11040 Rn.11040 1367856_AT -
"XM_346880.1, XM_346880.1, NM_017006.1" 3.7   -5.1   -3.3   -2.6   0.5
         Rn.44409 Rn.44409 1369816_at-0.4
NM_013018.1                                   1.3    1.8    0.5    -3.6
         Rn.44409 Rn.44409 1369816_AT
NM_013018.1                           -0.4    1.3    1.8    0.5    -3.6
         Rn.44409 Rn.44409 1369816_at-0.4
NM_013018.1                                   1.3    1.8    0.5    -3.6
         Rn.6282 Rn.6282 1370333_a_at
NM_178866.2                           1       -4     -2.3   -3.8   0.5

        Rn.9745
NM_012713.1                          A
                   Rn.91118 1368240_a_at      A      A      A      A

        Rn.4234
NM_012998.1        Rn.4234   1367635_AT.8
                                      0       -1.2   -0.4   -0.4   0.4

        Rn.7636
NM_031144.2        Rn.117620 1373087_at-0.1   0.3    -0.7   -0.2   0.5
        Rn.11042
NM_053616.1        Rn.11042 1368199_AT -0.7   0      -0.3   -0.5   0.5
        Rn.3293
NM_031020.1        Rn.88085 1367697_at0       0.5    -0.4   0.1    0.5
        Rn.8515
NM_172039.1        Rn.8515 1398859_at0.5      0.6    0      -0.3   0.4
        Rn.1604
NM_019143(LL)      Rn.1604 1370234_at2.3      -1.6   -0.5   -0.3   -4.6
        Rn.14733                       0
                   Rn.14733 1373499_AT.1      0.3    -0.3   0.3    0.3
        Rn.14733                       0
                   Rn.14733 1373499_AT.1      0.3    -0.3   0.3    0.3
        Rn.14733                       0
                   Rn.14733 1373499_AT.1      0.3    -0.3   0.3    0.3
        Rn.42891
NM_057103.1        Rn.122094 1368868_atA      A      A      A      A
         Rn.10970 Rn.10970 1368343_atA
NM_053949.1                                   A      2.3    A      A
         Rn.6406 Rn.90117 1369066_atA
NM_053585.1                                   0      -0.7   -0.4   0.8
         Rn.6406 Rn.90117 1369066_atA
NM_053585.1                                   0      -0.7   -0.4   0.8
         Rn.6406 Rn.90117 1369066_AT
NM_053585.1                           A       0      -0.7   -0.4   0.8
         Rn.10323 Rn.10323 1370812_at-1.2
NM_031535.1                                   -1.8   -1.2   0      0.9
         Rn.10323 Rn.10323 1369180_atA
NM_031535.1                                   A      A      A      A
         Rn.10323 Rn.10323 1369180_AT
NM_031535.1                           A       A      A      A      A
         Rn.10323 Rn.10323 1369180_atA
NM_031535.1                                   A      A      A      A
         Rn.22459 Rn.22459 1371006_AT
XM_343119.1                           A       A      0.9    A      A
         Rn.2490 Rn.2490 1368375_A_AT
NM_013129.1                           -0.8    2.9    -0.6   -0.4   -1.4
         Rn.19927 Rn.19927 1369956_at-1.5
XM_346525.1                                   -1.6   -0.8   -1.2   0.8
         Rn.19927 Rn.19927 1369956_at-1.5
XM_346525.1                                   -1.6   -0.8   -1.2   0.8
         Rn.19927 Rn.19927 1369956_at-1.5
XM_346525.1                                   -1.6   -0.8   -1.2   0.8
         Rn.9897 Rn.9897 1387212_at
"NM_012863.1, NM_012863.1, XM_346425" A       A      A      A      A
         Rn.9897 Rn.9897 1387212_AT
"NM_012863.1, NM_012863.1, XM_346425" A       A      A      A      A
         Rn.9897 Rn.9897 1387212_at
"NM_012863.1, NM_012863.1, XM_346425" A       A      A      A      A
         Rn.24412 Rn.107689 1387073_at
"NM_030991.1, NM_030991.1, XM_346670" A       A      A      A      A
         Rn.64562 Rn.64562 1398819_AT
NM_022934.1                           1       -1.3   -0.7   0.3    0.4
         Rn.10499 Rn.10499 1398289_A_AT
NM_030999(LL)                         A       A      A      A      A
         Rn.10557 Rn.10557 1368427_AT
NM_012773.1                           0       -0.2   0      0.3    0.5
         Rn.65864 Rn.86956 1368544_a_at
"NM_053516.1, NM_053516.1, XM_346521" -3.7    2.7    1.1    -2.6   -3.2
         Rn.65864 Rn.86956 1368544_a_at
"NM_053516.1, NM_053516.1, XM_346521" -3.7    2.7    1.1    -2.6   -3.2
         Rn.65864 Rn.86956 1368544_a_at
"NM_053516.1, NM_053516.1, XM_346521" -3.7    2.7    1.1    -2.6   -3.2
         Rn.10566 Rn.10566 1387132_AT A
"XM_346538.1, XM_346538.1, NM_012859.1"       A      1.6    A      A
         Rn.10566 Rn.10566 1387132_atA
"XM_346538.1, XM_346538.1, NM_012859.1"       A      1.6    A      A
         Rn.10566 Rn.10566 1387132_atA
"XM_346538.1, XM_346538.1, NM_012859.1"       A      1.6    A      A
         Rn.11183 Rn.11183 1369590_a_at
NM_024134.1                           -0.8    1      1.2    0.3    0.1
         Rn.11183 Rn.11183 1369590_A_AT
NM_024134.1                           -0.8    1      1.2    0.3    0.1

         Rn.10089 Rn.10089
NM_080782.2                  1387391_atA      -4.2   -2.4   -5.3   1.4
         Rn.10089 Rn.10089
NM_080782.2                  1387391_atA      -4.2   -2.4   -5.3   1.4
         Rn.10089 Rn.10089
NM_080782.2                  1387391_atA      -4.2   -2.4   -5.3   1.4
         Rn.10217 Rn.10217
NM_012800.1                  1370606_atA      1.4    A      -1     A
         Rn.10217 Rn.10217
NM_012800.1                  1370606_atA      1.4    A      -1     A
         Rn.10217 Rn.10217
NM_012800.1                  1370606_atA      1.4    A      -1     A
         Rn.10056 Rn.10056
NM_031006.1                  1368973_at0.4    A      A      -0.4   0.5
         Rn.10056 Rn.10056
NM_031006.1                  1368973_at0.4    A      A      -0.4   0.5
         Rn.10056 Rn.10056
NM_031006.1                            0
                             1368973_AT.4     A      A      -0.4   0.5
         Rn.10584 Rn.10584
NM_139089.1                  1387969_AT-0.5   -1.1   -0.7   0.5    -0.4
         Rn.9758 Rn.9758
NM_013123.2                            A
                             1370750_a_at     A      A      A      A
         Rn.18909 Rn.18909
NM_031514.1                  1368856_AT-1     -0.7   -1.1   -1.1   1
         Rn.1785 Rn.1785
NM_012595.1                  1370218_AT-4.7   -1.2   1      0.2    -2.1
         Rn.76185 Rn.10251
"NM_013086.1, NM_013086.1"             1.3
                             1369738_s_at     A      A      A      A
         Rn.76185 Rn.10251
"NM_013086.1, NM_013086.1"             1.3
                             1369738_s_at     A      A      A      A
         Rn.10251 Rn.10251
"NM_013086.1, NM_013086.1"   1387714_ATA      A      A      A      A
         Rn.10400 Rn.10400
NM_012611.2                  1387667_atA      A      A      A      A
         Rn.10400 Rn.10400
NM_012611.2                  1387667_atA      A      A      A      A
NM_013071(LL)
         Rn.6479 Rn.6479
NM_024125.3                           -1.2
                             1387087_AT       -0.6   -3.3   -3.1   0.9
         Rn.6479 Rn.6479
NM_024125.3                           -1.2
                             1387087_AT       -0.6   -3.3   -3.1   0.9
         Rn.6479 Rn.6479
NM_024125.3                           -1.2
                             1387087_AT       -0.6   -3.3   -3.1   0.9
         Rn.10668 Rn.10668
NM_017059.1                           -1.1
                             1369122_AT       -2     -1.4   -0.3   0.7
         Rn.10668 Rn.10668 1369122_AT
NM_017059.1                          -1.1    -2     -1.4   -0.3   0.7
         Rn.10668 Rn.10668 1369122_AT
NM_017059.1                          -1.1    -2     -1.4   -0.3   0.7
         Rn.31120 Rn.98260 1368146_at0.4     0.9    0.7    -0.2   0.4
                                     1
         Rn.2009 Rn.115752 1372715_AT.6      -2.2   -1     2.5    -2.7
         Rn.5811 Rn.98269 1370281_AT.2
NM_145878.1                          0       -2.9   0.3    -0.6   0.7
         Rn.15879 Rn.36202 1369681_AT
NM_017339.1                          A       A      A      A      A
         Rn.15879 Rn.36202 1369681_AT
NM_017339.1                          A       A      A      A      A
         Rn.15879 Rn.36202 1369681_AT
NM_017339.1                          A       A      A      A      A
         Rn.3980 Rn.101146 1388331_at0.9     -1     -0.4   0      0.6
         Rn.10131 Rn.54603 1369516_AT
NM_022852.2                          A       A      A      A      A
         Rn.10131 Rn.54603 1369516_AT
NM_022852.2                          A       A      A      A      A
         Rn.10131 Rn.54603 1369516_AT
NM_022852.2                          A       A      A      A      A
         Rn.76185 Rn.10251           1
"NM_013086.1, NM_013086.1" 1369737_AT.2      -0.6   -2     -1.8   0.2
         Rn.2178 Rn.2178 1373803_A_AT0.8     -2.1   -2.5   -2.1   0.8
         Rn.9889 Rn.89052 1387155_atA        A      A      A      A

         Rn.82706 Rn.965
NM_175838.1                            0.3
                             1370109_s_at    -1.8   -0.3   0.3    0.2
         Rn.82706 Rn.965
NM_175838.1                            0.3
                             1370109_s_at    -1.8   -0.3   0.3    0.2
         Rn.82706 Rn.965
NM_175838.1                            0.3
                             1370109_s_at    -1.8   -0.3   0.3    0.2
         ---       ---       1376089_at1
"XM_217091.1, XM_217091.1, NM_175762.2"      -1.1   -1.8   -1.1   0.8
         Rn.2163 Rn.2163 1370307_at0.4
NM_175754.1                                  -0.9   1.3    1.2    -1.2
NM_173837.2
         Rn.11131 Rn.11131 1370615_atA
NM_173323.1                                  A      A      1.7    -0.5
         Rn.11131 Rn.11131 1370615_atA
NM_173323.1                                  A      A      1.7    -0.5
         Rn.11131 Rn.11131 1370615_atA
NM_173323.1                                  A      A      1.7    -0.5
         Rn.11225 Rn.11225
"NM_172091.1, NM_172091.1" 1370522_at3.3     A      A      A      A
         Rn.11225 Rn.11225
"NM_172091.1, NM_172091.1" 1370522_at3.3     A      A      A      A
         Rn.11225 Rn.11225
"NM_172091.1, NM_172091.1" 1370522_at3.3     A      A      A      A
         Rn.82709 Rn.82709 1370787_at0
"NM_022612.1, NM_022612.1, NM_171988.1" .7   0.3    0.8    1      0.4
         Rn.82709 Rn.82709 1370787_at0
"NM_022612.1, NM_022612.1, NM_171988.1" .7   0.3    0.8    1      0.4
         Rn.82709 Rn.82709 1370787_at0
"NM_022612.1, NM_022612.1, NM_171988.1" .7   0.3    0.8    1      0.4
NM_152937.1
         Rn.49641 Rn.127825 1377206_atA
NM_145880.1                                  A      A      1.3    A
         Rn.49641 Rn.127825 1377206_atA
NM_145880.1                                  A      A      1.3    A
         Rn.49641 Rn.127825 1377206_atA
NM_145880.1                                  A      A      1.3    A
         Rn.32324 Rn.89906 1371122_at-0.1
NM_145788.1                                  -0.1   -1.2   -1.3   0.1
NM_145681.1
NM_145681.1
         ---
NM_139258.1        Rn.72585 1369902_at1.8    A      A      A      1.2
         ---
NM_139193.1        Rn.138127 1369910_atA     A      0.8    A      A
         ---
NM_139193.1        Rn.138127 1369910_atA     A      0.8    A      A
         ---
NM_139193.1        Rn.138127 1369910_atA     A      0.8    A      A
         Rn.3635 Rn.3635 1370317_at0
"XM_343317.1, XM_343317.1, NM_139101.1"      0      -0.4   -0.3   0.6
         Rn.3606 Rn.3606 1370277_at-0.7
NM_139100.1                                  0.8    0.7    0.1    -0.7
         Rn.3606 Rn.3606 1370277_at-0.7
NM_139100.1                                  0.8    0.7    0.1    -0.7
         Rn.3606 Rn.3606 1370277_at-0.7
NM_139100.1                                  0.8    0.7    0.1    -0.7
         Rn.3251 Rn.3251 1387946_at-2.2
NM_139096.1                                  -4.4   -2     -1.6   1
         Rn.10383 Rn.10383 1371152_a_at
NM_138913.1                            1.2   -0.4   -0.4   0.1    0.1
         Rn.7262 Rn.7262 1367465_at0.6
NM_138910.2                                  -0.3   -0.1   0.4    0.2
         Rn.7262 Rn.7262 1367465_at0.6
NM_138910.2                                  -0.3   -0.1   0.4    0.2
         Rn.7262 Rn.7262 1367465_at0.6
NM_138910.2                                  -0.3   -0.1   0.4    0.2
         Rn.34354 Rn.12038 1370950_at2
NM_138905.1                                  0.5    1.3    1.1    -2.2
         Rn.4037 Rn.141435 1387893_at2.2
NM_138900.1                                  -2.2   0.5    -0.1   -5.5
         Rn.30047 Rn.30047 1370627_atA
NM_138542.1                                  A      A      A      A
         Rn.30047 Rn.30047 1370627_atA
NM_138542.1                                  A      A      A      A
         Rn.30047 Rn.30047 1370627_atA
NM_138542.1                                  A      A      A      A
         Rn.30047 Rn.30047 1370627_atA
NM_138542.1                                  A      A      A      A
         Rn.11149 Rn.11149 1368111_atA
NM_134403.1                                  A      A      A      A
         Rn.11149 Rn.11149 1368111_atA
NM_134403.1                                  A      A      A      A
         Rn.11149 Rn.11149 1368111_atA
NM_134403.1                                  A      A      A      A
         ---
NM_134351.1        ---       1376289_atA     A      A      A      A
         ---
NM_134351.1        ---       1376289_atA     A      A      A      A
         ---
NM_134351.1        ---       1376289_atA     A      A      A      A
         Rn.3718 Rn.3718 1386867_at0.6
NM_133561.1                                  1      0.7    0.8    -1.5
         Rn.3718 Rn.3718 1386867_at0.6
NM_133561.1                                  1      0.7    0.8    -1.5
         Rn.3718 Rn.3718 1386867_at0.6
NM_133561.1                                  1      0.7    0.8    -1.5
         Rn.2232 Rn.2232 1370174_at-1.5
NM_133546.1                                  0.7    0.7    -0.4   0.2
         Rn.2232 Rn.2232 1370174_at-1.5
NM_133546.1                                  0.7    0.7    -0.4   0.2
         Rn.2232 Rn.2232 1370174_at-1.5
NM_133546.1                                  0.7    0.7    -0.4   0.2
         Rn.1300 Rn.1300 1373164_at-3.2
NM_133392.1                                  -2.9   -2.5   -2     1
         Rn.11665 Rn.15324 1376972_at1.5
NM_133315.1                                  A      A      1      A
         Rn.11665 Rn.15324 1376972_at1.5
NM_133315.1                                  A      A      1      A
         Rn.11665 Rn.15324 1376972_at1.5
NM_133315.1                                  A      A      1      A
         Rn.20738 Rn.98279 1387114_at-1.5
NM_133307.1                                  -1.1   -0.5   -0.9   0.8
         Rn.20738 Rn.98279 1387114_at-1.5
NM_133307.1                                  -1.1   -0.5   -0.9   0.8
         Rn.20738 Rn.98279 1387114_at-1.5
NM_133307.1                                  -1.1   -0.5   -0.9   0.8
         Rn.20738 Rn.98279 1387114_at-1.5
NM_133307.1                                  -1.1   -0.5   -0.9   0.8
         Rn.11303 Rn.11303 1387011_atA
NM_130741.1                                  A      1.4    1.3    A
         Rn.3786 Rn.3786 1386880_at1.1
NM_130433.1                                  0.5    1.5    -0.4   -1.6
         Rn.3786 Rn.3786 1386880_at1.1
NM_130433.1                                  0.5    1.5    -0.4   -1.6
         Rn.3786 Rn.3786 1386880_at1.1
NM_130433.1                                  0.5    1.5    -0.4   -1.6
         Rn.9775 Rn.9775 1368025_at-0.7
NM_080906.1                                  1.9    1      1.2    -0.7
         Rn.22800 Rn.106419 1370044_at-0.9
NM_080895.1                                  -3.2   -0.7   -0.6   0.8
         Rn.10749 Rn.10749 1368088_at0.1
NM_080885.1                                  -0.2   0.1    0.1    0.8
         Rn.9820 Rn.9820 1368722_atA
NM_080769.1                                  A      1.9    A      0.7
         Rn.9820 Rn.9820 1368722_atA
NM_080769.1                                  A      1.9    A      0.7
         Rn.9820 Rn.9820 1368722_atA
NM_080769.1                                  A      1.9    A      0.7
         Rn.54442 Rn.54442 1370473_a_at
NM_057204.1                            A     A      A      A      0.5
         Rn.54442 Rn.54442 1370473_a_at
NM_057204.1                            A     A      A      A      0.5
         Rn.54442 Rn.54442 1370473_a_at
NM_057204.1                            A     A      A      A      0.5
         Rn.11344 Rn.89639 1368535_atA
NM_057130.1                                  A      A      A      A
         Rn.42891 Rn.122094 1368868_atA
NM_057103.1                                  A      A      A      A
         Rn.52228 Rn.52228 1369735_AT
NM_057100.1                            A     A      1.5    0.8    -0.7
         Rn.52228 Rn.52228 1369735_AT
NM_057100.1                            A     A      1.5    0.8    -0.7
         Rn.52228 Rn.52228 1369735_atA
NM_057100.1                                  A      1.5    0.8    -0.7
         Rn.52228 Rn.52228 1369735_atA
NM_057100.1                                  A      1.5    0.8    -0.7
         Rn.11029 Rn.11029 1369669_at0.2
NM_053970.1                                  0      -1.7   -1.4   0.8
         Rn.10875 Rn.10875 1369017_atA
NM_053937.1                                  A      A      A      A
         Rn.14870 Rn.14870 1369050_at2.2
NM_053923.1                                  A      A      A      A
         Rn.14870 Rn.14870 1369050_at2.2
NM_053923.1                                  A      A      A      A
         Rn.14870 Rn.14870 1369050_at2.2
NM_053923.1                                  A      A      A      A
         Rn.19721 Rn.19721 1369061_at
"NM_053906.1, NM_053906.1, XM_344528" -1     -3     -3.6   -0.9   0.4
         Rn.19721 Rn.19721 1369061_at
"NM_053906.1, NM_053906.1, XM_344528" -1     -3     -3.6   -0.9   0.4
         Rn.19721 Rn.19721 1369061_at
"NM_053906.1, NM_053906.1, XM_344528" -1     -3     -3.6   -0.9   0.4
         Rn.34914 Rn.34914 1369078_at-0.7
NM_053842.1                                  0.7    -0.1   -0.9   0.4
         Rn.34914 Rn.34914 1369078_at-0.7
NM_053842.1                                  0.7    -0.1   -0.9   0.4
         Rn.34914 Rn.34914 1369078_at-0.7
NM_053842.1                                  0.7    -0.1   -0.9   0.4
         Rn.11185 Rn.11185 1368079_at-0.3
NM_053826.1                                  -1.4   0.8    -2.8   0.6
         Rn.11185 Rn.11185 1368079_at-0.3
NM_053826.1                                  -1.4   0.8    -2.8   0.6
         Rn.11185 Rn.11185 1368079_at-0.3
NM_053826.1                                  -1.4   0.8    -2.8   0.6
         Rn.31120 Rn.98260 1368146_at0.4
NM_053769.2                                  0.9    0.7    -0.2   0.4
         Rn.31120 Rn.98260 1368146_at0.4
NM_053769.2                                  0.9    0.7    -0.2   0.4
         Rn.31120 Rn.98260 1368146_at0.4
NM_053769.2                                  0.9    0.7    -0.2   0.4
         Rn.15500 Rn.15500 1368330_at-0.7
NM_053720.1                                  -0.5   -1.2   -1     0.9
         Rn.31765 Rn.31765 1367601_at-0.9
NM_053698.1                                  -1.6   -1.8   -0.4   0.9
         Rn.48799 Rn.48799 1369082_atA
NM_053679.1                                  A      A      A      A
         Rn.10230 Rn.10230 1368760_at
"NM_053647.1, NM_053647.1, XM_346458" A      A      A      -2.3   0.5
         Rn.5785 Rn.5785              A
"NM_053601.1, NM_053601.1" 1369999_a_at      A      1.8    1.1    A
         Rn.14550 Rn.14550 1387048_at-1.4
NM_053563.1                                  -1     -1.3   -0.9   1.1
         Rn.14550 Rn.14550 1387048_at-1.4
NM_053563.1                                  -1     -1.3   -0.9   1.1
         Rn.14550 Rn.14550 1387048_at-1.4
NM_053563.1                                  -1     -1.3   -0.9   1.1
         Rn.11114 Rn.11114 1369756_a_at
NM_053424.1                           A      A      A      2.4    A
         Rn.2060 Rn.2060 1387805_at-0.6
NM_053420.2                                  1.3    0.4    0.3    -0.2
         Rn.44218 Rn.44218 1368800_at0.8
NM_053353.1                                  A      A      A      A
         Rn.81055 Rn.81055 1369415_at-1
NM_053328.1                                  -0.7   -1.9   -1.9   1
         Rn.11059 Rn.11059 1368076_at-0.9
NM_052801.1                                  -0.9   -0.1   1      0.6
         Rn.11059 Rn.11059 1368076_at-0.9
NM_052801.1                                  -0.9   -0.1   1      0.6
         Rn.11059 Rn.11059 1368076_at-0.9
NM_052801.1                                  -0.9   -0.1   1      0.6
         Rn.11422 Rn.11422 1368862_at-1.5
NM_033230.1                                  -0.5   0.6    -1.2   0.7
NM_033230.1
         Rn.11422 Rn.11422 1368862_at-1.5
NM_033230.1                                  -0.5   0.6    -1.2   0.7
         Rn.10426 Rn.10426 1370267_at0
NM_032080.1                                  0.8    0.6    0.1    0.8
         Rn.10426 Rn.10426 1370267_at0
NM_032080.1                                  0.8    0.6    0.1    0.8
         Rn.10426 Rn.10426 1370267_at0
NM_032080.1                                  0.8    0.6    0.1    0.8
         Rn.10628 Rn.10628 1368938_atA
NM_032063.1                                  A      A      A      A
         Rn.2801 Rn.112600 1368830_atA
NM_031977.1                                  A      A      A      A
         Rn.2801 Rn.112600 1368830_atA
NM_031977.1                                  A      A      A      A
         Rn.2801 Rn.112600 1368830_atA
NM_031977.1                                  A      A      A      A
         Rn.1950 Rn.1950 1368247_atA
NM_031971.1                                  0.6    0.7    1.3    -1.2
         Rn.1950 Rn.1950 1368247_atA
NM_031971.1                                  0.6    0.7    1.3    -1.2
         Rn.1950 Rn.1950 1368247_atA
NM_031971.1                                  0.6    0.7    1.3    -1.2
         Rn.1923 Rn.1923 1370081_a_at
NM_031836.1                           A      1.4    1.5    0.3    -3.9
         Rn.30039 Rn.118960 1368952_atA
NM_031802.1                                  A      A      A      A
         Rn.30039 Rn.118960 1368952_atA
NM_031802.1                                  A      A      A      A
         Rn.30039 Rn.118960 1368952_atA
NM_031802.1                                  A      A      A      A
         Rn.3022 Rn.3022 1386976_at-0.7
NM_031797.1                                  -3.1   -1.4   0.5    0.2
         Rn.793
NM_031785.1        Rn.93045 1367873_at-1.5   -0.7   -0.4   -0.5   0.7
         Rn.793
NM_031785.1        Rn.93045 1367873_at-1.5   -0.7   -0.4   -0.5   0.7
         Rn.793
NM_031785.1        Rn.93045 1367873_at-1.5   -0.7   -0.4   -0.5   0.7
         Rn.37514 Rn.10845 1387624_at-0.7
NM_031777.1                                  -0.9   -0.7   0.2    0.6
         Rn.37514 Rn.10845 1387624_at-0.7
NM_031777.1                                  -0.9   -0.7   0.2    0.6
         Rn.37514 Rn.10845 1387624_at-0.7
NM_031777.1                                  -0.9   -0.7   0.2    0.6
         Rn.5789 Rn.5789 1370043_at-1.2
NM_031753.1                                  -5.8   -3.3   -2.4   0.7
         Rn.21126 Rn.21126 1387206_at
"NM_031740.1, NM_031740.1, XM_346507" -1.7   -0.5   0.7    0.2    0.8
         Rn.21126 Rn.21126 1387206_at
"NM_031740.1, NM_031740.1, XM_346507" -1.7   -0.5   0.7    0.2    0.8
         Rn.21126 Rn.21126 1387206_at
"NM_031740.1, NM_031740.1, XM_346507" -1.7   -0.5   0.7    0.2    0.8
         Rn.9113 Rn.9113 1368365_at2
"XM_346390.1, XM_346390.1, NM_031731.1" .2    -2.8   -1.4   -1.1   -0.1
         Rn.54603 Rn.126675 1387662_atA
NM_031693.1                                   A      A      A      A
         Rn.54603 Rn.126675 1387662_atA
NM_031693.1                                   A      A      A      A
         Rn.54603 Rn.126675 1387662_atA
NM_031693.1                                   A      A      A      A
         Rn.786
NM_031626.1        Rn.786    1370208_at-0.6   -0.1   -0.2   0.1    0.6
         Rn.786
NM_031626.1        Rn.786    1370208_at-0.6   -0.1   -0.2   0.1    0.6
         Rn.786
NM_031626.1        Rn.786    1370208_at-0.6   -0.1   -0.2   0.1    0.6
         Rn.2566 Rn.88457 1368273_at0.6
NM_031622.1                                   1.4    -0.2   -0.2   -0.1
         Rn.10506 Rn.10506 1387592_atA
NM_031575.1                                   A      A      A      A
         Rn.10506 Rn.10506 1387592_atA
NM_031575.1                                   A      A      A      A
         Rn.10506 Rn.10506 1387592_atA
NM_031575.1                                   A      A      A      A
         Rn.3561 Rn.3561 1369954_at0.8
NM_031510.1                                   -2     -1.9   0.3    -0.2
         Rn.25720 Rn.25720 1370036_at2.3
NM_031127.2                                   0.2    0.4    1.6    -2.3
         Rn.25720 Rn.25720 1370036_at2.3
NM_031127.2                                   0.2    0.4    1.6    -2.3
         Rn.25720 Rn.25720 1370036_at2.3
NM_031127.2                                   0.2    0.4    1.6    -2.3
         Rn.21394 Rn.3264 1369718_at0.8
NM_031120.2                                   0.5    A      -0.6   0.3
         Rn.21394 Rn.3264 1369718_at0.8
NM_031120.2                                   0.5    A      -0.6   0.3
         Rn.21394 Rn.3264 1369718_at0.8
NM_031120.2                                   0.5    A      -0.6   0.3
         Rn.34915 Rn.34915 1370261_at0.4
NM_031107.1                                   -1.1   -0.7   0.5    0.6
         Rn.34915 Rn.34915 1370261_at0.4
NM_031107.1                                   -1.1   -0.7   0.5    0.6
         Rn.34915 Rn.34915 1370261_at0.4
NM_031107.1                                   -1.1   -0.7   0.5    0.6
         Rn.3293 Rn.88085 1367697_at0
NM_031020.1                                   0.5    -0.4   0.1    0.5
         Rn.3293 Rn.88085 1367697_at0
NM_031020.1                                   0.5    -0.4   0.1    0.5
         Rn.3293 Rn.88085 1367697_at0
NM_031020.1                                   0.5    -0.4   0.1    0.5
         Rn.10090 Rn.10090 1369799_at2.7
NM_031003.1                                   -3.6   -2.3   1.2    -2.6
NM_030989.1
         Rn.54443 Rn.54443 1367830_a_at
NM_030989.1                            A      A      A      A      A
         Rn.54443 Rn.54443 1367830_a_at
NM_030989.1                            A      A      A      A      A
         Rn.29980 Rn.29980 1368896_at0.7
NM_030858.1                                   A      1.3    1.2    A
         Rn.10907 Rn.10907 1387316_atA
NM_030845.1                                   A      A      A      A
         Rn.64578 Rn.64578 1370113_atA
NM_023987.1                                   1.2    0.5    0.3    A
         Rn.1425 Rn.1425 1387797_at0
"XM_346708.1, XM_346708.1, NM_023950.2"       0.2    -0.6   0      0.3
         Rn.30010 Rn.30010 1369655_at0.8
NM_022958.2                                   0.3    -0.5   0      0.4
         Rn.54483 Rn.92606 1387205_atA
NM_022921.1                                   -0.9   0      -0.4   1
         Rn.10099 Rn.10099 1369409_at-0.2
NM_022856.1                                   -0.9   -0.3   -0.6   0.7
         Rn.9756 Rn.9756 1386968_at-2.9
NM_022676.1                                   2.3    -1.3   2      -3.9
         Rn.6452 Rn.6452 1368566_a_at
NM_022607.1                            0.2    0.9    1.3    0.3    -0.9
         Rn.6148 Rn.6148 1386885_at-0.9
NM_022594.1                                   0.8    1.4    0.1    -1.6
         Rn.6148 Rn.6148 1386885_at-0.9
NM_022594.1                                   0.8    1.4    0.1    -1.6
         Rn.6148 Rn.6148 1386885_at-0.9
NM_022594.1                                   0.8    1.4    0.1    -1.6
         Rn.1944 Rn.61687 1369961_at0.3
NM_022538.1                                   0.9    0.3    1.5    -0.6
         Rn.1119 Rn.1119 1367883_at-0.4
NM_022509.1                                   0.6    -0.1   0      0.5
         Rn.1114 Rn.1114 1368181_at1.3
NM_022508.1                                   -0.1   -0.2   0.6    0.1
         Rn.1114 Rn.1114 1368181_at1.3
NM_022508.1                                   -0.1   -0.2   0.6    0.1
         Rn.1114 Rn.1114 1368181_at1.3
NM_022508.1                                   -0.1   -0.2   0.6    0.1
         Rn.54471 Rn.54471 1368799_atA
NM_022274.1                                   -0.9   -1.3   -0.4   0.4
         Rn.44824 Rn.91239 1369248_a_at
NM_022231.1                            -1.5   -1.6   -1     -1.5   0.9
         Rn.37161 Rn.37161 1386966_a_at
NM_021764.1                            -0.3   0.2    0.6    0      0.4
         Rn.37161 Rn.37161 1386966_a_at
NM_021764.1                            -0.3   0.2    0.6    0      0.4
         Rn.37161 Rn.37161 1386966_a_at
NM_021764.1                            -0.3   0.2    0.6    0      0.4
         Rn.43867 Rn.43867 1368291_at1
NM_021752.1                                   0.2    A      -0.2   0.4
         Rn.43867 Rn.43867 1368291_at1
NM_021752.1                                   0.2    A      -0.2   0.4
         Rn.43867 Rn.43867 1368291_at1
NM_021752.1                                  0.2    A      -0.2    0.4
         Rn.42926 Rn.42926 1368710_at-0.7
NM_021699.1                                  -0.2   0      0.1     0.7
         Rn.41024 Rn.41024 1387235_atA
"XM_346781.1, XM_346781.1, NM_021655.1"      A      A      A       A
         Rn.41024 Rn.41024 1387235_atA
"XM_346781.1, XM_346781.1, NM_021655.1"      A      A      A       A
         Rn.41024 Rn.41024 1387235_atA
"XM_346781.1, XM_346781.1, NM_021655.1"      A      A      A       A
         Rn.39098 Rn.39098 1369000_atA
NM_021589.1                                  A      A      A       A
         Rn.39098 Rn.39098 1369000_atA
NM_021589.1                                  A      A      A       A
         Rn.39098 Rn.39098 1369000_atA
NM_021589.1                                  A      A      A       A
         Rn.24102 Rn.8209 1367922_at-2.4
NM_020306.1                                  -2.8   -1.4   -2.5    0.8
         Rn.53876 Rn.53876 1369329_atA
NM_020087.2                                  1.4    1.3    0.1     0.1
         Rn.11416 Rn.11416 1370511_at2.3
NM_020071.1                                  -10    -6.7   -10.7   -10.3
         Rn.11416 Rn.11416 1370511_at2.3
NM_020071.1                                  -10    -6.7   -10.7   -10.3
         Rn.11416 Rn.11416 1370511_at2.3
NM_020071.1                                  -10    -6.7   -10.7   -10.3
         Rn.1488 Rn.1488 1367713_at-0.5
NM_019356.1                                  -0.5   -0.7   -0.4    0.4
         Rn.10022 Rn.10022 1387242_at0
"XM_346785.1, XM_346785.1, NM_019335.1" .1   -0.6   -0.3   -0.5    0.4
         Rn.10146 Rn.10146            A
"NM_019284.1, NM_019284.1" 1368704_a_at      A      A      A       A
         Rn.9904 Rn.9904 1369796_atA
NM_019281.1                                  A      A      A       A
         Rn.9904 Rn.9904
NM_019281.1
         Rn.9904 Rn.9904
NM_019281.1
         Rn.1188 Rn.1188 1387369_at-0.8
NM_019277.1                                  0.2    -0.4   0.2     0.9
         Rn.3252 Rn.143727 1367839_at2.1
NM_019238.1                                  0.8    0.3    0.9     -1.4
         Rn.3252 Rn.143727 1367839_at2.1
NM_019238.1                                  0.8    0.3    0.9     -1.4
         Rn.3252 Rn.143727 1367839_at2.1
NM_019238.1                                  0.8    0.3    0.9     -1.4
         Rn.11273 Rn.11273 1387025_atA
NM_019234.1                                  A      A      A       A
         Rn.11273 Rn.11273 1387025_atA
NM_019234.1                                  A      A      A       A
         Rn.11273 Rn.11273 1387025_atA
NM_019234.1                                  A      A      A       A
         Rn.4636 Rn.4636 1367802_at-1.4
NM_019232.1                                  -0.5   -1.9   -0.1    0.9
         Rn.11495 Rn.11495 1375717_atA
NM_019220.1                                  A      A      A       A
         Rn.9258 Rn.9258 1367960_at1.4
NM_019186.1                                  1.6    1.6    1.2     A
         Rn.9258 Rn.9258 1367960_at1.4
NM_019186.1                                  1.6    1.6    1.2     A
         Rn.9258 Rn.9258
NM_019186.1
         Rn.17423 Rn.30015 1371489_at-0.2
NM_019182.1                                  -0.8   -0.6   -0.5    0.8
         Rn.3425 Rn.3425 1368037_at-2.2      -1.6   0.2    -0.9    0.4
         Rn.10966 Rn.88941 1387226_atA       A      0.6    A       A
         Rn.11160 Rn.11160 1367803_atA
NM_017361.1                                  -1.1   A      0.2     0.4
         Rn.10075 Rn.10075 1368255_atA
NM_017354.1                                  A      A      A       A
         Rn.10075 Rn.10075 1368255_atA
NM_017354.1                                  A      A      A       A
         Rn.10075 Rn.10075 1368255_atA
NM_017354.1                                  A      A      A       A
         Rn.2592 Rn.2592 1387771_a_at
NM_017347.1                           -0.1   A      1.3    1.2     0.1
         Rn.5968 Rn.5968 1370246_at0.6
NM_017326.1                                  0.5    0.4    0.8     -0.4
         Rn.5968 Rn.5968 1370246_at0.6
NM_017326.1                                  0.5    0.4    0.8     -0.4
         Rn.5968 Rn.5968 1370246_at0.6
NM_017326.1                                  0.5    0.4    0.8     -0.4
         Rn.27923 Rn.27923 1386994_at0.9
NM_017259.1                                  0.3    1.5    0.7     A
         Rn.11196 Rn.11196 1368440_at-4.6
NM_017216.1                                  -2.5   -1.9   1.9     -3.9
         Rn.11065 Rn.11065 1368505_atA
NM_017214.1                                  0.8    2.1    -0.3    -0.8
         Rn.11065 Rn.11065 1368505_atA
NM_017214.1                                  0.8    2.1    -0.3    -0.8
         Rn.11065 Rn.11065 1368505_atA
NM_017214.1                                  0.8    2.1    -0.3    -0.8
         Rn.40778 Rn.40778 1368860_atA
NM_017180.1                                  A      2.3    A       A
         Rn.11423 Rn.11423 1369254_a_at
NM_017175.1                           A      A      A      A       A
         Rn.11423 Rn.11423 1369254_a_at
NM_017175.1                           A      A      A      A       A
         Rn.11423 Rn.11423 1369254_a_at
NM_017175.1                           A      A      A      A       A
         Rn.32078 Rn.32078 1370584_a_at
NM_017155.1                           A      A      A      A       A
         Rn.32078 Rn.32078 1370584_a_at
NM_017155.1                           A     A      A      A      A
         Rn.32078 Rn.32078 1370584_a_at
NM_017155.1                           A     A      A      A      A
         Rn.4293 Rn.87066 1368832_at-0.3
NM_017093.1                                 1.1    0.1    -0.8   0.5
         Rn.4293 Rn.87066 1368832_at-0.3
NM_017093.1                                 1.1    0.1    -0.8   0.5
         Rn.4293 Rn.87066 1368832_at-0.3
NM_017093.1                                 1.1    0.1    -0.8   0.5
         Rn.4620 Rn.4620 1370420_at2.6
NM_017070.1                                 -1.5   -1     -1.6   -1.5
         Rn.11377 Rn.11377 1370202_at
"NM_017060.1, NM_017060.1, XM_346574" 0.4   1.7    1.6    0.8    -3.5
         Rn.9970 Rn.9970 1369473_at-0.5
NM_017033.1                                 2.4    -0.6   -2.3   -1.8
         Rn.3687 Rn.107896 1367586_at0
NM_017025.1                                 0.8    0      -1.5   0.1
         Rn.3687 Rn.107896 1367586_at0
NM_017025.1                                 0.8    0      -1.5   0.1
         Rn.3687 Rn.107896 1367586_at0
NM_017025.1                                 0.8    0      -1.5   0.1
         Rn.6656 Rn.6656 1368514_at2.8
NM_013198.1                                 -2.1   -0.5   -2     -3.3
         Rn.11418 Rn.11418 1367877_at-0.4
NM_013173.1                                 -0.3   0.4    2      0
         Rn.9437 Rn.9437 1375852_at2
NM_013134.2                                 -1.6   -1     0.6    -0.5
         Rn.9437 Rn.9437 1375852_at2
NM_013134.2                                 -1.6   -1     0.6    -0.5
         Rn.9437 Rn.9437
NM_013134.2
         Rn.25839 Rn.87394 1369691_atA
NM_013119.1                                 A      A      A      A
         Rn.25839 Rn.87394 1369691_atA
NM_013119.1                                 A      A      A      A
         Rn.25839 Rn.87394 1369691_atA
NM_013119.1                                 A      A      A      A
         Rn.9439 Rn.9439 1368391_at-1.7
NM_013111.1                                 -1.8   -0.5   -1.3   0.8
         Rn.6077 Rn.6077 1368084_at-5
NM_013097.2                                 -2.6   -4.1   2.7    -4
         Rn.6077 Rn.6077 1368084_at-5
NM_013097.2                                 -2.6   -4.1   2.7    -4
         Rn.6077 Rn.6077 1368084_at-5
NM_013097.2                                 -2.6   -4.1   2.7    -4
         Rn.10182 Rn.10182 1387173_atA
NM_013092.1                                 A      A      A      A
         Rn.10182 Rn.10182 1387173_atA
NM_013092.1                                 A      A      A      A
         Rn.10182 Rn.10182 1387173_atA
NM_013092.1                                 A      A      A      A
         Rn.11127 Rn.11127 1370166_at2.5
NM_013082.1                                 -2.2   -0.7   0.9    -4.8
         Rn.11127 Rn.11127 1370166_at2.5
NM_013082.1                                 -2.2   -0.7   0.9    -4.8
         Rn.11127 Rn.11127 1370166_at2.5
NM_013082.1                                 -2.2   -0.7   0.9    -4.8
         Rn.53971 Rn.53971 1367881_at-3.1
NM_013016.2                                 -4.4   -2.7   -3.2   1
         Rn.2130 Rn.97173 1369929_at-1.1
NM_013013.1                                 -0.4   -1.1   -1.1   0.5
         Rn.2130 Rn.97173 1369929_at-1.1
NM_013013.1                                 -0.4   -1.1   -1.1   0.5
         Rn.2130 Rn.97173 1369929_at-1.1
NM_013013.1                                 -0.4   -1.1   -1.1   0.5
         Rn.4234 Rn.4234 1367635_at0.8
NM_012998.1                                 -1.2   -0.4   -0.4   0.4
         Rn.4234 Rn.4234 1367635_at0.8
NM_012998.1                                 -1.2   -0.4   -0.4   0.4
         Rn.4234 Rn.4234 1367635_at0.8
NM_012998.1                                 -1.2   -0.4   -0.4   0.4
         Rn.10706 Rn.10706 1387027_a_at
NM_012977.1                           2.5   -0.9   0.8    0.1    -3.4
         Rn.10562 Rn.10562 1387690_atA
NM_012922.1                                 A      A      A      A
         Rn.9725 Rn.9725 1387587_at0.8
NM_012908.1                                 0.4    0.6    0.3    0.4
         Rn.9725 Rn.9725 1387587_at0.8
NM_012908.1                                 0.4    0.6    0.3    0.4
         Rn.9725 Rn.9725 1387587_at0.8
NM_012908.1                                 0.4    0.6    0.3    0.4
         Rn.9985 Rn.91342 1387468_atA
NM_012882.1                                 A      A      A      A
         Rn.9985 Rn.91342 1387468_atA
NM_012882.1                                 A      A      A      A
         Rn.9985 Rn.91342 1387468_atA
NM_012882.1                                 A      A      A      A
         Rn.9792 Rn.9792 1369407_atA
NM_012870.1                                 A      A      3.7    A
         Rn.6075 Rn.6075 1368325_at-1.5
NM_012842.1                                 -2.6   -4.3   2.4    -5.6
         Rn.6075 Rn.6075 1368325_at-1.5
NM_012842.1                                 -2.6   -4.3   2.4    -5.6
         Rn.6075 Rn.6075 1368325_at-1.5
NM_012842.1                                 -2.6   -4.3   2.4    -5.6
         Rn.2202 Rn.2202 1369939_at-0.3
NM_012839.1                                 0.7    0.4    0.4    -0.8
         Rn.2202 Rn.2202 1369939_at-0.3
NM_012839.1                                 0.7    0.4    0.4    -0.8
         Rn.2202 Rn.2202 1369939_at-0.3
NM_012839.1                                 0.7    0.4    0.4    -0.8
         Rn.7024 Rn.7024 1368057_at1.3
NM_012804.1                                 0.1    0.5    1.3    -0.6
         Rn.7024 Rn.7024 1368057_at1.3
NM_012804.1                                  0.1    0.5    1.3    -0.6
         Rn.7024 Rn.7024 1368057_at1.3
NM_012804.1                                  0.1    0.5    1.3    -0.6
         Rn.10999 Rn.10999 1370427_at-1
NM_012801.1                                  1.5    1.4    2.1    -6
         Rn.10708 Rn.87212 1368409_at2.3
NM_012796.1                                  -0.7   -0.2   1.7    -2.6
         Rn.10708 Rn.87212 1368409_at2.3
NM_012796.1                                  -0.7   -0.2   1.7    -2.6
         Rn.10708 Rn.87212 1368409_at2.3
NM_012796.1                                  -0.7   -0.2   1.7    -2.6
         Rn.37508 Rn.37508 1369186_at-1.9
NM_012762.2                                  -2.7   -1.5   -1.4   0.7
         Rn.37508 Rn.37508 1369186_at-1.9
NM_012762.2                                  -2.7   -1.5   -1.4   0.7
         Rn.37508 Rn.37508 1369186_at-1.9
NM_012762.2                                  -2.7   -1.5   -1.4   0.7
         Rn.6977 Rn.6977 1387122_atA
NM_012760.1                                  A      A      3      A
         Rn.6977 Rn.6977 1387122_atA
NM_012760.1                                  A      A      3      A
         Rn.6977 Rn.6977 1387122_atA
NM_012760.1                                  A      A      3      A
         Rn.6007 Rn.6007 1369953_a_at
NM_012752.1                           -3.6   1.3    -3.7   2.5    -4.4
         Rn.6007 Rn.6007 1369953_a_at
NM_012752.1                           -3.6   1.3    -3.7   2.5    -4.4
         Rn.6007 Rn.6007 1369953_a_at
NM_012752.1                           -3.6   1.3    -3.7   2.5    -4.4
         Rn.10247 Rn.10247 1370224_at0.1
NM_012747.1                                  -0.8   0.1    0.3    0.5
         Rn.44299 Rn.127118 1387708_atA
NM_012739.2                                  A      A      A      A
         Rn.44299 Rn.127118 1387708_atA
NM_012739.2                                  A      A      A      A
         Rn.44299 Rn.127118 1387708_atA
NM_012739.2                                  A      A      A      A
         Rn.10232 Rn.10232
"NM_012715.1, NM_012715.1" 1387219_atA       -0.7   0.9    0.2    -0.1
         Rn.2029 Rn.2029 1367721_at1.1
NM_012649.1                                  -0.3   -1     1.9    -1
         Rn.39743 Rn.116787 1369110_x_at
NM_012645.1                           -0.3   -1.6   -1     -0.9   0.8
         Rn.11317 Rn.11317 1368645_at-0.8
NM_012637.1                                  -0.3   -0.9   -1     0.9
         Rn.82691 Rn.82691 1370583_s_at
NM_012623.2                           0.4    A      A      0.1    0.6
         Rn.82691 Rn.82691 1370583_s_at
NM_012623.2                           0.4    A      A      0.1    0.6
         Rn.82691 Rn.82691 1370583_s_at
NM_012623.2                           0.4    A      A      0.1    0.6
         Rn.1785 Rn.1785 1370218_at-4.7
NM_012595.1                                  -1.2   1      0.2    -2.1
         Rn.147
NM_012592.1        Rn.147   1370232_at0.7    0.9    1.1    0.5    -0.7
         Rn.147
NM_012592.1        Rn.147   1370232_at0.7    0.9    1.1    0.5    -0.7
         Rn.147
NM_012592.1        Rn.147   1370232_at0.7    0.9    1.1    0.5    -0.7
         Rn.11394 Rn.11394 1387660_atA
NM_012586.1                                  A      A      A      A
         Rn.3160 Rn.3160 1370080_at-4.4      -5.8   -5     -6.5   -0.1
         Rn.3160 Rn.3160 1370080_at-4.4      -5.8   -5     -6.5   -0.1
         Rn.3160 Rn.3160 1370080_at-4.4      -5.8   -5     -6.5   -0.1
         Rn.55106 Rn.55106 1370200_at1.5
NM_012570.1                                  -0.1   -0.3   0.8    -0.1
         Rn.5762 Rn.5762 1367805_at-2.7
NM_012569.1                                  0      -0.5   1.2    1
         Rn.9096 Rn.9096 1368321_at-2.2
NM_012551.1                                  -2.2   -0.6   -1.8   0
         Rn.11064 Rn.11064 1368064_a_at
NM_012545.1                           2      -1.5   0.3    1.2    -2.4
         Rn.10352 Rn.10352 1370269_atA       A      A      4.4    A
         Rn.10352 Rn.10352 1370269_atA       A      A      4.4    A
         Rn.10352 Rn.10352 1370269_atA       A      A      4.4    A
         Rn.1472 Rn.1472 1367740_at-0.8
NM_012529.2                                  -0.3   2      1.7    -2.7
         Rn.1472 Rn.1472 1367740_at-0.8
NM_012529.2                                  -0.3   2      1.7    -2.7
         Rn.1472 Rn.1472
NM_012529.2
         Rn.31988 Rn.31988 1368518_at-3.9
NM_012523.1                                  -5.4   -3.1   -3.4   0.6
         Rn.31988 Rn.31988 1368518_at-3.9
NM_012523.1                                  -5.4   -3.1   -3.4   0.6
         Rn.31988 Rn.31988 1368518_at-3.9
NM_012523.1                                  -5.4   -3.1   -3.4   0.6
         Rn.3001 Rn.3001 1367995_at1.1
NM_012520.1                                  -1.5   -0.4   0.4    -0.4
         Rn.3001 Rn.3001 1367995_at1.1
NM_012520.1                                  -1.5   -0.4   0.4    -0.4
         Rn.3001 Rn.3001 1367995_at1.1
NM_012520.1                                  -1.5   -0.4   0.4    -0.4
         Rn.1774 Rn.1774 1367617_at-3.8
NM_012495.1                                  0.6    -0.1   -0.9   -0.4
         Rn.1774 Rn.1774
NM_012495.1
         Rn.1774 Rn.1774 1367617_at-3.8
NM_012495.1                                   0.6    -0.1   -0.9   -0.4
         Rn.9869 Rn.9869 1398256_AT
NM_031512.1                           -1      -4.1   -1.1   -0.8   0.8
         Rn.9869 Rn.9869 1398256_at-1
NM_031512.1                                   -4.1   -1.1   -0.8   0.8
         Rn.9869 Rn.9869 1398256_at-1
NM_031512.1                                   -4.1   -1.1   -0.8   0.8
         Rn.74724 Rn.47029 1382615_AT
"NM_199256.1, NM_199256.1, XM_342720" 0.1     -1.9   -1.2   -1.5   1
         Rn.47720 Rn.47720 1369717_atA
NM_022239.1                                   A      A      A      A
         Rn.47720 Rn.47720 1369717_atA
NM_022239.1                                   A      A      A      A
         Rn.65930 Rn.65930 1387480_AT
NM_024358.1                           A       A      A      A      A
         Rn.65930 Rn.65930 1387480_atA
NM_024358.1                                   A      A      A      A
         Rn.65930 Rn.65930 1387480_atA
NM_024358.1                                   A      A      A      A
         Rn.9753 Rn.9753 1387278_AT
NM_013196.1                           A       A      A      A      A
         Rn.9753 Rn.9753 1387278_atA
NM_013196.1                                   A      A      A      A
         Rn.9753 Rn.9753 1387278_atA
NM_013196.1                                   A      A      A      A
         Rn.10184 Rn.10184 1369787_at
"NM_012688.1, NM_012688.1, XM_341221" A       A      A      A      A
         Rn.3841 Rn.3841 1367577_at-2         1.7    2.1    -0.6   -6.2
         Rn.3841 Rn.3841
         Rn.38416 Rn.38416 1390213_at0        0.9    1      0.3    0.3
         Rn.9836 Rn.9836 1368311_at2
NM_008598.1                                   0.3    0.2    0.6    -3.9
         Rn.11384 Rn.11384 1368559_at-3.9
NM_017091.1                                   -4.6   -4.8   -5.5   1.5
         Rn.16064 Rn.16064 1370001_at
"NM_053998.1, NM_053998.1, XM_346486" -0.1    -2.4   -0.7   0.1    0.7
         Rn.16064 Rn.16064 1370001_at
"NM_053998.1, NM_053998.1, XM_346486" -0.1    -2.4   -0.7   0.1    0.7
         Rn.16064 Rn.16064 1370001_at
"NM_053998.1, NM_053998.1, XM_346486" -0.1    -2.4   -0.7   0.1    0.7
         Rn.25736 Rn.25736 1368332_AT
NM_133624.1                           -0.9    -1.9   -0.4   -0.3   0.6
         Rn.9889 Rn.89052 1387155_atA
NM_012746.1                                   A      A      A      A
         Rn.9889 Rn.89052 1387155_atA
NM_012746.1                                   A      A      A      A
         Rn.9889 Rn.89052 1387155_atA
NM_012746.1                                   A      A      A      A
         Rn.9836 Rn.9836 1368311_AT
NM_012861.1                           2       0.3    0.2    0.6    -3.9
         Rn.2992 Rn.2992 1367585_a_at
NM_012504.1                           -0.4    -1.8   0.1    1.5    -0.6
         Rn.2992 Rn.2992 1367585_a_at
NM_012504.1                           -0.4    -1.8   0.1    1.5    -0.6
         Rn.2992 Rn.2992 1371108_a_at
NM_012504.1                           -0.9    -1.6   -0.3   1.4    0.4
         Rn.9757 Rn.9757 1369493_at0.6
NM_012630.1                                   -1.6   -0.8   2.4    -0.9
         Rn.9757 Rn.9757 1369493_at0.6
NM_012630.1                                   -1.6   -0.8   2.4    -0.9
         Rn.9757 Rn.9757 1370384_A_AT
NM_012630.1                           A       -4     -1.6   3.4    -2.8
         Rn.29951 Rn.29951 1369462_AT
NM_012563.1                           A       A      A      A      A
         Rn.29951 Rn.29951 1369462_atA
NM_012563.1                                   A      A      A      A
         Rn.29951 Rn.29951 1369462_atA
NM_012563.1                                   A      A      A      A
         Rn.6975 Rn.6975 1387343_AT
NM_013154.1                           -1.4    1      -0.4   -0.4   0
         Rn.6975 Rn.6975 1387343_AT
NM_013154.1                           -1.4    1      -0.4   -0.4   0
         Rn.44573 Rn.116787 1371267_atA       A      A      A      0.5
         Rn.9664 Rn.9664 1369268_AT
NM_012912.1                           -4.3    -2.1   -2.1   -2.4   1
         Rn.9664 Rn.9664 1369268_AT
NM_012912.1                           -4.3    -2.1   -2.1   -2.4   1
         Rn.44376 Rn.85806 1387835_AT
NM_022194.1                           -3.2    -3.4   -3.2   -3.9   1.3
NM_017347.1
         Rn.6658 Rn.6658 1370884_at1.1
XM_342714.1                                   -1.6   A      1      0.4
         Rn.6658 Rn.6658 1370884_at1.1
XM_342714.1                                   -1.6   A      1      0.4
         Rn.22
NM_013046.2        Rn.22     1368912_AT
                                      A       A      A      A      A

        Rn.6396
NM_012591.1        Rn.6396   1368073_AT.5
                                       0      -1.2   0.7    0.3    0.7
        Rn.9757
NM_012630.1        Rn.9757   1370384_A_AT
                                       A      -4     -1.6   3.4    -2.8
        Rn.3908
NM_031984.1        Rn.3908   1370201_at-9.7   -8.1   -7.7   2.4    -9.3
        Rn.3908
NM_031984.1        Rn.3908   1370201_at-9.7   -8.1   -7.7   2.4    -9.3
        Rn.3908
NM_031984.1        Rn.3908   1370201_AT-9.7   -8.1   -7.7   2.4    -9.3
        Rn.3437    Rn.3437    1388117_AT-1     0.2    -0.2   0      0.5
        Rn.11169
NM_031117.1        Rn.11169   1368098_A_AT
                                        -3.7   1.7    2.3    -1     -4.8
        Rn.11169
NM_031117.1        Rn.11169   1368098_A_AT
                                        -3.7   1.7    2.3    -1     -4.8
        Rn.5785
NM_031984.1        Rn.5785    1369999_a_at
                                        A      A      1.8    1.1    A
        Rn.9873
NM_012589.1        Rn.9873    1369191_atA      A      A      A      A
        Rn.9873
NM_012589.1        Rn.9873    1369191_atA      A      A      A      A
        Rn.9873
NM_012589.1        Rn.9873    1369191_atA      A      A      A      A
        Rn.64900
NM_012600.1        Rn.3519    1370067_at-0.6   0.4    -0.7   -0.4   0.1
        Rn.29848
NM_145775.1        Rn.29848   1370816_atA      2.2    0.9    0.7    A
        Rn.29848
NM_145775.1        Rn.29848   1370816_atA      2.2    0.9    0.7    A
        Rn.29848
NM_145775.1        Rn.29848   1370816_atA      2.2    0.9    0.7    A
        Rn.962
NM_019129.1        Rn.962     1387815_ATA      A      A      A      A

        ---
XM_343636.1        ---        1388667_at1.1    -2.6   -1.5   0.2    0.2
        ---
XM_343636.1        ---        1388667_at1.1    -2.6   -1.5   0.2    0.2
XM_343636.1
        Rn.31977
NM_012663.1        Rn.12939   1369974_at0.1    1      1      0.7    -0.1
        Rn.31977
NM_012663.1        Rn.12939   1369974_AT.1
                                        0      1      1      0.7    -0.1
        Rn.31977
NM_012663.1        Rn.12939   1369974_at0.1    1      1      0.7    -0.1
        Rn.74044
NM_017272.15       Rn.74044   1368718_atA      A      A      A      A
        Rn.74044
NM_017272.15       Rn.74044   1368718_atA      A      A      A      A
        Rn.22      Rn.22      1368912_ATA      A      A      A      A
        Rn.25717   Rn.25717   1370822_atA      A      A      1.5    A
        Rn.6059
NM_017050.1        Rn.6059    1367641_AT.9
                                        0      -0.5   -0.4   0.6    -0.4
        Rn.6059
NM_017050.1        Rn.6059    1367641_at0.9    -0.5   -0.4   0.6    -0.4
        Rn.6059
NM_017050.1        Rn.6059    1367641_at0.9    -0.5   -0.4   0.6    -0.4
        Rn.484
NM_031102.1        Rn.484     1367623_AT-0.1   -0.2   -0.1   0.5    0.3
NM_017008.2
        Rn.4200
XM_215331.2                           0
                   Rn.103146 1370883_AT.2      -0.8   0.9    2.4    -4.4
        Rn.11088
NM_013083.1        Rn.11088 1370283_at0.5      -1.1   -0.4   -0.9   0.6
        Rn.3205
NM_138827.1        Rn.3205 1370848_AT -2.8     -2.1   -1.5   -0.8   0.9
        Rn.54397
NM_138826.2                           0.4
                   Rn.54397 1371237_A_AT       -7.8   -2.9   0.7    -4.2
        Rn.10741
NM_138513.1        Rn.88080 1370562_atA        A      A      A      A
        Rn.11359
NM_031576.1        Rn.11359 1387109_AT0        -1.9   -0.7   -0.4   0.2
        Rn.10250
NM_024127.1        Rn.10250 1368947_at-1.9     -1.8   -0.7   0.1    0.6

        Rn.10631
NM_022441.1        Rn.10631   1368553_atA      0      1.1    0.3    0.3
        Rn.10631
NM_022441.1        Rn.10631   1368553_ATA      0      1.1    0.3    0.3
        Rn.10631
NM_022441.1        Rn.10631   1368553_atA      0      1.1    0.3    0.3
        Rn.9975
NM_013155.1        Rn.9975    1369098_ATA      1.7    1.7    -0.4   A
        Rn.9975
NM_013155.1        Rn.9975    1369098_atA      1.7    1.7    -0.4   A
        Rn.9975
NM_013155.1        Rn.9975    1369098_atA      1.7    1.7    -0.4   A
        Rn.1574
NM_022502.1        Rn.1574    1370236_at-2.8   -3.7   -2.3   -1.9   1
        Rn.1574
NM_022502.1        Rn.1574    1370236_at-2.8   -3.7   -2.3   -1.9   1
        Rn.1574
NM_022502.1        Rn.1574    1370236_AT-2.8   -3.7   -2.3   -1.9   1
        Rn.10250
NM_024127.1        Rn.10250   1368947_AT-1.9   -1.8   -0.7   0.1    0.6
        Rn.64587
NM_012879.1        Rn.89295   1387228_at2.9    -7     -3.9   -0.5   -7.2
        Rn.64587
NM_012879.1        Rn.89295   1387228_at2.9    -7     -3.9   -0.5   -7.2
        Rn.64587
NM_012879.1        Rn.89295   1387228_at2.9    -7     -3.9   -0.5   -7.2
        Rn.40901
XM_341399.1        Rn.11176   1376062_at3      A      A      A      A
        Rn.9910
NM_017322.1        Rn.9910    1368646_at1      1.4    0.4    0      -0.2
        Rn.9910
NM_017322.1        Rn.9910    1368646_at1      1.4    0.4    0      -0.2
         Rn.9910 Rn.9910 1368646_at1
NM_017322.1                                    1.4    0.4    0      -0.2
         Rn.9910 Rn.9910 1368646_at1
NM_017322.1                                    1.4    0.4    0      -0.2
         Rn.29771 Rn.29771 1367854_at1.2       -3.9   -2.2   -1     0.5
         Rn.2411 Rn.2411 1370968_AT
XM_342346.1                           -0.9     -0.8   -0.1   -0.7   0.8
         Rn.3545 Rn.3545 1398759_AT.9
NM_013043.1                           0        1      0.9    1.4    -4.7
         Rn.9676 Rn.9676 1368481_AT
NM_012714.1                           A        A      A      A      A
         Rn.9676 Rn.9676 1368481_AT
NM_012714.1                           A        A      A      A      A
         Rn.9676 Rn.9676 1368481_atA
NM_012714.1                                    A      A      A      A
         Rn.1762 Rn.1762 1371687_AT
NM_172008.1                           -0.1     -2     -1.8   -0.7   1
         Rn.9996 Rn.9996 1387611_atA
NM_016993.1                                    A      A      A      A
         Rn.9996 Rn.9996 1387611_atA
NM_016993.1                                    A      A      A      A
         Rn.9996 Rn.9996 1387611_AT
NM_016993.1                           A        A      A      A      A
         Rn.54456 Rn.107069 1371099_at2.3      -6.8   -3.7   -1.5   -7.1
         Rn.6115 Rn.6115 1369950_AT
NM_053593.1                           -0.5     -0.7   -0.4   0      0.6
         Rn.1984 Rn.1984 1398798_AT
NM_022539.1                           -1.1     0.5    -0.4   -0.5   0.4
         Rn.1984 Rn.1984 1398798_AT
NM_022539.1                           -1.1     0.5    -0.4   -0.5   0.4
         Rn.10948 Rn.10948 1368711_AT
"NM_012743.1, NM_012743.1, XM_346676" 3        -1.7   -1.5   -2.7   -2
         Rn.25717 Rn.25717 1370822_AT A        A      A      1.5    A

        Rn.2135
XM_342732.1        Rn.2135    1387907_at-0.7   -0.8   0.3    1.5    0
        Rn.2135
XM_342732.1        Rn.2135    1387907_at-0.7   -0.8   0.3    1.5    0
        Rn.11389
NM_012930.1        Rn.11389   1386927_AT.1
                                        0      0.4    1.2    -1.4   0.1
        Rn.2178
NM_017094.1        Rn.2178    1368924_at-0.4   -0.8   -1.9   -2.7   1
NM_012651.1
        Rn.874
NM_012615.1        Rn.874     1370163_at-0.7   0      -0.4   1.5    0
        Rn.874
NM_012615.1        Rn.874     1370163_at-0.7   0      -0.4   1.5    0
        Rn.874
NM_012615.1        Rn.874     1370163_at-0.7   0      -0.4   1.5    0




        Rn.2305
NM_017290.1        Rn.2305 1370426_a_at0.2     -2.7   0.4    0.2    0.5
        Rn.4083
NM_031114.1        Rn.4083 1386890_AT  -2.1    -2.2   -0.7   0.1    0.8
        Rn.11274
NM_012543.1        Rn.11274 1387874_AT -2.5    2.7    -0.2   1      -2.1
        Rn.9660
NM_012669.1        Rn.9660
        Rn.9660
NM_012669.1        Rn.9660 1369148_at1.1       -2.6   A      1.5    A
        Rn.9660
NM_012669.1        Rn.9660 1369148_at1.1       -2.6   A      1.5    A
        Rn.64587
NM_012879.1        Rn.89295 1387228_at2.9      -7     -3.9   -0.5   -7.2
        Rn.6302
NM_016986.1        Rn.6302 1367702_at0.9       1      0.7    0.5    -1.7
        Rn.6302
NM_016986.1        Rn.6302 1367702_AT.90       1      0.7    0.5    -1.7
        Rn.6302
NM_016986.1        Rn.6302 1367702_at0.9       1      0.7    0.5    -1.7
        Rn.9857
NM_017134.1        Rn.9857 1368266_AT.42       -5.3   -3.8   -4.7   -1.3
        Rn.32351
NM_138828.1        Rn.32351 1370862_at1.3      -3.8   -1.7   -2.6   -8.3
        Rn.14615
XM_231032.2        Rn.139733 1372664_atA       1      A      A      A
        Rn.22325                       0.1
                   Rn.22325 1386321_s_at       -0.4   A      A      0.6
        Rn.11344   Rn.89639 1368535_atA        A      A      A      A
        Rn.12300                       -2.3
                   Rn.12300 1371170_A_AT       -2.2   -2.7   -3.7   1.3
        Rn.12300                       -2.3
                   Rn.12300 1371170_A_AT       -2.2   -2.7   -3.7   1.3
        Rn.12300                       -2.3
                   Rn.12300 1371170_A_AT       -2.2   -2.7   -3.7   1.3
        Rn.28195                       2
                   Rn.28195 1387221_AT.1       -3.5   -1.8   -3.6   0.3
        Rn.6215
NM_012820.1        Rn.6215 1370939_AT.71       0.3    0.6    -1.4   -1.4
        Rn.10641
NM_012981.1        Rn.10641 1387368_at-0.8     -0.3   A      0.3    0.6
         Rn.10641 Rn.10641 1387368_AT
NM_012981.1                            -0.8   -0.3   A      0.3    0.6
         Rn.10641 Rn.10641 1387368_at-0.8
NM_012981.1                                   -0.3   A      0.3    0.6
         Rn.12205 Rn.124916 1377143_AT -0.6   -0.1   -0.3   -0.2   0.6
         Rn.12205 Rn.124916 1377143_AT -0.6   -0.1   -0.3   -0.2   0.6
         Rn.44432 Rn.2611 1388196_AT.3 1      1.2    1      1.6    -2.7
         Rn.44432 Rn.2611 1388196_AT.3 1      1.2    1      1.6    -2.7
         Rn.44432 Rn.2611 1388196_AT.3 1      1.2    1      1.6    -2.7
         Rn.44440 Rn.44440 1368792_atA
NM_019163.1                                   -0.3   A      -0.7   0.6
         Rn.44440 Rn.44440 1368792_atA
NM_019163.1                                   -0.3   A      -0.7   0.6
         Rn.44440 Rn.44440 1368792_AT
NM_019163.1                            A      -0.3   A      -0.7   0.6
         ---
NM_152935.1        Rn.2143 1370785_s_at-0.9   0.7    0.3    0.5    0.1
         ---
NM_152935.1        Rn.2143 1370785_s_at-0.9   0.7    0.3    0.5    0.1
         Rn.10184 Rn.10184 1369787_AT
"NM_012688.1, NM_012688.1, XM_341221" A       A      A      A      A
         Rn.4017 Rn.127779 1367710_AT.1
NM_017257.1                            0      -0.4   -0.4   -0.1   0.3
         Rn.10400 Rn.10400 1387667_AT
NM_012611.2                            A      A      A      A      A
         Rn.17982 Rn.17982 1367453_AT
NM_053743.1                            0      0.6    0.8    0.2    0.2
         Rn.2641 Rn.2641 1369980_S_AT  -0.2   0.4    0.7    0.6    0.1
         Rn.2641 Rn.2641 1369980_S_AT  -0.2   0.4    0.7    0.6    0.1
         Rn.999
NM_017138.1        Rn.999    1367569_AT0      0.3    0.1    0.5    -0.1
         Rn.25764 Rn.96083 1370810_at-2.9     -3.1   -0.8   -2.4   1.2
         Rn.2712 Rn.2712 1367796_AT.6
NM_030861.1                            0      -0.3   0.3    0      0.5
         Rn.32315 Rn.103179 1386996_at
"NM_017343.1, NM_017343.1, XM_346859" 0.4     -0.8   0.7    1.1    -0.2
         Rn.4210 Rn.60078 1372090_at-0.4
NM_022210.1                                   0.7    0.3    0.1    0.1
         Rn.44443 Rn.4210 1387646_A_AT
NM_022210.1                            0.3    0.9    0.9    0      A
         Rn.4210 Rn.60078 1372090_at-0.4
NM_022210.1                                   0.7    0.3    0.1    0.1
         Rn.22279 Rn.22279 1371643_AT
NM_171992.2                            -2.2   -3.5   -1.2   -0.3   1.2
         Rn.44446 Rn.44446 1369514_AT  A      A      A      A      A
         Rn.44446 Rn.44446 1369515_S_ATA      A      A      A      A
         Rn.44446 Rn.44446 1369515_S_ATA      A      A      A      A
         Rn.44446 Rn.44446 1369515_S_ATA      A      A      A      A
         Rn.1658 Rn.1658 1369588_A_AT
"NM_012915.1, NM_012915.1, XM_343371" -2.3    -2     -0.5   0.2    0.6
         Rn.1869 Rn.1869 1398755_AT
NM_130823.2                            -0.4   -0.8   -0.6   0.2    0.3
         Rn.1869 Rn.1869 1398755_AT
NM_130823.2                            -0.4   -0.8   -0.6   0.2    0.3
         Rn.13686 Rn.13686 1370186_AT.7
NM_012708.1                            0      -2.2   0.1    -0.1   0.3
         Rn.29244 Rn.29244 1367786_AT.3
NM_080767.1                            0      -3.1   -1.8   -1.6   0.6
         Rn.24821 Rn.105934 1368853_AT
NM_012686.1                            A      A      0.9    -0.4   A
         Rn.15413 Rn.15413 1388194_at-2.2
XM_343389.1                                   1.1    1.6    -0.1   -0.7
         Rn.12
NM_012967.1        Rn.12     1387202_AT-0.6   -5     -1.9   -0.8   1.1
         Rn.80835 Rn.80835 1370961_AT
NM_017306.2                            A      A      A      A      A
         Rn.1491 Rn.108074 1369926_at
"NM_022525.2, NM_022525.2, XM_346395" -3.7    -2     0.1    1.1    -6
         Rn.35994 Rn.35994 1370808_AT.9
NM_138877.1                            1      -1.3   0.1    0.4    -0.5
         Rn.2854 Rn.2854 1367777_AT.1
NM_057197.1                            1      -1.2   1.3    0.5    -1.1
         Rn.2854 Rn.2854 1367777_at1.1
NM_057197.1                                   -1.2   1.3    0.5    -1.1
         Rn.2854 Rn.2854 1367777_at1.1
NM_057197.1                                   -1.2   1.3    0.5    -1.1
         Rn.15413 Rn.15413 1388194_at-2.2
XM_343389.1                                   1.1    1.6    -0.1   -0.7
         Rn.15413 Rn.15413 1388194_at-2.2
XM_343389.1                                   1.1    1.6    -0.1   -0.7
         ---
XM_343844.1        ---       1373379_at-0.2   -0.5   -1.3   -0.7   0.6
"XM_232954.2, XM_232954.2, NM_178095.2"
NM_173837.2
         Rn.16195 Rn.16195 1387818_at0.8
NM_053736.1                                   -0.9   -0.3   -0.3   0.1
         Rn.67084 Rn.67084 1387618_at0.5
NM_053733.1                                   0.3    0.2    -0.4   0.2
         Rn.32199 Rn.32199 1368652_at-0.3
NM_031632.1                                   -0.5   0      0.1    0.7
         Rn.54782 Rn.82754 1371252_atA
NM_145879.1                                  A      A      A      A
         Rn.44228 Rn.44228 1370153_AT
NM_019216.1                           -0.5   A      A      -0.4   -0.8
         Rn.2819 Rn.2819 1398769_AT
NM_019222.1                           -1.8   -3.1   -1.4   -0.3   0.9
         Rn.10893 Rn.10893 1368571_AT
NM_021997.1                           -3.2   -3.8   -2.4   -1.9   0.8
         Rn.44181 Rn.44181 1387823_AT.2
NM_021757.1                           0      0      -0.1   0.5    0.3
         Rn.44181 Rn.44181 1387823_AT.2
NM_021757.1                           0      0      -0.1   0.5    0.3
         Rn.3834 Rn.3834 1386965_at-5.6
NM_012598.1                                  -1.7   0.1    -3     0.5
         Rn.3834 Rn.3834 1386965_at-5.6
NM_012598.1                                  -1.7   0.1    -3     0.5
         Rn.3834 Rn.3834 1386965_at-5.6
NM_012598.1                                  -1.7   0.1    -3     0.5
         Rn.11098 Rn.11098 1370004_at0.5
NM_017182.1                                  -0.2   -0.5   0.7    0.6
         ---
XM_238069.2        ---       1388119_AT
                                      -0.1   -0.4   -0.3   -0.2   0.5
         ---
XM_238069.2        ---       1388119_AT
                                      -0.1   -0.4   -0.3   -0.2   0.5
         Rn.2366 Rn.87821 1387101_at1.6
NM_053623.1                                  -1.3   -2.5   -0.4   0.1
         Rn.10293 Rn.10293 1370929_at-0.3
XM_341239.1                                  A      -0.3   2.3    -0.9
         Rn.10293 Rn.10293 1370929_at-0.3
XM_341239.1                                  A      -0.3   2.3    -0.9
         Rn.10249 Rn.10249 1370005_AT.7
NM_030586.1                           0      -0.1   0.3    0.7    0.3
         Rn.10249 Rn.10249 1370005_AT.7
NM_030586.1                           0      -0.1   0.3    0.7    0.3
         Rn.8864 Rn.96181 1374914_at0.1
XM_228032.2                                  -0.1   0.6    -0.4   0.2
         Rn.6686 Rn.6686 1386887_AT
NM_053586.1                           -0.2   0.9    0.7    0.1    -0.8
         Rn.8112 Rn.60067 1370825_a_at
NM_171994.2                           -0.5   0.3    -0.1   -0.1   0.5
         Rn.2306 Rn.15845 1387885_AT
NM_033351.1                           1      -1.4   -0.7   0.5    0.7
         Rn.2306 Rn.15845 1387885_AT
NM_033351.1                           1      -1.4   -0.7   0.5    0.7
         Rn.4153 Rn.4153 1398852_AT.6
NM_031111.1                           0      0      0.2    0.6    0
         Rn.1254 Rn.1254 1367561_AT
NM_022514.1                           0      0.2    0      0.2    0.3
         Rn.1254 Rn.1254 1367561_AT
NM_022514.1                           0      0.2    0      0.2    0.3
         ---       ---                0
                             1388271_AT.2    -2.3   -2.4   2.2    -3.2
         Rn.2050 Rn.119388 1398751_at0
"XM_343041.1, XM_343041.1, NM_031570.1" .2   0.1    0.1    0.2    0.2
         Rn.1868 Rn.1868 1367595_S_AT
NM_012512.1                           0.5    -1.8   -0.2   -0.2   0.1
         Rn.54749 Rn.99661 1367579_a_at
NM_022298.1                           -0.9   -2     -0.3   -0.1   0.3
         Rn.54749 Rn.99661 1367579_a_at
NM_022298.1                           -0.9   -2     -0.3   -0.1   0.3
         Rn.25754 Rn.25754 1367712_AT
NM_053819.1                           A      A      2.3    1.7    A
         Rn.25754 Rn.25754 1367712_atA
NM_053819.1                                  A      2.3    1.7    A
         Rn.25754 Rn.25754 1367712_atA
NM_053819.1                                  A      2.3    1.7    A
         Rn.55007 Rn.92965 1370275_AT
XM_343136.1                           -0.1   0.6    0.4    0.4    -0.4
         Rn.55007 Rn.92965 1370275_AT
XM_343136.1                           -0.1   0.6    0.4    0.4    -0.4
         Rn.9354 Rn.9354 1370183_AT
NM_012791.1                           0      0.3    0.5    0.2    0.4
         Rn.4225 Rn.4225 1398851_at0
NM_031603.1                                  0.6    0.2    0.4    0.3
NM_031347.1
         Rn.6975 Rn.6975 1368813_at-0.9
NM_013154.1                                  1.4    A      A      0.4
         Rn.6975 Rn.6975 1368813_at-0.9
NM_013154.1                                  1.4    A      A      0.4
         Rn.6975 Rn.6975 1368813_AT   -0.9   1.4    A      A      0.4
         Rn.3723 Rn.3723 1367795_at-0.9
NM_019242.1                                  0.8    -1.3   -0.7   0.7
         Rn.3723 Rn.3723 1367795_AT
NM_019242.1                           -0.9   0.8    -1.3   -0.7   0.7
         Rn.3723 Rn.3723 1367795_at-0.9
NM_019242.1                                  0.8    -1.3   -0.7   0.7




        Rn.1059
NM_013224.1        Rn.1059   1367596_AT.3
                                       0     0.1    0      0.3    0.1
        Rn.989
NM_019130.1        Rn.989    1370077_ATA     A      A      A      A
        Rn.989
NM_019130.1        Rn.989    1370077_atA     A      A      A      A
        Rn.989
NM_019130.1        Rn.989    1370077_atA     A      A      A      A
        Rn.22146
XM_342107.1        Rn.22146   1385807_atA      A      A      A      A
        Rn.1011
NM_031151.2        Rn.1011    1369927_AT-0.4   0.9    0.8    -0.2   -0.8
        Rn.1011
NM_031151.2        Rn.1011    1369927_AT-0.4   0.9    0.8    -0.2   -0.8
        Rn.8019
NM_031116.1        Rn.8019    1369983_at0.8    -1.8   1.8    1.8    -1.7
        Rn.8019
NM_031116.1        Rn.8019    1369983_AT.8
                                        0      -1.8   1.8    1.8    -1.7
        Rn.8019
NM_031116.1        Rn.8019    1369983_at0.8    -1.8   1.8    1.8    -1.7
NM_153304.1
        Rn.827
NM_080888.1        Rn.827   1367898_at-0.2     -0.5   0.3    -0.1   0.6
        Rn.19770
NM_133416.1        Rn.19770 1368482_at-3.7     -4.4   -4.6   -4     0.8
        Rn.38487
NM_053704.1        Rn.38487 1387249_atA        A      A      A      A


XM_226742.2

        Rn.81078
NM_130422.1        Rn.81078 1387605_at1.2      A      A      A      0.4
        Rn.54474
NM_022277.1        Rn.54474 1369262_at0.1      -3.1   A      0.1    0.6
XM_213329.2
        Rn.14598
NM_053812.1        Rn.14598   1368066_at-0.1   0      0.3    0      1
        Rn.14598
NM_053812.1        Rn.14598   1368066_at-0.1   0      0.3    0      1
        Rn.14598
NM_053812.1        Rn.14598   1368066_at-0.1   0      0.3    0      1
        Rn.48798
NM_022684.1        Rn.31142   1369683_at-0.5   -2.4   -1     -1     1.3
        Rn.2423
NM_024403.1        Rn.2423    1367624_at0      1.8    -0.3   -0.1   0
        Rn.8395
NM_030867.1        Rn.8395    1367943_at-0.4   1.3    0.6    0      0
        Rn.28010
NM_057138.1        Rn.28010   1368545_atA      A      1.2    1.1    0.4
        Rn.64522
NM_023979.1        Rn.64522   1369197_atA      -0.3   0.2    -0.4   0.5
        Rn.1438
NM_022522.2        Rn.1438    1367890_at-0.8   -0.8   0.3    -0.2   0.5
        Rn.1438
NM_022522.2        Rn.1438    1367890_at-0.8   -0.8   0.3    -0.2   0.5
        Rn.1438
NM_022522.2        Rn.1438    1367890_at-0.8   -0.8   0.3    -0.2   0.5
XM_342491.1
        Rn.64412
XM_341548.1        Rn.64412   1382775_atA      A      3      A      A
        Rn.64412
XM_341548.1        Rn.64412   1382775_atA      A      3      A      A
        Rn.64412
XM_341548.1        Rn.64412   1382775_atA      A      3      A      A
        Rn.44219
NM_021846.1        Rn.4067    1370141_at-0.5   0.5    0      -0.2   0.3
        Rn.19222
NM_053355.1        Rn.19222   1368424_at-0.3   -0.1   -0.4   -0.8   0.7
        Rn.38647
XM_341818.1        Rn.87520   1390355_at-6.3   2.6    -5.7   -5.9   -8.2
        Rn.44266
NM_053777.1        Rn.44266   1387971_a_at
                                        -0.1   1.1    1.2    1      -0.2
        Rn.44266
NM_053777.1        Rn.44266   1386973_a_at
                                        0      0.5    1.3    1      -0.9
        Rn.44266
NM_053777.1        Rn.44266   1386973_a_at
                                        0      0.5    1.3    1      -0.9
        Rn.44266
NM_053777.1        Rn.44266   1386973_a_at
                                        0      0.5    1.3    1      -0.9
        Rn.44266
NM_053777.1        Rn.44266   1387971_a_at
                                        -0.1   1.1    1.2    1      -0.2
        Rn.24897
NM_031599.1        Rn.24897   1368326_AT-0.5   -1.3   -0.2   -0.3   0.8
        Rn.44267
NM_021850.1        Rn.44267   1369611_ATA      A      A      A      A
        Rn.44267
NM_021850.1        Rn.44267   1369611_ATA      A      A      A      A
        Rn.17172
NM_057186.1        Rn.92789   1370237_at0.9    0.1    1      0.3    -1.7
        Rn.17172
NM_057186.1        Rn.92789   1370237_at0.9    0.1    1      0.3    -1.7
        Rn.17172
NM_057186.1        Rn.92789   1370237_at0.9    0.1    1      0.3    -1.7
        Rn.17172
NM_057186.1        Rn.92789   1370237_at0.9    0.1    1      0.3    -1.7
        Rn.17172
NM_057186.1        Rn.92789   1370237_at0.9    0.1    1      0.3    -1.7
        Rn.1504
NM_033235.1        Rn.13492   1367653_A_AT
                                        -0.3   0.3    0.4    0.2    -0.4
        Rn.6343
NM_022602.1        Rn.6343    1367725_AT.6
                                        0      1      1.5    1.7    -2.1
        Rn.6343
NM_022602.1        Rn.6343    1367725_at0.6    1      1.5    1.7    -2.1
        Rn.6343
NM_022602.1        Rn.6343    1367725_at0.6    1      1.5    1.7    -2.1
         Rn.6343 Rn.6343 1367725_at0.6
NM_022602.1                                   1      1.5    1.7    -2.1
         Rn.6343 Rn.6343 1367725_AT.6
NM_022602.1                           0       1      1.5    1.7    -2.1
         Rn.2090 Rn.2090 1386925_AT
NM_019289.2                           -2.4    -3.7   -1.8   -1.4   0.8
         Rn.2090 Rn.2090 1386925_AT
NM_019289.2                           -2.4    -3.7   -1.8   -1.4   0.8
         Rn.1592 Rn.1592 1386960_AT.6
NM_031589.1                           1       1.5    -1.2   1.1    -1.6
         Rn.1592 Rn.1592 1386960_AT.6
NM_031589.1                           1       1.5    -1.2   1.1    -1.6
         Rn.1592 Rn.1592 1386960_AT.6
NM_031589.1                           1       1.5    -1.2   1.1    -1.6
         Rn.1592 Rn.1592 1386960_AT.6
NM_031589.1                           1       1.5    -1.2   1.1    -1.6
         Rn.1592 Rn.1592 1386960_AT.6
NM_031589.1                           1       1.5    -1.2   1.1    -1.6
         Rn.29984 Rn.127801 1369584_AT
NM_053565.1                           A       A      A      A      A
         Rn.29984 Rn.127801 1369584_atA
NM_053565.1                                   A      A      A      A
         Rn.29984 Rn.127801 1369584_atA
NM_053565.1                                   A      A      A      A
         Rn.29984 Rn.127801 1369584_atA
NM_053565.1                                   A      A      A      A
         Rn.29984 Rn.127801 1369584_atA
NM_053565.1                                   A      A      A      A
         Rn.29983 Rn.15045 1369577_AT
NM_058208.1                           A       A      A      A      A
         Rn.53995 Rn.53995 1369557_AT.8
NM_022260.1                           0       0.8    0.4    0.1    0.2
         Rn.53995 Rn.53995 1369557_at0.8
NM_022260.1                                   0.8    0.4    0.1    0.2
         Rn.53995 Rn.53995 1369557_at0.8
NM_022260.1                                   0.8    0.4    0.1    0.2
         Rn.53995 Rn.53995 1369557_AT.8
NM_022260.1                           0       0.8    0.4    0.1    0.2
         Rn.53995 Rn.53995 1369557_at0.8
NM_022260.1                                   0.8    0.4    0.1    0.2
         Rn.3946 Rn.3946 1370029_AT
NM_019201.2                           -1.1    0.6    0.2    0      0.3
         Rn.48688 Rn.82709 1387338_s_at
                                      A
"NM_022612.1, NM_022612.1, NM_171988.1"       A      A      A      A
         Rn.48688 Rn.82709 1387338_s_at
                                      A
"NM_022612.1, NM_022612.1, NM_171988.1"       A      A      A      A
         Rn.10722 Rn.10722 1369814_atA
NM_019233.1                                   A      A      0.9    A
         Rn.3318 Rn.3318 1386862_at-3.5
NM_013132.1                                   -3.6   -0.6   -1.2   0.7
         Rn.3318 Rn.3318 1386862_at-3.5
NM_013132.1                                   -3.6   -0.6   -1.2   0.7
         Rn.3318 Rn.3318 1386862_at-3.5
NM_013132.1                                   -3.6   -0.6   -1.2   0.7
         Rn.54594 Rn.54594 1386909_A_AT
NM_031353.1                           -0.8    2      1.1    0.4    -1.2
         Rn.54594 Rn.54594 1367706_at-0.7
NM_031353.1                                   1.2    0.7    0.4    -1.3
         Rn.54594 Rn.54594 1367706_at-0.7
NM_031353.1                                   1.2    0.7    0.4    -1.3
         Rn.24091 Rn.24091 1387975_at
"NM_031795.1, NM_031795.1, XM_346741" -0.1    0.1    0.7    0.2    0.1
         Rn.2627 Rn.83595 1388253_atA
NM_031841.1                                   A      A      A      A
         Rn.2627 Rn.83595 1367668_a_at
NM_031841.1                           -0.4    -0.1   1.6    2.2    -2.9
         Rn.2627 Rn.83595 1367668_a_at
NM_031841.1                           -0.4    -0.1   1.6    2.2    -2.9


         Rn.40130 Rn.40130 1388164_AT.8
XM_215303(LL)                          1      -0.3   -0.5   -0.2   -0.1
         Rn.44461 Rn.44461 1369084_a_at
NM_017312.1                            0.2    A      0.7    1.8    A
         Rn.44461 Rn.44461 1369084_A_AT
NM_017312.1                            0.2    A      0.7    1.8    A
NM_017312.1
         Rn.31756 Rn.88160 1368305_at1.2
NM_031775.1                                   -3.4   A      0.9    0.3
         Rn.31756 Rn.88160 1368305_at1.2
NM_031775.1                                   -3.4   A      0.9    0.3
         Rn.31756 Rn.88160 1368305_AT.2
NM_031775.1                            1      -3.4   A      0.9    0.3
         ---
XM_342006.1        ---       1380854_at-2.7   -0.1   1.1    -0.7   0.4
         ---
XM_342006.1        ---       1380854_at-2.7   -0.1   1.1    -0.7   0.4
         ---
XM_342006.1        ---       1380854_at-2.7   -0.1   1.1    -0.7   0.4
         Rn.74242 Rn.74242 1388000_atA
NM_031743.1                                   A      A      A      A
         Rn.74242 Rn.74242 1388000_atA
NM_031743.1                                   A      A      A      A
         Rn.74242 Rn.74242 1388000_atA
NM_031743.1                                   A      A      A      A
         Rn.7409 Rn.7409 1369559_A_AT
NM_019195.1                            0      -1.8   -0.9   0      1
         Rn.10877 Rn.10877 1368124_at
"NM_133578.1, NM_133578.1, XM_346588" 0.1     -1.5   1.2    0.1    -0.1
         Rn.10877 Rn.10877 1368124_AT
"NM_133578.1, NM_133578.1, XM_346588" 0.1     -1.5   1.2    0.1    -0.1
         Rn.10877 Rn.10877 1368124_at
"NM_133578.1, NM_133578.1, XM_346588" 0.1    -1.5   1.2    0.1    -0.1
         Rn.36696 Rn.36696 1386991_A_AT
NM_022698.1                           -1.2   -1.1   -0.7   0.1    0.8
         Rn.11252 Rn.7947 1387060_at-2.1
NM_031642.1                                  -1.4   -0.9   -1.1   1
         Rn.11252 Rn.7947 1387060_at-2.1
NM_031642.1                                  -1.4   -0.9   -1.1   1
         Rn.11252 Rn.7947 1387060_AT
NM_031642.1                           -2.1   -1.4   -0.9   -1.1   1
         Rn.10847 Rn.10847 1368636_AT
NM_053763.1                           A      0.8    0.9    0.9    0
         Rn.252    Rn.252    1367915_at
"NM_053437.1, NM_053437.1, XM_346804" -0.2   -0.2   0.3    0.3    0.3
         Rn.252    Rn.252    1367915_at
"NM_053437.1, NM_053437.1, XM_346804" -0.2   -0.2   0.3    0.3    0.3
         Rn.252    Rn.252    1367915_at
"NM_053437.1, NM_053437.1, XM_346804" -0.2   -0.2   0.3    0.3    0.3
         Rn.8124 Rn.8124 1370321_at0.4
NM_031356.1                                  0.1    0.1    0.3    -0.1
         Rn.8124 Rn.8124 1370321_at0.4
NM_031356.1                                  0.1    0.1    0.3    -0.1
         Rn.8124 Rn.8124 1370321_at0.4
NM_031356.1                                  0.1    0.1    0.3    -0.1
         Rn.3061 Rn.105862 1386926_AT.6
NM_053607.1                           0      -4.6   -3.1   -1.7   0.8
         Rn.23443 Rn.23443 1369179_a_at
NM_013124.1                           -2.9   -3.7   -3.3   -3.7   1.3
         Rn.23443 Rn.23443 1369179_A_AT
NM_013124.1                           -2.9   -3.7   -3.3   -3.7   1.3
         Rn.23443 Rn.23443 1369179_a_at
NM_013124.1                           -2.9   -3.7   -3.3   -3.7   1.3
         Rn.13333 Rn.13333 1368669_at-1.9
NM_019354.1                                  -3.1   0.9    -1.6   0.4
         Rn.13333 Rn.13333 1368669_at-1.9
NM_019354.1                                  -3.1   0.9    -1.6   0.4
         Rn.13333 Rn.13333 1368669_AT
NM_019354.1                           -1.9   -3.1   0.9    -1.6   0.4
         Rn.18983 Rn.18983 1368248_AT
NM_031242.1                           A      A      A      2.7    -3.6
         Rn.22514 Rn.22514 1370304_at-1.4
NM_019351.1                                  1.5    1      0.2    -0.6
         Rn.22514 Rn.22514 1370304_at-1.4
NM_019351.1                                  1.5    1      0.2    -0.6
         Rn.44359 Rn.44359 1369328_atA
NM_053922.1                                  1.3    A      A      A
         Rn.44359 Rn.44359 1369328_atA
NM_053922.1                                  1.3    A      A      A
         Rn.44359 Rn.44359 1369328_AT
NM_053922.1                           A      1.3    A      A      A
         Rn.3053 Rn.3053 1370159_at-0.3
NM_031983.2                                  0.5    0.3    0.1    0.7
         Rn.11130 Rn.11130 1370530_A_AT
NM_030992.1                           -1     -3.3   -1.9   -0.8   1.1
         Rn.28931 Rn.28931 1369083_AT
NM_031147.1                           A      0.9    A      0.8    A
         Rn.56138 Rn.56138 1370662_a_at
                                      -1.6
"XM_347144.1, XM_347144.1, NM_080583.1"      A      0.1    -0.2   0.4
         Rn.82693 Rn.82693 1398834_AT.6
NM_133283.1                           0      0.5    0.4    0.8    0
         Rn.36102 Rn.36102 1368211_AT
NM_022672.1                           0      0.3    0.2    0.4    0.1
         Rn.36102 Rn.36102 1368211_AT
NM_022672.1                           0      0.3    0.2    0.4    0.1
         Rn.5976 Rn.111576 1367625_AT
"NM_031100.1, NM_031100.1, XM_227695" 0.4    0      0.1    -0.2   0.2
         Rn.2833 Rn.2833 1370866_at0.4       -0.2   -0.2   0.3    0.1
"XM_344520.1, XM_344520.1, NM_198791.1"
         Rn.11254 Rn.88804 1368725_atA
NM_019147.1                                  A      1.4    1.8    A
         Rn.11254 Rn.88804 1368725_atA
NM_019147.1                                  A      1.4    1.8    A
         Rn.11254 Rn.88804 1368725_atA
NM_019147.1                                  A      1.4    1.8    A
         ---       ---                -0.6
                             1372826_AT      0.4    -0.6   -1.3   0.5
                                      0.1
         Rn.24460 Rn.98627 1383141_a_at      0      0.1    0.6    0.3
                                      0.1
         Rn.24460 Rn.98627 1383141_a_at      0      0.1    0.6    0.3
         Rn.23954 Rn.23954 1374524_AT.4
XM_343627.1                           1      -1.3   -1.7   1.8    -0.2
         Rn.17868 Rn.17868 1399043_at-1
XM_347256.1                                  0.4    -0.8   -0.8   0.5
         Rn.8411 Rn.8411 1370804_AT
NM_172036.2                           0      -0.3   -0.4   0.2    0.3
         Rn.8411 Rn.8411 1370804_AT
NM_172036.2                           0      -0.3   -0.4   0.2    0.3
         Rn.3031 Rn.127774 1371305_AT
XM_343278.1                           0      0.2    -0.3   -0.1   0.3
         Rn.12592 Rn.33229 1387354_AT
NM_032612.1                           -0.1   -1     -0.1   -0.4   0.5
         Rn.2079 Rn.2079 1398860_AT.1
NM_138878.1                           0      0      -0.1   0.3    0.4
         Rn.2079 Rn.2079 1398860_AT.1
NM_138878.1                           0      0      -0.1   0.3    0.4
         Rn.18996 Rn.18996 1373203_at-0.6    -0.7   -0.5   0.4    0.8
         Rn.3772 ---
XM_213774.2                           0
                             1371907_AT.1    0.2    0.4    0.6    0.4
         Rn.3658 Rn.3658 1373693_AT.2
XM_213518.2                           1      A      -1.5   2.4    A
         Rn.8160 Rn.46563 1371662_at-0.2
XM_214694.2                                  0.6    0.4    -0.5   0.6
         Rn.8160 Rn.46563 1371662_at-0.2
XM_214694.2                                  0.6    0.4    -0.5   0.6
         Rn.8160 Rn.46563 1371662_at-0.2
XM_214694.2                                  0.6    0.4    -0.5   0.6
         Rn.1439 Rn.1439 1398301_at0.5
NM_022504.1                                  A      0.1    0.5    0.2
         ---       ---                2.1
                             1376151_A_AT    -0.9   -0.3   0      -0.7
         ---       ---                2.1
                             1376151_A_AT    -0.9   -0.3   0      -0.7
         ---       ---                2.1
                             1376151_A_AT    -0.9   -0.3   0      -0.7
         ---
XM_343496.1        ---       1371847_AT
                                      -0.5   -0.9   0.6    2.7    -3.1
         ---
XM_343496.1        ---       1371847_AT
                                      -0.5   -0.9   0.6    2.7    -3.1
         Rn.54596 Rn.128189 1372581_AT
XM_213441.2                           0      0.6    -0.2   0.2    0.4
         Rn.2978 Rn.128917 1388900_AT.3
XM_347003.1                           0      -0.1   0.1    0.3    0.6
         Rn.2978 Rn.128917 1388900_AT.3
XM_347003.1                           0      -0.1   0.1    0.3    0.6
         Rn.2978 Rn.128917 1388900_AT.3
XM_347003.1                           0      -0.1   0.1    0.3    0.6
         Rn.969
XM_343144.1                           -0.1
                   Rn.105641 1371304_A_AT    -2.1   -0.3   0.6    0.1
         Rn.2880 Rn.79423 1367531_AT
XM_213755.2                           0      -0.8   0.1    0.4    0.5
         Rn.2727 Rn.129193 1372413_AT
XM_217048.2                           -1.3   0.5    0.7    0.4    0.1
         Rn.29857 Rn.29857 1370190_at0
NM_053985.2                                  -1.3   -0.5   -0.2   0.3
         Rn.29857 Rn.29857 1370190_at0
NM_053985.2                                  -1.3   -0.5   -0.2   0.3
         Rn.2559 Rn.95177 1373592_AT.1
XM_341522.1                           1      -1.2   0.5    1.2    -0.3
         Rn.3142 Rn.88169 1367855_at0.8
NM_031541.1                                  -2.9   -1.6   -1.6   1
         Rn.21315 Rn.107213 1369977_AT
NM_017237.1                           A      A      A      A      A
         Rn.21315 Rn.107213 1369977_AT
NM_017237.1                           A      A      A      A      A
         Rn.44178 Rn.93200 1370989_atA
NM_012643.1                                  A      A      A      A
         Rn.24811 Rn.24811 1383945_at-0.5    -0.5   -0.1   -1.3   0.9
         Rn.24811 Rn.24811 1383945_at-0.5    -0.5   -0.1   -1.3   0.9
         Rn.24811 Rn.24811 1383945_at-0.5    -0.5   -0.1   -1.3   0.9
         Rn.755
NM_031105.1                           0
                   Rn.112597 1398770_AT.5    0      0.1    0.4    -0.2
         Rn.4264 Rn.4264 1372467_at0.6       1.2    0.9    1.1    -3
         Rn.4264 Rn.4264 1372467_at0.6       1.2    0.9    1.1    -3
         Rn.4264 Rn.4264 1372467_at0.6       1.2    0.9    1.1    -3
         Rn.32136 Rn.7896 1383302_AT
XM_341663.1                           -0.7   -1.6   -0.8   0      0.4
         Rn.4300 Rn.4300 1398754_AT.2
NM_031687.2                           0      -0.1   0.3    0.3    0
         Rn.30508 Rn.30508 1387222_at-0.5
NM_019907.1                                  0.2    -0.2   0.2    0.1
         Rn.11408 Rn.11408 1369699_atA
NM_012728.1                                  A      A      A      A
         Rn.11408 Rn.11408 1369699_AT
NM_012728.1                           A      A      A      A      A
         Rn.11408 Rn.11408 1369699_atA
NM_012728.1                                  A      A      A      A
         Rn.3360 Rn.3360 1368386_AT
NM_030846.1                           -0.5   -0.7   -0.5   -0.7   0.7
         Rn.3360 Rn.3360 1368386_AT
NM_030846.1                           -0.5   -0.7   -0.5   -0.7   0.7
         Rn.6673 Rn.144484 1371542_AT
XM_237302.2                           -0.9   1.8    0.9    -0.7   -0.8
         Rn.2454 Rn.82737 1387870_AT.6
NM_133290.2                           0      0.9    0.3    0.1    0.1
         Rn.3503 Rn.3503 1374070_atA
"XM_238459.2, XM_238459.2, NM_183403.1"      A      A      1.2    -0.4
         Rn.3503 Rn.3503 1374070_atA
"XM_238459.2, XM_238459.2, NM_183403.1"      A      A      1.2    -0.4
         Rn.3503 Rn.3503 1374070_atA
"XM_238459.2, XM_238459.2, NM_183403.1"      A      A      1.2    -0.4
         Rn.947    Rn.100285 1372254_AT
                                      2
"XM_215766.2, XM_215766.2, NM_199093.1" .2   -2.3   0.5    0.2    -7.5
         Rn.22462 Rn.23143 1375700_AT
XM_221268.2                           A      1.6    0.5    0.2    A
         Rn.22462 Rn.23143 1375700_AT
XM_221268.2                           A      1.6    0.5    0.2    A
         Rn.3384 Rn.3384 1367610_AT
NM_031103.1                           -0.3   -0.1   -0.2   -0.1   0.3
         Rn.6246 Rn.101159 1383564_AT.1
XM_215121.2                           0      -1.5   0.8    0.3    0
         Rn.6235 Rn.70397 1383241_AT.7
XM_242644.2                           1      -3.5   -0.5   -0.7   -0.6
         Rn.25180 Rn.25180 1377698_AT
XM_230854.2                           A      A      A      A      A
         Rn.3816 Rn.121836 1388980_AT -
"XM_218971.2, XM_218971.2, NM_199102.1" 0.5   0.3    0      0.1   0.3
         Rn.2660 Rn.2660 1367567_at0
NM_053971.1                                   -0.1   0      0.1   0.3
         Rn.2660 Rn.2660 1367567_at0
NM_053971.1                                   -0.1   0      0.1   0.3
NM_017290.1
         Rn.37805 Rn.37805 1388898_at-0.5
XM_213699.2                                   -0.5   -0.9   0     0.7
           11_Signal Log 11_Signal Log Ratio11_Signal Log Ratio Log Ratio 3&4G1 Log2 Apochip 5&6G1 Log2 (ch2/Ch1)
                      vs Ratio 11_Signal Log Ratio 11_Signal Apochip Apochip 3&4G2 Log2 (ch2/Ch1)
                                                                                     (ch2/Ch1)
M061-02 vsM061-03EEM061-04 vsM061-05 vsM061-06vs Apochip FoldchangeFoldchangeFoldchangeFoldchange 5&6G2 Log2
1.2       0.9        0.8       0.1         -0.2        0.054104 0.052219 0.366831 -0.43338
1.2       0.9        0.8       0.1         -0.2        -0.09869 -0.08707 0.068943 -0.06686
1.2       0.9        0.8       0.1         -0.2        -0.33782 0.699158 1.061947 0.011415
-0.4      -0.6       -0.4      -0.6        -0.5        0.001725 0.433707 0.009621 0.111693
-1.2      A          -1.8      0.7         -0.5        0.209565 -0.06542 -0.10331 -0.17526
-1.2      A          -1.8      0.7         -0.5        -0.02954 0.206487 0.285092 -0.26277
-1.2      A          -1.8      0.7         -0.5        -0.06354 -0.00163 0.005668 -0.23095
0.8       0.5        0.8       0.6         0.7         0.026006 0.078357 -0.27393 -0.17954
A         A          A         A           A           -0.22926 -0.56938 -0.32493 -0.01337
A         A          A         A           A            0.02769 -0.15323 -0.07096 0.223982
-0.1      -0.2       -0.1      0.6         0.8         -0.30847 -0.03433     -0.6431 -0.61846
-1.2      A          -1        -1.4        -0.7        0.307027 0.09191 0.110738 0.217093
-1.2      -1.3       -1.1      -1.2        -1.1        1.058522 -0.03435 0.004521 -0.09305
-1.2      -1.3       -1.1      -1.2        -1.1        0.651789 -0.27551     -0.2072 0.02449
-1.2      -1.3       -1.1      -1.2        -1.1        1.246168 0.340028 0.159778 -0.19457
0         0.1        0.1       0.5         0.5         -0.38432 0.204605 0.054767 -0.19587
1.3       0.8        1.6       0.9         0.9         -0.24132    -0.9935 -0.55592 -0.44037
1.3       0.8        1.6       0.9         0.9         0.666413 0.18932 0.053662 0.10593
1.3       0.8        1.6       0.9         0.9           -0.5449 -0.58979    -0.7163 -0.46817
A         A          A         A           A           -0.15821 0.158598 0.160631 -0.14325
0.6       0.7        0.7       0.6         0.7         0.034595 0.304914 0.321847 0.088581



A         A         A         A          A          0.439229    -0.4226   -0.09256   -0.09391




0.6       0.4       0.6       0.8        0.8        0.146975 0.108616     -0.08546 0.019777




-0.9      -0.7      -0.8      -0.6       -0.8       0.240768 -0.09377 0.446158 0.073293
0.2       0.2       0.2       0.3        0.1        -0.00985 0.32511 0.041901 0.124059
-4.4      -4.7      -5.4      -5.5       -5.1       0.064419 0.309659 0.244825 0.251564

-1.2      -0.8      -1.3      -0.7       -1.2       0.938351    -0.4024   -0.22011   -0.14909
0.8    0.8    0.8    1.1    0.6    -0.65681    -0.75833    -0.33256 0.694458
0.3    -0.2   0.3    -0.2   0.2    -0.01911    -1.76786    -1.03519 -0.05343

0.8    0      0.8    0.5    0.4    -0.13027    -0.21138      0.3618 0.102675



0      0.1    0.1    0.1    0.2    0.212283    0.407939    0.575155 0.335666
0.5    A      1      0.8    0.4    0.028253    0.561762    0.089006 0.02013
1.6    A      1.3    1.1    1.2    0.652751      -0.1368   -0.06792 0.13755
-2.2   -1.1   -2.3   -3.5   -2.9     -0.1188   0.635214     0.76177 0.966506
-2.2   -1.1   -2.3   -3.5   -2.9    0.31373    -0.29345    0.223142    0.1502
0.1    0.8    0      1.2    0.9    -0.44847    1.012933    0.197415 -0.14368
A      A      A      A      A      0.240454    0.175405    0.134001 -0.15449
0.2    0.1    0.4    0.2    0.8    0.174613    -0.18083      -0.1742  -0.0703
-4.4   A      -5.2   -4.5   -4     -0.28836    0.636576    0.126271 -0.27117
1.1    0.4    1.1    0.7    0.9    -0.36408    1.748593    0.212525 -0.25305

A      A      0.3    A      A      -0.02558    -0.10167    -0.12509     0.03678
A      A      0.3    A      A      -0.11163    -0.06056    -0.22487     0.03159

-0.1   -0.4   -0.2   -0.5   -0.4   -0.48757      -0.4182   -0.25817    0.642704
-0.1   -0.4   -0.2   -0.5   -0.4   0.380317    -0.01757    0.654587    -0.52144
-0.1   -0.4   -0.2   -0.5   -0.4    0.26305    0.594519    1.089158      -0.0425
-0.4   0.4    -0.4   1      0.8    0.205571    0.302911    0.194806       0.0016
0      -0.2   0      0.3    0.2    -0.45326    -0.03852    -0.06181    0.380864
0      -0.2   0      0.3    0.2    -0.03263    0.155468    0.504688    -0.22812
0      -0.2   0      0.3    0.2    -0.19608    0.609891    0.915436    -0.08181
0      0.2    -0.1   0.1    0      0.368791    0.717654    0.302357    0.235759
0      0.2    -0.1   0.1    0      -0.32874    -0.27975    0.020045    -0.08539
-0.1   0.1    0.2    0.4    0.6    -0.07019    0.110393    -0.10132    0.034915
-0.1   0.1    0.2    0.4    0.6    -0.35422    0.664711    0.686737    -0.09431
-0.1   0.1    0.2    0.4    0.6    -0.01089    0.465706    0.281698    0.107032
0.3    0.2    0.3    0.1    0.4      -0.2813   0.001041    0.116721    -0.01269
0.3    0.2    0.3    0.1    0.4    -0.23885    0.197249    0.131298    -0.18677
A      1.2    A      A      A      -0.11709    -0.47359    -0.51283    -0.04142
A      1.2    A      A      A      -0.11512    -0.15409    0.042878    -0.17079
A      1.2    A      A      A       0.17466    0.198871    0.107845    0.267888
0.4    0.4    0.5    0      0.3    -0.81031    -0.99985      -0.3938   -0.28943
-3.6   -3.8   -4.5   -4.3   -3.7   -0.38529    -0.09125    0.212204    0.713551
A      A      A      A      A      0.833442    0.185146    0.169775    0.059083
A      A      A      A      A       0.05849    -0.15047    0.070992    0.121896
0      A      0.1    0      0.2       -0.095   -0.50247    -0.09319    -0.19926
-1     0      -1.3   1.1    0.4    -0.05524    -0.36098    -0.42277    -0.07059
0.4    0.6    0.4    0.3    0.6    0.677462    -0.26197    -0.63786    -0.32819
A      A      A      A      A      0.249365    -0.09898    -0.17132    0.189704
A      A      A      A      A      0.125837    0.367352    0.429762    0.135102
A      A      A      A      A      0.967831    -0.37667     0.03358    -0.15128
0.4    0.7    0.4    0.8    0.5    -1.15024    -0.74058    -0.86108      -0.5512
0.4    0.7    0.4    0.8    0.5    -0.53734      -0.6648   -0.64192    -0.73189
0.4    0.7    0.4    0.8    0.5    -1.31199    -0.82704    -1.04873    -1.08355
-1.2   A      -1     -1.7   A      -0.17596    1.019043 -0.20281 -0.16007
0.2    0.3    0.2    0.3    0.3    -0.33366    0.513952 -0.12391 -0.01807
0.2    0.3    0.2    0.3    0.3    -0.05336    0.211033 -0.03197 0.136473
1.1    A      1.1    0.8    0.8    -0.03223    0.012971   -0.1069 0.288562
-1     A      -1     -1     -1.1   0.160384    0.130304 -0.20472 -0.08333
A      A      A      A      A      0.470186    0.439146 0.459003 0.344175
A      A      A      A      A       0.11701    0.196035 0.239749 -0.26633

0      0.2    0      0      0.4    0.110318    0.033733   0.183952    0.414238
0      0.2    0      0      0.4    0.056639    -0.18004   0.043652    0.210554
-0.3   A      -1.1   -0.9   A      -0.77183    -1.30056   -1.36477    -1.20512
0.8    0.7    0.4    0.7    0.5    0.676464    1.064159   -0.05699    -0.26102
0.8    A      0.4    0.8    0.6    -0.15653    0.326988   0.419263    0.159222
0.8    0.7    0.4    0.7    0.5    0.284687    0.414879   0.391361    0.335851
0.3    0.3    0.3    0.2    0.2    -1.15063    0.610603     -0.4664   -1.18569
0.4    0.1    0.2    0      0.5    1.067371    -0.41977   -0.07207    -0.05316
A      A      A      A      A      0.004871    0.043219   0.168516    0.426759
A      A      A      A      A      1.180043    -0.84722   -0.39627    0.445828
0.2    0.2    0.3    0.3    0.6    0.307233    -0.16569   0.380045    0.699283
0.2    0.2    0.3    0.3    0.6    0.173428    -0.04741   0.210667    0.576047
-0.1   A      0.3    -0.3   A      0.149117    0.380387   0.535351    -0.27645
0.6    0.6    1      0.2    0.9    0.064309    0.014021   -0.10833    -0.17329
0.2    0.2    0.1    0.2    0.4    -0.02318    -0.47904   0.102541    0.490901
0.1    0.3    0.1    0.2    0.8      -0.1221   -0.33689   -0.15569     0.42088
0      0      -0.1   0.1    0      0.159664    0.522285   -0.01216    0.054185
0      0      -0.1   0.1    0      0.079653    1.118042    0.54422    0.396393
0      0      -0.1   0.1    0      0.006747    -0.52138   -0.35624    -0.30197
-0.1   0.5    -0.3   1      1.4    0.425434    -0.20278   -0.17816    -0.10743

1.1    A      0.9    0.6    0.7    -0.26624 1.773178 -0.11261 0.340268
-6.1   -2.6   -6.1   -5.3   -4.7   -0.11375 -0.02688 0.301962    -0.0163
-6.8   -6.7   -7.4   -7.5   -9.5   1.773443 -1.60697 -1.42847 0.686255
0.5    0.5    0.4    0.8    1.2    -0.63643 -0.08683 -0.27817 -0.04429
0.5    0.5    0.4    0.8    1.2         -0.69 -0.26061 -0.20688 -0.16981
-2.7   A      -1.5   -2.1   A      -0.01465 0.36281 0.139761 0.213951
-2.7   A      -1.5   -2.1   A        -0.1047 0.208379 0.172136 -0.06233
-2.7   A      -1.5   -2.1   A      -0.10996 1.108614 0.533734 0.424539
0.5    0.6    0.4    0.4    0.5     0.99099 -0.87825 -0.63333 -0.81713

A      A      -0.4   A      A      0.218578 0.264911 0.382816 0.275021

0.2    0.2    0.3    0.3    0.5    1.737985    -1.20513    -0.4062    -0.37481

0.7    0.4    0.5    0.5    0.5    -1.19238    -1.86949   -0.6725 -0.51872
0.7    0.5    0.9    0.4    0.8    -0.14732    -0.42953 -0.14757 0.049546
0.3    0.2    0.5    0.2    0.3    0.550992    -0.19232   -0.7004 -0.19092
0.1    0.3    0.1    0.5    0.3    0.206284    -0.10136   -0.0916 -0.08159
-5     -5.3   -5.4   -5.4   -4.2   0.034649    0.315914 0.107024 0.185264
0.2    0.6    0.4    0.4    0.1    0.861166    0.048089 -0.15479 0.096998
0.2    0.6    0.4    0.4    0.1    0.180151    0.253946 -0.10707 0.228874
0.2    0.6    0.4    0.4    0.1    0.275945    0.323994 0.076157 0.226254
A      A      A      A      A      -0.18837    -0.56365 0.042687 0.240786
A      A      A      A      A      -0.11516     0.482462    0.476463    -0.05073
0.8    A      0.9    0.6    0.6    -0.62271     -0.19863    -0.59915    -0.61355
0.8    A      0.9    0.6    0.6    0.298323     0.374122    0.058403    0.195702
0.8    A      0.9    0.6    0.6    -0.17695      0.32858    0.016682    0.230778
0.4    1.1    0.5    0.7    0.8    0.002979     -0.28805    0.023759    0.109623
A      A      A      A      A      0.552091     0.657234    0.078324    0.247081
A      A      A      A      A      0.223916      0.06393    -0.10556    0.213768
A      A      A      A      A      0.128679     -0.13222    -0.06834    -0.25831
A      A      A      A      A      -0.14361       -0.1622   -0.41097    -0.29978
-1.1   -1.5   -1.4   -1.6   -2.2   0.740728     0.224687    -0.41151    -0.51932
0.7    0.8    0.7    0.8    0.8    0.216234       -0.1598   0.409589    -0.16329
0.7    0.8    0.7    0.8    0.8    -0.77415     -0.53973    -0.38821    -0.20984
0.7    0.8    0.7    0.8    0.8    -0.53662     -0.30579    -0.22268    -0.13411
A      A      A      A      A      -0.77252     -0.53378    -0.86185    -0.85873
A      A      A      A      A           -0.32   -0.05637    -0.29082    0.997671
A      A      A      A      A      -0.92002     -0.59486    -0.48868    -0.62142
A      A      A      A      A      -0.02479       -0.6218     -0.4598     -0.3179
0.1    0.1    0.1    0.5    0.3    0.673486        -0.503   -0.02159    0.394635
A      A      A      A      A      1.991073     -0.26461    -0.46881    0.136377
0.7    -0.1   0.3    0.4    0.6    0.187568     0.445038    0.136023    0.145551
-6.5   -3.1   -3.8   -3.4   -2.8   -0.23167     1.210946     0.42448    0.167809
-6.5   -3.1   -3.8   -3.4   -2.8   -0.85293     0.290451    0.085807    -0.61783
-6.5   -3.1   -3.8   -3.4   -2.8   -0.37435     0.551257    -0.04876    -0.28991
A      A      A      A      A      0.292501     0.322423    0.432515    0.204482
A      A      A      A      A      -0.31694     1.221687     0.33127    -0.14099
A      A      A      A      A        -0.0286    0.180762    0.013598    0.055625
-0.5   0.1    -0.2   0.3    0.5    -0.53152     0.295038    -0.00843    -0.37038
-0.5   0.1    -0.2   0.3    0.5    0.119587     0.130174    0.615912    0.329475

1.4    1.1    0.6    0.7    1.2    0.087853     -0.05446    -0.06047      -0.0072
1.4    1.1    0.6    0.7    1.2    0.892268     0.083459    -0.10334    -0.17885
1.4    1.1    0.6    0.7    1.2    0.100518     0.331397    0.065795    0.037539
0.5    A      0.6    A      A        -0.0841    0.337968    0.500476    0.585799
0.5    A      0.6    A      A       0.42058     -0.22777    -0.07625    -0.07865
0.5    A      0.6    A      A      0.304833     0.087237    -0.12325    0.036077
0.8    A      0.5    0.5    0.8    0.040321     0.204179    0.184566    0.147986
0.8    A      0.5    0.5    0.8    0.399352     0.160474    0.378937    0.392301
0.8    A      0.5    0.5    0.8    1.960704     -0.83423    -0.15625    -0.48634
1.2    A      1.2    0.2    1.1    -0.57963     -0.25955    0.173055    -0.21628
A      A      A      A      A      0.250444     -0.18977    0.703448    0.118392
1      0.2    0.9    0.7    1.1    -0.90048     -0.79947    -0.44902    -0.36473
-1.7   -2.1   -1.5   -2.3   -2.2   -0.73253     -0.53951    2.012976    0.224674
1      A      0.8    A      A      0.051911     -0.14566    -0.61806    -0.25986
1      A      0.8    A      A      0.368126     -0.25461     0.08423    -0.18584
A      A      A      A      A       0.33004     -0.34195    -0.57122      -0.3593
A      A      A      A      A      -0.02699     0.875801    0.622523    0.173622
A      A      A      A      A      -0.16622     0.843446    0.413319    0.064341

0.6    0.7    0.7    0.9    1.1    -0.00625     -0.42621    -0.61135    -0.09175
0.6    0.7    0.7    0.9    1.1     -0.5709     -0.30821     -1.1201    -1.58555
0.6    0.7    0.7    0.9    1.1    -0.40946     -0.19382    -0.79028    -0.71952
0.9    0.4    1.1    0.9    1      -0.59796     -0.70701    -0.95388    -1.11905
0.9    0.4    1.1    0.9    1      -0.27809    -0.10754    -0.37298   -0.19771
0.9    0.4    1.1    0.9    1        -0.4082   -0.72635    -0.34668   -0.05795
-0.6   0      -0.6   -0.1   -0.6   0.066853    0.195412    0.136749    0.04515
-3     -4     -3.5   -3.5   -4.2   0.811186    -0.20957    -0.16082   1.148101
-0.4   0.5    -0.1   0.7    1      0.032552    0.053318    0.026794   -0.05794
A      A      A      A      A      0.122331    0.820824    0.255376   0.177574
A      A      A      A      A       0.00409    -0.34295    -0.24647   -0.09579
A      A      A      A      A      -0.05201    -0.17727    0.000603   0.094846
0.4    0.4    0.4    0.6    0.6    -0.13375    -0.92927    -0.73891   -0.08473
A      A      A      A      A      -0.19224    0.048827    -0.08518   -0.38043
A      A      A      A      A      -0.35343      -0.2522   -0.12102   -0.13022
A      A      A      A      A       0.51814    -0.04719     0.06998   0.398763
1.1    0.7    1.2    0      0.2    0.889333    -0.00642    -0.22443   0.021344
1.1    0.8    1.1    0.3    -0.1    0.08814    -1.48198    -1.31712   -0.50309
A      A      A      A      A      -0.49585    1.330554    -0.18247   -0.51379

0.3    0.3    0.3    0.2    0.2    -0.22317 -2.86445       -1.47529 -0.12123
0.3    0.3    0.3    0.2    0.2    0.216063 -2.41589       -0.98288 0.207605
0.3    0.3    0.3    0.2    0.2    0.092226 -2.73843       -1.10809 0.265502
0.8    0.7    0.7    0.6    0.4    0.355171 -0.68565       -0.40154 -0.22473
-0.4   A      -0.5   -1.4   -0.7   0.495681 0.055389        0.22083 0.232234

-0.7   A      A      A      A      2.410058 -0.83699 -1.34228 -0.64766
-0.7   A      A      A      A      0.025749 -0.12337 -0.02666 0.026597
-0.7   A      A      A      A      0.124199    -0.006 0.053218 0.192244
A      A      A      A      A      0.263319 0.329637 0.239437 0.121825
A      A      A      A      A      1.248344 -0.13022 0.043316 0.153844
A      A      A      A      A      -0.07284 0.45255 0.037222 -0.09754
0.8    A      0.7    0.9    -0.1   -0.14197 -0.73124 -0.70038 -0.37712
0.8    A      0.7    0.9    -0.1   0.211234 -0.46959 -0.40376 0.785143
0.8    A      0.7    0.9    -0.1   0.331896 -0.13872 -0.18042 0.052093

A      A      A      A      A      0.880351 -0.45933 -0.17219 0.225336
A      A      A      A      A      -1.81543 -0.91275 1.966753 0.244375
A      A      A      A      A      0.098763 0.179377 0.001983 0.00334
0.7    0.6    0.8    0.8    0.7      -0.7951 -0.23275 -0.08208  -0.6381


A      A      A      0.8    A      0.797138     0.01692     0.35885    0.09714
A      A      A      A      A      0.260823    0.104339    -0.04689   0.020934
A      A      A      A      A      0.110245    -0.17574    -0.11001   0.044882
A      A      A      A      A      -0.07309    -0.39301    -0.33209   -0.37964
0.7    0.8    0.5    0.6    0.5    1.259393    -0.10572    -0.09359    0.03097
-0.6   -0.7   -0.5   -0.8   -0.7   -0.40954    0.759557     1.02917   0.192409
-0.6   -0.7   -0.5   -0.8   -0.7   -1.06762     0.77776    1.101425     -0.1298
-0.6   -0.7   -0.5   -0.8   -0.7   -0.96821    1.045285    1.602344   0.192285
1      0.8    1.1    1      0.8    -0.48804    0.659736    -0.48046   -1.54982
0.6    -0.3   0.7    -0.2   0.5    0.866642    -0.05715    0.146847   0.091274
0      0.3    0.1    0.1    0.2    0.154286    -0.29674     0.18972   0.008245
0      0.3    0.1    0.1    0.2    -0.49149    0.689949    0.985776   -0.03777
0      0.3    0.1    0.1    0.2     0.05774    0.928193    1.408396   0.212072
-2.3   A      -3     -2.9   -2.5   0.252884    0.391128    0.326195   0.307261
-5.5   -3.1   -6.1   -5.8   -5.5    2.26936      -0.8809   0.187475      -0.2936
A      A      1.1    A      A      0.380175    0.706347    0.819368    0.258595
A      A      1.1    A      A      -0.20243    -0.32802    0.048072    -0.13104
A      A      1.1    A      A      -0.01454    -0.10708    -0.16538    -0.04254
A      A      1.1    A      A      0.310077    0.426302    0.534228    0.221449
A      A      A      A      A      0.038649    0.000751    0.062165    0.067164
A      A      A      A      A      0.627832    0.418074    0.117858    0.064779
A      A      A      A      A      1.976136    0.198152    1.229543    1.451021
A      A      A      A      A      0.035429    0.104982    0.075488    0.171011
A      A      A      A      A      0.113658    -0.09226    -0.14122    0.341104
A      A      A      A      A      0.265762    -0.24072    0.239607    0.384408
-1.3   -1.4   -1.3   -1.4   -1.7   0.622177    1.162245    1.238477    1.273989
-1.3   -1.4   -1.3   -1.4   -1.7   0.738309    1.488476    1.259861    1.526676
-1.3   -1.4   -1.3   -1.4   -1.7   0.647782    1.228252    1.092094    1.149944
0      -0.1   -0.1   0.5    0.5    0.332459     0.92195    0.700095    0.771263
0      -0.1   -0.1   0.5    0.5    0.253251    1.125841    0.969235    0.755628
0      -0.1   -0.1   0.5    0.5    -0.36087    0.501251    0.217235    0.235683
1.1    0.8    1.1    0.7    0.8    -0.17654    -0.30254    -0.22696    -0.33481
A      A      A      A      A      0.003823    0.833645    0.771714    0.228248
A      A      A      A      A      1.176496    0.313915    0.164029    -0.01432
A      A      A      A      A      0.215984    0.161825    0.190407    0.235488
0.6    1      0.5    1.1    1      -1.12661    -1.80167      -0.7997   -0.33118
0.6    1      0.5    1.1    1       0.15439    -0.06336    -0.07223       0.0945
0.6    1      0.5    1.1    1      0.432824    -0.52342    -0.24768      -0.2016
0.6    1      0.5    1.1    1      -0.27266    -0.21026    0.401062    0.065095
A      A      A      A      A      -0.27997    0.065591    -0.04581    -0.02484
-1.3   -1.3   -1.3   -1.7   -1.3   1.352659    -0.06444    1.100538    -0.18144
-1.3   -1.3   -1.3   -1.7   -1.3   0.721402    0.001968    1.066608    -0.71807
-1.3   -1.3   -1.3   -1.7   -1.3   1.357321    0.024286    1.240589    -0.36568
-0.6   A      -0.9   -0.9   -1     -0.15752    1.172695    0.990177    1.132227
0.7    1.2    1      0.9    0.7    0.112853    -0.08363    -0.02927    -0.04966
1      0.6    0.6    0.6    0.8    0.171985    0.369621    0.273973      -0.0268
A      A      A      A      A      0.403361    0.037194      -0.1441   0.996358
A      A      A      A      A      -0.09854    -2.70462    -1.27625    -0.07099
A      A      A      A      A      0.275511    -2.15552    -0.98212    -0.08132
A      A      A      0.7    0.8    1.291023    -0.05486    1.236781    -0.27861
A      A      A      0.7    0.8    0.086781     0.13253    0.059087    0.073872
A      A      A      0.7    0.8    0.598814    0.143785    1.119549      -0.5324
A      A      A      A      A      -0.12932    0.021801    0.120856    0.089639
A      A      A      A      A        -0.1526   0.080872    0.074568    0.628771
-1.3   A      -1.6   -1.8   A         -0.134   0.334079    0.130582    0.078016
-1.3   A      -1.6   -1.8   A      0.171224    -0.22642    1.314389    0.785197
-1.3   A      -1.6   -1.8   A      0.481301    0.300551     0.34323    0.638368
-1.3   A      -1.6   -1.8   A      0.176665    -0.08159    0.773594    0.193355
1      0.7    1      0.4    0.7    -0.18688    -0.28378    -0.42492    -0.21762
A      A      A      A      A      0.569102    0.424363    0.725347    0.505713
-0.9   A      -1.9   -0.9   A       0.06398    0.243142    0.226101    0.154686
-0.9   A      -1.9   -0.9   A      -0.20196    0.376662    0.181517    0.030303
-0.9   A      -1.9   -0.9   A      -0.01117    -0.01805     0.77259    0.053531
0.8    0.2    0.6    1.1    1.2    -0.19329    0.090493    0.127166    0.072259
0.8    0.2    0.6    1.1    1.2    -0.47663    0.119687    -0.14526    -0.49949
0.8    0.2    0.6    1.1    1.2    0.146458    -1.13379    -0.68096    -0.20089
0.6    1      0.5    0.5    1      0.060368      -0.1804   -0.23545    -0.31943
0.6    1      0.5    0.5    1      0.353823      -0.0127   0.080978     0.20086
0.6    1      0.5    0.5    1      0.479244      -0.1528   0.310571    1.236588
-0.2   0.7    -0.3   1.1    0.9    -0.49745    -0.37037    0.112454      -0.4627
-0.2   0.7    -0.3   1.1    0.9       -0.157   -0.60741    0.570975    -0.41206
-0.2   0.7    -0.3   1.1    0.9    -0.29116      -0.0485   0.604725    -0.28416
-0.6   0      -0.6   -0.1   -0.6      0.4698   0.484883    0.153768    0.060934
-0.6   0      -0.6   -0.1   -0.6   0.277181    0.331164       0.2533   -0.01671
-0.6   0      -0.6   -0.1   -0.6    0.45057    0.535813    0.844739    -0.07257
0.9    0.7    0.7    1      0.4    0.053632    -0.06456    0.007861    0.264685
0.7    0.8    0.6    0.8    0.5    -0.51966    -0.28319    -0.41643    0.008063
A      A      A      A      A      -0.17128    -0.06987    -0.19749    -0.31997
A      A      -0.3   0.7    1.6    1.032684    -0.98989    -0.32566    -0.22805
A      A      A      A      A      -0.13649    0.285472    -0.10237    0.044274
0.7    1.1    0.8    1.1    0.5      -0.0805   0.310666    0.157953    -0.12395
0.7    1.1    0.8    1.1    0.5     0.00185    0.515485    0.079589    0.015179
0.7    1.1    0.8    1.1    0.5    -0.15566    0.154464    0.047101    -0.17772
A      A      A      A      A      0.040958    0.132467    0.115912     0.63436
-1     -0.1   -0.9   0.4    0.1    -0.31371    0.722643    -0.19482    0.023374
A      A      A      A      A      1.922494    -1.16205    -0.23103    -1.48019
0.3    0.9    0.2    1.5    1.2    0.143727      -0.1032   -0.15337      -0.1533
0.4    0.5    0.2    0.4    0.6    0.873211    -0.04015    -0.32103    -0.10735
0.4    0.5    0.2    0.4    0.6    0.256388    -0.31171    -0.27955    0.112935
0.4    0.5    0.2    0.4    0.6    0.119293    -0.14822    -0.39192    -0.17522
0.7    0.6    0.8    0.7    0.6    -0.07343    -0.38497    -0.32007    -0.24921

0.7    0.6    0.8    0.7    0.6    -0.51983    0.217684    -0.02102    -0.09411
0.3    1.3    0.3    0.6    0.7    -0.79168    -0.20867    -0.43843    -0.68025
0.3    1.3    0.3    0.6    0.7    -1.22839      -0.5514   -1.05563    -1.08384
0.3    1.3    0.3    0.6    0.7    0.345499    0.019983    0.530552    -0.29461
A      A      A      A      A      -0.00176     0.86112    -0.00718    -0.68256
A      A      A      A      A        -0.1998   0.366076    0.126067      -0.1386
A      A      A      A      A      -0.02531    0.285218    -0.02806    0.039462
A      A      A      A      A      0.171258    0.379911    0.416778    0.077766
-1.2   A      -1.8   0.7    -0.5   -0.51364     0.33524    0.116223    0.124244
-1.2   A      -1.8   0.7    -0.5   -0.84459    0.370417    0.194678    0.413063
-1.2   A      -1.8   0.7    -0.5   -0.08032    0.284024    -0.19262    0.407054
-3.8   A      -4.7   -2.9   -1.3      0.1953   0.255775    0.074527    0.057417
A      A      A      1.4    A        -0.6125   0.637944     0.40994    0.602757
A      A      A      1.4    A      0.622334    -0.10369    -0.04138    0.878122
A      A      A      1.4    A      -0.62449    -1.62825    -1.34142    -0.31593
1      0.2    0.8    0.3    0.5       -0.203   0.024045    -0.16305    -0.00235
0.5    0.6    0.4    0.7    0.6    -0.68162    -0.12346    0.259801    0.034409
0.5    0.6    0.4    0.7    0.6     0.32889    0.575497    0.134514    -0.09089
0.5    0.6    0.4    0.7    0.6    -0.20519    -0.13049      -0.1332   -0.26489
1      0.4    0.9    0.4    0.8    0.319272     0.40092     0.07519    0.030347
1      0.4    0.9    0.4    0.8    -0.26733    0.262914    -0.10396    -0.17483
1      0.4    0.9    0.4    0.8    0.269235    -0.10129    -0.11789    -0.03261
0.6    0.7    0.6    0.7    0.4    -0.67275    -1.00635      -0.6354   -0.24891
0.5    0.5    0.5    0.4    0.5    -0.67165    -0.22969    -0.19399    -0.39634
0.5    0.5    0.5    0.4    0.5    0.735056    -0.39781    -0.24766    -0.17415
0.5    0.5    0.5    0.4    0.5    -0.00928    0.109844    0.301633    0.139321
0.1    -0.3   0      0      0.3    1.545911    -0.39566    -0.08807    -0.19505
A      A      A      A      A      -0.10658    -0.27248    0.304629    0.199137
A      A      A      A      A      -0.08963    0.069599    -0.25622    0.337268
A      A      A      A      A      -0.09416      -0.1188   0.204986    0.648452
0.5    0.6    0.3    0.6    0.8       0.0028   0.037833    -0.04383    0.158771
0.5    0.6    0.3    0.6    0.8    0.615403    0.113558    0.854922    -0.14119
0.5    0.6    0.3    0.6    0.8    -0.09362      -0.2359   -0.06296    0.110536
-0.2   0      -0.1   0.3    0.1    0.387886    0.142253    0.122016      -0.0525
A      A      A      A      A      -0.34136    -0.31914    -0.33851    -0.17613
A      A      A      A      A      0.326402    0.181069    -0.10116    0.386503
A      A      A      A      A      0.506165    0.124698    -0.02176    0.229549
0      -0.2   -0.2   0.3    0.7    0.273828    0.000498    0.295286    0.206198
-4.3   A      -2.6   -2.2   -4     1.148351    1.087347    0.998118    0.501431
-4.3   A      -2.6   -2.2   -4     0.886672    0.067844       0.1926   0.243874
-4.3   A      -2.6   -2.2   -4     -0.23046    0.809331    -0.53791    -1.57315
0.5    A      0.2    0.5    0.5    0.588333    0.045511    -0.28275    -0.02204
0.5    A      0.2    0.5    0.5     0.53502    0.602974    0.602099    0.517883
0.5    A      0.2    0.5    0.5      -0.0098   0.348634    -0.02408    -0.21814
0.4    0.6    0.4    0.4    0.2    -0.12025    0.055942    0.178346    0.329883
0.4    0.6    0.4    0.4    0.2    0.100688    0.000968     0.19063    0.304059
0.4    0.6    0.4    0.4    0.2    -0.18128    -0.20131    0.033125    -0.26899
0.3    0.2    0.5    0.2    0.3    0.154466      -0.1304     -0.4503   -0.15725
0.3    0.2    0.5    0.2    0.3    -0.08406    0.188956    0.115732    0.095041
0.3    0.2    0.5    0.2    0.3    -0.31618    0.110242    -0.16593    -0.10533
-3.3   A      -3.5   -3     -4     0.824764    0.264383    0.012402    -0.08475

0.9    A      A      A      A      0.185881    -0.19745    -0.31315    0.038136
0.9    A      A      A      A      -0.07855    0.275541     0.27555    0.171723
A      A      -1.5   A      -2.3   0.015601    0.396506    0.218156    0.519514
A      A      A      A      A      -0.31544    0.435059    -0.68457    -0.68597
A      A      -0.2   0      A      0.383517    -0.83231    -0.58448    0.366669
0.2    0.4    0.2    0.4    0.2    -0.28176    0.082052    -0.52336    -0.66963
0.2    0.3    0.3    0.5    0.5    0.469168    -0.61016    -0.56796    -0.63845
0.9    0.6    1      0.6    1.1    -0.42897    0.205702    -0.10653    -0.04831
0.9    1      0.7    0.7    0.5    0.188165    0.423107    0.204515    0.301935
-4     -2.7   -4.6   -5     -4.5   -0.34936    1.324185    -0.05392       0.6681
-0.7   -0.8   -0.7   -1.1   -0.7   0.281916     0.70376    0.516789    0.289016
-1.3   -1.8   -1.3   -1.6   -1.2   -0.10406    0.475123    1.129373     0.17529
-1.3   -1.8   -1.3   -1.6   -1.2     -0.3393   0.723795    1.339878    0.225601
-1.3   -1.8   -1.3   -1.6   -1.2   -0.53425    0.775267    1.799827    0.351897
-1     -0.6   -1     -0.6   -0.4   0.048021    0.461534    0.322673    0.097298
0.7    0.3    0.8    0.4    0.4    -0.26546    0.422189    0.234888    0.716149
0.1    -0.3   0      -0.3   -0.2    1.10061    0.488396    0.913124    0.496606
0.1    -0.3   0      -0.3   -0.2   0.396189     0.34346    0.745041    0.196184
0.1    -0.3   0      -0.3   -0.2   0.799123      -0.0094   0.073011    0.119115
1.4    A      1.3    0.1    0.7    -0.04633    -0.31465    0.100405    -0.16006
1      0.9    0.9    0.9    0.6    0.117873    -0.06633    -0.31776    0.034203
0.4    0.2    0.3    0.4    0.2    0.386719    -0.16375    -0.10876    0.261207
0.4    0.2    0.3    0.4    0.2    0.915311    -0.00067    0.093376    0.435012
0.4    0.2    0.3    0.4    0.2     0.18983    -0.69533    -0.38029     1.03984
0.6    A      0.5    0.6    0.7    -0.20146    0.711682    -0.39627    -1.17584
0.6    A      0.5    0.6    0.7    -0.17008      -1.2047   -0.63877      -0.2147
0.6     A      0.5     0.6     0.7      0.54891    -0.00791    0.031273   0.195272
0.7     0.5    0.7     0.7     0.8     -0.12757    0.104875    -0.20256   -0.30467
A       A      A       A       0.6     0.017422    0.627585    -0.16732   -0.86444
A       A      A       A       0.6     -0.12607    0.248144    0.052679      0.4814
A       A      A       A       0.6     0.319471    0.293684    0.197676   0.102865
A       A      A       A       A       0.056017    0.401538    0.228241      0.2865
A       A      A       A       A       0.103264    -0.41343    -0.09218   -0.22784
A       A      A       A       A       1.188201    0.077705    -0.12175   0.061124
0.7     1      0.9     0.8     0.8     -0.90632    -0.32475    -0.56732   -0.49094
A       A      -0.6    A       0.1     0.518482    1.110072    1.046868   0.803743
-10.3   -7.3   -10.7   -10.8   -10.7   2.598587    -2.91501    -1.86471   -2.22757
-10.3   -7.3   -10.7   -10.8   -10.7   2.430948      -2.2013   -2.03702   -1.76481
-10.3   -7.3   -10.7   -10.8   -10.7   3.037279    -2.72873    -0.72415     -1.4639
0.6     0.4    0.6     0.4     0.3     0.051911    0.406557    0.483186   0.346996
0.8     0.5    0.7     0.3     0.6     2.289274    -1.20444    -0.65215   -1.06981
A       A      A       A       A       0.365936    0.071855    0.308973   0.050055
A       A      A       A       A       1.243211    -0.23743     0.86281   -0.01267


0.8     0.9    0.9     0.7     0.7     -0.37307    0.427108    -0.10885   -0.24958
-1.8    -1.2   -2.2    -1.7    -1.8    2.223015    -0.45615    -0.48326   -0.52815
-1.8    -1.2   -2.2    -1.7    -1.8    2.491774    -1.71853    -1.47009   -1.56682
-1.8    -1.2   -2.2    -1.7    -1.8    0.523817    0.761091    0.412879   0.154532
A       A      A       A       A        0.27726    0.880413    0.770945   0.313921
A       A      A       A       A       0.136918    0.449057    0.331153   -0.01914
A       A      A       A       A       1.718732    0.311783    0.216785   0.050953
0.5     0.9    0.6     0.9     0.5     -0.54164     0.10163    -0.08858   0.109801
A       A      A       A       A       0.556421    0.452142    0.177603   -0.03325
A       A      A       A       A       -0.16181    -0.50782     1.74364   0.380666
A       A      A       A       A       0.555696    0.933068    0.626385    0.30873

1       0.2    1.2     0.5     0.7     1.633447    -0.83048    -0.41526   -0.69857
0.4     0.7    0.4     0.9     0.9     -0.38705    0.028884    0.016472   -0.09099
A       A      A       A       0.7        0.1909   -0.09567    0.367963   0.031079
0.7     -0.3   0.8     0.6     0.4     -0.91455    -1.29215    -0.94317   -0.45616
A       A      A       A       A       -0.36432    0.542315    -0.26362   -1.58736
A       A      A       A       A       0.219968    0.114997    -0.14492    0.72129
A       A      A       A       A       0.712269    0.094534    0.080433   0.015207
0.3     A      0.1     0.1     0.2     0.143813    0.195345    0.411502   0.334783
0.3     -0.5   0.2     -0.3    -0.1    -0.04073    -0.11203    -0.10275   0.320861
0.3     -0.5   0.2     -0.3    -0.1    0.121185    0.592892    -0.10143   -0.21986
0.3     -0.5   0.2     -0.3    -0.1    0.282423    0.129563    0.231614   0.572989
A       A      -1.9    A       A       -0.04182    0.227873    0.181747   0.060034
-3.8    -3.8   -3.9    -4.5    -4.1      -0.2959   0.342957    0.519424   1.237482
-3.6    A      -1.2    -2.9    -0.9    -0.28962    1.626536    0.324482   -0.20102
-3.6    A      -1.2    -2.9    -0.9    0.507047     0.27758    0.509469   0.959728
-3.6    A      -1.2    -2.9    -0.9    0.156748    0.231388     0.39403   0.440008
A       A      A       A       A       -0.36618      -0.1268   1.369883   -0.56324
A       A      A       A       A       0.031814    0.098051    0.413792   0.371616
A       A      A       A       A       0.186181    0.049244    0.230311   -0.07995
A       A      A       A       A       0.009589    -0.19899    0.600771   0.053154
A       A      A       A       A       -0.01939    0.895586    0.382997   0.779867
A      A      A      A      A       0.82715    -0.12763    0.161961    0.077753
A      A      A      A      A      1.242898    -0.40381    -0.06695    0.092482
0.6    0.9    0.2    0.3    0.2    0.595593    -0.47213    -0.13224    0.199598
0.6    0.9    0.2    0.3    0.2    0.347158    0.530969    0.126525    -0.10949
0.6    0.9    0.2    0.3    0.2    1.192621    -0.56413    -0.29565    -0.30408
-1     -0.8   -1.2   -1     -0.9   0.250313    -0.28007    -0.08963     0.00628
-3.5   -2.3   -3.5   -3.9   -3.6   0.512713       1.0551   0.803842    0.197045
-2.1   -1.9   -2.3   -1.3   -1.8     -0.4102   1.003014      -0.4557   -0.43227
-0.3   0.2    -0.3   0.1    0.6    -0.55848    0.556172    -0.65162    -2.03329
-0.3   0.2    -0.3   0.1    0.6    -0.33177    1.008021      -0.3644   -1.88806
-0.3   0.2    -0.3   0.1    0.6    -0.41489    0.861396    -0.47419    -1.77224
-4.1   -2.6   -3.5   -3.5   -2.6   0.393338    -0.16995    0.443293    -0.13504
-0.2   0      -0.4   0.2    0.1    0.196044    -0.07758    -0.14772    0.614488
-0.1   -0.1   0.1    -0.3   0.1    0.747102    0.731458    0.474452    0.231187
-0.1   -0.1   0.1    -0.3   0.1    -0.23697    0.761153    1.315018     0.19287

A      A      A      A      A      -2.20215    1.150582    -0.68452    -1.68698
A      A      A      A      A      -0.19949    1.109844    -0.35932    -2.08692
A      A      A      A      A      -0.45399    0.725146    -0.48787    -1.90303
0.5    0.5    0.7    1.3    0.6    -0.08506    -0.21529    0.249091    -0.33385
-4.9   -4.2   -4.5   -6.3   -5.6   -0.77836    -0.07953    -0.60921    1.649045
-4.9   -4.2   -4.5   -6.3   -5.6   1.615693    -0.99632    -0.73257    0.258569
-4.9   -4.2   -4.5   -6.3   -5.6   -0.77648    0.091782       -0.614   1.330431
A      A      A      A      A      -0.29618    -0.11891    -0.05061    1.596757
A      A      A      A      A      0.027504     0.44038    0.433125    0.188217
A      A      A      A      A      -0.36605      -0.4796   -0.21118    1.749759
-7.1   -5     -5.7   -5.4   -4.3   2.244467    -0.49741    0.090927     0.82357
-7.1   -5     -5.7   -5.4   -4.3   -0.33704    0.279171    -0.12211    -0.18887
-7.1   -5     -5.7   -5.4   -4.3   2.578164    -1.33528    -0.28173    1.116998
0.8    0.8    0.9    0.9    1      -1.27445    -0.73607    -0.29524    0.909897
0.2    0.6    0.1    0.5    0.9    -1.15708    -0.77154      -1.1776   -1.10195
0.2    0.6    0.1    0.5    0.9    -0.85248    -0.81347      -0.9423   -0.71557
0.2    0.6    0.1    0.5    0.9    -1.65132    -0.84306    -1.24724    -1.42107
0.2    0.2    0.3    0.3    0.5    1.390311      -1.2384   -0.39142    0.082019
0.2    0.2    0.3    0.3    0.5    1.254281      -1.4661   -0.60028    -0.12316
0.2    0.2    0.3    0.3    0.5    1.153522    -0.55332    0.119917    0.094272
-3.5   A      -3.2   -4.7   -1.9   1.688989    -0.24929    1.223789    -0.15494
A      A      A      A      A        -0.5494   -0.87437    -1.16808    -1.11105
0.1    A      0.4    0.1    0.5    -0.21158    0.313583    -0.37577    -0.78179
0.1    A      0.4    0.1    0.5      -0.0966   0.908066    -0.26502      -1.6981
0.1    A      0.4    0.1    0.5    -0.45942    -0.52826    -0.26056    -0.31451
0.9    A      A      A      A      -0.00132     0.69534    -0.23323    -1.00787
0.9    A      A      A      A      -0.23516    0.666172    0.067146       -0.276
0.9    A      A      A      A      0.357779    0.228282    0.183554    -0.00269
A      A      A      A      A      0.812122    0.156717    0.051478    -0.16936
-6.8   -2.5   -5     -4.8   -4.8   0.168964    -0.48393    -0.35448    0.500362
-6.8   -2.5   -5     -4.8   -4.8   -0.43257    -0.41366    -0.20353    1.263441
-6.8   -2.5   -5     -4.8   -4.8   -0.53164    -0.44971    -0.52874     1.57844
-0.5   -0.8   -0.5   -0.7   -0.7   -0.35243     1.26736    1.182247    1.579584
-0.5   -0.8   -0.5   -0.7   -0.7     -0.5196   0.850587    0.967349    1.266372
-0.5   -0.8   -0.5   -0.7   -0.7   -0.21007    1.527992    1.125252     1.23682
-0.8   -0.8   -0.5   -0.8   -0.7   -0.29449    0.849394      -0.1873   -1.29361
-0.8   -0.8   -0.5   -0.8   -0.7   -0.21607    0.964649    1.066855     1.20533
-0.8   -0.8   -0.5   -0.8   -0.7   0.009885    1.328371    1.302004    1.253777
-5.1   A      -5.3   -6.2   -4.1    0.24202    0.738496    -0.09055    0.105765
-2.6   -1.3   -1.7   -1.6   -2.2   1.296488    -1.08712      -0.4003   0.008051
-2.6   -1.3   -1.7   -1.6   -2.2   1.823805    -0.75454    -0.14488    0.935053
-2.6   -1.3   -1.7   -1.6   -2.2    0.97389    -0.33452    -0.22193    -0.17958
0.9    0.4    1.1    0.9    1.1    -0.26914    -0.25209    -0.21901    -0.34144
0.9    0.4    1.1    0.9    1.1    -1.01348    -1.32221    -0.67432    -1.07186
0.9    0.4    1.1    0.9    1.1      -0.2486   -0.43587    -0.23116    -0.18594
A      A      A      A      A      0.328571    0.871515    0.813844    0.370453
A      A      A      A      A      -0.62959    -0.07355    0.463109    -0.10379
A      A      A      A      A      -0.33781    0.527485    0.549117    0.404962
-6     -3.6   -5.8   -5     -10    -0.54439     1.03824    0.111017    1.403281
-6     -3.6   -5.8   -5     -10    -1.05826    1.120698      -0.1536   1.798609
-6     -3.6   -5.8   -5     -10    -0.43092    0.470397    0.135015    0.747802
0.5    0.4    0.2    0.5    0.2    0.614535    -0.10374    -0.08992    -0.01089
A      A      A      A      A      0.139971    0.798613    0.445213    0.697625
A      A      A      A      A      0.546628    0.179636    -0.25587    0.257885
A      A      A      A      A      0.390106    0.799579    0.925328    0.389298
-0.6   0.8    -1.3   0.7    0.7    2.807713    -1.34523      -0.1291   -1.00971
-2     -1     -2.2   -1.3   -1     0.149819    0.401482    0.283011       0.3541
0.5    0.7    0.5    0.7    0.8    0.301011    -1.67705    -0.74799    0.255122
0.9    0.9    0.8    0.7    0.5    0.150069    0.260917    0.123598    0.333103
0.3    A      -0.2   0.4    0.8    1.232055       -0.701   -0.31602    0.289608
0.3    A      -0.2   0.4    0.8    0.956002    -0.15901    0.379432    0.162037
0.3    A      -0.2   0.4    0.8    1.135206    0.217969    0.367372    -0.19077
-1.7   -2.1   -1.5   -2.3   -2.2   -2.15666    -0.76404    1.973946    0.423474
-0.5   -0.9   -0.6   -0.9   -0.7   0.540403    -0.63666    -0.13717     0.18331
-0.5   -0.9   -0.6   -0.9   -0.7   -0.27134    1.217562    0.227641    -0.43143
-0.5   -0.9   -0.6   -0.9   -0.7   0.655883    -0.07174    0.160793    0.496176
A      A      A      A      A      0.587042    -0.30624    -0.30407    -0.32999
-0.2   0.1    -0.5   0.7    1.1    -3.27999    -2.55392    -1.33262    -2.42839
-0.2   0.1    -0.5   0.7    1.1    -2.97699    -2.82767    -2.58827    -2.83602
-0.2   0.1    -0.5   0.7    1.1    -2.67843    -0.65353    -1.66381    -1.65562
-0.1   -0.4   -0.2   -0.3   -0.3   1.254131    -0.29635    -0.37256    0.387297
-0.1   0.9    -0.3   0.7    0.5     0.00793    0.420719    0.211636    0.189589
-1.4   -0.1   -1     1.9    1.3    0.060349    -0.21915    0.395762    0.001921
-2.8   -1.9   -3.5   -3     -2.7   2.326809      -1.3154   -1.13775    -0.67095
A      A      A      A      A      -2.50116    -2.58307      -1.8779   -2.28058
A      A      A      A      A      -0.29803    0.370694    0.165069    0.115596
A      A      A      A      A      -3.04745    -2.89378    -2.83865    -2.84813
-2.7   A      -3.8   -3.7   -3.4   -0.30138    -1.19687    1.065514     1.55619
-2.7   A      -3.8   -3.7   -3.4   -1.04906      -0.5668   1.378708    1.226685

0.2    0.9    0.2    0.8    0.9    -1.38655    -0.77367 -0.58208 -0.81669
0.2    0.9    0.2    0.8    0.9    -2.68587    -1.86768 -1.11808 -1.03001
0.2    0.9    0.2    0.8    0.9    2.477691    -1.59394 -1.32372 -0.95925
-0.6   -0.6   -0.6   0      -0.3   2.190313    -1.89801 -1.26166 -0.28869
-0.6   -0.6   -0.6   0      -0.3   1.653102    -2.83224 -1.28476 0.661853
-0.6   -0.6   -0.6   0      -0.3   0.954869    -0.48844 -0.07242 0.286208
-0.7   -0.3   -0.7   -0.3   0.4    1.118559    -0.35272 0.003619 0.433216
-0.7   -0.3   -0.7   -0.3   0.4    -1.30147    1.017869    -0.91304    -0.98773
0.5    -0.3   0.7    0.9    1.4    -0.00053    0.267145    0.035805    0.160651
0.5    -0.3   0.7    0.9    1.4    0.022239      -0.3443   -0.09901    0.105722
0.5    -0.3   0.7    0.9    1.4    0.448003    -1.01443    -0.37515    0.502353
1.1    0.7    0.6    0.7    0.6    0.483861    -0.47655    -0.42377    -0.42477
A      A      A      A      A      -0.15876    0.159495    0.178149    -0.00732
A      A      A      A      A      0.113453    0.435204    0.495241    0.263504
A      A      A      A      A       0.29899    0.046798    -0.39473    0.075787
A      A      A      A      A      -1.21161    -1.21285    1.215314    -1.26306
A      A      A      A      A      0.162206    0.442679    0.267031    0.301327
A      A      A      A      A      0.228148    -1.38686    -0.65113    0.325553
A      A      A      A      A      0.057793    0.277704    -0.00601    0.066551
A      A      A      A      A      -0.87912    -1.04968    1.409995    -0.98593
A      A      A      A      A        -0.0338   0.005995      -0.1103   -0.04714
-6.4   -5.1   -7.6   -4.8   -4.1   -0.21962    0.473682    1.072685    0.073786

0.2    A      0.2    0.2    0.3    -1.13056    0.927545    1.365394    -0.35413
-4.1   A      -3.8   -1.7   -1.4   0.312622    -0.56972    -0.27723    -0.13759
1.1    1.2    0.7    1.2    1.8    -1.95278    -2.13148    -1.81689    -1.68624
0.7    0.6    0.7    0.6    0.7    -0.15703    0.330108    0.531155    -0.05838
0.7    0.6    0.7    0.6    0.7    -0.27386    -0.09847    -0.34436    -0.18848
0.7    0.6    0.7    0.6    0.7    -0.73681    -1.03073    -0.81788    -0.37424
0.9    0.5    1      0.6    1      -0.31291    -0.34116    -0.27319    -0.58414
A      A      A      A      A      0.270335    0.098963    0.182386    0.152541
A      A      A      A      A      0.089246    -0.31114    -0.22847    0.003979
A      A      A      A      A      -0.42177    -0.07431    -0.12743    -0.26322
-4.1   A      -3.8   -1.7   -1.4   0.678248    0.251775    0.221232    -0.10253
-0.8   -0.9   -0.8   -0.4   -0.5   -1.20368    -1.06822      -0.7515   -0.07014
-0.8   -0.9   -0.8   -0.4   -0.5   -0.08947    -0.59347       -0.047   1.131638
0.3    0.4    -0.1   0.5    0.7      -0.4684   -0.15976    -0.22459    0.646986
-1.6   -0.5   -1.9   -1.7   -1.1   0.039211    -0.30416     0.22407    0.012935
-1.6   -0.5   -1.9   -1.7   -1.1   0.342145    -1.23607    -0.32876    0.565508
-2.4   A      -5.1   -4.2   -1.1   1.205936    -1.53155    -1.14504    1.175755
A      A      A      A      A      -0.43624    0.025131    -0.09175    -0.31542
A      A      A      A      A      -0.63368    -0.94769    0.482419    -0.27658
A      A      A      A      A      0.483092    -0.19034    -0.01499    0.210541
0.5    A      0.4    0.4    0.6    -0.15092    0.142163    -0.02446    0.024301
0.5    A      0.4    0.4    0.6    -0.27291    0.374575      -0.3015   -0.32171
0.2    A      0.2    0.2    1.2     0.38266    -0.18118    -0.10132    -0.11579
0.6    0.9    0.1    1.5    1.1    0.450652    -0.14975    0.857791    0.019945
0.6    0.9    0.1    1.5    1.1    -0.03804    0.092208    -0.06314    -0.19631
1      1.5    0.9    1.6    1.7     0.82846    1.040675    0.966521    0.275615

0.4    A      0.4    0.5    A         0.3201 -0.16263  -0.2517 0.40151
0.4    A      0.4    0.5    A      0.072226 -0.18657 -0.10185 0.068656
A      A      A      A      A      -0.11428 0.297216 0.027912 -0.20535

0.1    0.2    0.3    0.8    0.5    0.499842 -0.21549 0.124959 0.233045
-2.4   A      -5.1   -4.2   -1.1   0.145907 -0.03708 -0.12137 0.02112
-8.5   -6.9   -9.8   -7.2   -7.2   -0.43996 1.183108 0.403021 0.324597
-8.5   -6.9   -9.8   -7.2   -7.2   -1.43081 -1.69131 -0.30506 -0.71931
-8.5   -6.9   -9.8   -7.2   -7.2   -1.97912 -1.36236 -1.26962 2.197442
0.5    0.5    0.4    0.2    0      0.720798     0.13371   0.059115      -0.1136
-4.5   -3.1   -5.1   -5.1   -5     -0.25852    1.097037    1.18843     0.14725
-4.5   -3.1   -5.1   -5.1   -5     -0.56827     0.93137   1.020366    0.016226
A      A      A      A      A       0.65044    -0.57611   -0.50555    0.034655
A      A      A      A      A      0.088779    -0.24259   0.403764    0.742447
A      A      A      A      A      0.056177    -0.31976   0.029739    0.029534
A      A      A      A      A      0.235817    0.124597   -0.02735    0.519755
-0.2   0      0.2    1.1    0.8    -0.06286     0.38639   -0.05215    0.301246
A      A      A      A      A       0.21927    0.030447   -0.13682    0.116466
A      A      A      A      A        -0.3806   0.316346   0.195197    0.266438
A      A      A      A      A      -0.71027     1.11903   0.482377    -0.04443
0.4    1.1    A      A      0.5     0.07963    0.186098   0.037411    -0.13171

0.4    0.3    0.4    0.4    0.2    0.701904 0.946937 0.368653 0.389129
0.4    0.3    0.4    0.4    0.2    0.108533 -0.04634 -0.21213 -0.01652

-0.3   -0.1   -0.4   -0.3   0      0.122804    0.414957   0.466132    0.423101
-0.3   -0.1   -0.4   -0.3   0      -0.19162    0.345764   0.532371    0.253884
-0.3   -0.1   -0.4   -0.3   0      1.197636    -0.36982    0.17489    -0.08164
A      A      A      A      A      0.582314    -0.48059   -0.31595    0.085364
A      A      A      A      A      -0.11212    0.254933    0.35853    0.327541
A      A      A      A      A        -0.1763   0.604056   0.398574    0.653543
A      A      A      A      A      -0.96967    -0.64089   -0.96711      -0.8468
-0.5   -0.4   -0.3   0.1    0.4    1.190171    -0.55232   -0.21604     0.80265
-0.5   -0.4   -0.3   0.1    0.4    0.873081    -0.14014   0.054654    0.657718
-0.5   -0.4   -0.3   0.1    0.4    0.838813    -0.65748   -0.27316    0.853648
0.2    0.2    0.3    0.3    0.6      -0.3327   -0.59984   -0.31713    0.397689

-4.6   -3.6   -7.1   -4.5   -6       -0.7402   -0.51927 -0.59111 -0.43016
0.4    0.4    0.4    0.3    0      0.946141    -1.22043 -0.02859   -0.2517
0      1      -0.1   1.3    1.1    -0.43032    -0.87302 -0.64824     -0.348
-1.5   -3     -1.8   1.2    1.5    -0.52533    -0.79463 2.209454 0.314076
A      A      A      A      A      -0.21353    -0.06455   -0.6081 -0.66982
0.4    0.3    0.2    1.1    1.2    0.186057    -0.21405 0.081529 0.290386
0.5    0.7    0.1    1.1    0.8    0.083709    -0.43564 -0.35452 -0.14158

0.2    A      0.2    0.2    0.3    -0.36713    -0.32604   -0.06147    0.305114
0.2    A      0.2    0.2    0.3    0.175707    -0.00223   -0.02653    -0.04768
0.2    A      0.2    0.2    0.3    0.143443    0.247052    0.28625    0.266872
A      A      -3.2   -2.9   A      -0.09438    -0.13861   -0.26054    0.019848
A      A      -3.2   -2.9   A      -0.40758    0.189321    0.08479    0.129504
A      A      -3.2   -2.9   A         -0.296    0.60909   0.850047    -0.00127
0.9    0.8    0.9    0.7    0.6    -1.40951    -0.96101     -0.8552   -0.87995
0.9    0.8    0.9    0.7    0.6    -2.28012    -2.27222   -1.52765    -1.51019
0.9    0.8    0.9    0.7    0.6    -2.75671    -2.88257   -2.21726    -1.75869
0.5    0.7    0.1    1.1    0.8    -0.75164    -0.60074   -0.36751      -0.0897
-7.3   -3.2   -7.4   -7.9   -7.6   -0.84193    -0.51443   0.439337    -0.29359
-7.3   -3.2   -7.4   -7.9   -7.6   -0.37456    0.314473   0.179298    0.018913
-7.3   -3.2   -7.4   -7.9   -7.6   -0.28074    1.057396   0.602697    0.269736
A      A      A      A      A      0.313643    -2.45109   -0.95556    0.537131
0.1    A      -0.6   -0.3   -0.2   0.136498    0.173647   -0.01814    0.055941
0.1    A      -0.6   -0.3   -0.2   -0.07586    0.228022   0.311335    0.259061
0.1    A      -0.6   -0.3   -0.2   0.055589    1.117788    1.260077    0.758021
0.1    A      -0.6   -0.3   -0.2   -0.17328    0.339056    0.348281    0.079642
0.6    0.1    0.6    0.5    0.5    0.854079    0.036901    -0.01027    0.041297
0.7    0.5    0.7    0.8    0.6       -0.853   -1.04921    -0.69525    -0.64635
-4.5   -3.9   -5.6   -5.1   -4.8   1.063823    0.932538    0.837632    1.409766
A      A      A      A      A      1.353803    -1.84448    -1.11233    0.690964
A      A      A      A      A      0.168576    0.035798    0.069299    0.254568
A      A      A      A      A      0.530464    0.505921    0.101436    0.215451
1      0.8    0.6    0.9    0.7    -0.10537    0.157831    -0.08221    0.058467
A      A      A      A      A      0.511477    0.428584    0.347167    0.177329
A      A      A      A      A      0.294251    -0.06288    0.105171    0.325851
A      A      A      A      A      -0.39615    -0.05795    0.019789    0.113446
-5.4   -5     -7.1   -5.7   -5.5    1.67967    -0.26998    -0.13734    -0.25607
0.7    0.2    0.7    0.4    0.5    0.086909    -0.67755    -0.09077    -0.10269
0.5    0.4    0.6    0.4    0.3    -0.09696    0.738069    0.912654    0.633264
0.5    0.4    0.6    0.4    0.3      -0.6001     -0.0953   -0.29938    -0.22117
-2.5   -3.7   -2.8   -2.2   -1.2   -0.55718    1.485574    -0.48353    -1.22725
A      A      A      A      A      0.415412    0.494821    0.331179    0.499695

0.1    -0.5   0.1    -0.1   0.1    -0.10686    0.201156 -0.06486 0.013935
0.1    -0.5   0.1    -0.1   0.1    -0.38312    0.181341 0.139484 0.138826
0.4    -0.4   0.3    -0.2   -0.4   -0.08509    0.254488 0.251546 -0.32805
1.2    0.9    0.8    0.1    -0.2   -0.51052    0.116877 -0.67288 -0.43837

0      -0.1   -0.1   -0.1   -0.1   -0.05755 0.654224 0.282387 1.572894
0      -0.1   -0.1   -0.1   -0.1   -0.19879   -0.2798 -0.32838 -0.14712
0      -0.1   -0.1   -0.1   -0.1   -0.42647 -0.25377 -0.41073 0.980898




0.6    0.1    0.6    0.5    0.5    0.836673    -0.74818    -0.25973 0.309348
0.5    0.8    0.6    0.7    0.8    -1.10338    -0.87344    -0.10498 0.070988
-0.7   A      -0.4   -3.5   -0.6   -0.37482    -0.56401    -0.51077   -0.6372

A      A      A      A      A      1.070621    -0.21068    0.166121    0.802282
A      A      A      A      A       0.37463    1.333592    0.937527    0.443795
-7.3   -3.2   -7.4   -7.9   -7.6   -0.02115    -0.60132    -0.51478    -0.63028
-1.5   -1.8   -1.3   -1.8   -1.7    1.14618     1.32873    1.249103    0.935804
-1.5   -1.8   -1.3   -1.8   -1.7   1.122924    1.041765    0.783622    0.327328
-1.5   -1.8   -1.3   -1.8   -1.7   -0.50431    -0.35959      -0.4032   1.028523
-3.3   -0.7   -3.5   -0.9   -1.8   2.530371    -1.51475    -1.21628    -1.01583
-7.4   -5.9   -7.2   -7.4   -6.6    1.66588    -1.34362    -1.32616    -1.72185
A      A      A      A      A      -0.03894    0.289799    -0.12586    -0.14634
0.3    A      -0.1   1      1      0.580075    -0.17194    -0.16597    -0.34232
A      A      A      A      A      0.429364    0.158215    0.296188    0.559644
1.3    1.3    0.9    1      1       1.02049    1.321562    1.147157    0.388775
1.3    1.3    0.9    1      1      -0.82602    -0.78232    -0.42969    -0.12077
1.3    1.3    0.9    1      1      -1.79924      -2.7213   -1.73059    -2.09455
-0.1   0.3    -0.1   0.7    0.9    0.941388    -0.77346    -0.52546    -0.34006
-1.3   -1.3   -1.4   -1.3   -1.6   1.069201    0.538491    0.999121    0.583449
0.9    A      0.6    0.3    0.6      -2.1961   -1.96683    -1.59171       -1.837
0.9    A      0.6    0.3    0.6      -0.5568   -0.78802    -0.81605    -0.57606
0.9    A      0.6    0.3    0.6    -0.34235    -0.62127    0.149751    -0.44521
0.6    0.3    0.5    0.4    0.5    0.009483    0.281615    0.345727    0.154403
0.6    0.3    0.5    0.4    0.5    0.110713    0.314028     0.13664    -0.06251
-2.5   -2.1   -2.6   -3.2   -2.5   0.748134    0.543777    0.541375     0.63216
-2.5   -2.1   -2.6   -3.2   -2.5   0.592372    0.364727    -0.00404    0.592976
-2.5   -2.1   -2.6   -3.2   -2.5   0.323488     0.33225    0.062102    -0.06656
0.6    A      0.4    0.9    0.6    0.408219    0.269852    0.436834    1.028017
0.6    A      0.4    0.9    0.6    1.020778    1.086318    0.449599    0.892267
0.6    A      0.4    0.9    0.6    0.099182    -0.15603      -0.3018   0.063234
0.4    0.1    0.4    0.1    0.1    -0.51397    0.465692    0.380011    0.504008
0.4    0.1    0.4    0.1    0.1      -0.6651   0.392754    0.114392    0.185194
A      A      A      A      A      -0.35622    0.126934    -0.01096    -0.06763
0.6    0.3    0.7    0.1    0.9    -0.30658    -0.44723    -0.12062    0.040744
A      A      A      A      A      -0.14423    -0.17728    -0.21999    -0.18655
0.1    0      0      -0.1   0.2    -0.04989    -0.15246     0.18597    -0.14109
0      -0.2   0.2    0      0      -0.63074      -1.0444   -0.47924    -0.37557
0      -0.2   0.2    0      0      -0.37216    0.642953    0.692839     0.45745
0.1    0      0.1    0      0.3    -0.16303    -0.05962    0.184402    0.532819
1      0.8    0.5    0.7    0.7    -0.32748    0.619457    0.176849    0.447791
0.3    0.7    0.5    0.5    0.3    0.317103    0.139104    0.041636    -0.05814
-0.2   -0.4   0.1    -0.1   0      -0.72996    -0.48661    0.083878    -0.28524
0.3    0      0.3    0.3    0.3      -0.8915   -0.62182    -0.50476    -0.41655
A      A      A      A      A      0.047375    -0.28796      -0.2643   -0.00979
0.3    0      0.3    0.3    0.3    -0.13504    0.009232    -0.09962    -0.44567
0.8    0.9    0.9    0.6    0.7    -0.22314    -0.49868    -0.30104    0.430331
A      A      A      A      A      -0.81249    0.439943    0.396739    -0.18647
A      A      A      A      A      0.055165    0.234131    -0.00755     0.49955
A      A      A      A      A       0.30723    0.403524     0.31298    0.145121
A      A      A      A      A      -0.16825    0.893709    -0.09502    0.286486
0.4    0.4    0.5    0.9    0.8    -1.65754    -1.24748    0.267752     0.35498
0.3    0.5    0.3    0.4    0.6    -0.47472    -1.13364    -0.52272    -0.24458
0.3    0.5    0.3    0.4    0.6    -0.92064    -1.02731    -0.66221    -0.19311
0.6    0      0.9    0.1    0.6    0.496927    -0.02862    0.165455    0.058339
0.9    0.6    1.1    0.5    0.7    -0.20418    -0.48916    -0.61598    -0.72173
A      A      A      -1.1   A      -0.09756    -0.52235    -0.20192    -0.17806
-0.4   -1     -0.7   -1     -0.8   -0.77073     0.67732     0.83433    -0.12035
0.7    1      0.7    1.3    1.2    -0.14535    -0.19599    0.078521     0.63703
A      A      A      A      A      0.863885     0.33427    1.228534    0.606306
-5.6   -5.4   -6.2   -5.7   -5.6   -1.75929    0.080592    1.200423    1.376449
-0.3   -1     -0.4   -0.6   -0.4      0.5285   0.069761     0.06944    0.193001
-0.4   -1.3   -0.3   -1     -0.9   0.904275    0.020294     0.94916      -0.0282
-0.4   -1.3   -0.3   -1     -0.9   0.975659    -0.40529    1.407762    0.584786
-0.4   -1.3   -0.3   -1     -0.9   0.207379    0.111494    0.031119    0.041781
-0.4   -1     -0.7   -1     -0.8   -0.43928    0.079912    0.147577    -0.20495
-0.4   -1     -0.7   -1     -0.8   -0.72171    0.907349    0.667077      -0.0541
0.9    0.5    0.9    0.7    0.1    0.080704     0.24337     0.08415    0.177072


0.4    A      0.2    0.1    0.6    -0.07431 -0.28695       -0.18103    -0.28248
-0.1   1      A      -0.4   0.6    1.007629 0.041607       -0.19592    -0.22713
0.8    0.5    0.5    0.5    0.5    -0.82184 1.304933       -0.57775    -0.94435
A      A      A      A      A      0.859783    0.603571    0.484919    0.342035
-0.1   A      A      1.9    1.5    0.011267    0.005584    0.063822    0.040565
0.9    0.6    0.9    0.9    0.9    -0.60159    -0.30385    0.025057    0.116455
1.2    1      1      0.8    0.6    -1.30318    -1.46136    -1.15389    1.952489
0.5    0.4    0.6    0.4    0.5    -0.14177    -0.42381    -0.24288    -0.23866
0.5    0.4    0.6    0.4    0.5    -0.10328    0.216789    0.652876    0.173037
0.4    0.5    0.4    0.2    0.4    -2.54921    -2.26062    0.254783    -2.13627
0.4    0.5    0.4    0.2    0.4    -3.87387    -1.84652    0.291212    -2.05296
0.4    0.5    0.4    0.2    0.4    -0.11861    -0.40306    -0.11291    0.020165
0.2    0.1    0.5    0.1    0.2    1.119955    1.015317    0.908863    1.416503
0.5    0.3    0.6    0.4    0.5    -0.20345    -0.00829    0.253397    -0.27021
0.5    0.3    0.6    0.4    0.5    0.079119    -0.45616    -0.16363    0.045921
0.1    -0.2   0      0.2    -0.2   0.447196    0.173483    -0.04031    -0.08072
-0.5   A      -0.6   -1     -0.6   -0.33855    -0.51449    -0.49005    -0.56446
-0.5   A      -0.6   -1     -0.6   -0.11533    0.754801    0.263467    0.230891
0.2    0      0.2    -0.1   0.2    -0.57691    1.201325    1.015121     0.12547
0.2    0      0.2    -0.1   0.2    0.249406    -0.07909    0.149843    0.004779
0.2    0.4    0      0.4    0.1    0.087305    -0.15183      -0.1041   -0.08736
-0.7   -0.9   -0.7   -0.9   -0.6   -0.14858    0.894187    0.728457    0.226081
0.3    0.3    0.3    0.3    0.6    -0.06897    0.050072    0.010416    -0.23094
0.6    0.3    0.6    0.5    0.1    0.285323    0.011454    0.059954    0.073811
0.6    0.3    0.6    0.5    0.1    0.194144    0.408391    0.091911    0.329991
0.1    0.1    0.4    0.1    0.4    0.241307    -0.07146     0.25273    0.481723
0.2    0.4    0.3    0.3    0.7    -0.30061    -0.03142    -0.01915    -0.15208
0.2    0.4    0.3    0.3    0.7      -0.1227   -0.06588    0.183657    0.007586
-1.4   -2     -3.4   0.3    0.7    0.367878    0.346199    0.142569     0.06069
0.3    0.3    0.3    0.2    0.2    0.357974    0.400166    0.429191    0.670874
0.2    0.3    0.2    0.2    0.6    0.569315    -0.75136       -0.941   -0.40594
0.4    0.2    0.4    0.5    0.9     0.01981      -0.0607   0.118475    0.025169
0.4    0.2    0.4    0.5    0.9    0.144821    0.148955    0.164828    0.282001
A      A      A      A      A      -0.45948    -0.68453    -0.95906    -0.99649
A      A      A      A      A      -3.55997    -2.13934    0.286712      -2.4992
A      A      A      A      A      -2.48741    -1.76436    0.081544    -1.83908
-0.3   -0.5   -0.4   -0.5   -0.2   -0.90783    -1.48234    -1.30824    -0.34417
-0.3   -0.5   -0.4   -0.5   -0.2   -0.46227    -0.31783    -0.33027    -0.07577
0.5    0.6    0.5    0.6    0.6    -0.19005    0.145983    -0.14893    -0.15943
0.3    0.2    0.4    0.2    0.3     0.24736    0.289789    0.071574    0.155435

A      A      0.2    0.4    0.5    -0.46937 0.506081 0.400819 -0.09352
A      A      0.2    0.4    0.5    -0.36855 0.097644 0.003708 -0.11567
A      A      0.2    0.4    0.5     -0.0021 -0.17614 -0.12355   -0.1933
0.2    0.6    0.4    0.7    0      -1.04621 -0.80341 -1.10094 -0.90668
0.2    0.6    0.4    0.7    0       -0.1384 -0.40252 -0.09085 0.095752
0.2    0.6    0.4    0.7    0       -0.6319 -0.85424   -0.9836 -0.72812




0.2    0.3    0.3    0.3    0.5    -0.02469 -0.02977 0.272344 0.601532
A      3.4    A      A      A      0.440251 -0.00253 0.140157 -0.05027
A      3.4    A      A      A      -0.06637    0.2215 -0.08103 0.014971
A      3.4    A      A      A      -0.14963 0.618941 -0.08688 -0.03205
A      A      A      A      A      0.042642 -1.27585 -0.71326 0.177074
-0.5   -0.8   -0.4   -1     -0.7   1.115153 0.505169 0.478878 -0.14192
-0.5   -0.8   -0.4   -1     -0.7   -0.01179 0.481122 0.801534 0.346355
-3.9   -0.8   -3.1   -1.4   -3.6   0.815886 -0.29744 1.228323 1.028545
-3.9   -0.8   -3.1   -1.4   -3.6   1.224931 -1.63805 -0.99557 -0.17129
-3.9   -0.8   -3.1   -1.4   -3.6   0.428709 -0.19231 0.811175 0.63287

0.1    0.6    0      0.7    0.7    -0.20272 -0.11696 -0.02862 -0.17042
1      0.9    0.9    1.1    1.2    -0.80901 -0.52191 -0.24917 -0.08696
A      A      A      A      A      -0.00135 0.410138 0.348248 0.033078




0.4    A      0.2    0.3    0.9    0.154446   -0.16933 0.591748     -0.07745
1.1    1.1    1.1    0.7    0.9    -1.05642   -1.16814   -1.0052       -0.859

0.7    1.4    A      0.9    0.7    0.514821   0.407179   0.879961   1.013277
0.7    1.4    A      0.9    0.7    -0.15461   -0.24916   -0.34849   -0.13372
0.7    1.4    A      0.9    0.7    -0.02489    0.07306   -0.13668   -0.05445
1.1    0.8    0.8    0.8    0.6    -0.21497   -0.39067   -0.23144   0.133823
0      -0.2   0.1    0.1    0      -0.65456   0.209043   -0.86574   -0.84787
-0.1   0.7    -0.2   0.3    0.2    0.045178   0.376326   0.151466   0.164435
A      A      -0.4   0.2    0.5    -0.03201   0.585789   0.372805   0.192585
0.6    A      0.7    0.7    0.5    0.311507   0.238469   0.011746   0.470968
0.8    0.6    0.7    0.5    0.6    -0.13274   0.169483   -0.06057   -0.02878
0.8    0.6    0.7    0.5    0.6    0.053166   0.090427   0.146095   0.168978
0.8    0.6    0.7    0.5    0.6    1.324594   0.163377   -0.15571   0.140731

A      A      A      A      A      -0.23991   -0.05815   -0.77281   -0.20903
A      A      A      A      A      0.003898   -0.20226   0.426437   -0.09082
A      A      A      A      A      0.932192   0.434402   0.328544   0.384151
0.5    0.3    0.4    0.5    0.6    -0.72979   -0.54166   -0.43343   -0.03743
0.7    0.6    0.7    0.7    0.7    0.180085    0.02517   -0.06365   -0.12088
-7.8   -4.3   -7.1   -6.9   -8     -0.13971   0.679627   0.290267   0.569529
-0.6   A      -0.8   -1     -0.7   -0.63149   -0.63379   -0.13279   -0.12059
A      A      -0.8   -0.9   A      -1.38661   1.773719   0.107947   -0.85671
A      A      -0.8   -0.9   A      0.676734   0.317441   0.777329   0.457987
A      A      -0.8   -0.9   A      0.771502   0.017713   1.043154   0.252225
-0.6   A      -0.8   -1     -0.7    0.11906   0.086348   0.157034   0.312579
0.9    0.7    0.9    0.8    0.6    0.131415   -0.68233   -0.50909   -0.01401
A      A      A      A      A      -0.17636   0.155042   -0.54669     -0.4802
A      A      A      A      A      -0.23768   0.985979   -0.03122   -0.09566
-1     -1.8   -1     -1.7   -1.3   1.015806   -0.08692   1.231219   0.136562
-1     -1.8   -1     -1.7   -1.3   0.251547   -0.09973   -0.07003   -0.04159
-1     -1.8   -1     -1.7   -1.3   0.931487    0.37143   1.201839      0.1985
-1     -1.8   -1     -1.7   -1.3   1.163274   0.121169   1.579992   0.814352
-1     -1.8   -1     -1.7   -1.3   0.626631   -0.12264   0.310381   0.212465
-0.1   -0.5   0      -0.6   0      -0.51298   0.400858   1.153311   0.166035
-1.8   -1.4   -2.4   -2.7   -2.4   1.083287   -0.82279   -0.33555   0.429736
-1.8   -1.4   -2.4   -2.7   -2.4   0.622808   0.291069   0.854447    0.07524
-1.8   -1.4   -2.4   -2.7   -2.4   1.067203   0.239688   1.518998   0.901941
-1.8   -1.4   -2.4   -2.7   -2.4    0.04665    -0.04279    0.081427    0.030949
-1.8   -1.4   -2.4   -2.7   -2.4   1.037947      -0.0253   0.572984    0.284797
0.7    0.8    0.7    0.7    1      -1.48777    -0.30477    -0.34372    -0.57895
0.7    0.8    0.7    0.7    1      -1.00751      -2.3271   -1.32563    -1.12421
-1.3   -1.8   -1.4   -1.6   -1.6   0.801694    0.938341    -0.71408    0.810707
-1.3   -1.8   -1.4   -1.6   -1.6   0.436225    0.658346    0.005711     0.30499
-1.3   -1.8   -1.4   -1.6   -1.6   1.274369    1.038927    -0.32676    0.744187
-1.3   -1.8   -1.4   -1.6   -1.6   0.736933     0.66943    -0.28784    0.229745
-1.3   -1.8   -1.4   -1.6   -1.6   0.401482    0.090676      -0.5084   -0.43574
A      A      A      A      A      0.248932    0.237107    0.221191     0.34296
A      A      A      A      A      0.491532    0.891548    0.481597    0.231434
A      A      A      A      A      0.888326    0.976062    -0.71994    0.858939
A      A      A      A      A      0.220154    0.574185    0.373269    0.230688
A      A      A      A      A      0.785243    0.673596    0.000351    0.412148
A      A      A      A      A      0.100659    0.464079    0.533275    0.216151
0.3    A      0.2    -0.2   0.8    0.345669    -0.21667    0.159255    1.448927
0.3    A      0.2    -0.2   0.8    0.222194    0.266657    0.710774    0.063709
0.3    A      0.2    -0.2   0.8    0.778004    -0.31726     0.46065    1.572773
0.3    A      0.2    -0.2   0.8    -0.17675    -0.12761    -0.15566    -0.23524
0.3    A      0.2    -0.2   0.8    0.193135    0.104009    -0.14739    0.229678
0.3    0.3    0.5    0.4    0.1    0.122799    -0.15694    0.242363    -0.07046
A      A      A      A      A      -4.26021    1.359112      -0.8639        -2.4
A      A      A      A      A      -0.75914    0.612344     0.59055    0.049639
A      A      A      A      A      -0.11736      -0.1676     -0.3559   -0.18684
0.5    0.4    0.5    0.6    0.7    -1.67561    -1.65956    -0.71877    -1.35514
0.5    0.4    0.5    0.6    0.7      -2.3213   -2.63502    -0.48132    -1.18643
0.5    0.4    0.5    0.6    0.7    -2.95173    -3.24545    -0.81882    -1.07638
-1.4   -1.5   -2.3   -1.3   -1.1     -0.0545   1.274766    0.943789    0.129749
-1.6   -1.5   -2     -1.2   -1.3   -0.86087    0.756812    0.524518    -0.14426
-1.6   -1.5   -2     -1.2   -1.3   -1.48157    1.015718       0.2898   -0.26782
0      A      -0.5   0.2    0      0.314617    0.059174    -0.00938    0.029608
A      A      A      A      A      0.473952    0.274715    -0.04258    -0.06031
-3.2   A      -3     -4.3   -4.5   -0.10687    1.441531    0.982932    0.684046
-3.2   A      -3     -4.3   -4.5   -0.37383     1.85298    0.591468    0.586264


-0.3   -0.1   0.2    0      0.2    -0.07274 -0.28859       -0.37099 -0.07395
0.1    A      -0.3   A      A      0.318822 0.627114        1.19756 1.421505
0.1    A      -0.3   A      A      0.053064 0.012815       -0.01365 0.154583

A      A      -0.4   0      A      0.590712      -0.0242   0.321382    0.588832
A      A      -0.4   0      A      0.396783    0.214433     0.34559    0.448355
A      A      -0.4   0      A      1.062356    -0.35143    -0.25479    0.807977
0.2    0.5    0.1    0.5    0      -0.26722    0.441298      -0.0278   -0.14129
0.2    0.5    0.1    0.5    0      -1.32655    -0.94737      -0.5687   0.087125
0.2    0.5    0.1    0.5    0      -0.27382    -0.41228    0.640375    0.271247
A      A      A      A      A      -0.64175    -0.24496    0.515957    -0.35751
A      A      A      A      A      -0.90384    -0.22555    0.590352    0.307076
A      A      A      A      A      -0.19872    0.040288    0.720894      -0.2948
0.8    0.6    0.8    0.5    0.9    -0.08068    -0.50637      -0.2164   -0.06701
-0.4   0.1    -0.7   0.4    0.4    0.458972    0.390446    0.499358    0.234142
-0.4   0.1    -0.7   0.4    0.4    -0.35233    -0.84826    -0.39234    -0.39593
-0.4   0.1    -0.7   0.4    0.4    0.230483    0.029287    0.114306    0.174609
0.9    0.7    1      0.6    0.9    0.099601    0.052801    -0.17745    -0.07395
1.2    1.1    1.3    1.3    1.1    -1.05408    -0.89633    -0.50043    -0.41128
1.2    1.1    1.3    1.3    1.1    -0.04699    0.058796    0.336905    -0.02003
1.2    1.1    1.3    1.3    1.1    -1.24282    -0.85021    -0.26293    0.037913
0.2    A      -0.3   0      0.1    0.638828    0.945141    -0.12634    -0.38137
0.6    0.1    0.6    0.2    0.4     0.02778    0.381742    0.420867    0.125242
0.6    0.1    0.6    0.2    0.4    -0.06623    0.451002    0.558639    0.102606
0.6    0.1    0.6    0.2    0.4    0.082528    0.767082    0.463975    0.202221
0.3    0      0.4    0      0      0.107717    -0.08923    0.175115    0.149413
0.3    0      0.4    0      0      0.259867    0.342947    0.593435    0.212112
0.3    0      0.4    0      0      -0.05374      -0.2225   0.047208    0.062478
0.6    0.7    0.5    0.8    0.8    0.428164    0.368012    -0.36261    -0.07972
1.2    1.1    1.4    1      1.1    0.825839    -1.28019    -0.62287    0.994835
1.2    1.1    1.4    1      1.1    -1.34107    -1.31925    -0.63946    -0.59206
1.2    1.1    1.4    1      1.1    0.096363    -1.23338    -0.93984    0.403764
0.7    0.2    0.6    0.5    0.5    -1.53718    -1.36954    0.045659    -0.75872
0.7    0.2    0.6    0.5    0.5    -0.92095    -0.84229    0.632919    -0.47213
0.7    0.2    0.6    0.5    0.5    -0.81383    -1.37048    0.507586    -0.53863
-3.3   A      -4.3   -4.6   -2.8   0.178766    -0.13911    0.062402    0.052023
-0.3   -0.5   -0.3   -0.8   -0.4   -0.42824    0.289001    0.307969    -0.09616
-0.3   -0.5   -0.3   -0.8   -0.4   -0.48961    1.664569       1.2314   0.864485
A      A      -3.4   A      A      -1.16941    -1.50133    0.090347    -0.74328
A      A      -3.4   A      A      -0.13234       0.0747   0.797482    -0.22328
A      A      -3.4   A      A      0.179107    0.122487     0.39098    -0.18934
0.5    0.4    0.7    0.5    0.7    0.092097    0.121474    0.178798    0.056356
0.9    1      1      1      1      -0.51735    -0.51443    -0.26435    -0.27185
0.5    A      A      A      A      0.133558    -0.29822    -0.21555    -0.47313
0.5    0.5    0.2    0.3    0.5      -0.0706   0.252704    0.113166    0.006687
0      -0.2   0.3    0.1    0.4    0.002911    0.391651    0.317319    -0.00812
0.1    0.2    0.1    0      0.4    0.257925    -0.54763    -0.52029    -0.19471
0.1    0.2    0.1    0      0.4    -0.27261    0.016063    -0.03063    0.250251
0.1    0.2    0.1    0.3    0.4    0.188382     0.04216    0.455076    0.516618
0.1    0.3    0.1    0.1    0.5    0.227002    0.368665    0.621722    0.482079

A      A      A      A      A      0.095997    -0.00018    1.237701    0.120635
A      A      A      A      A      -0.17357    -0.08548    -0.12032    -0.03893
A      A      A      A      A      -0.16578    0.565072    0.801019     0.48146
0.4    0.5    0.3    0.5    0.6    -0.01903    0.065663    -0.12798    0.063152
0.5    0.1    0.4    0.1    -0.2   0.253309    -0.77743    -0.20684    0.206209
0.5    0.1    0.4    0.1    -0.2     -0.0075   0.059046    -0.00229    0.081483
-0.2   -0.8   -0.4   -0.6   -0.9   0.007236    0.102963      -0.0017     -0.0738
0.6    0.3    0.5    0.5    0.5    0.263143    0.485451    0.441733    0.287302
0.1    0.1    0.2    0.3    0.5    -0.26226    0.308355    0.008239    0.077422
0.1    0.1    0.2    0.3    0.5    -0.45297    -0.24852    -0.21745     0.09804
0.2    0.3    0.3    0.3    0.6    -0.07266       0.0999   -0.50187    -0.09769
0.9    0.3    0.8    0.4    0.7    0.011785    -0.45398    0.606511      -0.3535
0.3    0.5    0.3    0.2    0.6    -0.11896    0.081388    0.285913    0.372153
0.3    0.5    0.3    0.2    0.6    -0.00304    0.084587    0.054672    0.102461
0.6    0.4    0.6    0.8    0.8    -0.00403    -0.28228    0.097977    0.052823
0.4    1.2    0.4    0.3    0.6    -0.08174    0.496129       0.1471   -0.07366
A      A      -1.7   -1.4   -1.9   0.099825    -0.02156    0.171128    0.178364
0.4    0.3    0.5    0.2    0.7    0.450698    0.100441    0.938674     0.68248
0.4    0.3    0.5    0.2    0.7     0.47629     0.09869    0.586127    1.355741
0.4    0.3    0.5    0.2    0.7    0.033715    0.308356    0.236313    -0.02943
0.3    0.4    0.1    0      0.1    -0.28551    0.817121    0.034853    -0.29696
-0.1   -1     -0.1   -0.7   -0.7   0.160316    0.278048    0.442567    0.030448
-0.1   -1     -0.1   -0.7   -0.7   -0.27288    -0.18362    0.108346    0.188679
-0.1   -1     -0.1   -0.7   -0.7   0.293518    0.047408    0.491509    0.126096
-3.7   -4.5   -4.5   -4.6   -3     -0.20129    0.133134    0.230769    -0.03813
-3.7   -4.5   -4.5   -4.6   -3      0.11714    -0.03265    0.079491    0.280315
0.4    0.2    0.4    0.2    0.6    0.180758    0.481826    0.414474    0.265949
0.1    0.2    0.1    0.7    0.4    0.515052    -1.23488    -0.20789     0.43871
0.1    0.2    0.1    0.7    0.4    -0.54518    -0.37374    -0.31425    -0.01675
0.1    0.2    0.1    0.7    0.4    0.068493      -0.9306   -0.33644     0.20295
0.1    0.4    0      0.2    0.6    0.008753    -0.07916    0.065402    0.366978
0.5    0.3    0.6    0.4    0.4    -0.12325    0.030887      -0.1077     -0.2061
0.5    0.2    0.5    0.5    0.4    -1.03268    -1.15689    0.190421    0.314014
0.3    0.1    0.5    0.4    0.4    0.235367    -0.91869      -0.3443   0.642449
0.3    0.1    0.5    0.4    0.4    -0.05979    -0.80808      -0.6126   -0.01499
-0.2   A      -0.5   -0.2   -0.6      0.4475   0.010272    0.390708    0.081165
1.4    1.1    0.9    0.6    1      0.116953    -0.03481    -0.13204    0.156517
A      A      A      A      A      -0.19864    -0.38637    -0.23721    -0.38891
A      A      A      A      A      -0.40396    -0.64143    -0.28864    0.023048
A      A      A      A      A       1.11571    -0.39455    0.114922    -0.14305
1.1    1      0.6    1      0.9    0.865711    0.044827    0.501204    -0.05921
1.1    1      0.6    1      0.9    -0.81532    -1.56205    -0.16796    0.056473
1.1    1      0.6    1      0.9    0.135312    -0.01223      -0.0007     -0.2576
-0.1   0.1    0.1    0      0.1      -0.1227   0.730214    0.081939    -0.30052
-3.6   A      -3.5   -3.2   -1.6   -0.33393    0.050901    -0.11589    -0.11748
-3.6   A      -3.5   -3.2   -1.6   0.624092    0.343779    0.334473    0.217126
-3.6   A      -3.5   -3.2   -1.6   -0.14702    -0.10942    0.117922    -0.18921
0.4    0      0.4    1.7    0.9      -0.3406   -0.17536    -0.24797    -0.44511
0.1    0.1    0.2    0.1    0.4      -0.4123   -0.17973    -0.35656    0.309276
0.3    0.1    0.3    0.3    0.6    0.160065    0.212597    -0.02359    -0.00327
A      A      A      A      A      -0.02077       0.3349   0.195254    0.057831
A      A      A      A      A      -0.33027    -0.33568    -0.31122    -0.50333
A      A      A      A      A      0.621002    0.431937     0.43021    0.365647
0.8    0.4    0.6    0.6    0.7    -0.36423    -0.35873    -0.15915    -0.09853
0.8    0.4    0.6    0.6    0.7      -1.9299   -2.49794    -1.44357    -1.26941
-0.9   -1     -1     -0.4   -0.3   0.055717    1.175969    0.310817    0.100386
0.1    -0.1   -0.1   0.2    0.1    0.113564    -0.08362    0.994095    0.151523
A      A      A      -0.8   A      1.274219    0.156403    0.105421    -0.01829
A      A      A      -0.8   A      1.205408    0.002611    -0.01603    0.032211
A      A      A      -0.8   A      0.631792    0.087654    0.265257    0.348419
-6.4   -4.2   -6.2   -5.7   -8.9   0.168255    0.356261    0.138092    0.347963
0.2    A      -0.2   0.2    0.3    -0.19056      -0.2941   -0.19313    -0.01168
0.2    A      -0.2   0.2    0.3     0.74323    -0.10468    0.626486    0.700634
0.2    0.4    0.3    0.3    0.7      -0.3986   0.500647    0.967327    0.206122
0.3    0      1.2    0      0.8    -0.00696    -0.50611    0.232101    -0.01273
-0.1   -0.9   0      -0.6   -0.4   0.567071    0.154328    0.050445    0.025384
A      A      A      A      A      0.057646    -0.00687      -0.0827   0.031936
0.2   0.2   0.4   0.4   0.4   0.307989 0.45316 0.378328 0.300033
0.4   0.3   0.3   0.4   0.6    0.26502 0.191259 0.11205 0.095895
0.4   0.3   0.3   0.4   0.6   -0.25197   -0.1195 0.076313 0.181491

0.1   0.3   0.1   1.2   0.4   1.313553   -0.73524   -0.51848   0.4506
          Apochip '7&8G1 Log2 Apochip 9&10G1 Log2 (ch2/Ch1 Coefficient of correlation correlation MAS 5.0
                     Apochip '7&8G2 Log2 Apochip 9&10G2 Log2 (ch2/Ch1) Coefficient of (ch2/Ch1)
                               (ch2/Ch1) (ch2/Ch1) Apochip 11&12G1 Log2 (ch2/Ch1)   Variation-Apochip
Apochip FoldchangeFoldchangeFoldchangeFoldchangeFoldchangeFoldchange 11&12G2 Log2 RMA
 1.041974 1.281671 0.603276 0.703465 0.147884 0.304411 0.777763 0.827592 0.258923
 0.573367 0.732655 0.539481 0.646429 0.094211 0.131758 0.739233 0.80933 0.109444
 -0.22436 -0.11197 -0.25789 -0.12992 -0.62883 -0.58906 -0.58048 -0.51981 0.288193
 0.085824 0.271333     -0.1581 -0.07488 0.051462 0.026582 0.618171 0.610084 0.028668
 0.108187 0.132079 0.131419       -0.083 0.221458 0.068231     -0.5646 -0.53399 0.019654
 0.755587 0.860773 0.298075 0.272758 -0.03259 0.234505 -0.57301           -0.6517 0.117223
 0.409523 0.71614 0.43947 0.444579 0.03411 0.141771 -0.70865 -0.81973 0.087875
 -0.48819 -0.28735 -0.35143 -0.14619 -0.13145        -0.3619 -0.66056 -0.68973 0.03117
 0.254934 0.632714 0.23789 0.492301 0.104141 0.539973 0.890773 0.753207 0.158071
 0.107452 0.289304 0.109218 0.188811 0.324818 0.528283 0.692774 0.41666 0.039853
 0.125219 0.253145 0.077055 0.062104 0.716123 0.43879 0.860877 0.766434 0.187429
 0.040592 0.059323 0.010812 0.155174 -0.01278 -0.19581 0.464547 0.486728 0.018722
 -0.10069    -0.1122   -0.2249 -0.06285 -0.11693 0.001951 0.898359 0.905687 0.134558
 -0.00792 0.288524 0.106406 0.186615 0.185449 0.487724 0.128106 0.143773 0.082058
 -0.17555 -0.04092 -0.12637 0.060546 -0.22268 -0.09817 0.950145 0.977308 0.194819
 0.414055 0.386422 0.18003 0.299789 0.480666 0.369504 0.912488 0.847263 0.07934
 0.519127 0.572454 0.455804 0.629562 0.68826 0.638245 0.972078 0.971097 0.385413
 -0.16067 -0.04835 -0.20832 -0.07385 -0.21588 -0.22161 -0.63211 -0.62226 0.074002
 -1.15713 -0.93381 -0.86019 -0.60053 -0.72999 -0.86817         -0.6344 -0.64341 0.044065
 0.058639 0.248273 0.206962       0.1601 -0.02867 -0.00088 0.534658 0.401661 0.02078
 -0.09192 0.092601 0.049187 0.012789 -0.21706 -0.08119 -0.84726 -0.85685 0.028051



 0.079846 0.073682    -0.20766   -0.04055   -0.06957   -0.15653 0.803985 0.074664 0.050083




 0.118962 0.089817     0.00678 0.095491 0.188709 0.063972 0.490884 0.326292 0.006154




 -0.19281 -0.31317 -0.24909 -0.30508   -0.2591 -0.16775 0.836443 0.921122 0.065501
 0.209977 0.092585 0.063515 -0.09714 0.132105 0.151225 -0.11137 0.254132 0.01362
   -0.3026 -0.10329 -0.25698 0.155307 -0.23888 -0.23513 0.871617 0.852655 0.058531

 0.186009 0.187442 0.218514 0.154952 0.183227 0.172649          -0.81952   -0.82769 0.128534
0.178971 0.180004 0.031684 0.065325 0.022889 0.124418 0.584347 0.61273 0.184977
0.648246 0.584272 0.56145 0.392389 0.488191 0.535202 -0.06707 0.016671 0.660507

0.149112 0.110196 0.019557 0.089489 0.125794               -0.05217 0.093612 0.247564 0.025834



0.278275    0.044598   -0.0428  -0.0081 -0.07315 -0.23606 0.433565                 0.265622    0.063801
0.028072    0.104345 0.005471 0.143165 0.11277 0.055746 0.37426                    0.380453    0.026753
0.189547    0.272892 0.10561 0.332917 0.232922 0.254106 0.285382                   0.205857    0.047783
-0.12816      -0.0963 -0.14179 -0.00527 -0.47048 -0.17127 0.674882                 0.693816    0.230769
0.050256    0.053395 0.01376 0.030324 0.002837 -0.14068 0.78168                    0.800541    0.029655
-0.06588    -0.14648 -0.04486 -0.16486 -0.04511 0.017197 -0.28583                  -0.37801    0.149029
0.161517    0.359784 0.223275 0.009538 0.127572 0.313339 0.191087                  -0.26001    0.021933
  -0.0198   -0.05307 -0.14573 -0.02062 -0.19763 -0.00673 -0.15544                  -0.16918    0.012694
 0.10829    0.152384 0.062888 -0.01265 0.050711 -0.02976    -0.3811                -0.42833    0.065749
-0.65855    -0.48802   -0.3102 -0.29959 -0.51095 -0.39236 -0.63444                   -0.6239   0.488786

-0.03073 0.090418 0.027077 0.339785 0.119221               -0.03874    -0.02741    -0.13001 0.017835
-0.57753 -0.33724 -0.40375 -0.16068 -0.15362               -0.47049    -0.26397    -0.34119 0.037696

-0.00067    0.039252    -0.04172    -0.10456   0.027417    -0.25524    -0.27152    -0.32122    0.099895
1.083716    1.196802    0.561696    0.859173    0.28436     0.25657       -0.127   -0.11865     0.26749
0.114854    0.322721    0.113903    0.153298   -0.23397      -0.1442   0.923155    0.931097    0.149156
-0.02119    -0.17072    -0.18685    -0.15468   -0.21862    -0.42252    -0.63474    -0.62623    0.051628
0.020308    -0.10529    -0.01356    -0.20657   -0.05086    -0.18501     0.20246    0.256258    0.044004
0.566351    0.572673    0.268523    0.248905   0.129155    0.160642    0.186264    0.177797    0.067447
-0.09729    -0.00708    0.112782    -0.05883   -0.14545    -0.16768     0.75417    0.652824    0.139108
-0.12636    -0.17417    -0.11756    -0.07827   -0.13178    -0.23864    0.839802    0.874681    0.097908
0.463815    0.528961       0.6299   0.522723   0.210473    0.402308    -0.82238      -0.6955   0.125629
0.001038    -0.06145    -0.17271    0.011717   0.015585    -0.01841    0.609773     0.43645    0.006295
-0.15172    -0.27814    -0.03074    -0.18264   -0.15473    -0.18363    0.600196    0.604906    0.137727
-0.08721    -0.13178    -0.21112    -0.16221   -0.12734    -0.06481    0.641812    0.567132    0.047082
0.421866    0.279207    0.586939    0.627121   0.309214    0.306721    0.760922    0.626967    0.080199
0.206639    -0.05039     0.21395    0.177152   0.102472    0.096574     0.61658     0.61612    0.027571
-0.40166      -0.4312   -0.35824    -0.14987   -0.18761    -0.55958    -0.01719      -0.4784   0.033757
0.179889    -0.01928    -0.14856    -0.23448     -0.1039   -0.14457    -0.27166    0.008336    0.014904
0.135469     0.06531    0.153051    0.064666   -0.04176    0.067865    0.116921    -0.13496    0.007499
0.538431    0.489534    0.483336    0.350667   0.161895    0.217721    0.658967    0.404291    0.316506
0.107106    -0.09425    -0.01792    -0.10353   0.044172    -0.07906    0.818403     0.75528    0.082357
 0.41023     0.36382    0.123673    0.171605   -0.04395    -0.13852    0.188692    0.061307     0.07469
-0.04638    0.110419    0.074097    -0.03177   0.083905    -0.01121    -0.46478    -0.22145    0.007348
 0.30243    0.265408    0.057478    -0.01897   0.161724    -0.04674    0.427063    0.304996    0.055661
-0.03797    -0.25576    0.007973    -0.23894   0.090298    0.062799    0.125106    0.196794    0.032115
0.145888    0.248456    0.205315    0.206847   -0.08037    0.084871      -0.6414   -0.69194    0.135221
-0.19143    -0.05198      -0.1777   0.122753   -0.01545    -0.25842    -0.22746    -0.12656     0.03045
-0.28485    -0.02134    -0.02355    0.084738   0.026105    0.010977    -0.24482    0.038867    0.041288
0.232072    -0.03669    0.125197    -0.12523   0.188603    0.213548    0.024963    -0.08632    0.128403
0.707106    0.339295    0.590587    0.347107   0.778435    0.569204    0.953645    0.947899    0.547895
-0.31506      -0.6416   -0.68996    -0.86506   -0.76567    -0.90473    -0.01793      -0.0552   0.027932
0.734029    0.514007    0.778249    0.336311   0.770526    0.595374    0.981253    0.977002    0.791077
-0.03212 -0.01492 0.138474 0.129215 -0.09622 0.105578 -0.15249 -0.11251 0.127028
0.106387 -0.07108 0.278062 0.151835 0.037302 -0.06502 0.521767 0.727214 0.054541
 0.38252 0.226604 0.308437 0.254579 0.246568 0.297316 0.814111 0.771259 0.020279
-0.07505 0.219104 0.107541 0.167236 -0.18111 0.07485 0.043896 0.090476 0.022769
-0.49866 -0.39168 -0.38669 -0.44747 -0.54946 -0.72302 0.526774 0.582961 0.085716
-0.01317 -0.09101   -0.0812 -0.05893 -0.07391 0.077253 0.242184 0.300028 0.06183
 0.14266 0.302613 0.343198 0.146473 0.133151 0.156249 0.172353 0.287732 0.027288

   0.1468   -0.02542     0.21115    0.291982   0.114605   0.141115   0.125716    0.100621    0.01562
 0.11347    0.077365    -0.06403     0.16632   0.083486   0.305054   0.254573    0.028516      0.0185
0.944575    0.993879    0.946933    1.049752   0.963194   0.735737   -0.16322    -0.42073   1.205717
  -0.3476   -0.14442    -0.15883    -0.19325   -0.36167   -0.33615   -0.73643    -0.78589   0.234228
 0.02474    -0.04385    -0.08939    -0.18363   0.129238   0.201707   -0.59298    -0.46466   0.041348
-0.02192    0.168042    0.137628    0.211291   0.060506   0.066886   -0.90452    -0.93206   0.022182
-0.51385        -0.53   -0.56325    -0.46505   -0.52022   -0.46876     -0.5067   -0.57187   0.236593
0.362476     0.59877    0.404054    0.248233    0.38581   0.249669   0.830272    0.834747   0.164603
0.170546     0.18994    0.224467    0.109017   0.075593   0.272229   0.020131    0.147847   0.015077
-0.45261    -0.44924    -0.35177    -0.44679   -0.56841   -0.83776   -0.08988    -0.15837   0.386546
0.165762    0.275354    0.495033    0.562459   0.335676   0.401108   0.814727    0.638214   0.055442
0.026546    0.046434    0.196454    -0.00718   -0.09734   0.238159   0.433621    0.540113   0.038123
-0.00642    -0.17445    -0.15295    -0.13412   -0.09983   -0.28152   -0.11871    -0.03129   0.076739
-0.03986    -0.13329    -0.21838    -0.03498   -0.06458   -0.21356   -0.23657    -0.56305   0.009079
0.314529    0.298625    0.442596    0.261223   0.203154   0.257792   0.718657    0.593144   0.076901
-0.12838    -0.38895      -0.1415   -0.26344   -0.29863   -0.18013   0.387641     0.31717   0.050472
-0.24011    -0.07731      -0.1137   0.038528   -0.22506   -0.19014   0.671091    0.731205   0.051722
  -0.0861   0.000957    -0.04097    0.076395   -0.05183   -0.06383   0.732509    0.955262   0.149123
  -0.1561   -0.31498    -0.14183    -0.28156   -0.17629   -0.38027   -0.60538    -0.71961    0.02224
0.095569    0.163596    -0.10441    -0.03392   0.109227   -0.01389    0.05071    -0.11418   0.035902

-0.21869    -0.44484    0.174327    -0.09848 -0.29293 -0.54566 -0.42866 -0.12664 0.444816
-0.32901    -0.45818    -0.44512    -0.51067 -0.51418 -0.62482     0.8966 0.888385 0.087543
-1.37217    -1.51212    -1.27696    -1.17815 -1.36385 -1.41066 0.951546 0.861283 1.302888
0.231174    0.324672    0.172581    0.230376 0.268747 0.360204 0.817883 0.798138 0.100691
0.486809    0.544643    0.376788    0.325261 0.549311 0.652497 0.922287 0.920319 0.207328
-0.12442      -0.0701   -0.01238       0.0913  -0.1518 -0.03354 0.786371 0.737002 0.026015
0.198875    0.275192    0.215261     0.32138 0.174497 0.240369 -0.14393 -0.28123 0.019153
-0.12318    0.004901    -0.01841    0.021581 -0.08083 -0.09286 0.849501 0.692072 0.162125
0.227672    0.310111    0.270483    0.155887 -0.05665 0.139388 0.93822 0.941323 0.342426

0.052384 0.162168 0.020708 0.033952 0.128735 0.106142                -0.06185 0.549911 0.014207

0.143592    -0.05277 0.216004 0.285248 0.090622           -0.00729 0.752257 0.863236         0.54665

0.550931    0.424371    0.427391     0.33057   0.200553    0.31217   0.315123    0.580181   0.683164
0.476566    0.534591    0.146255    0.654672   0.474568   0.780658   0.863758    0.858134   0.161732
0.064816    0.413466    0.096488    0.414228   0.108561   0.121062   0.515291    0.547899   0.133669
0.045337    -0.08719    -0.06599    -0.20332   -0.33808   -0.48106   0.112265    0.002312   0.036143
0.049638    0.095028    0.080136    0.210163   0.104686   0.049771   0.089819    0.084151   0.007828
-0.05108     0.00106    0.203894    0.187614   0.183743   0.102419   0.026603    0.197198   0.075794
0.065225    0.157964    0.115696    0.093347   0.170273   0.154333   0.557084    0.611493   0.010286
0.283461    0.166995    0.422997    0.233134   0.377748   0.169592   0.429669     0.88773   0.010847
0.178739    0.218413    0.522795    0.262689   0.394376   0.637496   -0.00052    -0.56632    0.12134
  -0.0547   0.168573    0.064003    -0.08221      -0.2245     -0.1938   0.723706     0.67684    0.064857
0.665545    0.384651    0.984059    0.462268    0.774477    0.491164     0.26486    0.918017    0.386448
-0.10811      -0.0471   0.074923    0.033195    -0.07561    -0.16459    -0.45082    -0.67007    0.031471
0.212318    0.191948    0.171876    0.098703    0.011511    0.008518    0.300999     0.51272    0.021616
0.281294    0.263604    0.391675    0.336245     0.38485    0.299549    0.907224    0.949447    0.046944
 0.02549     0.03083    0.005141    -0.07338    -0.07423    0.053185    -0.21484     0.43236    0.065974
-0.45586    -0.25692    -0.43302      -0.1398   -0.27341    -0.37923    -0.65647    0.052457    0.063629
0.109727     0.26363    0.302222    0.198732    0.214848    0.266805     0.57999    -0.08158    0.036659
-0.76729    -0.65161    -0.53301    -0.38186    -0.68861    -0.75435    0.200401    0.209798    0.054957
  -0.2067   -0.30759    -0.43226    -0.54591    -0.56242    -0.78451    0.438535    0.488843    0.200608
0.583016     0.44033    0.629264    0.474208    0.531084    0.274759    0.774359    0.801329    0.081347
0.869008    0.795278    0.881024    0.688182    0.791428    0.973825    0.980929     0.97891    0.482737
0.332562    0.351652     0.26772     0.32342    0.327041    0.315552    0.977074    0.968017    0.112716
0.837109    0.599915    0.744196    0.265358    0.540963    0.766141    0.031851    0.621429    0.541512
0.005998    -0.05911    0.198471    0.077478    0.198753    0.098315    -0.56403    -0.17976    0.134586
0.855431    0.691428    0.775875    0.046681    0.580222    0.616091    0.015732    0.702553    0.474111
-0.09777    -0.48388    -0.25179    -0.56599    -0.44164    -0.51559    -0.00215    0.545061    0.039832
0.397111    0.454572    0.592293    0.178956    0.514408    0.488024    0.808673    0.912898    0.123172
-0.23478    -0.42009    -0.13729      -0.2456   -0.34681    -0.49456    -0.17495    -0.08662    0.547208
-0.08573    -0.00443    -0.12649    0.132754    0.044104    0.102306    -0.36134    -0.49209     0.02566
-0.03451    -0.12349    -0.20497    -0.18242    -0.21586    -0.11982    0.970244    0.912373    0.203711
0.790493    0.561787    0.703792    0.527573    0.598467     0.68094    -0.15206    -0.19192    0.330046
0.199564    0.255755    0.279677     0.24958    0.221961    0.229075    0.331968    0.201637    0.079519
-0.00188    0.003422    0.096678    -0.07898    0.006721    0.029605    0.922477    0.907862     0.02933
-0.19454    0.012604    -0.06365    0.010533    -0.10104    0.006508    0.464509    0.521207    0.190714
-0.07506      -0.0665   -0.07329    0.132473    -0.00414    -0.05881    0.211188    0.456817    0.008072
0.399341       0.1907   0.102279    -0.02886    0.278068    0.036314    0.365484    0.346343    0.086605
-0.26555    -0.23823     0.14578    0.199092     0.09475    0.024614    0.559331    0.574416    0.064816

0.093276    0.078184    -0.05076    -0.09701    -0.05923    0.254366        0.336   0.323538    0.011778
0.055968    0.113489    0.069673    0.004101    -0.29022    0.376974     0.05371    0.240745    0.109803
  -0.1552   0.050215    -0.00876    0.042972    -0.15817    -0.04452    -0.59323      -0.6117   0.019372
0.128752    0.149865    0.137307    0.083505    0.210289    0.146025    -0.35723    -0.51063     0.04035
0.235546    0.394299    0.207084    0.322341    0.207658    0.304743    0.192731    0.167574    0.049137
0.126008       -0.002   0.270592    0.173043     0.18694       0.1186   -0.03177    0.094847    0.016255
0.108582    0.205288      -0.0603    0.18895    -0.03051    -0.16935    -0.49697    -0.39256    0.017219
-0.04078    0.241827    0.212721    0.159932    0.165679    0.291845    -0.25761      -0.1195   0.018698
-0.44267    -0.42559    -0.76951    -0.66909    -1.01905    -1.28759    -0.28646      -0.2441   0.801015
0.491045     0.78052    0.293164    0.641535    0.593914    0.645197    0.553699    0.645842    0.215561
-0.17802    -0.23739    -0.39823    -0.45067    -0.35101      -0.5354   -0.14423    0.351244     0.14515
0.764229    1.042954    0.512631    0.716586    0.759248    0.813403    0.921625    0.947576    0.559086
-0.52342    -0.34045    -0.30024      -0.1815   -0.38682    -0.18569    0.828112    0.813848    0.615173
0.540692    0.766754    0.283678    0.469191    0.266441     0.42599    0.556336    0.708809    0.176617
0.008555    0.492912    -0.12771    0.293072    0.076729    0.240236    0.715532    0.655971    0.061297
0.169599     0.23084    0.053942    -0.06865    -0.12048      -0.0399   0.816713    0.612247    0.081734
-0.01405    0.099438    0.254092    0.228982    0.366423    0.274422    -0.01375    0.614743       0.0786
-0.23939      -0.2422   -0.06135    0.140754    0.196204    -0.06547    -0.10387       0.6422   0.113143

-0.11442 -0.24249 -0.23741 -0.24088   -0.1884 -0.35473 0.226502                     0.179181    0.031057
0.526212 0.653502 0.527194 0.421105 0.219082 0.503988 0.956111                      0.963618    0.621878
0.445279 0.709126 0.459817 0.314043 0.271484 0.456691 0.949616                      0.946905    0.290156
0.677207 0.705913 0.638501 0.566488 0.428395 0.540501 0.836161                      0.842895    0.575283
0.168561   0.448319    0.315401   0.230095    0.103309    0.441292    0.819588     0.81325    0.088665
0.231686   0.265684    -0.19276   0.273243    0.297159    0.214414     0.94457    0.949092    0.129766
-0.05249   -0.01635    0.024344   0.164276    -0.08354    -0.16689    0.467493    0.507309    0.013222
-0.34831   -0.48833    -0.43478   -0.49792    -0.45923      -0.6803   0.978676    0.971982     0.37135
-0.22342   -0.24395    -0.22524   -0.04941    -0.13632    -0.08957      -0.4164   -0.42525    0.012644
-0.17751     -0.1729   -0.15785   -0.17133    -0.05408    -0.24803    0.017691    0.612755    0.105559
0.199524   0.419972    0.330253   0.564262    0.253723    0.521262    0.118143    -0.25886    0.100974
0.290763   0.367153    0.344272    0.32731    0.248342    0.427778    0.123701    -0.40513    0.042493
 0.44004   0.441553    0.393103      0.0012   0.328817    0.261762    0.886582    0.794597    0.239371
0.212908   0.218942    0.030001   0.247325    0.039454       -0.072    0.09829    0.171047    0.039216
0.074972   0.102129    0.084869   -0.04864    0.159763    0.411426    0.151278    0.538992     0.04889
-0.02414   -0.02185    0.132005   0.126739    0.115558    -0.01795    0.055037    -0.11626    0.036285
0.133581   0.341924    -0.07759   0.311145    -0.10672    0.035252    0.747787    0.690892    0.102049
0.839574   0.710256    0.776529    0.53403    0.450394    0.445595    0.931892    0.927672    0.740165
-0.55924   -0.69175    -0.61921   -0.87623    -0.73583    -0.71411    0.189629    -0.01022    0.406745

-0.03988   0.057857    0.184738   0.389238    0.065647 0.12495     0.9209 0.949525            1.014921
0.073415   0.118508    0.189143   0.239966    0.006129 -0.11662 0.938421 0.97609              0.712375
0.312009   0.412447    0.644891   0.687883    0.430478 0.560467 0.942357 0.967497             1.160266
0.161193   0.224283    0.103983   0.334051    0.111937 0.388174 0.889432 0.878778             0.128493
0.080534   -0.03214    0.043723     -0.0954   0.028207 -0.07642 0.641641 0.600118             0.031765

-1.84155   -1.66409    -1.31555   -1.18473    -1.08295    -1.27218    0.450785     0.39574    1.456766
-0.06532   0.002946    -0.17033   0.039668    -0.09915    0.006972    0.481644    0.065595    0.005264
0.063659   0.426456    0.090141   0.128547    0.148647    0.113374    0.187747    -0.23552    0.013631
-0.17305   0.031018    -0.22833   0.067685    -0.05107    -0.07314    0.435829    0.217226    0.035327
0.008311   -0.06903    -0.09628   0.048444    -0.03667    -0.03591    0.925251    0.848866    0.165702
-0.06198       0.015    0.12826   0.130882    0.204888    0.266239    -0.52981      -0.4623   0.030109
0.486632   0.422205    0.239147   0.125577    0.245958    0.403002    -0.28676    -0.20695    0.210941
0.040064   0.104867    0.244184   0.170944       0.0346   0.096248    -0.53051    0.440939    0.121141
0.267076   0.296122    0.207697    0.29446    0.279122    0.202426    -0.56931    -0.03912    0.034738

 0.03044 -0.07146      -0.44358 -0.08125 0.076259 -0.06428 -0.20993 -0.00914                  0.142792
-0.55646 -0.56812      -0.48413 -0.27426 -0.46278 -0.50451 0.002132 0.118963                  0.925952
-0.18093 -0.05257      -0.18911   -0.0472 -0.10305 -0.06682 -0.37389 -0.08596                 0.013092
 0.51296 0.192612       0.62967 0.231784 0.52641 0.697661 0.649591 0.684632                   0.278416


0.079954   0.002315     0.01263 -0.00891 -0.03926 -0.13704 0.319879 0.151637 0.073522
-0.03023   -0.01564    -0.15356 0.049667 -0.07252 -0.09006 -0.24858 -0.11788 0.013562
0.287788   0.236589    0.187221 0.068783 0.118457 0.186656 -0.11716 -0.28532 0.021492
-0.05445   -0.21612    -0.15706 -0.34388 -0.44942 -0.54749 0.225907 0.205341 0.026721
-0.00173   0.250735    -0.30205 -0.29008 -0.41057 -0.22049 -0.25978 -0.26693 0.229004
-0.48879   -0.20891    -0.31067 -0.22936 -0.44454 -0.39521 0.970033 0.98331 0.288973
-0.46073   -0.33305      -0.4854 -0.35162  -0.5664 -0.48817 0.963228 0.934219 0.423871
-0.44893   -0.33074    -0.25269 -0.13217 -0.62687 -0.58498 0.969554 0.950054 0.637386
0.125948   -0.09724    0.245014   -0.1121 0.25182 0.135123 0.156612 0.140954 0.368243
0.007161   -0.06838    0.033773 -0.09983 -0.05335 -0.22675 0.608059 0.543328 0.09037
 0.04213    0.28444    0.147671 0.082647 0.060595 0.084051 0.352134 0.286808 0.023629
-0.33314   -0.28386    -0.41938 -0.37776 -0.49098   -0.4478 -0.35592 -0.61502 0.277438
-0.40087   -0.26261    0.011147 -0.20569 -0.46128   -0.4337 -0.31232 -0.49449 0.388176
0.153714   0.276592    0.155212 0.30829 0.174665 0.266737 0.460969 0.460293 0.006228
-0.17493      -0.0914   0.002429    -0.06692    -0.15368    -0.00054    0.605399    0.555942   0.672312
-0.45835    -0.13155    -0.34455    -0.15244    -0.51006    -0.56647      -0.5411   -0.68929   0.259121
0.164816    0.048053    0.208867    0.168279    0.211038     0.24369    0.490218    0.590855   0.039421
0.122092    0.099707    0.089204    0.087058    0.120243    0.087564    0.682147    0.800714   0.010635
0.118066       0.2177   0.192364    0.089109    -0.16877    0.025502    -0.58566    -0.61103   0.040134
-0.50405    -0.20271    -0.30968    -0.09264    -0.25669    -0.47356    0.462618    0.760088    0.04673
-0.07695    0.113995    0.118691    0.147662    0.050634    -0.07858    0.768494    0.680628   0.047155
-0.81958    0.549116    0.231334    -0.21895    -0.11228    -0.05651    0.531134    0.801826    0.74349
-0.46876    -0.25658    -0.25211    -0.07021    -0.24048      -0.3524   -0.20595    0.187023   0.047348
0.370479    0.177227    0.226988    0.058392    -0.01744    0.253444    0.188737    0.321203   0.031039
0.390271    0.324956    0.360059    0.307109    0.190345    0.136928    0.262837    0.384849   0.034916
-1.34802    -1.02547    -0.74838    -0.91175    -1.12996    -1.07022    0.972952    0.984515   1.244656
-1.36722    -0.87034    -0.85045      -0.5953   -1.06495    -1.23859    0.980837    0.988999   1.439614
-0.86471      -0.7197   -0.48354    -0.57423    -0.71682    -0.64645    0.976682    0.987725   0.800329
  -0.7999   -0.46794    -0.46987    -0.38853    -0.57337    -0.72224    -0.19227    -0.01159   0.453108
-0.51063      -0.3797   -0.39857    -0.25317      -0.5178     -0.6877   0.027404    0.215862   0.466472
-0.04794    0.207412    0.273489    0.129352    0.124979    0.067902    0.586433    0.702775    0.05105
0.307346    0.252153    0.095275    0.042438    0.033312    0.278457    0.892411    0.899034   0.059308
-0.29894    -0.16603      -0.1809   -0.05622    -0.26913    -0.28114    0.226949    0.505875   0.179187
0.211613    0.311882    0.059161    -0.00406    0.274421    0.032494    0.546315    0.444505   0.121538
-0.13968    0.058134    -0.06229    -0.05295    0.020314     0.02684    0.733941    0.698482   0.016941
0.548356    0.573844    0.410026    0.274604    0.610622    0.498421    0.944556    0.926679   0.736506
0.188044    -0.01306    0.078731     0.01436     0.21185     0.20745    0.592974    0.446595   0.011971
0.283619     0.37548    0.339802     0.27234    0.336814    0.461409    0.732222    0.619761   0.118526
0.228202    0.103059    -0.08158    0.075484    0.108087    -0.08542    0.035393    0.225576   0.040746
0.240097    0.079151    0.356824    0.146649    0.200925    0.097669    -0.34972    -0.61914   0.030902
-0.76802    -0.60881    -0.50972    -0.42942    -1.00469    -0.67484    0.924545    0.951004   0.625301
-0.22921    0.165201    -0.20581    0.056678    -0.35123    -0.27725    0.716102    0.706337   0.277114
  -0.7987   -0.53148    -0.36085      -0.2992   -0.76356    -0.53837     0.90914    0.926071   0.602381
-0.48361    -0.24764    -0.09881    -0.12504    -0.49594    -0.14166    0.917656    0.946064   0.445598
 0.34467    0.152766    0.088165    0.037597    -0.02597    -0.05801    0.359674    0.402492   0.017161
-0.07938    -0.06812    -0.02407    -0.22935    0.070495    0.159753    -0.85356    -0.70063   0.033153
0.312653    -0.07073    0.480195       0.1374   0.056386    -0.16315    -0.26338    -0.33845   0.126796
0.175719    0.173079     0.39897    0.458431    0.221668    0.261852    -0.42675    -0.55734   0.988992
-0.07481    -0.17473    0.024898    0.204321       -0.132   -0.14225    -0.34808    -0.38982       0.529
-0.85826    -0.72506       -0.795   -0.47212      -0.8384   -0.78077    -0.61558    -0.63002   0.687676
0.090799    0.040648    0.146155    0.228983    -0.00609    0.146435    0.104299    0.138771   0.004375
-0.19195    -0.21696      -0.6309   -0.54537    -0.69015    -0.48933    -0.46595    -0.56706   0.356147
-0.07915    0.008374    0.025193    0.028479    0.020947    0.033727    -0.10007    -0.06432   0.005247
0.042805    0.090763    0.005308    0.058593    0.040717    -0.02134    -0.09466    0.476156      0.0416
-0.10627    -0.10882    -0.07677    -0.12286    -0.12582    -0.10283    0.692156    0.735769   0.024191
  -0.0787   0.015695    0.245196    0.300743    -0.12556    0.123839    0.825137    0.760369   0.219442
-0.16074    -0.24586    -0.20385    0.004508    -0.15421    -0.27393    0.710738    0.741242    0.11342
-0.38704    -0.19573    -0.30892    -0.20206    -0.21258      -0.2765   0.820081    0.823912   0.121399
0.129795    0.340518    0.142123     0.21425       0.1331    0.09653    0.893821     0.86504   0.063221
-0.29931    -0.34312    -0.17952    -0.21265    -0.33767      -0.3081   -0.10998    0.077399   0.194437
-0.14806    -0.08434    -0.01148    -0.12457    -0.06026    -0.11224    0.295103    0.398596    0.02189
-0.25762    -0.29196    -0.10521    0.231205    0.090626    -0.13508    -0.14586    -0.15916    0.05094
-0.11606    -0.01404    -0.22437      -0.2422   -0.23902      -0.3452   0.310573    0.166948    0.09827
0.088002    0.160659    -0.05103    0.120491    0.284358    0.443429    0.226875    0.242024   0.029397
0.182441    0.066058    0.126996    -0.00067    -0.01395    0.087956    0.181718    0.243169    0.06036
0.259714    0.622712    0.294466    0.591152    0.575963    0.695141    0.946469    0.944181   0.375608
0.451639    0.318011    0.376688    0.345756    0.357513   0.430604    0.674678   0.682785    0.090638
 0.15863    -0.13365    0.088753    0.113602    0.235307   -0.01024    -0.54649   -0.60037    0.019544
-0.13675    0.010014    -0.09571    0.062222    -0.12688   -0.21197    -0.87841   -0.89992    0.198062
0.276069    0.224345    0.202704    0.085919    0.166841   0.479394    0.793348   0.786359     0.11548
 0.52338    0.098993     0.47932    0.076794    0.789113   0.563317    0.921571    0.92199    0.219787
0.408547    0.255655     0.35846     0.09871     0.52571   0.695077    0.867165   0.866432    0.124879
-0.14049    0.152499    0.155099    0.124853    0.155333   0.157545    0.345639   0.375624    0.033331
-0.15301    -0.13561    -0.10348    -0.22822    -0.03131   -0.02274    0.735212   0.742754    0.039347
0.471379    -0.16947    0.524536       -0.271   0.202428   0.335576     0.49981   0.794887    0.127628
0.201668    -0.01624    0.046813    0.067342     0.09976    0.07124    -0.05109   -0.15587    0.009582
0.421469    0.315746     0.22058    0.091456    0.282905   0.133258    0.917372    0.91782     0.10549
0.208447    -0.01839    0.130706    0.205691     0.10835   0.151431    0.661086   0.547156     0.03482
0.404042    0.435421    0.337499    0.085223    0.178039   0.365874     0.28541   0.234019    0.297356
0.101898    0.159439    0.178421    0.127322    0.217498   0.432074    -0.40066   -0.11883    0.028827
-0.04251    0.041015     0.14294    -0.06206    0.033446   -0.05324    -0.22297   -0.20709    0.018283
0.248547    0.105673    0.268107    0.160943    0.155199   0.103143    0.089653   0.043103    0.022696
0.170582    0.230157    0.279721    0.148084    0.152421   0.029912     0.71178   0.718808    0.023443
-0.13879    -0.00168    -0.06301    -0.05971    -0.09559   -0.11349    0.962869    0.84099    0.051502
-0.02114    -0.19282    -0.03301    0.021985    -0.03213    0.01487    0.716761    0.68809    0.077731
-1.32105    -1.21522    -1.16673    -0.99354    -1.53004   -1.50674    0.433773   0.408034    1.103437
0.133055    0.038098    0.127557    0.006763    0.070323   0.048753    0.767653   0.793998     0.01318
0.205236    0.198428    0.069104    0.025005     0.09089   0.045308    -0.25175   -0.29581    0.096448
0.289676    0.414616    0.371419    0.378638    0.472599   0.508223    0.381319   0.429805    0.086971
0.131044    0.182845    0.202749    0.058017    0.121109   0.042141    0.133522   0.248157    0.036668
0.181975    0.213962    0.452843    0.189115    0.265045   0.176806    0.664303   0.561032    0.079883

   0.3334   0.443853    0.402601    0.324655    0.251919   0.232952    0.792293   0.810924    0.085905
0.531432    0.375575    0.637177    0.307147    0.698016   0.491208    0.914634   0.590429    0.321408
0.527785    0.329175    0.828986    0.262739    0.720477   0.462472    0.891777   0.523799     0.65735
0.037507    0.075255    -0.15301    -0.03442    -0.12133     -0.0656   -0.39184   -0.08005    0.058577
-0.14505    -0.41039    0.047175    -0.34257    -0.16671    0.11894    0.240214   0.223863    0.167257
-0.08206    -0.05277    0.082013    0.083128    -0.07068   -0.02736    0.150985   -0.22637    0.026355
-0.17149    -0.14156    -0.10611    -0.01992    0.066784     -0.1951   -0.24627   -0.60538     0.01991
0.166184    0.202942    0.104767    0.025641    -0.32727   -0.15385    0.047345      -0.183   0.050154
 0.31456    0.144299    0.277364    0.152493     0.40868    0.30959    0.231919   0.215776    0.067712
 0.46122    0.475399    0.472324    0.388447    0.879447   0.442562     0.16397   0.118984    0.198099
-0.15807    -0.36589    -0.39583      -0.1635   -0.15285   -0.21421    0.769232   0.656165       0.0661
0.017402    0.025674    0.029385    -0.08062    -0.13101   -0.06749    0.804719   0.680693    0.014255
0.524186    0.434381     0.49653    0.272909    0.684045   0.554507    0.103123   0.040023    0.141068
  -0.9581   -0.27056    -0.31956    -0.06819    0.148706   -0.14893    -0.64382   -0.46582     0.25625
-0.81424      -1.3409   -0.69991    -1.08286    -1.22374   -1.61973    0.117866   0.226287    0.194908
0.128409    0.178756    0.050536    0.052433    0.113629    0.10341    0.557202   0.494007    0.015303
0.501933    0.300683    0.411706    -0.05325    0.475923   0.585106    0.828403   0.874802    0.148803
0.050427    0.161236    0.056519    0.072817    0.095121   -0.03951    -0.57973     -0.5593   0.036951
0.408751    0.397877    0.439537    0.270247    0.562214   0.621031    0.923723   0.911077    0.117105
0.165083    0.259511    0.048476    -0.03149    0.099844   0.214853    -0.38574   -0.47079    0.019227
0.005838    0.061267    0.068068    -0.06537    -0.02866   -0.09515    -0.07432   -0.15247    0.021462
0.208015    0.319921    0.187919    0.149578    0.259892   0.223835    0.631423   0.676384    0.025767
0.476611    0.603157    0.570561    0.465601    0.316959   0.290828    0.919686   0.911137    0.360752
0.407733    0.218707    0.523571    0.303282    0.457375   0.432427    0.747239   0.692103    0.178052
0.307666     0.31532       0.2893   0.216423    0.178461   0.207735    -0.16672   -0.15786    0.109473
0.155569    0.188826    0.197937     0.16777    -0.04395   0.031043    0.253961   0.414595     0.01102
0.005569   0.025043    0.041959    -0.12633    -0.08992    0.027181    0.728338    0.774605    0.284783
-0.00256   0.103969    0.139896    -0.04282      -0.1241    0.04574    0.224536    0.422371    0.029086
0.187327   0.262274    0.293037    0.201343    0.204636    0.247017    0.174431    -0.08171    0.034808
-0.03253   0.229628    0.062597    0.046958    -0.11552     0.04079    -0.12061    -0.01999    0.053811
 0.52253   0.709099    0.577409    0.529157    0.677561    0.562671    0.887765     0.88788    0.088805
-0.18117   -0.14548    -0.22569    -0.17997    -0.39917    -0.34024    -0.86841    -0.85876    0.172752
0.215863   0.180458    0.114033    0.065005    0.313302    0.184265    0.848171    0.829392    0.027393
0.079349   0.056304    -0.00177    0.022673    -0.03364    -0.05607    0.325481     0.35528    0.017575
 0.41516   0.409052     0.48423    0.179243    0.379984    0.642849    0.032479    0.323325    0.149955
0.298986   0.710668     0.60365    0.937451    0.441533    0.678317    -0.11141    0.220089    0.088827
0.203843   0.205445    0.350351    0.162293    0.354648    0.170468    0.015596    -0.48852    0.021128
-0.18828     -0.0331     -0.1695   0.092372    0.196322    0.281371    0.052911    0.080097     0.03389
-0.30408     -0.1658     -0.2226   -0.29497      -0.3324   -0.47947    0.730188    0.831043    0.441202
 0.00537   0.169784    -0.01046     0.16638    -0.01833    -0.06018    0.725621    0.600049    0.075315
0.058781     -0.2619   0.168312    -0.21075    0.220226    0.077484    -0.45443    -0.31624    0.383614
0.014143   -0.01962    0.084751    0.072543    0.058824    -0.01744     0.75921    0.401224    0.046463
-0.10255   0.053064    -0.14564    -0.21598    -0.12997    -0.08881    -0.22549    0.062154    0.124606
0.124318   0.069396    0.168222    0.004356    0.110213    0.146681    0.272572     0.29525    0.022249
-0.02594     -0.1353     -0.0741   0.185844    0.012445    0.084708    -0.28993    -0.22139    0.022266
0.020293   0.034076    -0.18149      -0.0274   -0.12794    -0.02757    -0.33639    -0.23582    0.020347
0.208824   -0.00701    0.131817    0.022728    0.129286    0.284898    0.222377    0.348838    0.033773
0.575345   0.544547    0.662003    0.457346    0.347884    0.569083    0.538154     0.63158    0.147368
0.144002    0.36048        0.063   0.058159    0.047651    0.524702    0.349043    0.250591    0.030188
0.464083   0.618482     0.20122    0.342261    0.092605    0.285567    0.669597    0.713703    0.084803
-0.00399    0.04856    0.028624    0.015578    0.058604    0.054804    0.656314    0.565597    0.068751

 0.01759   0.519139    0.276506    0.277426     0.02584    0.265877    0.801337    0.773326    0.060841
-0.18867   -0.03339    -0.07878    -0.13332    -0.51461    -0.25978    -0.59746    -0.73937    0.060963
0.162525   0.059538    0.103838    0.132243    -0.03968    -0.00401    0.690589    0.475492    0.032232
0.071715   -0.04489    0.179153    -0.21376    0.620496    0.656687    0.147916    -0.01514    0.236571
0.525646   0.390141    0.641688    0.601578    0.532797    0.535253    -0.47381    -0.79204    0.270312
0.280419    0.28888    0.326916    -0.11993    0.262762    0.268672    0.814837    0.800896     0.13692
 0.22454   0.206496    0.215951    0.091288    0.147325    0.171573    0.504308    0.737212     0.16815
0.162603   0.189708    0.138567    0.076811    -0.01597    -0.02956    0.273917    0.284759    0.036288
-0.01686   -0.01831    0.014843    -0.00825    -0.09611    -0.10393    -0.93011    -0.93183    0.032146
-0.21566   -0.20939    0.032956    -0.21004    0.050936    -0.16708    0.906171    0.857686    0.268338
0.054613   -0.02054      -0.0887   -0.06423    -0.39381    -0.25413     0.93008    0.919153    0.117269
-0.87891   -0.46242    -0.59118    -0.51756    -0.96133    -0.62214    0.953109    0.967699    0.433527
-0.50827   -0.32317    -0.39421    -0.17891    -0.34932    -0.34403    0.940861    0.964426    0.363728
-0.77846   -0.62777    -0.80304    -0.53211    -1.24253    -0.89498    0.948659    0.970358    0.878283
0.035486   -0.00901    -0.12966    -0.08981    -0.14629    -0.16751    0.634497    0.685949    0.042968
-0.10033   -0.02459    -0.15817    -0.14956    -0.41733    -0.14816    -0.32618    -0.22846    0.118858
-0.08847   0.083251    0.146731    0.191303    -0.14456      -0.1911   0.419171    0.549968    0.195895
-0.44722   -0.36109    -0.21958    -0.09966      -0.3526   -0.23469     0.20317    0.293643    0.159594
 0.05729    0.20322    0.046194    0.046787    -0.08164    -0.04263    0.774305    0.902745    0.063213
0.005262   0.051804    -0.10417    0.009021    -0.15488    -0.03808    0.325651     0.20057    0.014829
0.484361   0.311353    0.488442    0.301797    0.484357    0.416591     0.68724    0.835914    0.075704
0.005823   0.061923     0.08768    0.083935    -0.03243    0.158494    -0.62602    -0.81777    0.027368
0.266432   0.348737    0.033236    0.169935    -0.11886    0.055627      -0.5771   -0.69222    0.088042
0.321211   -0.13998    0.490127    0.184386    0.090945    -0.17774    -0.25035      -0.4698   0.233008
-0.04282   -0.17299    0.182667    -0.09384    0.124724    0.207446    0.528681    0.359976    0.238427
0.457585   0.498331    0.568095    0.329866    0.620574     0.79246    0.443329    0.543551    0.414316
0.005774         0.11   0.237747    0.219208    -0.03337    0.014194   0.304135     0.24559   0.031552
0.144267    0.060053    0.066012    -0.09624    0.473261    0.577562   0.634926    0.569702   0.078713
-0.05145    -0.28315    0.236934    -0.22597    0.095892    0.214986   0.638743    0.341929   0.155433
  -0.0227   -0.11743    0.164829    -0.06817    0.056729    0.038944   -0.15198    0.043863   0.034741
0.063549    0.244629    0.183827    0.129605    0.011829    0.136826    0.32999    0.380312   0.009748
-0.04481     0.10988    0.136761    0.036398     0.09005    0.074599   0.199499    0.243276   0.017469
0.160463    0.049626    0.242711    -0.03972    0.273149    0.168735    0.03103    -0.14124   0.047636
-0.21853    -0.15723    -0.07001    -0.05906    -0.26717    -0.27917   -0.00622     0.29209   0.184914
0.612809    0.503466    0.323026    0.032111    0.614716    0.668757   0.911536    0.882075   0.336398
-0.63847    -0.53276    -0.48794    -0.45714    -0.63182    -0.73851   0.779426    0.703203   0.591795
  -1.9833   -1.94197      -1.7834   -2.09834    -1.70757    -2.05236   0.977874    0.928425    2.28703
-2.43946    -1.94403    -1.90197    -1.84814    -2.52629    -2.62271   0.969767    0.912716    2.18166
-2.46204    -2.04695    -2.26885    -2.13135      -2.2102   -2.56684   0.958564    0.964787   2.947203
-0.15238    0.000347    -0.10048    -0.11372    -0.16797    -0.16127   -0.85936    -0.88595   0.065238
-0.68451    -0.51281    -0.76171    -0.85807    -1.09232    -1.47621   0.013919    0.000781   1.117141
0.094815    -0.03667       -0.108   -0.13926    0.050068    -0.02663   -0.24095    0.541386   0.026868
-0.21142    0.141484    0.158215    -0.11991    -0.34949    -0.28151   0.678571    -0.03274   0.278852


0.087921    0.009275    0.049429    0.005794 0.03722 -0.00846          0.526552    0.444756   0.045108
-1.09581      -0.9932   -1.06313    -0.97831 -1.38605 -1.70669         0.819815    0.829912   1.176412
-2.12619    -1.85394    -1.80554    -1.57687 -2.19521 -2.59048         0.665588    0.679762   2.026879
-0.25929    -0.22456    -0.11606    -0.26932 -0.17044 0.10085          0.824275    0.832087   0.134158
-0.55494    -0.19507    -0.42536    -0.14924 -0.47749 -0.53613         -0.04314    -0.20509   0.289848
-0.08986    -0.16666    0.104749    -0.22604 -0.05232 -0.13767         0.227957     0.31561   0.048793
-0.05248    -0.12406    -0.09868    -0.20793 -0.22698 -0.33801         -0.13619    -0.00454   0.353495
0.178432    0.065891    0.111083    0.025527 0.083444 -0.05886         0.622555    0.609002   0.042576
-0.05745    0.118438    0.140944    0.036776 0.061965 -0.01579         0.491275    0.758808   0.042511
-0.40893    -0.52732    -0.42711    -0.34581 -0.53929 -0.95339         0.511571    0.525865   0.567897
0.029008    0.160562     0.04871    0.198805 0.00431 0.061153          0.891583    0.822795   0.098107

-0.05172    -0.06888    -0.06304    -0.21813    -0.13187    -0.31494   0.089985    0.127944   0.451045
 0.22038    0.193039    0.309347    0.290979     0.24419    0.320745   0.889367    0.889051   0.050729
-0.06584    -0.03941      -0.1386   -0.10546    0.052294     0.02227   0.174231    0.164612   0.024065
0.681395    0.613561    0.722126    0.673058    0.689864    0.460152   0.695588    0.823928   0.677901
-0.02572    -0.72927    0.201711    -0.28098    0.250569    0.221036   0.122616    -0.17453   0.373936
0.293024    0.121594    0.270961    0.296804    0.152475    0.059855   0.143653    -0.11756   0.049813
-0.04377    -0.00862      -0.0831   -0.14859    -0.12181    -0.12456   0.080592    0.254139   0.063384
0.146903    -0.10485    -0.02764    -0.02663    0.030596     0.02959   0.634258    0.654101   0.027517
0.120908     0.27667    0.162284    0.280762    0.427834    0.308702   -0.14741    -0.34253   0.036956
-0.13768    -0.25596    0.115758    -0.07094     0.06107    0.316854   -0.24121    -0.04635   0.068229
-0.37926    0.093901    -0.33805    0.320304    -0.31668    -0.02762   0.941803    0.941815   0.101855
0.151558    0.122518    0.308925    0.097651    0.453821    0.508702   -0.43906    -0.30018   0.029898
-0.42596    -0.22447      -0.2626   -0.03001    -0.37223    -0.39332   0.940451    0.961255   0.288931
-0.77532    -0.46139    -0.28532      -0.3524     -0.8186   -0.78574   0.650077    0.631089   0.530544
  -0.3807   0.205905    -0.17708    0.313053    -0.33778    0.238694   0.360676    0.430761   0.172759
-0.02436    0.079441    -0.13787    0.078969    -0.19058    0.119948   0.629604    0.644836   0.042012
  -0.2685   -0.25106    -0.60064    -0.44148    -0.29488    -0.37493   0.476957    0.496882   0.321612
0.106867    0.087592      -0.0973   0.032947    0.033312    0.130901   -0.15988    0.066471   0.024614
0.016896    0.077886    -0.06007    0.032955    -0.06082    -0.08875   -0.35398    -0.48208   0.012212
0.125896    0.276226    0.069375    0.244975    0.123535    0.287032   -0.30608    -0.14575   0.044973
-0.10743    -0.01751    -0.03965    0.049303      -0.2801   -0.16614     -0.1747   0.071811   0.162325
-0.11271    0.072527    -0.17338    -0.04281    0.017639    0.179509      -0.2305    0.36055    0.081966
-0.10894    0.052777    -0.23784    -0.06775    -0.05751    -0.13866    -0.09678        0.306   0.201092
0.202566    0.076624     0.18174    0.063354    0.207716       0.1616   -0.40958    -0.47223    0.074508
0.024157     0.17448    -0.04146    -0.08778    0.003253      -0.0841   0.340381    0.337583    0.044431
0.106107     0.02675    -0.01835    -0.05444    -0.00112    0.115325    -0.25141    -0.27509    0.216102
0.310956     0.30317    0.241058    0.233602    0.008914    0.154563    0.285588    0.254876    0.038294
-0.32973    -0.24406    -0.09622    -0.18745    -0.26463    -0.19217    0.942286    0.946143    0.247042
-0.04032    0.061985    0.050702    0.021173    0.534422    0.636785    0.418577    0.431889    0.241599
-0.13986    -0.74276    0.112462    -0.38747    0.027946      -0.0809   0.972762    0.947388    0.489131
0.004549    -0.57803    0.455479    -0.31863    0.298613    0.234181    0.964935    0.955181    0.599092
  -0.0989   -0.52281    0.224665    -0.41974    0.149958    0.156479    0.972163    0.963933    0.478093
-0.04294    -0.05837    0.009762    0.051501    0.043673    0.138282    0.674273    0.693965    0.042445
0.381307    0.111378    0.357549    0.249219    0.194454    0.228551    0.652725    0.510322    0.048604
-0.02815    0.343978    0.074435    -0.13743    -0.26278    0.156255      -0.0717   -0.03721    0.118403
-0.31108    -0.30667    -0.36634    -0.17434    -0.51852    -0.42933    -0.53173    -0.57641     0.35667

-1.22401    -1.18817    -0.90879    -1.13232      -1.0676   -0.84837     0.44168    0.581591    0.752923
0.043281    -0.55317    0.444437    -0.36799    0.300595    0.253239    0.702876    0.533951    0.705649
-0.15458      -0.6302   0.042358    -0.56092    -0.02376    -0.02821    0.676582    0.445842    0.458077
-0.07688    -0.35542    -0.25908    -0.39115    -0.26457    -0.26027    -0.24457    -0.24622    0.035576
-0.47844    -0.56966    -0.32982    -0.45934    -0.29364    -0.25952       0.9524   0.868567    0.471299
-0.85333    -0.82988    -0.56583    -0.52352    -0.52234    -0.55255     0.20319    0.087161    0.602816
-0.30469    -0.36614    -0.25689    -0.35275      -0.2701   -0.35191    0.927673    0.906316    0.335836
-0.23581    -0.35294    -0.25441    -0.19766    -0.15786    -0.44275      -0.1748   -0.12269    0.348103
-0.16713      -0.1313   -0.08623    -0.14245    -0.28316    -0.16041    0.593224    0.641177    0.066124
-0.12856    -0.27376    -0.23016    -0.49398    -0.37966    -0.51583    -0.16665    -0.10973    0.454702
-0.36073    -0.32294      -0.1392   -0.32204    -0.66538    -0.53232    0.895392    0.780207     0.78278
-0.33139    -0.15318    -0.07552    -0.04414    0.109868    0.045707      -0.4132   -0.30253    0.036709
-0.90362    -0.77309    -0.44298    -0.52397    -1.25509    -1.23806    0.883251    0.769288    1.534935
 0.49668    0.486232     0.32822    0.384146    0.211979    0.024583    0.542614    0.546679    0.426258
0.618407    0.690322    0.856881    0.145642    0.461508    0.551509    0.980642    0.952038    0.732066
0.786967    0.551877    0.935231    0.320428    0.560146    0.779559     0.97907    0.947206    0.619317
0.608717    0.441318    0.740542    0.140649    0.608051    0.574309    0.987238    0.968855       0.9362
0.261861    0.246601     0.43595    0.211731    0.085344    0.069764    0.836698    0.873604    0.429983
0.292241    0.357439    0.467058    0.415142    0.253698    0.368889    0.942533    0.965764    0.528179
0.353844    0.658275    0.274899    0.270404    -0.01898    0.455617    0.808813    0.873724    0.198497
-0.22551    -0.22827    -0.11066    -0.07594    -0.32324    -0.24897     0.92344    0.810746     0.50622
0.555644    0.423827    0.490796    -0.06795    0.194673    0.093524    0.944358    0.760141    0.448972
0.215004      -0.0146   0.465158    0.183219    0.535424    0.729541    -0.25639    -0.00917     0.21098
0.314513    -0.28321     0.54626    -0.10947    0.606196    0.550364       0.0508   0.223921    0.547246
   0.4251   0.334045    0.360714    0.325818    0.258718    0.365605    -0.64818      -0.1513   0.151152
0.176288    -0.18211    0.323702    -0.06402    0.264984    0.369132    0.519307    0.531449    0.213519
-0.19316    -0.38625    -0.02505    -0.14993    0.121738    0.026775    0.349438    0.053546    0.087799
-0.14671    0.064255    -0.14462      -0.0771   -0.06811    0.019998      -0.0138   -0.03073    0.028242
-0.01917    -0.04169    0.013196    -0.08079    -0.23297    -0.25364    0.086277    0.267004    0.093032
0.294001    0.439207    0.180161    0.245677    0.083458    -0.02028    0.306204    0.060593     0.10082
-0.03354    -0.17912    0.007634    -0.27103    -0.38918    -0.22738     0.85743    0.682791     0.24762
-0.76722    -0.63929      -0.4696     -0.2731   -1.21953    -1.05699    0.926413     0.80754    0.583795
-0.90165    -0.52318    -0.54596    -0.14938    -0.89565    -0.71104    0.967866     0.96576    0.926422
-0.92988    -0.64452      -0.4472   -0.41338    -0.94819    -0.61638    0.919915    0.934969    0.695223
-0.46891    -0.13439    0.057873    -0.06524       -0.256   0.163281    0.907218    0.948628    0.514058
-0.15748    -0.57398    0.015189    -0.55705    0.035648    0.126123    -0.36103    -0.33291    0.309278
-0.77073    -0.55394    -0.59131   -0.40512    -0.84275   -0.55216    0.681081    0.761522    0.661071
-0.62944    -0.41979    -0.45912     -0.1033   -0.74508   -0.56627    0.675615    0.748601    0.734137
0.188887    0.160242    0.295524   0.075934    0.544032   0.592589    -0.32773    -0.29818    0.067889
0.336196    0.218473    0.298723   0.330817    0.253653   0.176432    0.342973    0.235243    0.363668
0.137405    0.295185    0.109843   0.144516    -0.04331   0.225739    0.747657    0.631508    0.470896
-0.16346    -0.34669    -0.31541   -0.33286    -0.38789   -0.45653    0.717736    0.682989    0.171825
0.195199    0.215547    0.172154   0.111614    0.071362   0.153183    0.922104     0.92739    0.050345
0.575813    0.538438    0.296899   0.717798    0.828831   0.928284    0.977108    0.981826    0.794298
0.414833    0.637023    0.401105   0.185662    0.834909   1.042677    0.898254    0.896578    0.257138
0.103962    -0.13058    0.107761   0.416985    0.197923   0.024135    0.476842    0.270938     0.10626
-0.08196    0.266458    0.203148   0.156669     0.25807   0.559848    -0.10525    -0.17395     0.11632
0.017633     -3.8E-05   -0.17556   -0.08199    -0.16912   0.135606     0.72475    0.666156    0.096331
-1.27083    -0.90046    -0.80659   -0.98277    -1.05149   -1.19863    0.909227    0.889356    0.908248
-0.75176    -0.53084    -0.49992   -0.52134    -0.93929   -1.15442    0.944876    0.874216    0.943821
-0.23961    -0.22101    -0.11816   -0.10805    -0.15744   -0.13412    0.917619    0.765986    0.128751
0.085923    0.102013    0.175864   0.084077     0.03506   0.088562    0.394292    0.272784    0.040572
-0.06531    -0.09157    -0.04794   0.106254    0.014588   0.089387    0.077195    0.108978    0.104581
0.164802    0.218115    0.370752   0.203367    0.155366    0.34563    0.307175    -0.46365    0.042467
-0.12496    -0.11214    -0.09418   -0.11229    -0.13091   -0.09139    0.362117    0.136881    0.170718
  -0.6335   -0.54572    -0.42453      -0.508   -0.37454   -0.46507    -0.49478    -0.44148       1.2814
-0.18873    -0.11646    -0.16351   -0.04408    -0.11446   -0.18069    0.649218    0.600535    0.055361
0.453413    0.500667     0.59435   0.569806    0.506987   0.457834     0.90748    0.866894    0.553454
0.035129       0.1435   -0.05877   0.110312    -0.10179   0.085433    -0.65316    -0.69362     0.01722
0.318151    0.030172    0.337778   -0.04499    0.502266   0.272693    0.687998    0.469559    0.263231
  -0.2362   -0.25288    -0.11663   -0.28904    -0.09051   -0.01909    -0.04073    0.240321    0.147081
-0.03629    0.098934    -0.09435   -0.20072    -0.00605     -0.1023   -0.03208    0.111737    0.159665
-1.22705    -0.85601    -0.81497   -0.33995    -1.39823   -1.04907    0.942701    0.940772    1.281095
0.402083    0.482032    0.515766   0.279918    0.541359   0.437976    -0.62829      -0.6915   0.143597
  -0.6527     -0.5214   -0.41139   -0.46318    -0.29633   -0.37453    0.552909    0.649643    0.301432
-0.10087    -0.03959    -0.19861   0.016631    0.125248   -0.02298    0.657841    0.563781    0.074536
0.064005    -0.03623    0.156348   -0.05867    -0.08354   0.060386    0.500405    0.443732    0.075264
  -0.1496   -0.32739    0.040851   -0.42178    1.258172   0.978055    0.876425    0.877005    2.339029
  -0.1249   -0.20658    0.234993   -0.53582    1.464423   1.292817    0.960735    0.958969    3.058726
-0.23176    -0.51098    -0.38294   -0.91251    0.205113   -0.11721    0.772699    0.772664    0.784607
0.182921    0.384478    0.375649   0.466768    0.384183    0.40682    0.586781    0.614202    0.199535
0.040393    0.179412     0.01736    0.19544    0.167643   0.088257    0.088781    0.117263    0.015052
-0.10452      -0.2601   -0.18318   -0.13104    -0.39376   -0.34102      -0.3801   -0.36924    0.052327
-1.50313    -1.29431    -1.26803   -1.11407    -1.36694   -1.80484     0.79355    0.747425    1.380992
-0.04464    -0.21431    0.116806   -0.62464     1.28783   1.079329    -0.48733    -0.25212    2.121141
0.153383    0.070067    0.160213   -0.01585    0.406221   0.007483    0.020365    -0.07369     0.03972
  -0.1421   -0.30072    0.325627   -0.62663    1.598773   1.235502    -0.47694    -0.20137    3.269555
0.490791    -1.54328    1.151801   -0.60545    -0.66366   -1.07066    0.813594    0.866884    1.206462
-0.80705    -0.71394    -1.71517     -0.6935   -1.12089     -1.6849   0.974797    0.892204    1.133877

0.701816 0.153029 0.659549 0.263845 0.617642 0.670176                 0.938583    0.930259    0.594865
1.491028 0.723538 1.44335 0.677885 1.259015 1.568965                  0.965286    0.963522    2.480892
0.486686 -0.11285 0.645327 0.091863 0.435255 0.521638                 0.323428    0.328615    1.382588
 0.19845 -0.09764 0.539286 -0.00656 0.379388 0.33285                  0.738646    0.834549    1.185421
0.263328 -0.27599 0.528962 0.003976 0.637163 0.333586                 0.729603    0.801948    1.530657
0.099221 0.038482 0.134025 -0.03719 0.163592 0.005031                 0.865805    0.949239    0.130845
-0.26359 -0.41903 0.082544 -0.09627 0.330392 0.071705                 -0.84149    -0.80117    0.206245
-0.82761    -1.11537    -0.96243    -0.96076    -0.47345    -0.73888   0.561517    0.579554    0.423624
0.053802    0.011245     0.11013    0.203525    0.007325    0.090424   -0.38293    -0.55084    0.008332
-0.11875    -0.03994    0.125166    0.291526    0.157822    0.033897   0.520514     0.69396     0.03118
0.406892    0.493239    0.409886    0.775558    0.391912    0.368346   0.688246    0.861873    0.279035
0.240627    0.223098    0.364276    -0.02752    0.148432    0.201568   0.885831     0.86388     0.12394
0.176441    0.054385    0.162112    0.051594    0.009477    -0.02888   0.124474    -0.19935    0.012309
-0.04845    -0.03493      -0.2442     -0.1575   -0.02434    -0.07553   -0.55417    0.269808    0.062121
0.462615    0.485794    0.401594    0.312392    0.545897    0.448083   0.436729    0.798018    0.082315
  -0.2957   -0.19865    0.056492    -0.38047    0.744707    0.568079   0.057981    -0.07838    0.752481
0.047233    0.174028    0.175414    0.319527    0.147082    0.027282   -0.03413      -0.2803   0.016246
0.533785    0.353206    0.589887    0.536513    0.541181    0.549138   -0.39793    -0.03552    0.431452
-0.04503    0.025207    -0.04961    0.062413    -0.03576    -0.08489   0.265982    -0.16245    0.010581
-0.17562    -0.09889    -0.00564    -0.29528    0.530644    0.447967   -0.07396    0.031803     0.59151
-0.05083    -0.18099    -0.14475    -0.21701      -0.0599   -0.18281     -0.2537   -0.19893    0.005734
-0.61651      -0.5279   -0.31402    -0.37738      -0.8474   -0.39448   0.945589     0.87751    0.324546

-0.07985    0.021896    -0.10281    0.007811    -0.14268    -0.26126   0.730054    0.823137    0.469779
 0.14888    -0.01371    -0.00339    0.049045    0.123557    0.080263   -0.01515    -0.26076    0.061815
1.044702    1.368318    0.980742    1.124503    0.608927    0.743563   0.942101    0.961634     2.25779
 0.11209    0.295992    0.103627    -0.01166    0.047616    0.231485   -0.42564    -0.40575    0.042556
-0.77523    -0.71037      -0.6977   -0.43545    -0.58873    -0.83253     -0.6297   -0.73266    0.068338
0.375951    0.524614    0.531946    0.296897    0.287509    0.317379   0.845556    0.836176    0.371803
-0.33193    -0.60406    -0.62968    -0.61048    -0.65988    -0.78918   -0.66551    -0.65658    0.032686
0.365678    0.358092    0.411478    0.264608    0.098349    0.427605   0.429694    0.493439    0.015722
0.109674    0.230362    0.089603    0.357879    0.087986    0.250495   -0.14073    -0.01943    0.042499
 0.09736    0.063331    0.170749    0.000434    0.106649    -0.03881    0.52685    0.466914    0.033416
0.219994    0.046226    0.113832    -0.01486    -0.03223    -0.05672    0.58226    0.423745    0.052809
0.316378    0.654505    0.139714    0.129771    0.247376    0.368654   -0.03109    -0.06807    0.418723
-0.08812    -0.23349    -0.14874    -0.31807    -0.08908    -0.13968    0.95224    0.945937    0.202018
0.265094    0.311212    0.244604    0.033618    0.495238     0.47038   0.893347    0.889583    0.127549
-0.26072    -0.32642    0.004129    0.085164    -0.06694    -0.17181   0.198814    0.369783     0.03353
0.444698     0.35268    0.311417    0.490951       0.2234   0.254004   0.205559    0.248164    0.293975
-0.69841    -0.75439    -0.80612    -0.76721    -0.63896    -0.48864   0.836391    0.824347    0.828532
0.423559    0.376727    0.339518    0.328103    0.629816    0.479575   0.295266    0.505249    0.128926
0.021429    -0.08653     0.19531      -0.1876   0.944834    0.891876   -0.03772    0.502175    0.373559
0.043892    0.086777    0.071107    -0.05692      -0.0065   0.186034   0.246498    -0.12049    0.033391
 0.33982    0.146645     0.14955    0.154109    0.191814    0.120576   0.628241    0.646805    0.017668
-0.16389    -0.22368    -0.19031    -0.19005    -0.16143    -0.14388   0.766188    0.679975    0.038983
0.158614    0.124041    0.139784    -0.05206    0.066693    0.092255   0.214612    0.447548    0.028032
-0.18982    -0.19084    -0.22859    -0.26474    -0.34679    -0.32354   -0.75752    -0.71443    0.152008
0.308917    0.161436    0.125117    0.085038    0.108335    -0.02125   0.626567    0.648673    0.019714
-0.68687    -0.57211    -0.50964    -0.62174    -0.79795    -0.98768     -0.9105   -0.93746    0.635972

-0.17773 0.135536 -0.07627 0.062322   -0.1621 -0.18372 0.79178 0.498736 0.052475
0.206374 0.042233 0.110148 0.010836 0.054659 0.053033 0.653153 0.677002 0.011852
0.130072 0.140019 0.059814 0.253309 0.105405 0.137492 0.136738 0.28667 0.023274

0.169551 0.022847 0.011266 0.046513 0.398327 0.08823 0.798005                      0.754731    0.041558
0.037665 -0.02147 -0.03135   -0.0849 0.227811 0.25252 -0.00461                     0.095316    0.016495
0.203578 -0.08117 0.386762 -0.16808 0.457525 0.602078   -0.0372                    0.095963    0.203808
-0.08705   -0.2044 0.171061 -0.33888 1.027535 1.017422 -0.24938                    -0.02103    0.794095
-0.86885 -0.66941 -0.84507 -0.22698 -0.95244 -0.83971 0.885581                     0.833917    1.238734
0.094924      -0.0229   -0.04298    -0.07026    -0.09359      -0.2414   -0.78717    -0.72557    0.068802
-0.37788    -0.33178      -0.3475   -0.27372    -0.31673    -0.22241    0.992776    0.965266    0.365939
  -0.5041   -0.44532    -0.24086    -0.22289      -0.7744   -0.66664    0.947481    0.959459    0.402718
-0.33589    -0.51386    -0.32108    -0.35291    -0.53052    -0.46665    -0.17532    -0.16155     0.14048
-0.42194    -0.37101     0.29187    -0.33637    -0.66999      -0.1576   0.327798    0.181088    0.191497
 0.11099    -0.00389     0.04647    0.098747    0.030648    -0.03136    0.114282    0.192996    0.014789
-0.01907    0.242025    0.085806    0.357094    0.130505    0.107944    -0.14501      -0.5508    0.02842
0.212975    0.295614    0.195719    0.200219    0.406623    0.412011    0.818949    0.798984    0.029543
-0.43357    -0.43116    -0.33142    -0.16971    -0.23364    -0.51156    0.406787    0.276434    0.061779
-0.24075    0.400832    -0.00022    -0.09454    -0.11598    -0.03691     0.55789     0.45919       0.0652
0.365875    0.394104    0.271702    0.433624    0.784808    0.626515    0.514028    0.370581    0.240503
0.447696    0.328816    0.396165    0.256498    0.252253    0.381919    0.353364    0.394757    0.033454

0.419369 0.191536 1.235881           0.58032 0.637128 0.255476           -0.2304    -0.06295 0.105058
-0.43839 -0.49294 -0.29731          -0.18156   -0.1581 -0.63161          -0.1115    -0.15395 0.053299

0.079932    0.1483 -0.03723 -0.15458            -0.07361    0.203503    0.557309    0.906919    0.047799
0.018195 -0.04353 0.011989 -0.14646             0.124805    0.220492    0.597218    0.802918    0.051711
0.446667 0.35147 0.919467 0.275025              0.691055    0.774338    -0.40552    -0.56391    0.223553
-0.22923 -0.34843 -0.29554 -0.59179             -0.53969    -0.46095    0.286462    -0.05657    0.124364
0.400533 0.224144 0.477388 0.261734             0.217355    0.315138      -0.1775   0.145036    0.024929
-0.19471 -0.29846 -0.08214 -0.13558             -0.08982    -0.20002    -0.07824      -0.3385   0.128798
0.628415 0.437492 0.654006 0.237917             0.510576    0.415172    -0.71475    -0.82126    0.497533
-0.55875   -0.5691 -0.30121 -0.25511            -0.05954    -0.01635    0.894293    0.904599    0.353278
-0.39533 -0.35606 -0.36641 -0.34017             -0.17666      -0.0846   0.725216    0.801105    0.197931
-0.60808 -0.49484 -0.40957 -0.28449             -0.24602    -0.10816     0.93185    0.910077    0.297969
0.085048 0.074534 0.22401 0.077646              0.041323    0.189935    0.951561    0.913858    0.092608

-0.18337    -0.408 -0.11275 -0.72463            0.873739    0.687275 -0.50258 -0.43223 0.318227
0.666288 0.484213 0.523963 0.348564             0.416927    0.133407 0.919338 0.929407 0.36748
0.199963 -0.16758 0.414436 -0.22048             0.385049    0.098565 0.911748 0.877089 0.186932
-0.55349 -0.35097 -0.35531 -0.21587             -0.39204    -0.50786 -0.20109 -0.13854 0.751599
 0.16591 0.213898 0.188561 0.19385              0.811798    0.514975 0.15006 -0.09868 0.212269
0.136119 0.297777 0.018642 0.127509              0.40404    0.249801 0.781054 0.78284 0.030212
-0.12643 -0.28708 -0.18398 -0.48267             -0.41135    -0.44365 -0.39241 -0.37178 0.033239

0.074913    0.293262    0.303724    0.124238    0.548678    0.511848    0.034565    0.126154    0.100254
0.187779    0.197153    0.458931     0.22066    0.506033    0.513648    -0.30741      -0.2599   0.045605
0.022714    0.276136    0.247844    0.310973    0.069977    0.022989    0.171771    0.183204    0.012919
-0.11683    -0.21071     0.02586    -0.27554    0.694544    0.623709    -0.36464    -0.62973    0.121699
0.003248    0.044899    0.076791    0.108652    0.322594    0.136792    0.053345    -0.16414    0.035662
0.036149     0.12501    0.106133      -0.2136   0.054172    -0.07859    0.874575    0.806425    0.124694
0.853209    0.995378    0.796395    1.032092    0.600112     0.39797    0.971152    0.960223    0.924471
0.605665    0.746259    0.738066    0.563491    0.501905    0.245644    0.993142    0.989702    1.702184
1.218298    1.254418    1.130528    1.219255    1.109637    0.836124    0.996572     0.99465     3.42892
 0.61444     0.37331    0.505216    0.339141     0.66714    0.592133    0.962473    0.963963    0.287501
 0.60307    0.852299    0.672007     0.67193     0.25219    0.144685    -0.74299    -0.60022    0.326241
-0.22296    -0.04142    -0.09898    -0.08971    -0.28575    -0.12281    -0.31651    -0.09752    0.042817
-0.25638    -0.27476    -0.21772    -0.18084    -0.33872    -0.45113    -0.18193    -0.01349    0.241332
0.534312    0.523336    0.650104    0.666314     0.67157    0.599978    0.082794      -0.0517   1.047335
-0.20347    -0.01957    -0.02352    0.200003    0.234682    -0.08965    0.263386    0.251461    0.019752
0.344612    0.156717    0.052335    0.045574    0.029636    0.016085    0.129902    0.013121     0.02045
-0.14399    -0.16915    0.091571    -0.15307    -0.46129    -0.60794   0.554345    0.628044    0.419229
-0.23907    -0.17126    -0.17292    -0.10251    -0.42721    -0.14288   0.522771    0.568649    0.062066
   -0.268   -0.22689    -0.15278    -0.08741    -0.14881    -0.44934   0.110917    0.144445    0.121561
0.659819    0.535666    0.720054    0.272948    0.690565    0.472453   0.818251    0.944316    0.527088
-1.07022    -0.83451      -0.7799   -0.49532      -0.7758   -0.71129    0.97666    0.966579     0.94174
  -0.5006   -0.47511    -0.24854    -0.34476    -0.37999    -0.50796   0.184609    -0.04648    0.763772
0.124307    0.229571    0.104245    -0.22899    0.167957     0.29848   -0.08983    -0.31208    0.022033
-0.00321    0.267172    0.127758    0.201114    -0.50888    0.227316   0.067355     0.02153    0.083975
0.306186     0.27661    0.378556    0.253624    0.247947    0.431914   0.675754     0.68651    0.033567
-0.04527      -0.0318   -0.04526    0.061978    -0.21498    -0.13653   -0.13444    0.185838     0.06225
0.117638    0.067225    -0.22484    -0.09318    -0.09168    0.050369   -0.58427    -0.28097    0.030279
0.073614      -0.0015   0.077228    0.012463    -0.08697    -0.07115   0.251044    -0.25396    0.020851
-0.37857    -0.37275    -0.42931        -0.62   -0.52304    -0.48798   0.809705    0.775701    0.446548
0.754341    0.827145     0.55301    0.657359    0.498117    0.335211   0.900782    0.897919     0.22554
   -0.648   -0.62873    -0.28544    -0.34816    -0.74917    -0.57283   -0.30889    -0.32568    0.398457
0.549186    0.557144    0.573113     0.31509    0.354497    0.530139   0.734913     0.77445    0.186399
-0.62045    -0.74298    -0.50829    -0.85718    -0.24497    -0.29927      -0.104    0.07037    0.521363
-0.15312    -0.14344    -0.12737    -0.17804    0.037492    -0.12011    0.70389    0.764083    0.085883

-0.18479   -0.0903 -0.12842 -0.05101 0.032662  -0.1405 0.073606 -0.10537 0.012394
0.006856 0.139023 0.023957 0.042598 -0.00998 0.040998 0.335419 0.429226 0.025744
-0.22631 -0.22358 -0.28256 -0.30317 -0.41341 -0.53407 0.701616 0.684381     0.0683
0.445121 0.368223 0.299406 0.323791 0.249554 0.205487 0.887309 0.86564 0.170776

0.554969 0.741154 0.077094 0.413685 0.278676 -0.03093 0.931336 0.925031 0.231678
-0.02279 -0.19012 -0.23044 -0.35961 -0.50092  -0.4049 0.120296 0.233531 0.019127
0.263669 0.371966 0.391444 0.370353 0.01276 0.100727 0.771575 0.855062 0.18772




0.053856 -0.12455 0.245609 0.292319 0.176049 0.099186 0.54276 0.559301 0.17227
0.518012 0.261707 0.473252 0.261224 0.330916 0.203331 0.982291 0.977863 0.308461
  -0.4512  -0.6203 -0.66606 -0.56133 -0.78304  -0.8127 -0.05086 -0.03682 0.018718

0.137545    0.313342    -0.21265    0.265099     0.11795    0.197442   0.560464     0.51655     0.16074
-0.22096      -0.2371   -0.21132    0.017541    0.008841    -0.16575     -0.1623   0.026433    0.294676
-0.41356    -0.71116      -0.7635   -0.73326       -0.709   -1.06639   0.762462    0.677678    0.073505
-0.76163    -0.60497    -0.67049    -0.63724    -1.11238    -1.10319   0.972963    0.986695    1.085119
-0.37246    -0.39077    -0.21596    -0.21761    -0.26362    -0.24284   0.927046    0.953241    0.370455
-0.02334    -0.10661    0.147353    0.006812    -0.00077    0.294498   -0.17556    -0.18707    0.191537
-0.61545    -0.96826    -0.27571    -0.49979    -0.26481    -0.45467   0.912603    0.895392     1.25362
-1.83429    -1.55634    -1.04885      -1.0656   -1.11374    -0.64036   0.749319    0.713292     1.00077
-0.20959    -0.29923    -0.24148    -0.23835    -0.27244    -0.38787   -0.04992    0.734033    0.035225
-0.00447    -0.07816    -0.08946    0.105581    -0.01491    0.116553   0.433187     0.31236     0.06105
0.077134    0.197395    0.337012    0.238873      -0.1688   0.136321   0.375342    0.232161    0.040175
-0.46349      -0.5245   -0.51564      -0.3428   -0.79795    -0.91637   -0.89392      -0.8873   0.732751
0.446078       0.1446    0.26561    0.098451    0.231926    -0.03562   0.769567    0.748479    0.194133
 0.93756    1.159933    0.832331    0.836106    0.910685    0.804713   0.980124    0.980136    2.477507
0.126566    0.089356    0.029696     0.04858    -0.02947    -0.00818    0.88784    0.851147    0.209437
-0.55596    -0.53094    -0.48572       -0.242   -0.48955    -0.62185   0.833216    0.867148    0.475185
1.130954    1.361026    0.975246    0.999079    0.552474    0.774268    0.83252     0.85128    2.251258
-0.90279    -0.89573    -0.67799    -0.48384    -0.56284    -0.80177   -0.03888    -0.10221    0.023612
0.574273    0.758535    0.569934    0.419219    0.267618    0.658681      0.7551   0.734665    0.248816
0.138323    0.251963    -0.00018    0.200024    0.004315    0.117445   -0.05816    -0.10878    0.014808
0.126363    -0.19762    -0.19369    -0.38553    -0.38185    -0.44376   -0.65563      -0.6254   0.069096
0.266181    0.557824    -0.00988    0.155194    -0.48209    0.312985   0.718709    0.699277     0.13536
-0.18111      -0.0418     -0.2875   -0.22068    -0.57161    -0.47562   0.888065    0.885837    0.172114
-0.08712    -0.00687    -0.12822    0.003595      -0.2361   -0.14473   0.684427     0.68283    0.035981
0.086963    0.294951    -0.19841       0.0246   -0.72795    -1.15829   -0.74631    -0.83972    0.385731
0.107373    0.236416    0.536718    0.230265    -0.01837    0.181589   -0.89026    -0.86907    0.159061
0.146495    0.184683    0.017027    0.045086    0.148801    0.082223   0.639298    0.395592    0.022804
 0.32293    0.249497    0.322915    0.223379    0.119074    0.304612   0.922718    0.924753    0.082398
0.099979     0.13354     0.08031    0.051598    0.101811    0.002123   0.953096    0.951288    0.074071
-0.35636    -0.40945    0.032854    0.404906    0.269904    0.221473    0.15163    0.116251    0.080797
0.164052    0.454578    0.231473    0.280832    0.358371     0.43572   0.782005    0.795267    0.097266
0.250821    0.046364    0.108694    0.000402     0.00637     0.02979   0.313917    -0.26361    0.022786
0.202814    0.006625    -0.00981      -0.1506   -0.13786    0.007123   0.422099    0.393324    0.017501
0.447039    0.459726    0.483986     0.27141    0.518977    0.541784   -0.49549    -0.55923     0.34862
-0.49445    -0.41952    -0.08971    -0.19495    -0.07887    -0.02289   0.504768    0.845426    0.190333
0.415258    0.407294    0.447981    0.367707    0.166531    0.414942   0.809811    0.255022    0.053937
0.212445    0.087259    0.148825    0.100246    -0.11924    0.028565   -0.25662    -0.24892    0.070417
-0.18121      -0.0846   -0.01185    0.183292    -0.10269    -0.21822   -0.16455    -0.08763    0.028539
-0.02875    -0.29556    0.034733    -0.40761    -0.28324    -0.19818   -0.10673    0.025257    0.062096
0.740772    0.772249    0.775805    0.306242    0.470544    0.695554   0.029626    0.172127    0.442194
   0.2556   0.125841    0.408203    0.043571    0.073753    0.296519   -0.32298    -0.36933    0.050081
0.690013    0.442096     0.68021    0.273691    0.558457    0.652779   -0.12439    0.017521    0.164929
0.294986    0.377379    0.228762    0.320475    0.266121    0.251862   0.918503    0.885825    0.106825
0.100982    -0.13871    0.182907      -0.1747   -0.04709    0.024562   -0.26098    0.103499    0.126389
0.310762    0.161785    0.319883    0.198809    0.031057    0.093872   0.169019    0.573193    0.024645
0.001775    0.029826    0.098015    0.059198    0.014818    -0.11348   0.525784    0.143214    0.027203
-0.23006    -0.23823    -0.23267    -0.23403    -0.23626    -0.31376   0.384444    0.208672    0.139856
0.290881    0.155287    0.310387    0.133711    0.446457    0.379223    0.93804    0.944791    0.559484
0.208985    0.248039    0.204545    0.187134    0.079992    0.077404   0.934696    0.897886    0.205602
0.174787    0.291068    0.388569    0.180373    0.125011    0.146209   0.978366    0.944537    0.276708
-0.14676    0.146709      -0.0375   0.150076    -0.05729    0.073055   0.336759     0.37133    0.031871
 0.14163    0.014657    -0.22022    -0.08823    -0.20073    -0.15206   0.837172    0.832741    0.075348
0.171031    0.003888    0.099644    0.013527    -0.00013    -0.07837   -0.09389    -0.41838    0.037546
0.034363    0.170795    0.197738    0.264782    0.096251    0.421191   0.787134    0.853104     0.19595
0.121667    0.041704    0.119317      -0.0985   0.187172    0.053686   0.187595    0.283953    0.054003
  -0.1521   -0.13265      -0.0423   0.039065    -0.35052    -0.12932   0.846171    0.682866    0.267274
-0.75897    -0.51696    -0.57285      -0.2562   -0.58939    -0.48592   0.897284    0.854343    0.859665
-0.07905    -0.13196    -0.12338    -0.21198    -0.03207    -0.21855   0.758886    0.751331     0.05094
-0.40964      -0.3516   -0.38063    -0.34102    -0.41463    -0.50874   0.814101    0.836748    0.296858
-0.42049    -0.15157    -0.34484    -0.13529    -0.65096    -0.31834   0.948705    0.964406    0.474746
-0.35189      -0.3078   -0.03136    0.163048    -0.14903    -0.20558   0.411417    0.464137    0.038297
0.012531      -0.0397   -0.04004    -0.12762    -0.20934    -0.43598   0.608528    0.753844    0.039854
-0.05476    -0.05854    -0.11809    -0.13414    -0.35339    -0.16446   0.857798     0.95435    0.220183
0.011993    0.096631    0.100253    0.210657    0.104595    0.013528      -0.269   -0.21883    0.005901


  -0.0031 -0.09805      -0.04137    -0.12148    -0.29921 -0.33003 0.355426 0.385707 0.014424
0.064003 0.073536       -0.04312    -0.02106    -0.12304 0.107058 0.320455    0.3441 0.122078
-0.39918 -0.28621       -0.31979    -0.22728    -0.27438 -0.22547 -0.06229 -0.49231 0.373016
-0.29473    -0.08175   -0.15798    -0.06712    -0.39378   -0.35392    0.021639    0.482941    0.196715
0.303745    0.406626   0.349079    0.176341    0.229329   0.397236    0.630432    0.451168    0.025929
0.141688    0.508734   0.402536    0.269124    0.335929   0.199063    0.781272    0.840489     0.11275
-0.31866    -0.40919     -0.2934   -0.26564    -0.52736     -0.8155   0.223649    0.247798    0.914917
0.007769    -0.12796   -0.12169    -0.19657    -0.15362   -0.31508    0.183079    0.274273    0.014056
-0.33991    -0.28683   -0.22836    -0.20084    -0.28977   -0.46695    -0.62786    -0.76855    0.114434
 0.84871    0.865063   1.036458    0.874217    0.336774   0.364633    0.922865     0.90543     2.13682
1.062402    1.013237   0.970095    0.935719    0.412348   0.518044    0.978444    0.967183     2.94063
0.152371    0.040076   0.323843    0.113017    0.253533   0.286361    0.564565    0.574048     0.04974
-1.34187    -1.29346   -1.10248    -1.08416    -1.32049   -1.68062    -0.22075    -0.21404    1.602196
0.115329    -0.03824   -0.14158    -0.02225    -0.13225   -0.00888    -0.27009    -0.13908    0.023413
0.286805    0.112608   0.094919    0.139621    0.106791    0.13754    0.842295    0.798568    0.042476
0.008637    -0.27729   0.049778      -0.1368   -0.12607   0.044735    0.292969    0.330242     0.03932
-0.20425    -0.66657   -0.74947    -0.86737    -0.76007   -0.95256    0.076872    -0.00163    0.054739
  -0.1687   -0.14316   -0.03695    0.068759    -0.13327   -0.14264    0.173784    0.221479    0.085057
0.108013     0.19089   0.127645    -0.04108    -0.20914   -0.01577    -0.16744    -0.42537    0.284614
0.253595    0.100516   0.135876    0.111745    0.031169   0.137653    0.076493    0.322314    0.010689
0.080528    -0.00738   -0.02913    0.151174    0.047128   0.066906    -0.15501    0.069766    0.009533
0.300515    0.301463    0.16895    0.603934    0.157475    0.41555    0.680576    0.645951    0.093838
0.289802    0.499167   0.293574    0.527748    0.477063   0.790029    0.504169    0.861371    0.101601
0.133715    0.008019     -0.0041     -0.0908   0.109897   0.021663    0.450742     0.43345     0.01025
0.128393    0.255955   0.058861    0.196646    0.033405   -0.06319       -0.275     -0.2428   0.020433
0.051171    -0.14078   0.036363    -0.16511    -0.27436   -0.16753    0.244012    0.438299    0.056408
 0.15159    -0.00511   0.149178    0.171747    0.079249   0.064727    0.756661    0.675475    0.022101
0.428086     0.34874   0.582429    0.501813    0.222895   0.258254    0.723881    0.477033    0.057292
0.156773    0.051053   0.083541    -0.04256    -0.09215   -0.19608    -0.22126    -0.21403    0.031671
0.070075     0.07176     -0.1019   -0.08834    -0.02677   -0.35723    -0.42702    -0.50749    0.097315
0.323868    0.328459   0.328199    0.127892    0.361737   0.085608    0.712966    0.681154    0.268211
0.152891    0.169879   0.073179    0.192492    0.231637   0.114163     0.88257    0.841913     0.00806
-0.02109    -0.03204   -0.15288    0.043402    0.018752    0.04808    -0.49912    -0.46448    0.015296
0.741798    0.948801   0.462338    0.595057    -0.02824   0.196218    -0.84367      -0.6825   0.516306
1.103142    0.984674   1.223104    1.089902    0.515574   0.460976    -0.53812    -0.45473    3.142744
 0.90056    0.966471   0.783244    0.699659    0.483459   0.425079    -0.57173    -0.50283     1.73833
0.392447    0.393477   0.364073    0.422705    0.267184   0.048885    -0.61958    -0.86066    0.564597
0.219766     0.13349    0.23005    0.080902    0.205686   0.088059    -0.27645    -0.61485    0.066663
 0.06563    -0.10047     -0.0609   -0.16871    -0.14976   -0.15086    0.317901    0.036625    0.012512
-0.23562    -0.18392   -0.23159    0.060577    -0.05055   -0.16886    0.109685    0.367853    0.039106

0.141903     0.21257   -0.06316    0.090212    0.021806     -0.0597   0.262946    0.579336    0.075558
0.277322    0.525804   0.324195    0.351003     0.21887   0.380672    0.660498    0.447012    0.071773
  -0.0118   0.009992   0.069889    -0.00481    0.135039     -0.0092   0.358485    -0.09871    0.010863
 0.53809    0.463515   0.720178    0.098661    0.310779   0.360435    0.682939     0.75864    0.538549
0.330909    0.419017   0.321759     0.20867    0.373867   0.195995    0.414408    0.445413    0.070691
0.942947    0.534708   0.940843    0.251453    0.486215   0.704264    0.572903    0.691001    0.604292




0.465626 0.35583 0.51222           0.487872 0.225309 0.393164 0.602132 0.184492 0.04714
-0.07095 0.14673 -0.00161          0.282415 -0.11331 0.402814 0.040672 0.129367 0.039963
   0.3143 0.158238 0.232822        0.144515 0.326628 0.355432 -0.40822 -0.24243 0.025491
0.311778 0.345507 0.387699         0.257846 0.157958 0.377396 0.118235 -0.18794 0.059536
0.320205 0.52444 0.40345 0.713824 0.375344 0.95087       -0.0812                   -0.20151    0.448219
-0.46199 -0.44397 -0.24386 -0.19958 -0.43292 -0.65165 0.404752                     0.543691    0.316379
0.098353 -0.02247   -0.0374 -0.10246 -0.09548 -0.12824 0.92604                     0.896446    0.096101
-0.37116 -0.04812 0.224124 0.278486 -0.21745 0.29498 0.910805                      0.783009    0.317874
0.183637 0.251259 0.084196 0.225597 0.320087 0.089049 -0.12011                     -0.14196     0.60569
-0.07648 0.385092   -0.6763 0.143199 -0.16417 -0.23517 0.743082                    0.457789    0.209106

0.063588 0.015721 0.129019 0.042209 0.28892 0.195904 0.825402 0.840193 0.024946
0.100111 0.08494 0.071036 0.240603 0.14906 -0.00337 0.830821 0.814129 0.110438
-0.00752 -0.08067 0.013056 -0.08731 0.110892 0.026215 -0.00759 0.034138 0.028827




0.355638 0.272714 0.394163 0.288019 0.217834 0.140177                  -0.00416 0.022035 0.04944
0.403814 0.502404 0.775855 0.471963 0.614692 0.822867                   0.82076 0.683876 0.722146

  -0.1309   0.284717    0.215905     0.37781   0.184868    -0.12385    -0.62828    -0.66831    0.139531
-0.27693    -0.19831    -0.03218    0.119122   0.200912    0.181729    0.422533    0.461495    0.038938
-0.47347    -0.23251    -0.46695    -0.19048   -0.49226    -0.47238       -0.872   -0.87213    0.046115
0.277696    0.060465    0.120919    0.019023   0.082354    0.110644    0.789538     0.80925    0.042776
0.034628    -0.07759    -0.01532    -0.29988   0.311687    0.032306    0.417834    0.456273    0.184865
0.184961     0.06253    0.059072    0.010638   0.288159    -0.01067    0.807321    0.705194    0.015674
-0.12644    0.056697    -0.20241    -0.14193   -0.20367    -0.00586     0.51239    0.430197    0.068613
0.541154    0.309232    0.617916    0.893627   0.373985     0.34129    0.502422    -0.00209    0.056882
-0.35426    -0.31403    -0.41215    -0.32177   -0.54302    -0.41082    -0.58786    -0.77283    0.047982
0.005251    0.048917      -0.1303   0.091873   -0.03557    -0.11229    -0.13561    -0.40774    0.010217
0.120154    0.488699    -0.05402    0.212383   0.037519    0.252026    -0.12861      -0.3805   0.172394

0.385852    0.321701    0.402923    0.213453   0.404782     0.05128    -0.65242    -0.61435    0.144846
0.087705    0.640476    0.434366    0.649154   0.109339    0.656372    0.147701    0.231662    0.107205
-0.29756    0.064552    0.033139    0.116014   -0.17174    -0.05118    0.195395    0.231211    0.126488
0.519591    0.392393    0.556822    0.255753   0.423461    0.381913    0.352786    0.673865    0.230866
0.175874    0.267248    0.229389    0.321025   0.252271    0.139775    0.745492    0.813713    0.021685
0.027609    0.175401    0.277305    0.132393   -0.14214     0.24791    0.640841    0.655736    0.072108
0.455825     0.37824     0.22279    0.236299    0.09906    0.255542    -0.61862    -0.59056    0.151379
-0.66909    -0.59061    -0.56657    -0.58002   -0.45475    -0.39298    0.324281    0.325959    0.702469
-0.46662    -0.08977    -0.35674    0.089463   -0.01082    -0.06098    0.841583    0.875525    0.173296
-0.44504    -0.31802    -0.28544    -0.32636   -0.62719    -0.59905    0.807503    0.851326    0.328895
-0.06424    0.481369    0.348066    0.283295   0.167584    0.356089    -0.32142    -0.27187    0.025683
0.452942    0.366815    0.310063    0.293628    0.40139    0.266916    0.796755    0.803311    0.154785
-0.22544    -0.41181      -0.2279   -0.33223   -0.35985    -0.31942    0.288708    0.284743    0.038152
-0.10077    -0.05025    0.122997    -0.00339   -0.31762    -0.04085    0.009769    0.241308    0.129309
-1.01763      -0.5832   -0.60511    -0.35764   -1.02014    -0.92643    0.882285    0.939151    0.650303
-0.31955    -0.18665    -0.23939    -0.00937   -0.22157    -0.28951    0.711886    0.757417    0.028538
  -0.5821   -0.19854    -0.36799    -0.24821     -0.6006     -0.5111   0.928757    0.961933     0.40921
-0.80307    -0.40483    -0.85267    0.031648   -1.38619    -0.63899    0.955261    0.960134    0.931115
-0.34123    -0.07689    -0.22775    0.328213   -0.32083    -0.26339    0.782218    0.811483    0.111319
-0.35434    -0.09708    -0.26325    0.090755   -0.63974    -0.23828    0.927063    0.876085    0.272378
-0.70876    -0.61352    -0.53225    -0.34174   -0.36318      -0.3714   0.472339    0.467065    0.336973
-0.38135    -0.19928       -0.375   -0.30641     -0.4316   -0.52771    0.802559    0.868489    0.230944
-0.62419    -0.35658    -0.46383    0.629523   -1.25929      -0.2837   0.759642    0.768129    0.769343
-0.01859    -0.00073    -0.21231    0.082791    -0.02222    -0.17504    0.257042    0.340488   0.009969
-0.29872    -0.09223    -0.34185    0.040591    -0.37676    -0.45098    0.683376    0.746033   0.226298
0.596341    0.574148    0.527749    0.436932    0.349081    0.490542    0.741235    0.750271   0.474459
0.539874    0.445463    0.675757       0.5629   0.359256     0.32192    0.973281    0.966682      1.1243
-0.62447    -0.16247      -0.6517   -0.34314    -0.65574    -1.12624    0.937335    0.947617   0.561033
  -0.3365     -0.2359   -0.14669    -0.23765    -0.40864    -0.43469     0.82491    0.933243   0.144889
-0.60812    -0.12829    -0.46864    -0.48188    -0.66033      -0.3447   0.927945    0.978659   0.528531
-0.05298    -0.11486    -0.18617    -0.03505    -0.16973    -0.17568    0.899743    0.932003   0.133414
0.166673    0.185562    0.332052     0.26353    0.276902    0.352184    -0.10746    -0.13338   0.103759
-0.07755       0.0349      -0.032   -0.13051    0.104983    -0.06282      -0.2175   0.454326   0.027364
-0.41054    -0.08743    -0.31391    -0.31445    -0.18351    -0.34061    -0.20114    0.586199   0.202822
-0.47274    -0.45187    -0.36893    -0.31868    -0.58239    -1.18657      -0.0944   -0.03563   0.580059
0.134534    -0.02272    0.039916    -0.01038    -0.15141    -0.32604    -0.14458    0.179407   0.067491
-0.15398      -0.0342   -0.12955      -0.0549   -0.12916    -0.17435      -0.1326   0.263574   0.132124
0.035243    0.000579    -0.04994     0.00172    -0.07117    0.081202    0.611037    0.675683   0.044436
0.974833     0.84657    0.923307    0.444667    0.686791    0.639219    -0.54887    -0.45211   0.219912
-0.11483    0.260417    -0.04071    0.061908    0.043157     0.20488    0.049729    0.137594   0.053161
0.722081    0.367449     0.27296    -0.33096    0.371372    0.195364    -0.46423    -0.36598   0.303723
 0.08967    0.067246    0.133698    0.022085    0.077696    0.073319    0.214294    0.130637    0.01823
0.358903    0.358291    0.155514    0.184452    0.163756    0.107849    -0.32748    -0.31238   0.020516
-0.03353    -0.10235    -0.00529    -0.11831    0.008873    0.025931    -0.58362    -0.50123   0.014337
-1.31171    -1.32944    -0.92741    -1.08034      -0.8683   -0.74292    0.082596    0.156666   1.987293
  -0.1137   -0.03381    0.251232    0.265367    -0.07233    0.216075    0.081528    0.133272   0.155639
-0.00677    -0.30158    -0.19104    -0.38463    -0.16862    -0.16738      -0.0876   -0.11495   0.012889
0.736452    0.824516    0.768751    0.924516    0.781622    0.695031    0.930455    0.920522   1.292306
0.956649    0.574763    0.995035    0.913947    0.606447    0.728336    0.982985    0.977657   1.955375
1.403778    1.018295    1.304354    1.104267    0.615963    1.080969    0.965812    0.962536   3.145116
-0.03061    -0.02486    -0.06455    -0.03397    -0.16031    -0.32271    0.870095    0.886319   0.266421
0.055242    -0.17133    0.213213    -0.00234    -0.32748    -0.11313    0.528999    0.509609   0.200802
 0.54664    0.426517    0.534016     0.23073    0.314771    0.397102    0.164521    0.177898   0.450668
0.041867    0.046054    0.103492    0.132502    0.060357    -0.03437    -0.38904    -0.50543   0.009453
-0.07002    -0.02203    -0.10695    -0.01515    -0.13671    -0.25809    0.086527    0.156389   0.045307
-1.54056      -1.4625   -1.06098    -2.13929    -1.64471    -1.58433    0.788355    0.860132   1.646415
  -1.2697   -1.34231    -0.83244    -1.58999    -2.00114    -1.48351    0.641871    0.752405   1.518956


0.022353    -0.18735 -0.17414 -0.01793 0.114617 -0.13587 0.490804 0.390033 0.021021
-0.65771    -0.34781 0.039475 -0.22703 -0.42728 0.090681 0.60399 0.669062 0.481438
0.145682     -0.0529 -0.02303 0.174188 0.12152 0.034162 -0.31251 -0.33277 0.00679

0.315305    0.263481    0.494455    -0.23307    0.335031 -0.12135 0.574739 0.656798 0.083752
  -0.0336   0.267691    -0.25665    -0.04326    0.006516 -0.01511 0.281105 0.002251 0.054176
-0.41096    -0.33851    -0.28975    -0.39406    -0.09511 -0.04354 0.737673 0.460438 0.277115
-0.49982      -0.2531   -0.42381    -0.15837    -0.37688 -0.40445 -0.04035 -0.02381 0.073918
0.374206    0.563759    0.126027    0.191483    0.143908 0.291349 0.614058 0.612231 0.387875
0.038739    -0.16929    -0.12632    -0.25165    -0.09107   -0.2987 0.391285 0.41691 0.098923
0.147523    -0.19151     0.21323      -0.1757   0.148804 0.388011 0.081464 -0.15944 0.129937
0.324175    0.431772    0.447673    0.355568    0.075707 -0.02911 -0.13674 -0.20891 0.19409
0.120422    0.200631    0.062183    0.078597    -0.26851 -0.23581 -0.09323 0.123406 0.092793
0.580425    0.311604    0.139067     0.15394    0.254967 0.335576 0.934799 0.94271 0.098551
-0.18557    -0.04893    -0.08309    0.049411    -0.04675 -0.01503 0.324871 0.092936 0.062098
0.574306    0.384957    0.456869     0.15067    0.340392 0.15032 -0.23542 -0.01321 0.222425
 0.17599   -0.04764    0.162374    0.010663     0.245448    0.143965    0.238246    0.579861   0.009399
-0.33176   -0.22968    -0.36165    -0.21218     -0.26689      -0.4785   -0.72808    -0.79164   0.032954
0.787804   0.527338    0.674633    0.633824     0.664147    0.540201    0.979834    0.982304   0.525475
0.385674   0.324945     0.44209    0.314632      0.41169    0.395434    0.812212    0.845579   0.035174
0.568469   0.378952     0.37084    0.299641     0.303628    0.237652    0.895207    0.884535   0.353138
-0.11185   -0.14795    -0.22403    -0.12722     -0.16605    -0.11335    0.533806    0.498331   0.177837
0.082177   0.126845    0.201136    0.146629     -0.05184    -0.07987    -0.19167    -0.20833   0.026949
0.004664   0.173659    0.303872    0.104929     0.236055    0.321284    -0.29784    -0.14385   0.038116
-0.02662   0.038719    0.028408    0.024419     0.067662     0.09031    -0.70711    -0.63738   0.062825
-0.14343    0.19071    0.080516    0.005752     -0.22393    -0.02348    0.154843    0.531697   0.020162
0.041852   0.136876    -0.11121    0.188681       -0.2828   0.099153    0.356911     0.36953   0.057917
 0.01132   0.075203    -0.00313    0.002435     -0.03236    -0.24839    0.289685    0.349703   0.012667
0.575564   0.504581    0.545974       0.3824    0.576472    0.539081    0.621894    0.582566   0.100013
-0.10118   -0.11261    0.214161    0.089559     0.270785    0.488104    0.219887    0.208886   0.447577
0.744837   0.647295    0.342144    0.369994     0.094845    0.161039    0.904646    0.893931   0.591822
0.516957   0.679779    0.222599     0.27156     0.530637    0.473216    0.695081    0.682455   0.425621
0.353486   0.775032    0.392813    0.597074     0.272732     0.29494    0.918676    0.927663   0.680768
0.514904   0.808733    0.466201    0.511588     0.535586     0.56193    0.961577    0.970984   0.428803
 0.18782   0.515524    0.152928    0.049426     0.081299    0.013546    0.966142     0.96906   0.363822
-0.08777   -0.03878      -0.0441   0.073199     -0.03809    -0.08265    0.417573    0.409757   0.009143
-0.18538     -0.3932     -0.0931   -0.29314     -0.32828    -0.25374    0.933109    0.915694   0.067709
0.043635   0.105141    -0.14398    0.113768       -0.1163   -0.14428    0.972023    0.969388   0.486246
0.144469   0.727136    0.314151    0.483416      0.20577    0.216236    -0.22299    -0.45355   0.555703
-0.09035   0.218759    -0.13628    0.176624     0.025705    -0.04934    0.186624    0.312847   0.086003
0.270191   0.137073    0.216305    0.117029     0.151629    0.361472    0.359324     0.28264   0.025894
-0.01633   0.066985    -0.00919         -0.04   -0.03864    -0.00816      -0.4926   -0.50409   0.005567
0.592916   0.322701    0.484364    0.011302     0.729947    0.419513    0.829908    0.863747   0.219639
-0.31446     -0.5685   -0.61956    -0.82105     -0.73713    -0.87641    0.411108    0.377348   0.097084
0.111049   0.117928    0.062119    0.080959       -0.0043   0.006783    -0.27986    0.149087   0.008072
0.104601   0.034333    -0.01316    0.076939     -0.08982    0.139988    0.272898     0.32588   0.023169
 0.45393   0.481104    0.478618    0.615095     0.479149    0.306367    -0.10767    -0.45184   0.190663
0.316955   0.236133    0.326913    0.311838     0.189893    0.312632    0.765906    0.347437   0.039728
0.007274   0.032038    0.141225    -0.04975     -0.17133    0.004571    -0.60157    -0.48546   0.047567
-0.17071   -0.00705    0.114974    -0.26213     -0.30153    -0.28069    -0.66799    -0.47264   0.113826

-0.10339   0.893642    0.648368    0.414808     1.162596    -0.57751    0.294695     0.38611   0.347474
-0.05272   -0.17493    -0.04755    0.011103     -0.02044    -0.14151    0.436751    0.503139    0.00426
-0.54801     -0.3384   0.032219    -0.13799     0.003826    0.566431     0.42289    0.209628   0.201919
0.141472   0.120559    0.308591    0.158965     0.084623    0.100432    0.519573    0.596795   0.012997
0.240104   0.447214       0.1746   0.543029     0.441658    0.740257    0.264232    0.028607   0.183854
0.282926   0.210031    0.478147    0.434642     0.215622    0.281925    0.002528    0.038509   0.029348
0.073303   0.149202    0.070118    0.052949       -0.0222   0.013736    -0.41158    -0.38087   0.004257
-0.06427   0.014034    -0.12959    0.059246     -0.10361    -0.09954    -0.71144    -0.64758   0.054967
0.194091   0.087271        0.261   0.217161     0.238027    0.273541     0.38828    0.296283   0.029464
0.347339   0.252919       0.4582   0.395445     0.261558    0.234245    0.812221    0.679184   0.096737
0.220229   0.179543    0.244717    0.053173     0.136023    0.191252    0.786888    0.872005   0.050524
0.264783   -0.07075    0.370156    -0.02098     0.344912    0.277999    0.198573    0.291883   0.112493
0.137199   0.189435    0.187148     0.18749     0.222815    0.212789    0.343542     0.10989   0.016888
-0.09054   -0.10793      -0.1076   -0.02429     0.116091      -0.1089   -0.61739    -0.69646   0.008588
0.225721   0.255218    0.198982    0.180377     0.516564    0.478936    0.764835     0.80195   0.053398
0.000473   -0.10753    -0.02169    -0.07918     -0.19737      -0.1213   -0.40543    -0.25916   0.039079
-0.11694   -0.01991   -0.08699      -0.0238   -0.25923    -0.33193    0.627579    0.597649    0.028246
-0.23164   0.192125   1.171931    -0.26656    1.461715    -0.10706    -0.50406    -0.40844    0.368172
-0.00026   0.468143   0.120771    0.222258    0.288549      -0.2514   -0.91616    -0.91262    0.190612
0.068889   0.015071   0.037315    0.203462    0.054489    0.074122    0.559285    0.565025    0.012077
-0.14466   -0.08263   0.011083     0.08617    0.004119    0.034783    -0.55106    -0.94305    0.096883
-0.16662   -0.02127   -0.18334    -0.19254    -0.13289    -0.12717    0.218377    0.221717    0.047974
0.454716    0.54017   0.181005    0.585557    0.728373    0.595101    -0.20228    -0.32123    0.117617
0.143394   0.151226   0.222085    0.157648    0.243238       0.1334   0.175055    0.160451    0.015181
0.250114   0.149118   0.257276    0.077449    0.253783    0.094752    -0.43367    -0.48365    0.021959
0.015603   0.036869   0.082122    0.069712    -0.17991    -0.03499    0.701325    0.659027    0.014186
0.147657   0.130739   -0.02428    0.026904    -0.06945    -0.06371    -0.46204    -0.08745     0.03713
0.449595   0.287624   0.461179    0.409463    0.350605    0.349979    0.181789    0.574705    0.289498
0.534552   0.313367   0.467707    0.236244    0.548724    0.486438    0.287183    0.633601    0.172597
0.310323   0.098912   0.080547    0.183021    0.128241    0.265297    0.356707    0.660402     0.13972
0.329962   0.459158   0.307049    0.336372    0.174622    0.489365    0.771452     0.75094    0.037552
0.021237   -0.29076   -0.12904    -0.30466    -0.32794    -0.44929    -0.47925    -0.50863     0.02424
0.292133   0.152264   0.493152    0.269932    0.644974    0.853492    0.572791    0.627589    0.444945
0.324109   0.468582   0.222015    0.627792    0.354856    0.721806    0.900382    0.886335    0.255654
0.250924   0.144904   -0.02174    0.200219    0.397092     0.52709    0.921761     0.93221    0.176899
0.079266   0.079883   0.069472    -0.01211    0.161532    0.010063    0.510599    0.663135    0.025532
0.380636   -0.18204    0.09498    0.007794       0.1237   0.093705     0.26666    0.255787    0.025433
-0.23837   -0.91121   -0.57961    -0.61007    -0.27817    -0.57571    -0.31882    0.017614    0.051175
0.366829   0.500882   0.482612    0.379264    0.360713    0.450686    0.205073    -0.03413    0.178067
0.078372   -0.13804   0.072895      -0.1573   0.070884    0.007051    -0.19077    -0.16667    0.161687
0.048711   -0.19978   -0.00853    -0.00994    0.092876    -0.03996    -0.29487    -0.37996    0.100679
0.641228    0.67506   0.697947    0.672908     0.61033    0.301586    0.544282    0.670526    0.587019
0.350437   0.264115   0.284697    0.250038    -0.01034    0.205854    0.704945    0.772471    0.035236
0.008619   -0.00986   0.002304    -0.07999    -0.09069    0.139326    -0.33363      -0.4203   0.074072
 0.18844   0.107024   0.203148    -0.01481    -0.08061      -0.1358   -0.32227    -0.45976    0.027613
0.450944   0.144909   0.197228    0.212393    0.109928    -0.05575    0.370994    0.256536    0.036117
-0.01077   0.186745   0.031699    0.201176    0.060593    -0.09166    -0.59005    -0.62969    0.019065
-0.22531   -0.48682   -0.28195    -0.41385    -0.50561    -0.53893    -0.81174    -0.74621    0.016702
0.161918   -0.02292    0.18155    0.003052    0.009135    0.137801    0.528211     0.01082    0.055669
0.003136   -0.22361   -0.06657    0.106507    0.048811    -0.03063    0.096219    -0.27321    0.015236
-0.04512   0.209525   0.063056    0.150506    -0.03497    -0.00886    0.022925     0.20127    0.016298
-0.30053   -0.56703     -0.3824   -0.57651      -0.3499   -0.39301     0.49576    0.478642    0.011014
0.256551   0.457488    0.13193    0.332173    -0.36247    0.075119     0.21939    0.262338    0.075593
0.509228   0.372712   0.604692    0.379027    0.470307    0.477001    0.895977    0.930024    0.146323
0.612343   0.571877   0.713619    0.513897     0.56707    0.281225    0.930861    0.949575    1.558829
-0.35144   -0.12314   -0.11654    -0.03907    0.097961    0.266339    0.918489    0.916207    0.170822
0.016627   -0.24988   -0.10984    -0.13839    -0.31197    -0.61245      -0.0454   0.206474    0.176902
0.112358   0.045308   0.161712    -0.11963    0.126067     0.24185    -0.18287      -0.1793   0.150463
-0.01302   0.042128   0.133987    -0.15116      -0.1916   -0.06675    -0.03597    -0.08959    0.160291
-0.26471   -0.04883   -0.15913      -0.1135   0.029775    -0.15925     0.28694    0.386333    0.077487
0.212337   0.060099   0.140026    0.115577    -0.00773      -0.0611   0.498021    0.582097    0.018312
0.224428   0.241952   0.168036    0.161538    0.252079    0.243355      -0.2621   -0.45313    0.045557
-0.76565   -0.87392   -0.66721    -0.65622    -0.82845    -0.67531    -0.16474    0.154681    0.465478
-0.16176   -0.11823   -0.32588    0.003933      -0.4479   -0.59108    -0.68473    -0.74561    0.230082
0.148767   -0.18791   -0.01165    -0.20011    0.116524    0.141092    0.470734    0.546984    0.048123
-0.19519   -0.25414     -0.2651   -0.18043      -0.0775   -0.37664    0.439227    0.364861    0.074613
0.057496    0.19576   0.057484    0.141777    0.201597    0.136197    -0.20142    -0.28158     0.00811
0.075866 -0.03961 -0.01137 0.146291         -0.02796 -0.13378 -0.31603 -0.44609 0.041216
0.308477 0.354794 0.091057 0.330504          0.17508 0.128289 0.295661 -0.03761 0.010333
0.306865 0.338745 0.333342 0.29469           0.22315 0.347332 0.885258 0.821572 0.043821

-0.49008   -0.60675   -0.51884   -0.59101   -0.75583   -0.84683   -0.3572   -0.37107 0.462754
            Variation-Apochip-log2 Slope beta dilution alpha dilution
Variation Affymetrix Variation Affymetrix-log2Intercept Variance around the straight line
 1.693333 -1.94941 0.759866 0.990035 0.174786 25.75442
 1.693333 -3.19174 0.759866 1.124785 0.243805 40.82917
 1.693333 -1.79489 0.759866 1.024977 0.561774 20.30937
 0.551667 -5.12441 -0.85813 0.642301 0.524215 3.815712
 1.088889 -5.66906 0.122857             0.559 0.62924 72.24736
 1.088889 -3.09267 0.122857 1.049122 0.26078 21.15541
 1.088889 -3.50841 0.122857 1.010698 0.381657 56.99055
 0.844889 -5.00369 -0.24317 0.94277 -0.02616 11.22428
 1.151111 -2.66136 0.203027 0.951905 0.296238 17.58874
 1.151111 -4.64915 0.203027 1.023332 0.349362 51.19046
 0.170667 -2.41558 -2.55075 0.700642 0.508073 27.21056
 1.472111 -5.73916 0.557886 1.02407 -0.11895 225.0757
 1.512889      -2.8937 0.597306 1.03109 0.181688 5.260127
 1.512889 -3.60722 0.597306 0.924146 0.337027 18.48179
 1.512889      -2.3598 0.597306 0.726994 0.526883 25.68457
 0.127667 -3.65581 -2.96955 0.623091 0.581955 12.51375
 4.162333 -1.37552 2.057392 0.779114 0.465628 16.86913
 4.162333 -3.75629 2.057392 1.014068 0.112987 54.2839
 4.162333 -4.50422 2.057392 1.077145 -0.83579 25.2891
 0.600444 -5.58863        -0.7359 0.712902 0.552461 5.917932
 0.827111 -5.15579 -0.27385 0.856412 0.287882 15.01402
                                    0.824468 0.405747 7.16688
                                    0.960848 0.171757 105.9163
 0.757778 -4.31954 -0.40015 0.798208 0.39009 10.15506
                                    1.078243 0.06195 96.68441
                                    0.890969 0.344772 6.585026
                                    0.919889 0.398424 0.639938
                                    0.688167 0.436005 16.8156
                                    0.499723 0.594175 10.36396
                                    0.855512 0.356028 126.5722
                                    0.809528 0.412456 19.2108
                                    0.986849 0.223572 31.86088
                                    0.980404 0.258699 76.19026
                                    1.019589 0.153501 55.45774
                                    0.960918 0.153599 19.20208
                                    0.955469 0.138368 32.36064
                                    0.943807 0.167624 25.89608
     0.376     -7.3443    -1.4112 0.794301 0.43154 18.28919
                                    1.109062 -0.06608 18.22468
                                    0.811661 0.413525 5.444934
                                    1.007951 0.253476 50.18254
                                    0.945194 0.377641 7.123541
                                    0.914598 0.367956 151.3921
 0.876556 -3.93235 -0.19008 0.803514 0.343492 21.62392
 0.009889 -6.19809 -6.65998 0.862783 0.284925 137.0554
 9.742333 -4.09466 3.284267 0.92461 -0.33852 225.072
                                    0.160538 0.494639 136.1686
 1.472889 -2.95978 0.558649 0.827787 0.554563 4.800231
5.789444    -2.43459 2.533425 0.948567    0.215094   19.63491
0.128444    -0.59835 -2.96078 0.836903    0.481378   28.00405
                               0.969593   -0.04889   31.92434
0.653889    -5.27458 -0.61288 0.94218     0.271598   127.8041
                               0.901571   0.347835   8.118436
                                0.79435   0.485079   21.32667
0.078333    -3.97028 -3.67423 0.944586    0.305293    28.8367
0.361778    -5.22418 -1.46682 0.869983    0.278467   4.001649
0.502667    -4.38737 -0.99233 0.916225    0.335353   57.21884
4.320111    -2.11548 2.111068 0.713248    0.581586   25.38999
4.320111     -5.0756 2.111068 0.713248    0.581586   25.38999
3.786778    -2.74634 1.920971 1.030067    0.125629   10.02274
0.831111    -5.51072 -0.26689 0.692919    0.577807   61.44551
0.326778    -6.29969 -1.61362 0.878665    0.303112    153.083
7.466667    -3.92689 2.900464 0.891842    0.266047   62.83914
0.983222    -1.03273 -0.02441 0.817735    0.357235   172.1685
                               0.928244   0.371953   32.08653
0.260444    -5.80912 -1.94095 1.055701    0.144036   30.20918
0.260444    -4.72943 -1.94095 1.168096    -0.07776   15.72323
                               0.763203   0.416359   22.67613
0.282667    -3.32345 -1.82283 0.743879     0.48144   61.47037
0.282667    -1.90244 -1.82283 1.08951     0.357233   53.28016
0.282667    -2.74511 -1.82283 1.063343    0.281981   63.36289
0.540111    -4.27569 -0.88867 0.696038    0.430196   24.21324
0.137889    -4.50621 -2.85842 0.888452    0.299049   42.26427
0.137889     -3.8901 -2.85842 1.028546    0.279902   22.06788
0.137889    -2.84572 -2.85842 0.962075     0.16015   37.56421
0.062667    -3.35242 -3.99616 0.77116     0.462194   9.258605
0.062667    -2.99276 -3.99616 0.989192    0.032957   81.64158
    0.441   -7.31166 -1.18115 1.032523    0.056515    69.6954
    0.441   -2.86012 -1.18115 1.029939    0.070502    13.1475
    0.441   -4.40869 -1.18115 0.837654    0.316174   36.00918
0.022333    -3.64028 -5.48466 0.93106      0.24596   18.76301
0.022333    -5.18071 -5.48466 0.936144    0.397798   61.81628
0.159556    -4.88867 -2.64787 1.111175    -0.38964   21.15101
0.159556    -6.06815 -2.64787 0.488758    0.568355   29.80068
0.159556    -7.05909 -2.64787 0.837542     0.36108   4.961186
0.038778     -1.6597 -4.68863 1.029607    -0.21551   70.49556
5.309444    -3.60197 2.408561 0.832964    0.414447   3.258351
0.347667    -3.74294 -1.52422 0.792593    0.546914   6.277435
0.347667     -7.0884 -1.52422 0.792593    0.546914   6.277435
0.151667    -4.16718 -2.72102 0.572441    0.597859   23.45224
0.600111     -4.9606   -0.7367 0.815066   0.349823   14.87842
0.247667    -2.88661 -2.01353 1.021172    0.217161   29.62968
0.662333    -5.03743 -0.59437 1.064315    0.019567    18.8603
0.662333    -4.59814 -0.59437 0.978356     0.22182   54.98065
0.662333    -2.96125 -0.59437 0.882314    0.338662   3.062896
1.364889    -0.86803 0.448784 1.033717    0.077754   7.519583
1.364889    -5.16191 0.448784 0.08905     0.359446    173.322
1.364889    -0.33811 0.448784 0.922962    0.247298   2.538503
2.126222    -2.97678   1.088292   0.909957    0.260894    48.51625
0.036556     -4.1965   -4.77377   0.935961    0.248233     21.0401
0.036556     -5.6239   -4.77377   0.923203    0.368508    62.47556
3.400556    -5.45679   1.765771   0.986363    0.263607    33.91806
1.200111    -3.54429   0.263168   1.050026    -0.79916     144.787
2.926667    -4.01555   1.549259    0.92759    0.225334    91.74624
2.926667    -5.19561   1.549259   1.051439    0.295328    25.14371
                                   1.12288    -0.99174    74.99603
0.022333 -6.00047 -5.48466        0.843264    0.490277    27.67172
0.022333 -5.75633 -5.48466        0.967333    0.232457    15.72925
1.324444 0.269891 0.405387        0.705314    0.505411    16.97173
0.838222 -2.09402    -0.2546      0.982077    -0.08565    239.9035
4.337778 -4.59603 2.116956        1.037372    0.039602    29.27593
0.838222 -5.49444    -0.2546      1.014793    0.181174    53.29555
0.005444 -2.07952     -7.521      0.928674    0.145386     92.7934
0.192111 -2.60293 -2.37999        0.889505    0.349897    16.59352
1.510667   -6.0515 0.595186       0.998348    0.333269    52.75979
1.510667 -1.37129 0.595186        0.899907    0.285041    23.44056
0.022222 -4.17287 -5.49185        0.957124    0.394295    52.75392
0.022222 -4.71321 -5.49185        0.885307    0.410603    12.58069
0.397889 -3.70389 -1.32956        0.626415       0.5744   4.195673
0.326778   -6.7833 -1.61362       0.461736    0.632357    6.145692
0.053778 -3.70085 -4.21685         0.87916    0.454838    11.49118
    0.044 -4.30838 -4.50635        1.02257    0.174934    32.68316
    0.205 -4.27307   -2.2863      1.108516    -0.02162    63.98654
    0.205 -2.74542   -2.2863       0.99863    0.291374    8.583655
    0.205 -5.49068   -2.2863      0.451799    0.405657    3.459089
7.964889 -4.79979 2.993654        0.633679     0.50856    12.97476
                                         -1          10          -1
2.762667 -1.16872 1.466062        1.023385    0.007951    42.40538
9.207222 -3.51386 3.202766        0.464137    0.395768    36.69117
13.25822 0.381713 3.728815        0.951158    0.308094     27.2566
5.408444    -3.312 2.435214       0.878559    0.297739    75.39966
5.408444 -2.27001 2.435214           0.8299   0.477762    17.29839
3.300444 -5.26454 1.72266         1.099584    0.159346     6.68236
3.300444 -5.70628 1.72266         0.888805    0.524668    71.08108
3.300444 -2.62483 1.72266         1.038198    0.230484    6.880411
3.812889 -1.54613 1.930885        0.989797    0.290115    18.73374
                                         -1          10          -1
1.366778    -6.13725 0.450779     0.899693    0.293047    36.88441
                                         -1          10          -1
0.335667    -0.87131    -1.5749   0.949978    0.427317    14.17084
                                  0.884363     0.33022     15.5471
0.189333     -0.5497    -2.401    0.975972    0.161367    12.48456
0.322333    -2.62832 -1.63337     0.815114    0.375427    5.892722
0.077333    -2.90327 -3.69277      0.77256    0.378248    13.09782
0.076111    -4.79013 -3.71575     0.558864    0.294397    89.57365
      7.6   -6.99718 2.925999     0.834816     0.37641    17.17895
0.058222    -3.72177 -4.10229     1.069036    0.067595    8.478575
0.058222    -6.60311 -4.10229     0.952698    0.391143    6.342812
0.058222    -6.52655 -4.10229     1.021631    0.230732    6.963052
2.848444    -3.04287 1.510174     0.762609     0.39617       53.731
0.750667     -3.94659   -0.41376      0.7674    0.41488   5.255512
0.409444     -1.37165   -1.28826   0.978639    0.316422   8.999194
0.409444     -4.98984   -1.28826   1.066441    0.094128   33.55853
0.409444     -5.53172   -1.28826   0.649772    0.581168   10.39627
1.075111     -4.41292   0.104486   0.847842    0.321138   32.53773
0.246778     -3.92197   -2.01872   1.041092     0.19676   8.870912
0.246778     -3.97417   -2.01872   0.992169    -0.13015   55.55113
0.246778     -4.76969   -2.01872   0.832399    0.418436   41.51352
       0.7   -4.18556   -0.51457   1.004964    -0.77814   69.35348
1.976556     -2.31755   0.982989   0.441267    0.567968   7.160032
1.156111     -3.61977    0.20928   1.006309     0.28466   34.60171
1.156111     -1.05069    0.20928   0.945953    0.371564   1.631535
1.156111     -3.14924    0.20928   0.953719    0.248291   50.52001
    1.641    -0.88493   0.714575   0.853823    0.402538   22.08359
    1.641     -2.8934   0.714575   0.846318     0.37303   28.84134
    1.641     -1.0767   0.714575   1.010379     0.12175   4.185603
1.998778     -4.64992   0.999118   0.277502    0.502871   23.79713
0.415111     -3.02125   -1.26843   0.920362    0.366192   7.917937
0.571222     -0.86984   -0.80788   1.004651    0.122707   28.31598
0.096111     -5.28434   -3.37915   1.076914    0.027293    40.3213
6.764556      -2.2954   2.757995   0.968306    0.229921   30.03729
6.764556     -1.59926   2.757995   0.988035    0.265231   8.164127
6.764556     -3.65256   2.757995   0.886845    0.372106   22.85055
    1.624     -5.0915   0.699552   0.846027    0.420159   5.700334
    1.624    -2.39052   0.699552   0.809413    0.415086   19.49385
    1.624    -6.95291   0.699552   1.013512    0.107067   10.95353
     0.38    -3.52941   -1.39593   0.617734    0.580289   12.31975
     0.38    -3.94751   -1.39593   0.817019    0.411153    0.98307
                                   0.827152     0.47988   0.743523
6.234333     -6.40781   2.640235   1.013285    0.205283   16.86143
6.234333     -3.18701   2.640235   0.837987    0.478466   25.34754
6.234333     -5.68991   2.640235   0.797618    0.439527   61.65806
0.358778     -4.63129   -1.47884   0.916988    0.412703   11.79441
0.358778     -4.34705   -1.47884   0.969548    0.192497   12.67985
0.358778     -5.94295   -1.47884   0.655816    0.497008   18.54074
0.202667     -5.85986   -2.30282   1.044556    0.150992   29.43835
0.202667     -5.74099   -2.30282   0.933624    0.402181   0.329393
0.202667      -0.3201   -2.30282   1.032936    0.204713   79.31986
0.737778     -2.21383   -0.43874   0.779368    0.496929   9.190399
    1.096    -2.78438   0.132248   0.975348    -0.32406   56.96133
0.928889     -0.83886   -0.10642   0.934789    0.393059   21.62203
2.344889     -0.70093    1.22952   0.720492    0.584474   36.20061
0.430667     -2.50131   -1.21536   0.975165    0.312292   11.36501
0.430667     -4.02805   -1.21536   0.974866    0.325345   3.627201
0.320111     -3.61292   -1.64336   0.790363    0.273453   50.35991
1.213333     -3.66932   0.278976   0.950173    0.413049   120.7165
1.213333     -3.14379   0.278976   0.950173    0.413049   120.7165
                                   0.679627    0.419893   41.94499
2.820111     -5.00895   1.495752   1.053951    -0.43081   29.07734
2.820111      -0.6853   1.495752   0.935859    0.265809   5.541211
2.820111      -1.7851   1.495752   0.929577    0.323102   7.434304
    1.304    -0.79766   0.382944   0.889733    0.433542   5.695409
    1.304   -3.49549    0.382944   0.901708   0.346574    9.59794
    1.304   -2.94601    0.382944   0.563584   0.573177    14.3889
0.304556    -6.24094    -1.71522   0.950371   0.247485   49.65113
5.453333    -1.42915    2.447138   0.792302   0.422701   3.311058
1.251556     -6.3054    0.323723   0.947281   0.172898   4.903321
1.281778    -3.24388    0.358146   0.802704   0.384733   13.45423
1.281778    -3.30794    0.358146   0.921761   0.400464    0.20876
1.281778    -4.55664    0.358146   0.793414   0.443153   4.102272
0.322778    -2.06268    -1.63139   0.746883   0.543003   27.44109
0.844556    -4.67242    -0.24374   0.987873   -0.02266   44.96941
0.844556    -4.35431    -0.24374   0.932975   0.266296   17.78479
0.844556    -4.78448    -0.24374   0.956336   0.308257   9.094976
1.361778    -3.29267    0.445492   0.851664   0.343333   17.03505
2.127667    -0.43408    1.089272   0.925043    0.29399   2.819458
1.004444     -1.2978    0.006397   0.912775   0.279119   9.001842
                                   0.521014   0.343083   42.80209
0.433333 0.021367 -1.20645         1.103138   0.110299   20.44765
0.433333 -0.48929 -1.20645         1.023442   0.111456   18.53448
0.433333 0.214456 -1.20645         0.967363   0.445181   9.547125
1.037778 -2.96024 0.053498         0.735755    0.57156   15.18198
0.875667 -4.97644 -0.19155         0.820753   0.344351    42.9246
                                   0.931115   0.290557   37.75863
    0.589 0.542769      -0.76366   0.958898    0.20413   40.58121
    0.589 -7.56951      -0.76366   0.995233   0.196857   21.61371
    0.589 -6.19692      -0.76366   0.910246   0.322243   16.37117
3.812111 -4.82309        1.93059   1.089506   0.076516   16.66179
3.812111 -2.59334        1.93059   0.902547   0.478418   2.253239
3.812111 -5.05368        1.93059   0.792429   0.430337   54.53843
0.122778 -2.24509       -3.02588   0.772128    0.46924   15.48269
0.122778 -3.04524       -3.02588   0.772128    0.46924   15.48269
0.122778 -4.84736       -3.02588   0.772128    0.46924   15.48269
                                   0.919988   0.202285   49.03736
1.125444    -2.80801 0.170494      0.797022   0.505363   7.199986
1.125444    -0.11099 0.170494      0.802405   0.463537   10.59122
1.125444    -6.25516 0.170494      1.064528   0.007606   99.95637
0.631111    -1.84469 -0.66403      0.843427    0.38157   12.60424
                                   0.825956   0.440792    65.9385
                                   0.994576   0.285012   45.39842
3.227222    -3.76567    1.690293   0.914125    0.39505   22.95807
    1.509   -6.20431    0.593593   1.045027   0.108624   26.21331
    1.509   -5.54007    0.593593   0.745414   0.499787   7.747971
    1.509   -5.22589    0.593593   0.228133   0.485034   30.91907
0.188889    -2.12655    -2.40439   0.878254   0.487603   25.98989
0.376556       -1.791   -1.40907   1.039763   0.054133   113.7363
0.376556     -1.2383    -1.40907   1.047868   0.115558   35.70122
0.376556    -0.64976    -1.40907   0.911844   0.182277   29.69475
3.802778    -1.44127    1.927054   0.869846   0.330573   6.908147
0.294333    -3.46801    -1.76448   0.897584    0.32794    9.68881
    0.065   -5.40329    -3.94342    0.93734   0.364826   13.21519
    0.065   -1.84976    -3.94342   1.072161   0.060218   54.67759
    0.065   -1.36522    -3.94342   0.932541    0.19281    65.2917
    3.861    -7.3269    1.948975   0.977244   0.394017   10.54665
    9.381  -0.5728 3.229742 0.94073 0.318483 32.42963
0.389444   -1.9483 -1.36051 1.026253 -0.23706 61.62323
0.389444 -4.66487 -1.36051 0.778172 0.365543 35.1446
0.389444 -6.55509 -1.36051 0.778172 0.365543 35.1446
0.389444 -4.63904 -1.36051 0.956277 0.279516 9.601381
3.831222   -4.4195 1.937805 1.106082 -0.33395 25.04319
3.831222 -4.40646 1.937805 1.016959 0.114772 124.7983
3.831222 -0.42762 1.937805 0.981556 0.390636 2.30516
1.237778 -4.40055 0.307753 1.101369 -0.21352 11.25153
1.237778 -5.00975 0.307753 0.825898 0.529505 10.93638
1.237778 -4.83997 0.307753 0.922669 0.42154       9.1484
1.322778 0.315747 0.403571 1.004671 0.279849 5.235179
1.322778 0.525682 0.403571 0.988725 0.299983 29.03537
1.322778 -0.32133 0.403571 1.005831 0.374569 35.18864
0.436111 -1.14207 -1.19723 0.867097 0.326959 87.57905
0.436111 -1.10014 -1.19723 1.032347 0.103197 10.47579
0.436111 -4.29196 -1.19723 1.037764 0.00604 27.52834
3.498778 -4.07564 1.806851 0.535499 0.529439 50.48552
1.088444 -2.48046 0.122267 1.053119 0.064275 19.26248
1.088444 -3.04052 0.122267         -1       10        -1
1.088444 -5.88332 0.122267 1.030505 0.190599 10.48396
0.986667 -0.44123 -0.01937 0.608012 0.495178 13.05904
0.986667 -6.38428 -0.01937 1.005861 0.149034 16.20652
0.986667 -3.07673 -0.01937 0.807703 0.504148 3.500583
0.986667   -4.6172 -0.01937 0.736691 0.493202 14.88177
2.643222 -5.01616 1.402298 0.773729 0.440383 125.9437
1.412889 -0.67738 0.498648 1.029747 0.139074 16.18265
1.412889 -1.85145 0.498648 0.952518 0.390566 20.79974
1.412889 -0.73125 0.498648 0.812295 0.467166 29.21385
1.173778 -1.16619 0.23116 0.983437 0.547186 32.10572
1.863222   -5.8647    0.8978 0.809778 0.492872 17.42621
0.156111   -4.9147 -2.67935 0.884155 0.245451 84.52593
0.300111 -2.97941 -1.73643 1.004907 0.139222 19.37321
0.300111 -0.01597 -1.73643 1.020809 0.257413 8.296562
0.300111 -0.91866 -1.73643 1.041366 -0.31705 153.8398
0.527667   -0.5402   -0.9223 1.04415 0.135286 32.42528
0.527667 -7.83651    -0.9223 0.951763 0.282927 49.18989
0.527667 -1.48945    -0.9223 1.049618 0.246756 6.695861
0.942333 -7.57433 -0.08569 0.905331 0.175973 47.68569
2.848444 -4.58728 1.510174 0.943724 0.217757 23.62873
1.140444 -5.36936 0.189596 1.038001 0.125119 26.01931
1.140444 -2.18809 0.189596 1.038001 0.125119 26.01931
1.140444 -3.14025 0.189596 1.011072 0.174617 22.70649
1.140444 -3.04217 0.189596 0.994944 0.257016 14.33961
0.931222 -3.98346    -0.1028 0.888061 0.266382 15.99987
0.499556 -2.36263 -1.00128 1.006591 0.169795 210.108
1.282667 -5.51356 0.359147 1.046862 0.108415 49.21894
1.282667 -4.29506 0.359147 0.980785 -0.04287 93.8854
1.282667 -3.34711 0.359147 0.931342 0.375824 15.98933
2.872889 -5.08821 1.522502 1.046254 0.140541 12.09868
2.872889 -4.05026 1.522502 0.700933 0.543403 3.105024
2.872889   -1.4127 1.522502 0.834636 0.488006 14.44169
0.435556 -3.46373 -1.19907 0.924214 0.326902 22.52743
0.435556 -5.67713 -1.19907 1.023703 0.181379 6.946427
0.435556 -2.33598 -1.19907 1.012952 0.272468 8.34036
1.494333 -3.11429 0.579502 0.563093 0.636321 29.7429
1.494333 -2.18582 0.579502 1.003289 0.216491 4.614409
1.494333   -3.0014 0.579502 1.025314 0.279054 11.77618
0.304556 -4.90699 -1.71522 1.000544 0.285648 109.762
0.304556 -4.66761 -1.71522 1.066337      -0.0996 45.27347
0.304556 -2.96998 -1.71522 1.052489 0.367707 2.689309
0.755111 -6.70544 -0.40524 0.697135 0.532131 22.32025
1.104889 -3.24482 0.143901 0.747334 0.474593 6.561055
0.913444 -4.84394 -0.13061 0.526928 0.641406 3.21885
     1.08 -1.74974 0.111031 0.84864 0.552887 8.618922
2.132111 -5.11644 1.092283 0.875549 0.41548 53.5082
1.157889 -5.77333 0.211497 1.105063 0.063577 6.917158
1.157889   -5.4614 0.211497 0.986409 0.237854 16.09854
1.157889   -5.4147 0.211497 0.969114 0.057517 24.53769
2.993889 -4.27924 1.582021 0.884221 0.323045 17.4064
0.480111 -3.68537 -1.05856 0.859635 0.345077 121.1419
0.691556 0.142004 -0.53208 0.971993 0.274913 68.41097
1.591556 -6.24555 0.670438 0.760487 0.437709 67.38563
    0.404 -3.37411 -1.30757 0.999853 0.205069 3.354949
    0.404 -3.52332 -1.30757 0.991866 0.392547 158.8464
    0.404 -4.76934 -1.30757 1.057709 0.118887 20.27997
0.767222 -3.64596 -0.38228 1.011517 0.180163 5.234238
                              1.074396 -1.22494 17.0371
0.767222 -3.54112 -0.38228 0.93507 0.33474 9.405383
0.149444 -1.63752 -2.74232 1.049245 0.074489 10.61731
0.149444 -0.60527 -2.74232 0.949252 0.206875 6.992688
0.149444 -4.09352 -2.74232 0.671655 0.564364       23.962
0.661778 -2.57986 -0.59558 0.953165 0.05273 28.2168
0.968889 -5.24578     -0.0456 1.073322 0.090625 6.262294
0.968889 -5.65033     -0.0456 0.993406 0.153554 13.69878
0.968889 -4.31749     -0.0456 0.956641 0.260155 11.86051
1.088889 -3.88444 0.122857 0.870392 0.344201 14.54369
1.088889 -2.33571 0.122857 0.992036 0.468343 13.26389
1.088889 -3.91921 0.122857 0.954297 0.189439 5.945162
5.420444 -6.13241 2.438411 0.703393 0.523971 12.11672
1.302667 -2.82554 0.381468 1.06074 0.375707 18.97311
1.302667 -1.96437 0.381468 0.878996 0.364852 3.872194
1.302667 -2.35913 0.381468 0.757507 -0.84922 86.45176
1.564556      -6.03 0.645753 0.935746 0.207555 22.66501
0.582667 -2.74852 -0.77926 1.027933 0.261599       24.793
0.582667 -4.75822 -0.77926 0.949765 0.212873 206.7504
0.582667 -3.09413 -0.77926 1.026551 0.155613 7.935418
0.506667 -5.70075 -0.98089 1.037826 0.175221 34.30751
0.506667 -5.54206 -0.98089 0.94992 0.230343 52.93231
0.506667 -5.27835 -0.98089 0.927775 0.246169 22.31014
5.108889 -1.47092 2.35301 0.847337 0.316439 24.73222
0.567667 -2.48963 -0.81688 0.963982 0.21176 9.356055
0.567667 -3.19135 -0.81688 0.855657 0.536813 15.28131
0.567667 -6.50369 -0.81688 1.012137 0.246848 22.6879
1.676556    -1.81207    0.745501   0.958108   0.205923    25.64503
0.693444    -5.10351    -0.52815   0.954852   0.242262    3.631792
0.693444    -4.84442    -0.52815    0.90104   0.283771    30.60606
0.693444    -4.21596    -0.52815   0.896815   0.247532    4.362181
0.200444    -3.49322    -2.31873   1.041286    0.38603    2.455301
0.200444    -2.53323    -2.31873   0.893322   0.307855    26.99539
0.200444    -5.19006    -2.31873   0.923305   0.306722    2.321627
    0.256   -5.83034    -1.96578   0.854889   0.361152    14.49426
1.113889     -2.7374    0.155605   0.877232    0.40059    10.59006
1.113889    -3.49286    0.155605         -1          10         -1
1.113889    -5.56467    0.155605   0.990223      0.3302   5.696998
0.940444    -4.88301    -0.08859   1.051322   0.173597    66.94314
    5.141   -1.18049    2.362049   1.033438   0.216065    2.209533
    5.141   -3.73091    2.362049   1.010555   0.352319    0.460993
    5.141   -1.38227    2.362049   0.969711    0.22467    15.24737
0.347222    -4.42779    -1.52607   0.992476   0.261809    43.95524
0.347222    -3.00455    -1.52607    1.04259   0.218436    2.965091
0.347222    -5.49009    -1.52607   0.737605   0.488408    9.416186
0.340111       -5.489   -1.55592   1.049495    0.15991    0.412543
0.340111    -5.61903    -1.55592   1.009087   0.234464    13.17965
0.340111       -4.888   -1.55592   0.832953    0.37243    26.35294
0.077333    -2.76251    -3.69277   0.927606   0.334745    5.844282
0.077333    -5.04986    -3.69277   0.988866    0.26538    1.582614
0.077333    -3.55975    -3.69277   0.988866    0.26538    1.582614
5.009333    -3.86248    2.324619   0.727389   0.565396    29.87271
                                   0.961855   -0.60942    505.5099
2.082667    -4.03881    1.058432   0.921421   0.279318    6.627953
2.082667    -4.03592    1.058432   0.980749   0.114648     51.9833
1.426778    -4.95537    0.512761   0.876782    0.44467    61.26676
1.984889    -2.07966    0.989058   0.815473   0.410336    21.28989
0.207111     -1.8873    -2.27152   0.993034   0.363235    66.50981
0.084556    -2.86859    -3.56396   0.953849    0.14012    33.45892
0.119556    -2.57218    -3.06425   0.856574   0.217569    44.86468
0.598778    -4.78437    -0.73991   0.695034   0.541658    7.119893
0.467222    -4.95924    -1.09782   1.001675   0.160635    14.03336
7.087111    -1.89788    2.825198   0.956421   0.226447    10.73034
0.697333    -3.09211    -0.52008   0.895058   0.429605    50.97893
    1.236   -1.20581    0.305679    0.99291   0.242551    4.826147
    1.236   -1.45907    0.305679   0.811076   0.524322    6.326692
    1.236   -0.18724    0.305679   1.021719   0.453561     9.72562
    0.704    -4.5406    -0.50635   0.806391   0.361161    39.88503
    0.144   -3.07268    -2.79586   0.870914   0.363005    6.044669
0.248889    -2.35185    -2.00643   0.999108   0.459174    8.517263
0.248889    -2.64753    -2.00643   0.937053   0.231119    32.87552
0.248889    -3.98363    -2.00643   0.665672   0.642228    30.05986
0.798222    -6.07541    -0.32514   0.683143   0.426902    61.81257
1.404889    -3.72349    0.490456   0.878762   0.481777    75.58846
0.062667    -5.19136    -3.99616   0.957922   0.228583    16.52401
0.062667    -3.50567    -3.99616   0.987269   0.327445     17.1874
0.062667    -2.10155    -3.99616   1.002866    0.21193    13.46513
0.167111    -2.06838    -2.58112   1.022165   0.153874    64.39741
0.167111     -1.2712    -2.58112   0.789363   0.439314    4.403249
0.167111    -4.98613   -2.58112     0.92308    0.318443    11.24276
0.255667    -3.66726   -1.96766    0.771539    0.414161    20.24888
0.598222    -2.68564   -0.74125       1.0198   0.201987    42.47324
0.598222    -4.84721   -0.74125    0.889343     0.34209    180.0173
0.598222    -6.68071   -0.74125    0.862794    0.401533     4.31377
0.917333    -5.83907   -0.12448    0.840258     0.44984    19.50054
0.917333    -4.39181   -0.12448    0.688942    0.489511    3.827953
0.917333    -2.43507   -0.12448    1.006381    0.137598    10.84925
2.705444    -1.57176   1.435865    0.828376    0.343943    6.655767
    0.465   -0.75683     -1.1047   0.993522    0.129313    152.7781
16.65067    1.193475   4.057508    1.044214    0.389256    3.610185
16.65067    1.125426   4.057508    1.002308       0.2006    7.00953
16.65067    1.559346   4.057508     1.03131    0.356837    143.8374
0.267111    -3.93814   -1.90449    1.032457    0.080359    55.32076
0.255556    0.159811   -1.96829    1.011968    0.414844    158.9615
1.515111    -5.21794   0.599423    0.770948    0.352604    13.45023
1.175111    -1.84243   0.232797    0.759502     0.52785    11.65601
                                          -1          10         -1
                                          -1          10         -1
    0.361 -4.47046 -1.46993        0.839203    0.306399    12.25609
2.217778 0.234393 1.149115         1.051739    0.383992    17.14746
2.217778 1.01926 1.149115          1.022098    0.256908     11.3258
2.217778 -2.89799 1.149115          0.90627    0.288858    28.59403
0.718778 -1.78663 -0.47638         1.007812    -0.29738    186.7427
0.718778 -4.35719 -0.47638         0.965729       0.1895   13.33394
0.718778 -1.50024 -0.47638         0.977894    0.409825    8.532542
1.011556 -4.55381 0.016576         0.703925    0.462517    32.26117
0.262222 -4.55603 -1.93114         0.784793    0.433979    2.961514
6.058333   -0.8163 2.598921        0.871113    0.437682     13.6939
6.058333   -3.3495 2.598921        1.062807    0.241007    5.724921
                                          -1          10         -1
0.513444    -1.14866   -0.96172    0.768332    0.645689    57.92195
1.197333    -4.30104   0.259824    0.891073    0.337783    125.1248
    0.164   -5.37689   -2.60823    0.821874    0.404244    60.41795
0.401778    -0.56085   -1.31553    0.835702    0.401482    0.328702
0.581778    -1.41914   -0.78146    1.090762    0.151178    5.873423
0.581778    -4.32732   -0.78146    0.916126    0.309925    21.14063
0.581778    -3.97974   -0.78146    0.965659     0.23905    44.07756
0.262778    -5.18353   -1.92808    0.920617     0.21623    34.54321
0.202778    -4.75805   -2.30203    0.808676    0.455456    31.89655
0.202778    -3.87346   -2.30203       1.0224   0.278548     22.6258
0.202778    -3.29542   -2.30203    0.931672    0.231736    36.95085
1.848889    -5.06379   0.886659    0.822553    0.378664    34.12096
3.807667     -1.7912   1.928907    1.016769    0.082827    14.31158
2.631222    -0.91446   1.395733    0.980923    0.101896    72.64307
2.631222    -2.53317   1.395733    1.007045     0.31829    24.57454
2.631222    -4.57306   1.395733    0.912134    0.270211    10.21341
1.469333    -1.63661   0.555161    0.961439    0.308848    12.85019
2.728444    -5.34436   1.448078    0.889351    0.392365    13.10586
2.728444    -6.35551   1.448078    0.860064    0.359746    8.697088
2.728444    -4.47479   1.448078    0.869399    0.450814    2.927907
1.661778    -2.62304   0.732728    0.918463    0.517919    67.87358
1.661778    -3.60882   0.732728   0.938359     0.28691    15.25315
1.661778    -2.31407   0.732728   0.872263    0.356078    27.33567
0.306222    -3.74645   -1.70735   0.878564    0.351525    22.48104
0.306222    -4.49228   -1.70735   0.990168    0.256907    12.45724
0.306222    -2.21022   -1.70735   0.942723    0.361031    7.610004
1.496556    -4.70672   0.581646   0.892005    0.339413    3.297777
5.721778    -2.01717   2.516464   0.853479    0.453183    89.69692
2.028444    -2.04932   1.020373   0.806277    0.393774    19.20983
0.386778    -1.03171   -1.37042    1.06425    0.121326    14.58945
0.386778    -0.73915   -1.37042   0.997462       0.2361   15.52022
0.386778    -1.06464   -1.37042   0.897745    0.275265    24.92435
4.047111    -4.55827   2.016892   0.834183    0.248484    86.18972
    0.496   -4.36278   -1.01159   0.823477     0.42053    4.409683
0.915111    -3.07823   -0.12798   1.004985    0.246099    14.96305
0.915111    -1.48734   -0.12798   0.810354    0.504041    8.271881
                                  0.504734    0.620702    9.125214
2.391556 -0.40942 1.25795         0.855082    0.455622    24.06373
2.391556 -0.50298 1.25795          1.01312    0.259955     8.24889
2.391556 -1.12634 1.25795                -1          10         -1
1.296556 -4.81296 0.374685        0.522885    0.469112    11.44035
6.287222 -1.08529 2.652423        1.032289    0.298716     5.53119
6.287222 -0.73021 2.652423        0.891101    0.413324    26.07688
6.287222 -1.57417 2.652423        0.932034    0.382867    2.692005
1.658222 -1.52242 0.729637        0.976534    0.288204    6.122599
1.658222 -3.91867 0.729637        0.972943    0.180242    29.81597
1.658222 -1.13701 0.729637        0.974647    0.365013    5.659553
    9.984 -0.35332 3.319618       0.997691    0.361363     1.74203
    9.984 -4.76772 3.319618       0.981991    0.378492    6.998449
    9.984 0.618178 3.319618       0.953449    0.218767    26.98778
        5   -1.2302 2.321928      0.979722    0.140377    7.125429
0.603222 -0.44996 -0.72924        1.004286     0.47012    6.091804
0.603222 -0.69125 -0.72924        0.956902    0.500683     7.07798
0.603222 -0.09511 -0.72924        0.898673    0.317662     3.43854
0.335667 -1.21765     -1.5749     1.040704    0.275656    8.250725
0.335667    -0.9209   -1.5749     0.982718    0.297578     8.34975
0.335667 -2.33281     -1.5749     0.930794     0.43281    0.067599
5.101778 -0.98216       2.351     0.757209    0.606268    6.952165
1.808444    -1.1553 0.854749      0.964658    0.424864    23.33092
0.080444 -2.24483 -3.63586        0.998234    0.290927    24.87643
0.080444 -0.86974 -3.63586           0.9316    0.40943    41.63612
0.080444 -2.72592 -3.63586        0.678369    0.439718     61.3588
0.462667 -2.22757 -1.11195        0.986367    0.236401    15.09547
0.462667 -3.50966 -1.11195        0.965468    0.163007    28.85585
0.462667 -5.14603 -1.11195        0.881545    0.316532    51.16736
4.765444 -3.42613 2.252611        0.947222    0.245642    11.77759
6.907222 -3.31015 2.788106        1.021471    0.116621    81.49438
6.907222    -2.0138 2.788106      0.957597    0.403781    2.096837
6.907222 -0.77647 2.788106        0.999864    0.278923    13.23853
0.319556 -0.11026 -1.64586        1.029863    0.388726    31.47304
0.319556 -0.52445 -1.64586        0.983023    0.296038    5.097488
0.319556       -0.96 -1.64586     1.018999    0.519321    16.73992
0.728889 -1.69302 -0.45623        0.971042    0.141743    23.01138
0.728889    -0.59712    -0.45623    1.033993   0.323029   10.82401
0.728889    -0.44588    -0.45623    1.013282   0.365752   6.631607
10.90944    -3.88068    3.447505    0.842244   0.325878   11.00878
    2.921     -1.4593   1.546462    0.951567   0.458627   16.54679
    2.921   -1.08652    1.546462    0.976286   0.461236   14.34061
    2.921   -2.54099    1.546462     0.80949   0.466346    3.21978
    2.136   -4.31201    1.094912    0.660206   0.527359   7.316947
    2.136   -0.33225    1.094912          -1         10         -1
    2.136   -1.95939    1.094912    0.964525   0.251395   7.590873
3.875556    -3.23433    1.954403    1.023539   0.133515   14.19573
3.875556    -3.10383    1.954403    1.003104    0.11038   6.899268
3.875556    -3.37585    1.954403    0.979329   0.160874   48.19917
12.76233    -0.13884     3.67382    1.007911   0.166964   15.30093
12.76233    -0.08342     3.67382    1.029272   0.183838   11.24245
12.76233    -2.95735     3.67382    1.011661   0.172682   135.3895
0.148889    -4.62338    -2.74769    0.788656   0.443673   3.327806
1.363222    -3.25731    0.447021    0.855746   0.396566   31.33104
1.363222    -4.55752    0.447021    1.007708   0.209599   17.67703
1.363222    -2.55031    0.447021    1.039169   0.134392    33.0872
0.667111    0.357721       -0.584   0.718079   0.675895   55.08076
1.646222       -4.175   0.719159    0.996586   -0.13598   128.4989
0.801778    -0.85347    -0.31873    0.935439   0.314348   111.0334
0.673444    -5.85977    -0.57037    0.929502   0.356394   14.42077
0.171222      -1.9256   -2.54606    0.960937   0.225585   7.466083
0.171222    -2.76532    -2.54606    1.062863   0.077373   60.66332
0.171222    -2.64688    -2.54606    0.919214   0.306329   219.0755
2.344889    0.357377     1.22952    1.003987   0.286111   36.97652
0.649889    -2.79991    -0.62173     0.93788   0.369505   118.2693
0.649889      -1.7301   -0.62173     1.01922   0.204962    35.7826
0.649889    -3.74592    -0.62173    0.932278   0.336021   7.501174
0.496556    -3.73189    -1.00997    0.634884   0.440845   1.853161
8.869333     1.22591    3.148826    0.946253   0.298352   13.24652
8.869333    1.612931    3.148826    0.927048   0.453053   20.20367
8.869333    -0.34996    3.148826     0.99081   0.274547    32.3295
0.373889    -2.32528    -1.41932    0.953489   0.361224   185.2021
1.286778    -6.05393    0.363763    0.911426   0.315554   27.09271
    1.981     -4.2563   0.986229     0.93932   0.122264   21.41658
3.675667    0.465705    1.878006    0.998079   0.065999   25.51403
2.841778    1.084841    1.506794    0.879654   0.412344   5.399593
2.841778    -4.65397    1.506794    0.609228   0.640201   16.72214
2.841778    1.709094    1.506794    0.934101   0.413741   10.19816
4.611667    0.270782    2.205288    0.888765   0.529925   7.178583
4.611667    0.181264    2.205288          -1         10         -1
                                    1.045427   -0.53257   85.06473
5.928444 -0.74937 2.567654          0.695591   0.548306   44.01393
5.928444 1.310859 2.567654          0.956031   0.487445   0.506362
5.928444 0.467371 2.567654          0.999825   0.317459   12.68782
0.474333    0.2454 -1.07603         0.987598   0.337642    17.5264
0.474333 0.614151 -1.07603          1.012314   0.373556   6.646993
0.474333 -2.93407 -1.07603          0.911544   0.202566   38.98032
1.472889 -2.27757 0.558649           1.03061   0.367827   6.849394
                                    0.743269   0.515006   23.78945
1.472889    -1.23914   0.558649   1.010144   0.351281    2.916632
2.555556     -6.9071   1.353637   0.907873   0.399267    32.24105
2.555556    -5.00323   1.353637   1.107583   -0.12029    6.659172
2.555556    -1.84148   1.353637   1.046957   0.209362    5.856708
1.246222    -3.01229   0.317561   0.759836   0.377891     69.1369
1.959556    -6.34413   0.970527   0.680678   0.537966     4.18566
1.959556    -4.00879   0.970527   0.680678   0.537966     4.18566
0.788444    -3.60271   -0.34292   0.899765   0.502571    70.97214
0.788444    -0.41027   -0.34292   1.001857   0.218821    7.755693
0.788444    -5.94381   -0.34292    0.92985   0.232787    2.591188
0.961778    -1.21273   -0.05622   0.895017    0.36962    70.15794
0.961778    -6.56242   -0.05622   0.980438      0.1789   12.95953
0.961778    -0.75753   -0.05622   0.925974   0.304868    14.84908
2.923222    -7.44618   1.547559    0.69017   0.227464    23.70175
11.75333    -1.62351   3.554998   0.906703   0.300333    1.240881
                                  0.936239   -0.83288    61.65599
0.162222 -1.08995 -2.62396        0.892319   0.458943    24.14121
4.504889 -4.01591 2.171492         0.66232   0.429034    10.45281
9.662333 1.174911 3.272372        0.627129    0.46622    28.33158
0.985444 -4.55449 -0.02115        0.926988   0.275711    17.43165
0.985444 -3.87117 -0.02115        1.335639   -0.60549    33.30773
0.985444 -1.42739 -0.02115        0.684915   0.548668    17.54067
0.925444 -4.93518 -0.11178        0.394895   0.229884    40.77787
1.004444 -5.99105 0.006397         0.84773      0.3361   3.715238
1.004444 -4.55644 0.006397        0.972565   0.171914    59.29862
1.004444 -4.90334 0.006397        0.666485   0.460913    24.12517
4.504889 -4.24307 2.171492        0.812573   0.477118    16.67477
0.711556 -1.25593 -0.49095        1.061956    0.03617    44.97264
0.711556 -2.30745 -0.49095        0.997794   0.267429    59.55772
    0.724 -2.97087 -0.46594       0.829061    0.43249    21.83149
1.734333 -4.89842 0.794381        1.093135   0.102178    6.338316
1.734333 -1.76624 0.794381        1.034211   0.165105    17.25531
6.449444 -0.27137 2.689175        0.792242   0.480243    7.448712
0.795667 -2.95538 -0.32976        0.799296   0.418444    11.06365
0.795667 -1.42059 -0.32976        0.911499   0.389109    17.48297
0.795667 -4.90442 -0.32976        0.796046   0.514568    43.61011
0.469444 -5.82272 -1.09097        0.763267   0.532051    13.06211
0.469444 -4.68103 -1.09097        0.549835   0.491707    26.26458
0.327111 -5.15677 -1.61215         0.89053    0.35049    28.01713
3.940111 -2.71778 1.978236        0.650178    0.53756    18.95369
3.940111 -5.66466 1.978236        0.650178    0.53756    18.95369
6.133444 -0.65296 2.616697         0.91532   0.419341    93.52014
                                  0.950919   0.210998    71.85024
    0.616   -4.25223    -0.699    0.719564   0.517229    5.754924
    0.616   -6.39876    -0.699    0.712556   0.501182    20.66703
1.636556    -5.42513 0.710663     0.927927    0.20343    32.43423
                                  1.023525   0.161938     16.2996
0.327667 -4.58872   -1.6097       0.732474   0.551257     7.42794
6.449444 -5.92184 2.689175        0.679921   0.499398     46.0097
12.49111 -2.29472 3.64283         0.944817   0.666067    3.982701
12.49111 -0.33262 3.64283         0.830361   0.450989    38.89555
12.49111 0.308866 3.64283         0.905572   0.436954    14.21326
0.212111    -3.86141   -2.23711   0.962638   0.310437   11.88174
8.077889    -1.45032   3.013978   1.020601   0.272917    22.7222
8.077889    -1.31216   3.013978   1.057366    0.08187      57.704
2.132111    -2.83156   1.092283   0.390751   0.620598      15.269
2.165444     -2.3846   1.114663   0.890749    0.41651   2.858465
2.165444    -6.07929   1.114663   0.965514   0.277376   11.87086
2.165444    -5.13695   1.114663   0.965514   0.277376   11.87086
0.340111    -5.08105   -1.55592   0.780452   0.478399    5.54233
1.760556    -4.01673   0.816031   0.948018   -0.60589   115.5644
1.760556    -3.93898   0.816031         -1         10          -1
1.760556    -2.05587   0.816031   0.932266   0.435897   3.359353
0.146778    -4.90168   -2.76829   0.606924   0.656937   62.54613
                                        -1         10          -1
1.203222    -3.25074 0.266903           -1         10          -1
1.203222    -4.22975 0.266903     0.974249   -0.88566   16.85146
                                        -1         10          -1
0.289333    -4.38687   -1.7892    1.010703   0.195808   11.29655
0.289333     -4.2734   -1.7892    0.968511   0.219494    25.0658
0.289333    -2.16131   -1.7892          -1         10          -1
0.157889    -3.00735 -2.66302     0.560184   0.442774    34.6984
0.157889    -5.32606 -2.66302     0.893858   0.506938   18.00055
1.636556    -2.95682 0.710663     0.943218   0.086228   28.25993
7.004556    -1.00714 2.808294     0.885175   0.419821   11.15091
    0.265   -1.50113 -1.91594     1.004099   0.272026   25.08291
    0.265   -2.33693 -1.91594     1.070786   -0.02804   34.56965
    0.265   -1.74676 -1.91594     0.989053   0.363995   13.70774
0.068889    -3.43273 -3.85958     1.058863   0.176097   29.75039
                                  0.971894   0.153121   107.9409
10.19611    -1.65187   3.349947   0.918637    0.29188   4.479291
0.372889    -1.44426   -1.42318   1.000757   0.169679   49.02681
2.106667    -2.41942   1.074962   0.584578   0.385294   32.84288
8.382667    -0.41196   3.067409   0.932963   0.554267   163.0042
0.406778    -2.23604   -1.29769   0.741592   0.481292   73.38893
0.802667    -5.04872   -0.31713   0.988916   0.285976   17.13998
1.142778    -4.91096   0.192545   0.201648    0.50575   19.95661
                                        -1         10          -1
0.217889 -3.31826 -2.19834        0.965062    0.26988   23.78548
0.217889 -4.45468 -2.19834        0.800891   0.480229   52.53352
0.217889 -6.27431 -2.19834        0.923384   0.339031   12.05473
3.517889 -3.03861 1.81471         0.906044   0.287555    20.9501
3.517889 -4.80946 1.81471         1.040306   0.250236   4.886061
3.517889 -3.00353 1.81471         0.856826   0.341388   6.658317
    3.464   -0.1133 1.792439      0.988405   0.273944   7.247958
    3.464 0.767387 1.792439       0.957204   0.209216   8.210195
    3.464 1.777754 1.792439       0.866149   0.391762   13.19707
1.142778 -1.79836 0.192545        0.779661   0.550944   1.285417
13.56544 -1.61599 3.761864        1.082586   0.058237   5.833535
13.56544 -4.54566 3.761864        0.975056   -0.32915   391.0415
13.56544 -2.05091 3.761864        0.909638   0.253122   14.12089
4.533778 0.066723 2.180714        0.864972   0.511129   161.1047
0.382778 -5.66189 -1.38542        0.797278   0.372238   7.590958
0.382778 -5.61174 -1.38542        0.797278   0.372238   7.590958
0.382778    -1.25419   -1.38542   0.945835    0.273061    5.250096
0.382778    -4.01004   -1.38542    1.10732    -0.29692    98.57596
2.556556    -3.04024   1.354202    1.00943    -0.22069    60.60814
0.507111    -0.92388   -0.97963   0.660384    0.456532     0.87231
9.222667     -0.0866   3.205184    0.91593       0.5197   18.39121
0.454333    -0.38879   -1.13818   0.798956    0.429519    2.913315
0.454333    -5.50419   -1.13818   0.798956    0.429519    2.913315
0.454333     -3.5739   -1.13818   0.971557    0.240101    10.16342
    1.336    -4.8968    0.41792   0.934217     0.41875     113.217
0.099556    -4.00577   -3.32835   0.899945    0.308362    33.88815
0.099556    -5.04555   -3.32835   0.969571    0.194342    22.50538
0.099556    -5.58373   -3.32835   0.689508    0.533658    50.92321
    8.685   -1.16311   3.118526    0.60163    0.534216    5.831369
0.273889    -2.14855   -1.86834   0.854048    0.499563    27.76968
0.325444     -1.3275   -1.61952    1.04695    -0.11871     83.5635
0.325444    -2.42354   -1.61952   0.772873    0.535614    17.00471
3.284556    -0.93964   1.715698    0.87823    0.326557    48.46795
7.004556    -3.54149   2.808294   0.840086    0.356014     10.3413
                                         -1          10         -1
0.417778    -6.33416 -1.25919     0.875703    0.315896    37.31018
0.417778    -5.27963 -1.25919     0.875703    0.315896    37.31018
0.465444    -3.87196 -1.10332      0.36869    0.615416     48.6384
1.693333    -2.54983 0.759866     0.757351    0.379991    26.36514
                                   1.01993    -0.15677    191.8139
0.326667    -2.10981   -1.61411   1.040279     0.44872    3.288517
0.326667    -5.70822   -1.61411   0.390337    0.426455    35.86615
0.326667    -2.41335   -1.61411   0.912289    0.450186    7.265393
                                         -1          10         -1
                                         -1          10         -1
                                         -1          10         -1
0.992111    -2.53726 -0.01143     0.638725    0.516341    2.396112
1.413444    -1.69684 0.499215     0.577146    0.581821    1.537798
3.157333     -5.7394 1.658706     0.358296    0.212519    63.40213
                                  0.962895    -0.69919     187.425
2.810667   -2.6372 1.490913       0.848965    0.462459    3.822092
2.810667   -1.7628 1.490913       1.166426    -0.09157    22.51342
13.56544 -3.76601 3.761864        0.300017    0.281791    9.976158
1.584556 0.117853 0.664079        1.029755    0.413798     34.1582
1.584556 -1.43263 0.664079        0.893832    0.435414    51.79159
1.584556   -2.3843 0.664079       0.857301    0.484388    52.22846
5.256556    0.3261 2.394118       0.792772    0.573837    3.450271
9.820444 0.00111 3.295788         0.977879    0.455327    26.30264
0.138333 -4.82727 -2.85378        0.594293     0.50741    28.99284
0.311556 -4.03387 -1.68244        0.846917    0.366135    273.1543
0.942333 -4.63756 -0.08569         0.83137    0.446284    46.73434
4.145444   -0.4486 2.051527          1.0386   0.416047     19.5066
4.145444 -2.36489 2.051527        0.694228    0.361029    28.24811
4.145444 1.308889 2.051527               -1          10         -1
3.561778 -2.25541 1.832598         0.46465    0.515995    5.303095
1.312111 -1.07344 0.39189         1.096835    0.112453    32.23415
0.371667 1.170731 -1.42792        0.844945    0.493072    7.908682
0.371667    -5.40432   -1.42792 1.145484    -0.26538     14.7177
0.371667    -2.00685   -1.42792 1.051861    0.306476    17.37027
0.186778     -6.0775   -2.42061 0.937958    0.345752    5.430619
0.186778    -3.85526   -2.42061 0.428274    0.511407    1.535826
4.096111    -2.88513   2.034255 0.815129    0.412134    1.454751
4.096111    -2.53856   2.034255 0.959217    0.260368    26.54006
4.096111    -4.79661   2.034255 0.759714    0.347444    27.94584
0.389444    -1.37433   -1.36051        -1          10         -1
0.389444    -2.65235   -1.36051        -1          10         -1
0.389444    -5.45455   -1.36051  0.96116    0.246854     25.6632
0.186222    -3.60125     -2.42490.871717    0.540688    7.750416
0.186222    -3.75494     -2.42490.766243    0.472845    26.50574
2.923222    -3.62955   1.547559 0.969709    0.333291    66.39194
0.194333    -3.36192   -2.36339 0.932486    0.366717    20.34098
1.213333    -5.45571   0.278976 0.478682    0.641112     43.9731
0.082222     -5.8364   -3.60433 0.583159    0.585126    5.107555
0.098222    -1.52027   -3.34781 0.899842    0.326896    14.64571
0.098222     -2.3934   -3.34781 0.845383    -0.02955    203.1764
0.033444    -4.21257   -4.90209 0.877347    0.406469    20.92727
2.986778    -3.82793    1.57859 0.854893    0.519387    46.58935
0.089333    -5.13091   -3.48466 0.943895    0.106767    31.47886
0.302667    -4.00936     -1.72420.390177    0.476643    29.67607
     0.08   -1.17725   -3.64386 0.981685    0.241768    14.01268
0.645444    -4.31959   -0.63164 0.701389    0.531932    11.20397
     0.08   -2.60008   -3.64386 0.811853    0.433003    4.314183
2.525444    -3.22668   1.336537 0.983535    0.274956    114.4145
    0.644   -2.98406   -0.63487 0.597396     0.39089    56.93204
1.095111    -5.34257   0.131077 0.817258     0.46261    8.684171
1.095111    -5.20007   0.131077 0.942746    0.187873    10.57911
1.095111    -2.83798   0.131077 0.832858    0.356492    65.97534
1.317778    -0.83783   0.398107 1.023843    0.200561    12.50633
0.241778    -2.28207   -2.04825 1.069404    -0.02036     88.9955
0.241778    -1.85356   -2.04825 0.922043    0.322591    12.60934
0.764444     -4.9716   -0.38752 0.936719       0.2676   28.95804
2.072889    -3.73028   1.051643 0.452941    0.501334    9.786036
    0.649   -4.73521   -0.62371 0.696076    0.391083    21.70366
1.181778    -2.35144   0.240959 0.707735    0.512846    15.01514
3.933444    -4.21081   1.975793 0.854166    0.323885    13.89333
1.432111    -1.90361   0.518143  0.80476    0.526379    40.46457
7.291111    -0.21815   2.866139 0.962459    0.355359    48.08787
0.783222    -4.29507   -0.35251 0.665301    0.470296    22.92124
0.940111    -1.75216     -0.08910.578513    0.584802    11.04082
0.940111    -1.07477     -0.08911.006593    0.310584    15.09443
0.940111    -4.70663     -0.08911.011753    -0.09624    23.34503
1.181778    -4.64914   0.240959 0.409378    0.477124    32.56955
1.181778    -2.18323   0.240959 0.677639    0.492944    6.466866
0.566667    -7.40488   -0.81943 0.862834    0.380515    196.2589
                                0.892771    -0.45354    159.4354
                                0.969131    0.397147    75.66658
0.244444    -6.11542   -2.03242    0.2422   0.565779    10.29008
0.292111    -3.03413   -1.77541 0.830794    0.297345    20.42692
0.188444    -1.42269   -2.40779 0.861434    0.276506    88.13879
0.611667    -2.34582    -0.70918    1.009114    0.212315    29.09075
1.691111    -5.26931    0.757971    0.861145    0.436569     13.2638
2.120556      -3.1488   1.084443    0.853456    0.355628     51.4942
    3.961   -0.12829    1.985865    0.807538    0.512645       10.286
0.053444    -6.15267    -4.22582    0.626025    0.341275    44.97972
0.053444    -3.12741    -4.22582    0.871657    0.271013    10.04013
    4.244   1.095465    2.085425    1.025878    0.358522    15.69432
    4.244   1.556125    2.085425    1.041945     0.23942    6.650705
    4.244   -4.32946    2.085425    0.891415    0.280623    70.58565
0.139556    0.680051    -2.84109    0.976516       0.4697   15.22926
0.148444    -5.41652    -2.75201    0.544618    0.600901    5.655447
0.148444    -4.55722    -2.75201    0.829927    0.459903     48.2401
1.124889    -4.66861    0.169783    0.604853    0.455699     20.4272
0.875667    -4.19128    -0.19155    0.027426    0.467954    177.3054
0.875667    -3.55543    -0.19155    0.919586    0.373589    5.016519
0.080444    -1.81292    -3.63586     0.73034    0.500177    3.857545
0.080444    -6.54767    -3.63586    0.683572     0.43449    4.723769
0.080556    -6.71284    -3.63387    0.856682    0.317145    95.09748
0.443222    -3.41369      -1.1739   0.873099    0.243226    22.91151
0.107667    -3.29901    -3.21536    0.880949    0.337266    6.133297
0.530667    -6.60818    -0.91412    0.822152    0.416781    59.04467
0.530667    -5.61297    -0.91412    0.777636       0.4189   0.368738
0.053889    -4.14795    -4.21387    0.659838    0.515256    27.13989
0.040444    -5.49976    -4.62791    0.906235    0.372888    37.26176
0.040444    -4.12552    -4.62791    1.000112    0.256171       29.757
3.500111    -4.98069    1.807401    0.837811    0.401434    19.78911
0.005444    -3.36119       -7.521   0.890653    0.400403    20.84625
    0.461   -1.89856    -1.11716    0.655362    0.450563    18.69254
0.709333    -6.95495    -0.49546    0.928551     0.23979    14.98578
0.709333    -6.03071    -0.49546    0.998813    0.148021    25.60115
4.735111      -0.9537   2.243398    0.614085    0.483992    1.944111
4.735111    1.652025    2.243398       1.0708   0.312693    18.99186
4.735111    0.797702    2.243398    1.045094    0.203891    21.25006
0.171111    -0.82471    -2.54699    1.008385    -0.01904    110.3185
0.171111    -3.90697    -2.54699    0.939621    0.247926    44.34429
0.039556    -6.32053    -4.65998    0.473747    0.518188    26.06273
0.025444    -4.67646    -5.29651    1.082503      -0.1407   92.63242
                                    0.564478    0.477952    25.05742
0.437333    -3.72626    -1.19319    1.009738    0.165542    7.405748
0.437333    -3.80042    -1.19319    0.973481    0.268765     3.87799
0.437333    -6.52449    -1.19319    0.737577    0.492301    8.387753
0.571667    -0.89285    -0.80675    0.976528    0.381654    6.287765
0.571667    -3.82233    -0.80675    0.965409    0.252443    91.10671
0.571667    -0.72668    -0.80675    0.972101    0.346144    5.738913
                                    1.014587      -0.8184   32.09559
                                    1.121783      -0.3094   279.1157
                                    1.001137    -0.88245     8.71793
0.020444     -4.4069    -5.61215    0.957103    0.461932    8.993451
    1.104   -4.64519     0.14274    0.719799    0.464665    10.90402
    1.104   -5.29384     0.14274    0.912376    0.324462    15.47025
    1.104   -4.07009     0.14274    0.785399    0.585928    10.75359
2.762222    -1.15772   1.465829   0.854283    0.370361    38.63661
0.429889    -1.66028   -1.21796   0.949895    0.204215    43.04483
0.429889    -3.37931   -1.21796   0.999135    0.188766    50.33659
4.385444    -1.65348   2.132723   0.899995    0.504366    15.72656
4.385444    -0.72335   2.132723    0.87545    0.479716    23.35623
4.385444    -2.25769   2.132723   0.825743     0.38482    3.069798
                                  0.921738    0.269536    12.02177
0.179556    -5.32505   -2.4775    0.789419    0.470359    12.68975
7.161778    -3.17869 2.840318     1.029425    0.178335    95.80102
0.727667    -5.11646 -0.45865      0.90319     0.32901    25.39901
                                         -1          10          -1
                                         -1          10          -1
                                  0.764562     0.47423       2.9233
                                         -1          10          -1
0.350667    -4.33817 -1.51183     1.009502    0.214731    81.12156
1.574333    -0.46964 0.654741     0.934324    0.330386     73.1609
                                  1.053897    0.109182    124.8064
0.263222    -2.84134 -1.92565     0.921001    0.515681    8.329529
0.263222    -4.68266 -1.92565     0.993264    0.352785    27.44635
0.263222    -4.43861 -1.92565     1.119178    -0.23343    4.632506
1.462778    -4.54705 0.548711     0.963822    0.241898    144.0874
    0.356   -2.43545 -1.49005     0.831411    0.390045    34.05059
    0.256   -5.99545 -1.96578     0.748265       0.5141   6.670803
1.383222    -3.86537 0.468033      0.98779    0.270679    15.80044
0.322778    -4.13589 -1.63139     0.876186    0.374939     8.96107
    0.364   -4.38136 -1.45799     1.081978    -0.19271     9.71491
    0.364   -6.61287 -1.45799     0.765958    0.345696     31.6313
    0.364   -2.53622 -1.45799     1.002566    0.340422     3.84713
                                       0.96   0.233182    15.79954
3.708889     -2.7874   1.890987   1.032565    0.111503    14.55929
3.708889    -3.22156   1.890987   0.902756    0.312824    0.401837
3.708889    -2.98292   1.890987   0.986866    0.248877    4.144358
0.129333    -2.11487   -2.95083   0.897239    0.417839    54.53544
0.342778    -5.52714   -1.54465   0.859138    0.369694       13.139
10.06267    -3.79369   3.330941   1.000086    0.264667    4.038374
0.688889    -2.72377   -0.53766    0.70355    0.432204    38.11053
0.769333    -0.50949   -0.37832   1.030608       0.2039   37.09263
0.769333    -2.52869   -0.37832   1.051641    0.208171    7.516849
0.769333     -1.6043   -0.37832   0.919482    0.318415    4.350736
0.688889    -5.28305   -0.53766   0.941859     0.31177    7.604714
0.582667    -2.69167   -0.77926   0.954607    0.258371    6.897837
0.372111    -4.71211   -1.42619   0.361087    0.509289    11.50845
0.372111     -2.9511   -1.42619   0.361087    0.509289    11.50845
1.197333    -0.62082   0.259824   1.025606    0.137076    11.14646
1.197333    -5.13099   0.259824   1.052305      -0.2467   32.27183
1.197333    -1.28909   0.259824   1.032113    0.496645    0.847608
1.197333    -0.10297   0.259824   1.032113    0.496645    0.847608
1.197333    -3.16723   0.259824   1.089305    0.065624    21.58252
0.117778    -1.87632   -3.08586   0.994256    0.284253    21.96121
3.168889    -1.56929   1.663977    0.78939    0.408599    18.18451
3.168889    -2.11439   1.663977    1.07727    0.020656    34.63438
3.168889     -0.3783   1.663977          -1          10          -1
3.168889    -6.64834    1.663977    1.098856   -0.03372    3.467131
3.168889      -2.1437   1.663977    1.044919   0.219456     5.15734
2.920444    -1.07564    1.546188    0.988211   0.280664    27.88845
2.920444    0.169027    1.546188    0.902817   0.243696    20.17755
2.006778    -0.83384    1.004881     1.11364      0.1824   9.364984
2.006778    -2.78698    1.004881     1.11364      0.1824   9.364984
2.006778    -0.91994    1.004881    0.955378   0.206526    4.185322
2.006778    -2.90601    1.004881    0.955378   0.206526    4.185322
2.006778    -3.26869    1.004881     0.90871   0.275347    54.63479
    0.349   -5.19157      -1.5187   0.860184   0.396326    7.707111
    0.349   -2.30171      -1.5187   0.987772   0.077362    65.87204
    0.349   -0.78573      -1.5187   1.083975   0.237053    26.88271
    0.349   -3.88915      -1.5187   1.006765   0.353756    20.81886
    0.349   -2.92004      -1.5187   0.957936   0.273335    18.35768
2.282222    -4.49213    1.190439    0.843676   0.353579    22.09014
0.151556       -2.185   -2.72208    0.905809   0.497316    12.12812
0.151556    -4.23349    -2.72208    0.963323   0.192667    6.291244
0.151556    -1.71917    -2.72208    1.008606   0.233029    16.19773
0.151556    -5.77753    -2.72208    0.553652   0.598924     7.33105
0.151556    -5.60712    -2.72208     0.89157   0.457769    0.336676
0.227111      -6.1241   -2.13853    1.023445   0.055092    43.78473
0.326222    0.990805    -1.61607    1.019949   0.316452    6.359183
0.326222    -2.68373    -1.61607    1.045673   0.398646    6.887604
0.802333      -6.2777   -0.31773    0.382122   0.611926    53.84812
2.887222    0.369948    1.529682    0.828718   0.394462    48.90378
2.887222    0.967445    1.529682          -1          10         -1
2.887222    1.653113    1.529682          -1          10         -1
1.792111    -1.90822     0.84166    0.902746   0.351111    24.56413
    1.209   -2.31615    0.273814     0.98349    0.26337    3.655167
    1.209   -1.14986    0.273814    1.115456   0.396668    11.60787
0.096111    -6.72508    -3.37915     0.69232   0.442486    26.26016
0.564556    -4.46411    -0.82481     0.83583   0.324959    13.21397
5.587667    0.719328    2.482246    1.015798   0.326351    8.420403
5.587667     0.60308    2.482246    1.167646   0.302411    22.83271
                                     0.76741   0.392893    50.39544
                                    0.322844   0.376746    92.48033
0.417889       -5.572   -1.25881    1.025602   0.052159    45.07219
0.555667    -1.05458    -0.84771    0.885728    0.49179    10.88123
0.555667     -7.2023    -0.84771    0.796268   0.442839    5.319155
                                          -1          10         -1
1.587222    -3.57773    0.666504          -1          10         -1
1.587222     -4.2062    0.666504     1.00178   0.355154    16.39668
1.587222    -1.85145    0.666504    0.945255   0.310019    68.57948
1.073444    -3.75792    0.102247    0.999137   -0.48724    213.3431
1.073444    -1.36634    0.102247     1.05319   0.068991    14.28827
1.073444    -3.33755    0.102247    1.005596   0.255506    49.41484
3.515111    -2.94411     1.81357    0.453908   0.570467    19.11638
3.515111     -2.3652     1.81357    0.978013   0.309605    5.585525
3.515111    -3.42984     1.81357    0.986807   0.158193    16.01803
    0.821   -3.34298    -0.28455    0.860433   0.364413    3.128483
0.520444    -4.00931    -0.94218    1.036081   0.079498    42.02141
0.520444    -2.16861    -0.94218    0.593268   0.464275    23.07087
0.520444    -6.73325   -0.94218    0.914658   0.305779    2.400102
0.762222    -4.92341   -0.39172    0.947786   -0.19965     38.9616
1.822778    -0.92831   0.866139    0.875047   0.473867    4.747904
1.822778    -4.82936   0.866139    1.040559   0.119494    2.585395
1.822778     -1.5017   0.866139    0.880519   0.272246    24.77886
0.175111    -2.49137   -2.51366    0.828193   0.258201    30.58522
0.078222    -5.21361   -3.67628    1.043281   0.095982     13.9576
0.078222    -4.71345   -3.67628     0.94309   0.143834    19.39062
0.078222    -3.99251   -3.67628    0.901728   0.259452    35.52726
0.033889    -5.63225   -4.88304    1.005946      0.1682   3.285548
0.033889    -4.10988   -4.88304    1.032836   0.175344    10.66554
0.033889    -6.30278   -4.88304    0.759545   0.455871    56.89833
3.880444    -3.32174   1.956222    0.954773   0.403329    99.56028
5.662778    -1.15979    2.50151    1.143038   0.316808    14.39024
5.662778    -0.75677    2.50151     0.92627   0.195727       71.869
5.662778    -1.23236    2.50151     0.98121   0.383744    6.738385
1.928444    -0.55477   0.947437          -1          10          -1
1.928444    -1.22161   0.947437    1.069275   0.337033     9.16944
1.928444     -1.4587   0.947437    0.913526   0.407551     15.4471
5.664444    -6.77306   2.501934    0.778762    0.33946    42.97402
0.731556    -3.88451   -0.45096    0.727461   0.398183    19.22344
0.731556    -1.04024   -0.45096     0.85663   0.551769     5.43101
    3.409   -0.84761   1.769349    1.133904   0.139919    32.91566
    3.409   -3.53947   1.769349    1.025737   0.226472    30.07922
    3.409   -5.27125   1.769349    0.751228    0.47391    2.158453
0.098778    -7.48876   -3.33967     0.85455   0.402165    16.28085
2.451111     -2.1868   1.293436    0.628862   0.567682    13.07069
    0.204   -3.36463   -2.29336    0.167215   0.427795    13.40863
0.407222     -6.9529   -1.29611     0.90644   0.303847    3.160021
0.096556    -5.43169     -3.3725   0.656485    0.52314    6.776648
0.021778     -2.3909      -5.521    0.95544   0.268167    51.69709
0.021778    -4.65368      -5.521   0.898426   0.357633    45.42374
0.033778    -4.39388   -4.88778    0.961279   0.239834       1.1492
0.053889    -3.13509   -4.21387    0.544695   0.545451       27.628
                                   0.715141    0.57453    42.19517
3.117889    -1.52502 1.64057             -1          10          -1
3.117889    -7.87493 1.64057       0.601686   0.524878    39.66393
3.117889    -2.30815 1.64057       1.180586   0.103652    8.881771
0.431222    -6.26568   -1.2135     0.715017   0.465119    17.24732
     0.06   -2.44337 -4.05889      0.909223   0.306013    16.15779
     0.06   -5.09058 -4.05889      0.889911   0.400404     61.8589
    1.221   -7.87585 0.288063      1.017494    0.12732    200.7182
0.426778    -4.18529 -1.22844      0.833438   0.433308    3.989407
0.075556    -5.08492 -3.72632      0.929313   0.374219    82.90295
0.075556    -3.36979 -3.72632      0.991084    0.22385     40.8575
    0.064   -4.30688 -3.96578      0.795316   0.351164    18.70235
0.357778    -3.15209 -1.48286      0.658229   0.510572    10.22151
0.047111    -5.88783 -4.40779      0.991705   0.325781    24.46067
0.047111    -6.86355 -4.40779      1.028098   0.073365     20.4714
    0.376   -4.22706   -1.4112     0.889301   0.397396    15.55631
0.091556    -4.67748 -3.44921      0.651402   0.488304    45.94854
    1.969 -5.14579 0.977463 0.895616 0.377386 26.86775
0.144444 -1.44155 -2.79141          -1        10       -1
0.144444 -2.39129 -2.79141          -1        10       -1
0.144444 -6.37157 -2.79141 0.948418       0.2269 180.0521
0.072889 -3.36761 -3.77816 0.941454 0.278793 59.96587
0.802667   -4.3816 -0.31713 0.897898 0.263504 38.82511
0.802667 -3.08783 -0.31713 0.853065 0.530437 3.07974
0.802667 -6.04158 -0.31713 1.011073 0.290382 37.26864
6.271667 -5.50903 2.648849 0.849401 0.401167 20.67264
6.271667 -6.13939 2.648849 0.729382 0.448249 2.317437
    0.064 -4.75129 -3.96578 0.97642 0.162314 46.11907
0.060111 -1.78837 -4.05622 1.007126 0.292304 11.9586
0.060111 -2.53452 -4.05622 0.710507 0.602951 8.849071
0.060111 -2.83939 -4.05622 0.978365 0.21514 38.28566
0.602778 -4.73498    -0.7303 0.896133 0.540851     38.024
0.167111 -5.36649 -2.58112 0.644505 0.468537 87.28784
    0.325  -1.1683 -1.62149 0.987578 0.391414 6.92417
0.304444 -1.96774 -1.71575 0.993184 0.30947 7.770456
0.304444     -2.499 -1.71575 0.604222 0.580373 8.014185
0.582667 -5.29155 -0.77926 0.846879 0.335776 42.18357
2.273444 -5.29716 1.184879 0.84201 0.410907 21.47359
2.293778 -4.28841 1.197726 0.244503 0.622928 9.784958
2.293778 -2.48951 1.197726 0.854544 0.38207 32.44674
3.138778 -2.62873 1.650203 0.670636 0.586361 92.8584
0.714333 -3.31217 -0.48533 0.851935 0.41233 52.9378
0.714333 -0.76852 -0.48533 0.920416 0.356411 3.173116
0.714333 -4.82681 -0.48533 0.869845 0.275679 16.17294
0.044444 -3.75493 -4.49185      0.9583 0.416806 17.28146
4.155111 -5.17848 2.054887 0.628993 0.574914 44.79724
4.155111 -4.79116 2.054887 0.839372 0.419009 10.8361
4.155111 -5.71295 2.054887 1.05472 -0.01143 16.53299
    0.869 -5.90384 -0.20257 0.187115 0.723586 95.07305
0.022667 -4.16699 -5.46328 1.004034 0.178831 29.34206
0.091556 -6.03633 -3.44921 0.670997 0.529317 5.289337
0.180111 -5.93917 -2.47304 1.020448 0.139797 21.46813
0.180111 -6.50446 -2.47304 0.637284 0.420645 19.38923
0.180111   -3.7256 -2.47304 0.921363 0.22215 3.301706
0.420444 -2.77277 -1.25001 0.929052 0.416538 19.9117
0.420444 0.640463 -1.25001 0.865424 0.337587 1.855238
0.884556 -2.54944 -0.17698 0.953515 0.199867 161.8408
0.097333 -2.49898 -3.36092 0.989647 0.537206 301.9857
0.438333 -2.73252    -1.1899 0.911965 0.224472 11.03274
0.438333 -2.64124    -1.1899 0.921545 0.220008 2.92159
0.438333 -3.68991    -1.1899 0.783834 0.518862 10.18402
14.30233 -5.77105 3.838178 1.021877 0.201035 22.38375
0.313444 -4.45617 -1.67372 0.98714 0.212142 57.7356
0.313444 -1.10322 -1.67372 1.006329 0.154757 18.02006
0.098333 -2.11978 -3.34618 0.984043 0.170952 38.64044
0.528889 -4.37714 -0.91896 0.683773 0.584171 4.000863
1.604889 -3.74443 0.682474 0.614234 0.555485 58.0211
1.242667 -6.94605 0.31344 0.91468 0.347502 8.80109
0.075111    -4.60064   -3.73483 0.936129 0.290986 24.15469
    0.049   -6.59664   -4.35107 0.961834 0.186166 38.67241
    0.049   -4.51223   -4.35107 0.894594 0.396071 23.44724
                                0.970372 0.28077 48.16392
   0.381    -1.11168   -1.39214 0.995831 0.351543 111.6254

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:1
posted:9/22/2011
language:English
pages:106