Docstoc

Human Growth Hormone Activities

Document Sample
Human Growth Hormone Activities Powered By Docstoc
					Human Growth Hormone Activities

This activity centers around the use of recombinant DNA technology to produce large
amounts of Human Growth Hormone. This could be paired with the study of DNA in
any level Biology class, or with the endocrine system in Anatomy and Physiology.
Choosing which related activities to include would depend on the specific course and
where this fits in.

Background activities:

1. Instagraph Questions:
         On chart paper T charts, have students indicate agree or disagree with each
statement with a colored sticker of some kind.
         1. Use of anabolic steroids and human growth hormone is a significant problem
in professional sports today.
         2. Use of anabolic steroids and human growth hormone is a significant problem
in high school sports today.
         3. Athletes testing positive for steroids and/or human growth hormone should be
banned from Olympic competition.
         4. Use of steroids and human growth hormone can have serious and harmful side
effects.

2. Assigned Reading: Many choices! Some include
       The New York Times June 7, 2006 “Pitcher Used Human Growth Hormone,
Document Says,” by Jack Curry
       The New York Times Jan 15, 1993, “Sports of the Times” by George Vecsey.
       People Magazine, July 29, 1991 “Trouble: Fourth Down and Long (Lyle
       Alzado) by Wayne Edwards.
       Sports Illustrated, March 13, 2006 “Shock to the System.”
       Sports Illustrated , June 13, 2006 “Growth Industry.”
       Drug Week Sept 19, 2003 “ Sports Medicine”
       Obesity, Fitness & Wellness Week Nov 11, 2000 “GH May Shorten Life Span.”

3. Research on effects of steroids and human growth hormone abuse.
4. Research on acceptable uses of steroids and human growth hormone.
5. Ethics discussion and case studies. When would it be okay to give a child human
growth hormone? See attached worksheet.
6. Recombinant DNA simulation. Using the activity, “DNA Scissors: An Introduction
to Restriction Enzymes and Making a Recombinant Plasmid” given to us at the
workshop, I modified the donor DNA sequence to be a portion of the Human Growth
Hormone gene. The original plasmid recipient sequence can be used as it appears in the
original activity. The same restriction enzymes are used. The directions have been
slightly modified to reflect the change in the donor DNA.
DNA Scissors: Restriction Enzymes and Recombinant DNA
Student Information

Introduction: Restriction enzymes are proteins that recognize and bind to specific DNA
sequences and cut the DNA at or near the recognition site. They occur naturally in
prokaryotes such as bacteria and serve as defense mechanisms against viruses that attack
bacteria. When this foreign DNA enters a bacterium, the restriction enzymes recognize
the foreign DNA and cut it into pieces, thus rendering the virus useless. Although
discovered in bacteria, we now know that these restriction enzymes will cut the DNA of
many organisms if the recognition site is present. Typically, they recognize a specific
DNA sequence of 4-6 base pairs long. These recognition sites are palindromes. Below
are some examples of restriction enzymes and their recognition sites and how they cut the
DNA.

ECoRI GAATTC                           HindIII           AAGCTT
           CTTAAG                                             TTCGAA


BamHI          GGATCC                            AluI         AGCT
                CCTAGG                                         TCGA


SmaI            CCCGGG                           HbalI         GCGC
                GGGCCC                                         CGCG

When these restriction enzymes are allowed to mix with the foreign DNA under
appropriate conditions (pH, temperature), it will cut the DNA at all the sites that have that
recognition sequence. A specific combination of 4 base pairs will occur only once every
few hundred bases, while a specific sequence of 6 base pairs will occur randomly only
once every few thousand bases. It is possible that a DNA molecule will contain no
restriction site for a given enzyme.

Using restriction enzymes, it is possible to cut a desired gene from a donor DNA
sequence and insert it into a recipient’s DNA. To glue fragments together, another
enzyme called DNA ligase is needed.

You will be inserting the gene for Human Growth Hormone into a bacterium. Then
multiple copies of the modified bacterium can be made to manufacture large quantities of
HGH. This is how the large pharmaceutical companies manufacture the HGH used to
treat undersized children by prescription. Human insulin is also made this way to supply
insulin injections for diabetics.
Instructions:

1. Working in pairs, assign one student as the donor and one as the bacterium recipient.
Each student in the pair cuts out his DNA segment. Tape your sequences together to
make one long piece. Label or note the color so as not to confuse which is donor and
which is recipient.

2. Simulate the activity of the BamHI restriction enzyme. Reading from the 5’ to 3’ (left
to right) along the TOP row of your DNA, find the base sequence GGATCC. This is the
BamHI restriction site. Draw lines where the cut is to made along the strip. (See
example on previous page for the exact cut.) Cut the donor and the recipient DNA at the
proper place. Mark the ends BamHI.

3. Next simulate the activity of the restriction enzyme HindIII. Reading from the 5’ to 3’
(left to right) along the top row of your DNA, find the base sequence AAGCTT. This is
the HindIII recognition sequence. Draw lines where the cut is to be made. Cut the DNA
and mark the ends as HindIII.

4. Take the piece of donor DNA coding for the production of Human Growth Hormone
and connect it to the recipient bacterium DNA. Tape will represent the action of DNA
ligase. Be sure that the complementary bases are paired where you connect the
fragments. Notice the BamHI end will pair only with another BamHI end. Likewise, the
HindIII end must pair with another HindIII end.

5. Now tape your recombinant DNA ends together to make a circular shape, since
bacterial DNA occurs as a circular plasmid.

You have now created a bacterium that will manufacture human growth hormone.
You have genetically engineered!
Recipient Bacterium DNA

5’ TACTCGATCAAATCXXXXXXXXXXXXXXXXXXXXXXXXXX
   ATGAGCTAGTTTAGXXXXXXXXXXXXXXXXXXXXXXXXXX




AGCTATGTTTCTGAAGGATCCATATAGCGCATGACCGTCAGATCC
TCGATACAAAGACTTCCTAGGTATATCGCGTACTGGCAGTCTAGG




GATGCTTCXXXXXXXXXXXXXXXCGAACGTACGGTCCGAGATCA
CTACGAAGXXXXXXXXXXXXXXXGCTTGCATGCCAGGCTCTAGA




CATGCTTATAAATATTGCGAAGCTTCAGTCAGCGCGTAGCACTCC
GTACGAATATTTATAACGCTTCGAAGTCAGTCGCGCATCGTGAGG




TTAACGCGATGCATTAA
AATTGCGCTACGTAATT
Donor DNA:   Human Growth Hormone


5’CGAGAGGCTTGGGGCTTGGTGGCCTGGACACGGCGGAAGGATCCCAGCT
  GCTCTCCGAACCCCGAACCACCGGACCTGTGCCGCCTTCCTAGGGTCGT


5’ AGATCCATAGCAGAGGCTGATAGTCACGAGAACGGAAAACCTTTGTGA
   TCTAGGTATCGTCTCCGACTATCAGTGCTCTTGCCTTTTGGAAACACT


5’ TGAAGCTGCCACCACGGGCCAAAAAGTCACAAGCCAAACGTAGAGCCA
   ACTTCGACGGTGGTGCCCGGTTTTTCAGTGTTCGGTTTGCATCTCGGT


5’ TCAGTGTCAAATGGGCTGTAGGATAGAGACAATTAGTTGACGCACTCT
   AGTCACAGTTTACCCGACATCCTATCTCTGTTAATCAACTGCGTGAGA


5’ GCAGCCCAGGAGGGCATAAGCTTGCGCCCACCTCCACCATCACCTGAT
   CGTCGGGTCCTCCCGTATTCGAACGCGGGTGGAGGTGGTAGTGGACTA
Human Growth Hormone Therapy Activity                Name _____________________

Introduction: Human Growth Hormone (HGH) is a hormone secreted by the anterior
pituitary gland to regulate postnatal growth (after birth.) Prior to 1985, the only hormone
available for medical treatment was from a cadaver pituitary. It was only used for
children that did not produce enough HGH naturally. The cadaver HGH was withdrawn
from the market when if was associated with Creutzfeldt-Jakob disease (a form of mad
cow disease.) Now that HGH can be genetically engineered, people have asked to use it
for more conditions or reasons.

Side Effects: Adverse reactions reported from taking HGH were musculoskeletal
discomfort (aches and joint pain), fever, rigid tissues, diarrhea, nausea and headache.
Long term effects include gradual degeneration of the nervous system, an association
with diabetes, high blood pressure, heart disease, and possibly leukemia. Some
researchers are suggesting that injections of HGH actually shorten life span. Lyle
Alzado, a former NFL defensive end, died of brain cancer at age 43 that he believed was
caused by abusing steroids and HGH.

Activity: Suppose you were a parent in the following situations. Knowing the side
effects, for which reasons would you be willing to have your child undergo HGH
therapy? In each example, place a check in the yes or no column. Instructions for how to
fill in the risk column are at the end of this activity, and should be done last.


NO             YES            RISK

_____          _____           ______          Your child or someone in your care has
                                             AIDS. There is some evidence that HGH
                                             may slow the progressive loss of body mass
                                              known as “wasting.”


_____          _____         ______          Your child has a pituitary problem. The
                                             gland does not secrete enough (if any) HGH.
                                             Children with this problem will be pituitary
                                             dwarfs. Maximum height: 4.5 feet.


_____         ______          ______         A male child who is near the bottom of the
                                             height charts, in the lower 10% of normal
                                             growth charts. Both you and your spouse
                                             are short, and you do not want your son to
                                             face the problems you have had.
NO            YES            RISK

_____        _____           ______          A child with Turner syndrome (a condition
                                             in which a girl has only one X
                                             chromosome.) Short stature, webbed neck,
                                             and failure to mature sexually are typical.
                                             There is, however, rarely a HGH deficiency
                                             in these patients.

_____        ______          ______          A middle school boy who shows great
                                             promise in basketball. He is a gifted athlete,
                                             and except for height, seems a sure bet to
                                             get a Division I NCAA scholarship.


_____       ______           _____           A child with chronic renal (kidney) failure,
                                             which stunts growth.


Risk Column: If you said yes to any of the above situations, also include a risk/benefit
ratio you would be comfortable. Choose from the following:

1 in 10 chance that your child would be helped by HGH therapy. Write 1/10 in the blank.

3 in 10 chance that your child would be helped by HGH therapy. Write 3/10 in the blank.

5 in 10 chance that your child would be helped by HGH therapy. Write 5/10 in the blank.

7 in 10 chance that your child would be helped by HGH therapy. Write 7/10 in the blank.

9 in 10 chance that your child would be helped by HGH therapy. Write 9/10 in the blank.

Note: choosing a 9 in 10 chance that therapy would help is saying that you would need a
HIGH chance for success before you would allow the therapy. Choosing a 1 in 10
chance implies that you would do it, even if the chance of success were very low (10%.)

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:5
posted:9/14/2011
language:English
pages:7