INTELLECTUAL PROPERTY RIGHTS IPR by benbenzhou

VIEWS: 21 PAGES: 16

									                      INTELLECTUAL PROPERTY
A BULLETIN
                      RIGHTS (IPR)
   FROM
  TIFAC

                                                 VOL 9 NO. 2, 3 FEBRUARY-MARCH, 2003



 Obtain Patents and                   of the European Union. This provision    indigenously, it would be placed
 Enjoy the Incentives                 was made in 1996-1997 when an            outside the price control order for
                                      Indian resident, as per the Indian       a period of 10 years from the date
    An innovative industry in India   Patent Act 1970, was required to         of commencement of commercial
can gain competitive advantage in     file a patent application first in       production. In order to establish
the market in India if it develops    India and then anywhere else. In         that a process or a product has
the necessary expertise and skills    the amended Patent Act this              been developed through indigenous
in developing and manufacturing       provision has been diluted and would     R&D, novelty of the process or
new products, which are patented.     be applicable only in case of those      product would have to be ensured.
For example, the advantage of a       inventions, which may be important       In other words a patent would have
three year excise duty exemption      from defence and security reasons.       to be necessarily obtained for
or exemption from Drugs Price         Going by the spirit of the excise        claiming the benefit.
Control Order may translate into      duty provision, it is felt that filing
reserves / income which may offset    in India and obtaining patent in         3. Weighted tax deduction on
the cost towards R&D. In order to     India may continue to be necessary.      R&D expenditure
promote R&D and innovation in         The manufacturer, before                     Weighted tax deduction @ 150%
Indian industries, Government of      commencing commercial production         on R&D expenditure is available to
India provides a number of fiscal     must obtain a certificate from the       companies engaged in the business
incentives and support measures       Department of Scientific and             of biotechnology, or the business
to industries.                        Industrial Research for claiming         of manufacture or production of
1. Excise duty waiver on patented     the benefit.                             drugs, pharmaceuticals, electronic
products                              2. Exemption from Drug Price             equipment,             computers,
   All goods, falling under the       Control Order                            telecommunication equipment,
Schedule to the Central Excise           Bulk drugs produced from the          chemicals and manufacture of
Tariff 1985, are exempt from the      basic stage based on indigenous          aircraft and helicopters. The
excise duty for a period of 3 years   R&D are exempt from drug price           expenditure on scientific research
from the date of commencement of      control for a period of 5 years from     in relation to drugs and
commercial production provided such   the date of commencement of              pharmaceuticals, shall include
goods are manufactured by a wholly    commercial production provided that      expenditure incurred on clinical
owned Indian company and such         they are produced from the basic         trials of drugs, obtaining approval
goods are designed and developed      stage by a process of manufacture        from regulatory authority under
by such Indian company and the        developed by the unit through its        any Central, State or provincial
goods so designed are patented in     own R&D efforts. In case of a drug,      Act and filing a patent application
any two countries outside India       which has not been produced              in India.
namely, USA, Japan and any country    elsewhere, if developed and produced                          Contd on...2
                               Visit us at www.indianpatents.org.in
                                                                                                               1
Contd from...1                              1961 provides for a weighted tax        in Stockholm in 1967 and further
Obtain ......                               deduction of 125% for expeses on        amended in 1979. It is open to
                                            sponsoring research programmes          States, which are members of the
4. Accelerated depreciation
                                            at National laboratories functioning    Paris Convention. As on April 15,
allowance
                                            under ICAR, CSIR, ICMR, DRDO,           2003 there were 20 States who
    Depreciation allowance at a             Department of Biotechnology,            were members of the Union. These
higher rate is available in respect         Department of Atomic Energy,            countries are Algeria, Bulgaria,
of plants and machinery installed           Department of Electronics; IIT and      Burkina Faso, Congo, Cuba, Czech
for manufacturing goods based on            universities.                           Republic, France, Gabon, Haiti,
indigenous technology developed
                                                                                    Hungary, Israel, Italy, Mexico,
in recognized in-house R&D units,
                                                                                    Portugal, Republic of Moldova, Serbia,
Government R&D institutions,                 Lisbon Agreement                       Slovakia, Togo and Tunisia. The
national laboratories and Scientific         for the Protection                     last one to join the Union was
and Industrial Organizations (SIRO).         of Appellations of                     Republic of Moldova which became
The present rate of depreciation
for such plants and machinery is
                                              Origin and their                      a member on April 5, 2001. Up to
                                                International                       October 15, 2001, 842 appellations
40% as against 25% for other plants
                                                                                    of origin had been registered of
and machinery.                                  Registration
                                                                                    which 773 were in force in October
5. Tax holiday to R&D companies                 The aim of this Agreement is to     2001. The majority of registrations
   Tax holiday for ten consecutive          provide protection of appellations      were made during the first year of
assessment years is available to            of origin. Geographical name of a       entry into force of the Agreement,
approved companies engaged in               country, region, or locality, which     especially in 1967. France is reported
scientific and industrial R&D activities    serves to designate a product           to account for almost 66% of all
on commercial lines. This incentive         originating therein, the quality and    registrations. Further, it may be
is applicable to any commercial             characteristics of which are due        noted that six countries namely,
company that has its main objective         exclusively or essentially to the       France, Czech Republic, Slovakia,
and activities in the area of scientific    geographic environment, including       Bulgaria, Hungary and Italy account
and industrial R&D. This would be           natural and human factors would         for almost 94% of all registrations.
applicable to companies approved            qualify for such protection. These      The products getting such
after March 31, 2000 but before             names are registered by the             registrations are wines, spirits,
April 1, 2003.                              International Bureau of the World       cheese, ornamental products,
6. Income tax relief on R&D                 Intellectual Property Organization      agriculture products, tobacco, mineral
expenditure                                 (WIPO) upon the request of the          water, beer and malt.
     Under Section 35(1)(i) of the Income   competent authorities of the
                                                                                       The Agreement does not
Tax Act 1961, the revenue expenditure       interested contracting state. The
                                                                                    appear to be popular with Member
on scientific research, by the recognized   International Bureau communicates
                                                                                    States of WIPO as a few countries
R&D units on activities related to the      the registration to other contracting
                                                                                    have become members to the
business of the company is allowed          states. A contracting state may
                                                                                    Lisbon     Agreement.         This
full deduction. Under Section 35(1)(iv)     not accept the registration and
                                                                                    Agreement , however, provides
expenses on capital nature could be         declare its inability to protect the
                                                                                    a good platform to provide
deducted totally from the income of         registered appellation within one
                                                                                    protection of appellations of origin
the year in which the expenses have         year of communication.                  in respect of products which are
been incurred.                                 The Lisbon Agreement created         produced in many countries which
7. Tax deduction for sponsoring             a Union which has an assembly.          have now become independent but
research                                    The Lisbon Agreement was                used to be an integral part of a
    Section 35(2AA) of the IT Act           concluded in 1958 and was revised       unified country some time back.

                                    Visit us at www.indianpatents.org.in
2
   The word ‘veda’                      Dictionary gives the meaning as “         the research and results for later
   being used as a                      any four canonical collection of          access to your work from any
                                        hymns, prayers and liturgical             location; and, providing periodic
      trademark                         formulas that comprise the earliest       updates on research. The trademark
    The word ‘veda’ is becoming         Hindu writings.” Therefore, ‘veda’        has been registered under IC 009
popular among companies as they         is a dictionary word in the English       and US 021 023 026 036 and 038
get the word ‘veda’ registered as       language as well having more or           for the first part and IC 042 and US
a trademark for their products. The     less the same meaning.                    100 and 101.
US register of trademarks shows            SSH Medical Limited has got               Veda JSC Corporation has its
‘veda’ being used as trademark by       the word “veda” registered as a           trademark as veda for alcoholic
four companies namely, Maharshi         trademark under US 010, 026, 039          beverage , namely, vodka under IC
Ayur-Ved Products International         and 044 for medical and veterinary        033 and US 047 and 049.
Inc., Colorado; VedaSource LLC          apparatus namely, specula, spatula,           The use of word veda as a
Limited Liability Company, Georgia;     proctscopes and anal specula and          trademark would fall in the category
“Veda” JSC Corporation, Russian         disposable components, parts and          of arbitrary trademarks which are
Federation; and SSH Medical Limited     accessories for the aforesaid             well known words but used arbitrarily.
Company, Australia.                     apparatus. This record also states        Therefore, it can be used for different
    Maharshi Ayur-Ved has obtained      “ The English translation of “veda”       products by the same or different
the trademark for ready to eat          is one or all of the holy books of        companies. No one can possibly
products, food bars and herbal based    writing in Hinduism.”                     have an exclusive use of this word
food beverages under US                      VedaSource has “veda” registered     which would preclude others from
classification US 046 and under         as a trademark (service mark) for         using it in different contexts and
US 001, 004, 006 , 050, 051, 052        computer         programs         and     different products. This is obvious
for aromatic blend of essential oils    documentation sold as a unit therewith    from the fact that the USPTO has
for personal use; personal care         for      searching,       gathering,      awarded this trademark to different
skin products, namely, skin creams,     manipulating,            organizing,      companies for different products.
skin and body lotions, skin             consolidating, validating, merging,       There are many such examples.
moisturizers, skin soaps, skin oils,    summarizing and reporting data            Legally, arbitrary trademarks may
skin toners, and bath powders;          and text information obtained from        be strong or weak. The strength of
massage oils, facial masks; body        a global computer network, knowledge      such marks would depend on how
scrubs. It should be noted that the     bases and/ or electronic information      frequently they are used by others
same word is being used as              source. The mark is also associated       as successful trademarks and also
trademark for two different types of    with providing a search engine for        some times, on the nature of word
products. Obviously, this word cannot   research in a wide variety of areas       selected. One question could occupy
be used as trademark in USA for         which incorporates the following          some minds- “ Could such
products falling in the above           features, namely, researching             trademarks ever become ‘well known
categories. The use of the word         numerous sources of information           trademarks’ ?
is not a mere coincidence. The          on a global computer information
record in the register states "Veda     network; verifying results prior to
is a dictionary term that refers to     reporting to the user to ensure all       Patenting in Display
prayers and hymns that comprise         are still relevant; providing custom            Devices
the earliest Hindu sacred writings”.    summaries based on what the user
                                                                                      Patent applications, filed in India,
    The word veda has been recorded     is researching; editing out information
                                                                                  related to electronic display devices
in English dictionaries. The Oxford     that are no longer available; storing
                                                                                  were at their peak in 1997 when
Dictionary gives the meaning as “       the research, allowing the user to
                                                                                  the data from 1995 onwards upto
the most ancient Hindu scripture”       review, reuse, and refine the
                                                                                  2001 was screened and analysed.
and the Webster’s Ninth Collegiate      requests; keeping and organizing
                                                                                                           Contd on...4
                                 Visit us at www.indianpatents.org.in
                                                                                                                       3
Contd from...3                          • Applications by Indian                   area. Similar is the case with
Patenting ......                           companies / individuals          43     companies like LG Electronics Inc,
The data for the period 1995-1998
                                        • Applications by                          Motorola Inc and Toyo Kohan Co
has been picked up from the IPR            Indian individuals              31      Ltd, all these companies have not
bulletin of August 1999 when a             Among       the    convention           filed even a single application during
similar analysis, as being presented    applications, 50% are PCT                  the period 1999-2001.
now was published. These devices        applications which have entered                Matsushita Electric Industrial
include cathode ray tubes, liquid       the national phase. The rest of the        Co Ltd filing maximum number of
crystal devices, phosphor screens,      convention applications are from           applications during 1999-2001 but
picture tubes, flat panel displays,     Japan (17), USA (10), Germany              didn’t find any place among major
light emitting diodes and plasma        (4), France (2), UK (3), Korea (1)         players prior to 1999 in the area of
displays. An update on patent           and EPO (1).                               display devices. Matsushita has
applications filed in the area of          Most of the individuals and             filed 2 applications for liquid crystal
display devices from 1999 to 2001       companies whether Indian or foreign,       display and five applications relating
is presented in this issue. A total     have filed single applications. Foreign    to display control device, display
of 131 applications were filed during   companies filing 2 or more                 unit installing and connecting device
this three-year period whereas 287      applications are listed in Table II.       and display apparatus picture
applications were filed from the        Table II                                   generation. Sony Corporation’s
period 1995 to 1998. Table I below                                                 five applications relate to video
                                        Company                    No. of
shows year wise distribution of                                    Applications    display and manufacture method,
applications from 1995 to 2001.         Matsushita Electric                        display unit, display apparatus,
                                        Industrial Co Ltd             7
The analysis also looks at their                                                   method and apparatus for displaying
                                        Sony Corp                     5
subsystems as well like controllers,                                               information and program and medium
                                        General Electric
driver circuits etc.                    Company                       4            used therefor and bus analyzer
Table I.                                Rolic AG                      4            bus resetting display method.
                                        Brookhaven Science                         General Electric Company has
    Year      Applications filed        Association                   3            filed three applications related to
    1995      51                        Imphy Ugine Precision                      dimensional ultrasound data display,
                                        France                        3
    1996      77                                                                   vibration phases monitoring system
                                        IBM                           3
                                                                                   for rotating members and man
    1997      107                       Intel Corp                    3
                                                                                   machine interface for a virtual lockout
    1998      52                        Siemens AG                    3
                                                                                   tagout panel display. Rolic AG
    1999      30                        Verintelligent (BVI) Ltd      3
                                                                                   has all the four applications related
                                        Sarnoff Corp                  2
    2000      45                                                                   to liquid crystal compounds.
                                        Thomson Licensing SA          2
    2001      56                                                                   Brookhaven Science Association
                                        Koninklijke Philips
                                        Electronics NV                2            has applications on multi class
   Out of the 131 applications filed,                                              display panel, transparent seam
almost 62% were convention                  Samsung Display Devices Co
                                                                                   display panel and a light redirective
applications. A break-up of the         Ltd had filed a total of 66 applications
                                                                                   display panel. All these applications
applications is given below :           during 1995 to 1998 out of which
                                                                                   arePCTapplicationsenteringthenational
                                        31 were for cathode ray tube (CRT).
• Convention                                                                       phase. Imphy Ugine Precision has
                                        But the same company has filed a
    applications                82                                                 2 applications for masking device for
                                        single application on CRT during
• Non convention                                                                   a flat screen colour display cathode
  applications                  49      1999 to 2001. Daewoo Electronics
                                                                                   ray tube and one for support frame for
• PCT applications in                   Co Ltd had 16 applications related
                                                                                   a planar mask pertaining to a cathode
  National phase                41      to display technologies while during
                                                                                   ray tube. Verintelligent (BVI) Ltd
• PCT applications filed                the period 1999-2001 it has not
  from India                      1     filed a single application in this                                Contd on...5
                                Visit us at www.indianpatents.org.in
4
Contd from...4                                Indians have filed 33 percent of          down. The number of applications
Patenting ......                          the total applications. Centre for            came down substantially in 1999
has all the three applications for        Liquid Crystal Research has filed             but has been on the increase since
liquid crystals. These relate to liquid   3 patent applications, all relating           then. The relative positioning of
crystal display with non specular         to an improved liquid crystal display         companies filing applications has
reflectors, driving scheme for liquid     device. Council of Scientific and             undergone a perceptible change
crystal display and liquid crystal        Industrial Research (CSIR) has two            and one cannot see a few companies
display driving scheme using              applications related to a process             capturing the major and substantial
orthogonal block circulant matrix.        for preparing a novel polycrystalline         share of the total filings. The reasons
Intel’s applications relate to display    ceramic phosphor composition useful           for low filing by the well-known
capture systems, method of                in luminescent display screen and             companies like Samsung and Sony
displaying private data to collocated     compact fluorescent lamps and a               who have a major presence in India
users and method and apparatus.           process for the synthesis of new blue         are not understood.
Sarnoff Corp has 2 patent                 emitting ce+ activated borate phosphors
                                                                                          A case study on
applications related to light emitting    for use in fluorescent lamps and TV
diodes. Thomson Licensing has             tubes. Indian individuals have filed            making precursor
applications for color picture tube       applications for on-line display of freight        of insulin
having a low expansion tension            rates and computations of road freight           A patent was granted to Novo
mask and a frequency dependent            index, device for measurement and             Nordisk in February 2003 for a
x-ray protection circuit for a            display of instantaneous relationship         novel process for making insulin
multimedia monitor.                       between distance covered and fuel             precursor and insulin precursor
   The PCT applications entering          consumed by an automobile, local              analogs. These precursors can be
the national phase relate to areas        traininformationdisplaysystem,activated       expressed in yeast in high yields.
such as monitoring system, color          display cases and boards, improved            Background and prior art
changeable fibre optic illuminated        lamp system using LEDs and others.
                                                                                            Insulin is a polypeptide hormone
display, light beam displays, liquid          Major areas where most of the             secreted by beta cells of the pancreas
crystal thermometers, plasma              applications have been filed are given        and consists of two polypeptide
accelerator arrangement, micro            in table below with the number of             chains, A and B, which are linked
mechanical flat panel display with        patent applications in each area.             to each other by two disulfide bridges.
touch sensitive input and vibration                                                     Three methods have been used for
source, positioning a cursor on           Area                 No of Applications       the production of human insulin in
the display screen of a computer.                          1999-2001 1995-1998          microorganisms. Two involve E coli
The companies filing PCT                                                                with either the expression of a
                                          Liquid Crystal
applications and entering national        Display (LCD)         14          41          large fusion protein in the cytoplasm
phase include Advanced Laser              Light Emitting                                or use a signal peptide to enable
Technologies Inc, Altoweb                 Diodes (LED)          8            8
                                                                                        secretion into the periplasmic space.
Systems Inc, Ani-motion Inc,              Cathode Ray
                                          Tube (CRT)            3           64          A     third      method        utilizes
Computer Association Think Inc,                                                         Saccharomyces cerevisiae to
                                          Picture Tube          3           11
Dimensional Media Associates                                                            secrete an insulin precursor into
                                          Flat Panel Display    3            3
Inc, Euresearch Ltd, Flixel Ltd,                                                        the medium. There are only a limited
                                          Plasma Display        1           9
Fonnil Inc, Molecolour Opto                                                             number of insulin precursor produced
Electronics Corp, Troyer Diane,              It is seen that the number of              by above methods. These suffer
Telecruz Tehnology, Studer                applications related to CRTs has              with low yield and reduced stability
Professional Audio and others.            come down quite sharply. PFC                  of the precursor.
    One PCT applications has been         had indicated this trend in its analysis      Present Invention
filed from India by Centre for Liquid     carried out in August 1999 that
                                                                                           Connecting peptide or “C-
Crystal Research.                         patent filings in CRT would come                               Contd on...6
                                   Visit us at www.indianpatents.org.in
                                                                                                                            5
Contd from...5                            new areas of knowledge as the              chromosomes into which it has
A Case Study......                        terminologies are still not                been integrated. The recombinant
peptide” means the connection             standardized.                              expression vector is capable of
moiety “C” of the B-C-A polypeptide           The present invention relates to       replicating in yeast. The vectors of
sequence of a single chain                novel connecting peptides (C peptide),     the invention contain one or more
preproinsulin like molecule. In the       which confer an increased production       selectable markers, which permit
natural insulin chain, the C peptide      yield and increased stability in insulin   easy selection of transformed cells.
connects position 30 of the B chain       precursor molecule and insulin             Examples of bacterial selectable
and position 1 of the A chain. The        precursor analog molecule when             markers are da1 genes from Bacillus
C-peptide of this invention connects      expressed in a transformed                 subtilis or Bacillus licheniformis.
B29 or B30 to A1 and differ in            microorganism, in particular yeast.        In the vector, the polynucleotide
sequence and length of the natural        C peptides of the invention contain        sequence is connected to a suitable
C peptide.                                at least one aromatic amino acid           promoter sequence. Examples of
                                          residue Phe, Trp, or tyr and will          promoters are operon,Streptomyces
   Insulin precursor means a single
                                          generally be shorter than the natural      coelicolor agarase gene and Bacillus
chain polypeptide, which by one or
                                          human C peptide, which consists            subtilis levansucrase gene.
more subsequent chemical and /
or enzymatic processes can be             of 35 amino acids. Thus the novel          Example 1
converted into human insulin.             C peptides in general will not be of           Construction of Synthetic C-
                                          more than 15 amino acid residues           peptides With Aromatic Amino
    Insulin precursor analog means
                                          in length and preferably not more          Acid(s) Synthetic genes encoding
an insulin precursor molecule having
                                          than 9 amino acid residues. As in          fusion proteins, consisting of
one or more mutations, substitutions,
                                          the human insulin molecule, the C          Asp.sup.B28 IP associated with a
additions or deletions of the A and
                                          peptide will contain a cleavage site       leader sequence consisting of a
/ or B amino acid chains relative
                                          at its C and N termini enabling in         pre-peptide (signal peptide) and a
to the human insulin.
                                          vitro cleavage of C peptide from the       pro-peptide, were constructed using
   B(1-29) means a natural insulin        A and B chains.                            PCR under standard conditions.
B chain lacking the B30 amino
                                                    The     polynucleotide           The resulting DNA fragments were
acid residue. A(1-21) means the
                                          sequence of the invention may be           isolated and digested with
natural insulin A chain.
                                          prepared synthetically by established      endonucleases and purified using
   Functional analog of insulin           methods. It can also be of mixed           the Gene Clean kit. Standard methods
means a polypeptide with a similar        genomic, cDNA and synthetic origin.        were used for DNA ligation and
biological action as the native natural   The invention encompasses a vector         transformation of E. coli cells were
insulin.                                  which is capable of replicating in         performed by the CaCl.sub.2 method.
   The terms ‘ significantly increased    the selected microorganism or host         Plasmids were purified from
production’ or ‘increased fermentation    cell and which carries a                   transformed E. coli cells using
yield’ mean an increase in secreted       polynucleotide sequence encoding           QIAGEN columns. Nucleotide
amount of the insulin precursor           the insulin precursor or insulin           sequences were determined using
molecule or insulin precursor analog      precursor analogs of the invention.        the ALF Pharmacia Biotech DNA
molecule present in the culture           The recombinant vector may be an           sequencing system with purified
compared to the yield with no aromatic    autonomously replicating vector e.g.,      double-stranded plasmid DNA as
amino acid residue in C peptide.          a plasmid, an extra- chromosomal           template. Oligonucleotide primers
    There are many terms occurring        element, a mini chromosome or an           for PCR were obtained from DNA
in the patent document, which have        artificial chromosome. The vector          technology.
been clearly defined to avoid any         may also be one which, when                   DNA encoding a number of fusions
confusion in understanding of the         introduced into the host cell, is          proteins of leader sequences and
invention. This rigour in writing is      integrated into the genome and             Asp.sup.B28 IP with different mini
extremely important especially in         replicated together with the                                     Contd on...6
                                  Visit us at www.indianpatents.org.in
6
Contd from...6                           for PCR generation of leader-         DNA fragment was dissolved in
A Case Study......                       Asp.sup.B28 IP with randomized        water and restriction endonucleases
C-peptides was generated by PCR          synthetic mini C-peptides used to     buffer and digested with suitable
using appropriate oligonucleotides       generated synthetic mini C-peptides   restriction endonucleases according
as primers.                              with the general formula: Xaa-Trp-    to standard techniques.
    Development of synthetic mini        Lys (XWK) are as follows:                The expression plasmid
C-peptides was performed by                 Polymerase chain reaction was      pAK1150 or a similar plasmid of
randomization of one or more codon(s)    typically performed by taking 5       the CPOT type was digested
encoding the amino acids in the          .mu.l Primer A (20 pmol), 5 .mu.l     with the restriction endonucleases
mini C-peptide. All synthetic mini       Primer B (20 pmol), 10 .mu.l 10X      Bgl II and Xba I and the vector
C-peptides feature an enzymatic          PCR buffer, 8 .mu.l dNTP mix,         fragment of 10765 nucleotide
processing site at the C-terminus        0.75 .mu.l E.H.F. enzyme, 1 .mu.l     basepairs isolated using the Gene
which allows enzymatic removal           pAK1150 plasmid as template           Clean Kit.
of the synthetic mini C-peptide.         (approximately 0.2 .mu.g DNA) and        The two digested and isolated
Randomization was performed using        70.25 .mu.l distilled water.          DNA fragments (the vector fragment
doped oligonucleotides which             The PCR mixture was subsequently      and the PCR fragment) were ligated
introduced codon(s) variations at        loaded onto a 2% agarose gel and      together using T4 DNA ligase
one or more positions of the synthetic   electrophoresis was performed using   and standard conditions. The
mini C-peptides. Typically one of        standard techniques. The resulting    ligation mix was subsequently
the two primers (oligonucleotides)       DNA fragment was cut out of the       transformed into a competent
used for PCR was doped. An example       agarose gel and isolated by the       E. coli strain (R-, M+) followed
of an oligonucleotides pair used         Gene Clean kit. The purified PCR      by selection with ampicillin
Primer A:                                                                      resistance. Plasmids from the
5'-TAAATCTATAACTACAAAAAACACATA-3' (SEQ ID NO:13) and                           resulting E. coli’s were isolated
Primer B:                                                                      using QIAGEN columns.
3'-                                                                               Table 1 shows the insulin
CCAAAGAAGATGTGACTGTTCNNMACCTTCCCATAGCAACTTGTTACA                               precursors analogs generated
ACATGAAGATAGACAAGAAACATG                                                       by the above method and
GTTAACCTTTTGATGACATTGATCAGATCTTTGA-TTC-5' (SEQ ID NO:14),                      production yield expressed as
where N is A, C, G, or T and M is C or A.                                      a percent of control.
 TABLE 1                                                                       Claims
 Leader-N-                                                                       The patent has 40 claims.
 terminal ex-
 tension     Precursor mini C-peptide Yield* ` SEQ      ID NO:
                                                                               Few of them are listed below :
 .alpha.*-ex4 Asp.sup.B28 IP None              100                             1. An insulin precursor or insulin
               (control)                                                       analog precursor comprising a
 .alpha.*-ex4 Asp.sup.B28 IP MetTrpLys         378                             connecting peptide (C-peptide)
 .alpha.*-ex4 Asp.sup.B28 IP AlaTrpLys         270
                                                                               being cleavable from the A and
 .alpha.*-ex4 Asp.sup.B28 IP ValTrpLys         284
 alpha.*-ex4 ASP.sup.B28 IP IleTrpLys          330                             B chains said connecting peptide
 .alpha.*-ex4 Asp.sup.B28 IP LeuTrpLys         336                             comprising at least one aromatic
 .alpha.*-ex4 Asp.sup.B28 IP LysTrpLys         288                             amino acid residue and a cleavage
 .alpha.*-ex4 Asp.sup.B28 IP GluGluPheLys      272       SEQ ID NO: 15         site enabling cleavage of the
 .alpha.*-ex4 Asp.sup.B28 IP GluPheLys         379
 .alpha.*-ex4 Asp.sup.B28 IP GluTrpLys         374
                                                                               peptide bond between the A-
 .alpha.*-ex4 Asp.sup.B28 IP SerTrpLys         226                             chain and the connecting peptide,
 .alpha.*-ex4 Asp.sup.B28 IP ThrTrpLys         270                             wherein one aromatic amino acid
 .alpha.*-ex4 Asp.sup.B28 IP ArgTrpLys         227                             residue is immediately N-terminal
 .alpha.*-ex4 Asp.sup.B28 IP GluMetTrpLys      212       SEQ ID NO: 1          to said cleavage site.
 .alpha.*-ex4 Asp.sup.B28 IP GlnMetTrpLys      239       SEQ ID NO: 2
                                                                                                    Contd on...8
                                  Visit us at www.indianpatents.org.in
                                                                                                               7
Contd from...7                           36. A process for making insulin or          passing off its name and goods
A Case Study......                       an insulin analog, said method               under the name KANISHK.
9. An insulin precursor or insulin       comprising (i) culturing a host cell         Plaintiff’s Allegations
analog precursor according to claim      comprising the polynucleotide
                                                                                      The plaintiff alleged that :
1, wherein the aromatic amino acid       sequence of claim 31 under suitable
                                         culture conditions for expressing
                                                                                      • The defendant’s mark resembled
residue immediately N-terminal to                                                       their famous name TANISHQ.
the cleavage site is less than 5         the precursor; (ii) isolating the
                                         precursor from the culture medium            • The defendant was doing business
.ANG. away from at least one of
                                         and (iii) converting the precursor              under the name Khazana
the amino acid residues in position
                                         into insulin or an insulin analog by            Jewellery at different places but
B11, B12 or B26 in the B chain.
                                         in vitro chemical or enzymatic                  to take the advantage of plaintiff’s
10. An insulin precursor or insulin
                                         conversion.                                     goodwill saw it fit to start under
analog precursor having the formula:
                                                                                         the name KANISHK.
B(1-27)-X.sub.2 -X.sub.3 -X.sub.1         A Trademark Case
                                                                                      • The use of the name KANISHK
-Y-A(1-21)                                      Law                                      indicated the nexus between
wherein                                    A Tale of two Jewellers:                      the plaintiff and the defendant.
X.sub.1 is a peptide sequence of         TANISHQ vs. KANISHK                          • Defendant being late entrant
1-6 amino acid residues of which
                                             Titan Industries Ltd, a company             was aware of plaintiff’s goodwill
at least one is an aromatic amino
                                         well known for watches established              and reputation and had been
acid residue,
                                         in 1956 had ventured in to the field            passing off the trademark and
X.sub.2 is one of Pro, Asp, Lys, or      of manufacture and sale of jewellery            trade name of the plaintiff both
Ile at position 28 of the B chain,       under the brand Tanishq in 1993 in              in its corporate form as well
X.sub.3 is one of Pro, Lys, Ala,         Chennai. Later Titan Industries                 as in trademark.
Arg, or Pro-Thr at position 29 of        (hereinafter called plaintiff) opened
                                                                                      • The use of deceptively similar
the B chain, and                         Tanishq boutiques in many cities
                                                                                         name by defendant has caused
Y is Lys or Arg.                         of India and abroad. The plaintiff
                                                                                         irreparable loss and injury to
14. An insulin precursor or insulin      also applied for trademark registration
                                                                                         plaintiff, which cannot be
analog precursor of claim 10 wherein     of TANISHQ in 1994. Trademark
                                                                                         compensated in pecuniary terms.
X1-Y is selected from the group of:      for TANISHQ is also registered in
                                                                                         On this ground, the plaintiff asked
(a) Met-Trp-Lys, (b) Ala-Trp-Lys,        Argentina, Bahamas, Benelux,
                                                                                         for interim injunction restricting
(c) Val-Trp-Lys, (d) Ile-Trp-Lys, (e)    Bermuda, Cambodia Hongkong and
                                                                                         use of impugned mark by the
Leu-Trp-Lys, (f) Glu-Glu-Phe-Lys         several other countries.
                                                                                         defendant.
(SEQ ID NO: 15), (g) Glu-Phe-Lys,            In the year 2002, the plaintiff
                                                                                      Defendant’s Claims
(h) Glu-Trp-Lys, (i) Ser-Trp-Lys, (j)    came to know that a jewellery
Thr-Trp-Lys, (k) Arg-Trp-Lys, (l) Glu-   showroom just 7 kms away from                  The defendant denying the
Met-Trp-Lys (SEQ ID NO: 1), (m)          their TANISHQ showroom had opened            above allegations claimed that
Gln-Met-Trp-Lys (SEQ ID NO: 2),          in Chennai under the name KANISHK.           :
and (n) Asp-Trp-Lys.                     The plaintiff filed an application to        • The plaintiff has neither
31. A polynucleotide sequence            grant interim injunction restraining            claimed damages or accounts
encoding an insulin precursor or         the defendant from making use of                for profits nor have they paid
insulin analog precursor according       the name KANISHK for its goods                  the court fees.
to claim 1.                              and/or, as its corporate name of
32. An expression vector comprising
                                                                                      • The name has been adopted
                                         trading style or any other name
the polynucleotide sequence.                                                             from ‘Kanishka’, a Hindu King
                                         which is deceptively, phonetically
33. A host cell transformed with a                                                       of Kusha Dynasty and also
                                         and confusingly similar to the plaintiffs’
vector of claim 32.                                                                      the name of their nephew.
                                         name TANISHQ and also from                                       Contd on...9
                                 Visit us at www.indianpatents.org.in
8
Contd from...8                               that they have not suffered any            International News
Trademark ......                             loss or damage by the business
                                                                                          Bradley Pharmaceuticals, Inc
   The name was suggested by                 carried on by the defendant under
                                                                                       has been issued a US patent No.
   a family astrologer based on              the name and style of KANISHK
                                                                                       6, 495, 602 B1 on February 6, to
   numerology and namology.                  jewellers.
                                                                                       cover a number of new formulations
   Defendant’s two brothers carry               It is seen from the pleadings          of skincare products. Bradley
   on jewellery business with the            that the trade mark of the plaintiff      subsidiary, Doak Dermatologics
   name KHAZANA & KUBER both                 TANISHQ is completely different           will market the formulations.
   starting with ‘K’.                        from the trade mark of the defendant         An Australian patent has been
• The marks of the plaintiff and             named KANISHK. Although                   granted to Novogen for its topical
   defendant are phonetically,               phonetically it may appear to be a        skin repair compound NV-07a,
   visually and structurally different.      similar one, but it cannot be said        covering protection of the skin
                                             that it is visually and structurally      from sun-induced immuno-
• Considering nature of goods and
                                             similar and identical one.                suppression and ultra violet-induced
   class of customers, there is no
                                                                                       damage. NV-07a has been shown
   likelihood of defendant assuming             The plaintiff has not filed any
                                                                                       to restore immune function and
   to be associated with plaintiffs.         record to show that during the last
                                                                                       inhibit the DNA changes that may
• Neither the defendant nor the              ten months whether the defendant
                                                                                       occur, even when used after sun
   plaintiffs sell their jewellery bearing   had passed off their goods as that
                                                                                       exposure.
   the trademark.                            of the plaintiff and whether any
                                                                                           Japan Science and Technology
                                             customer has been misled that
• Adoption of the name ‘KANISHK’                                                       Corporation has patented Bacillus
                                             the shop of the defendant is affiliated
   by defendant is honest, bonafide                                                    sp. NTAP-1 deposited under number
                                             or associated with the plaintiff. No
   and without reference to any                                                        FERM BP-6926; and a collagen-
                                             doubt, the plaintiff was already in
   company including plaintiff’s.                                                      decomposing enzyme produced
                                             the market since 1996; but this
• The defendant’s end product                                                          by bacterium (Patent No. US
                                             does not mean that the plaintiff is
   are embossed with initials ‘KJ’                                                     6,465,236). The enzyme has a
                                             automatically entitled to the relief      capability of hydrolyzing, at the
   ‘Kanishk Jewellery’ while nothing         of interim injunction against the         highest efficiency, collagen and
   is embossed on the jewellry by            defendant.                                gelatin from among casein, gelatin
   the plaintiff.
                                                 There is also no special pleading     albumina and collagen and shows
    The court after hearing pleadings                                                  the optimum pH of 3.5 to 4.5.
                                             relating to the damages already
of both the parties found that the
                                             sustained by the plaintiff or is likely       China has recently formed its
plaintiff has not claimed damages
                                             to sustain in future because of any       first national anti-piracy organisation,
or accounts for profits. The suit is
                                             alleged similarity. It is also seen       the       Anti-Piracy Committee
not properly valued and proper court
                                             from the types set of documents           composed of 82 members from
fee has also not been paid. The                                                        anti-piracy organisations all over
                                             that there is lot of variation between
defendant has started its business                                                     the country. The Anti-Piracy
                                             the two trade names not only in
in January 2002. The word KANISHK                                                      Committee will coordinate the anti-
                                             the advertisement but also in the
is the name of famous Hindu King                                                       piracy efforts initiated by different
                                             guarantee card and also in the
Kanishka of Kushan dynasty. The                                                        regions, industries, departments
                                             logo supplied by them.
name is also a personal name,                                                          and individuals, and will handle
which means ‘young’ in Sanskrit.                 Having regard to the entire           anti-piracy related affairs, as required
KANISHK jewellery is defendant’s             materials and also the logo of the        by copyright owners and their
only business and his only source            two trade names, the judge was            deputies, of investigating, collecting
of livelihood. The balance of                of the view that it cannot be said        evidence, asking for administrative
convenience is also in their favour.         that both are identical and similar       regulation or filing a lawsuit.
The plaintiff has indirectly admitted                               Contd on...10                             Contd on...10
                                     Visit us at www.indianpatents.org.in
                                                                                                                            9
Contd from...9                                arrangement,      assembly,              Contd from...9
Trademark ......                              program, method, technique or            International ......
                                              process.                                    Some major changes have taken
which is likely to cause deception or
confusion to public. The plaintiffs have   3. Holder of Trade Secret means             place in Libya’s trademark systems.
                                              the person who finds, searches,          There has been a substantial
failed to establish that they have got
                                              complies or invents a trade              increase in official fees for trademark
a prima facie case and the balance of
                                              information intended as a trade          matters. Under the restructuring
convenience is in their favour. Hence
                                              secret, which is required not to         programme, a new Trademarks
the case was dismissed and the
                                              violate other person’s right to          Office has been opened for business
defendants were allowed to use the
                                              an ownership of a result of a            where all the applications have
tradename KANISHK.
                                              test or ownership of trade               been kept under the previous
     (Source : Industrial Property            information intended as a trade          system in a suspense condition.
     Law Reporter, January 2003)              secret. In case of transfer of              StemCells Inc (STEM) has been
                                              trade secret as prescribed under         granted a US patent (6,497,872)
Trade Secret Act of
                                              the Trade Secret Act, it shall           with broad claims covering the
     Thailand                                 also include a transferee.               transplantation of mammalian
    A new Trade Secrets Act has            4. Custodian of Trade Secret                tissue-derived neural stem cells
been enacted by the government                means the holder of a trade              and their progeny into the central
of Thailand in order to be in                 secret, including the person who         nervous system and the peripheral
compliance with the Article 39 of             possesses, control or keeps a            nervous system including the spinal
the TRIPS Agreement. The aim                  trade information intended as a          cord. It is the first patent to be
of the Act has also been to support           legitimate trade information.            issued anywhere in the world with
the operation of free trade and to         5. Court of Law means the                   claims covering transplantation
protect against unfair business               Intellectual Property and                uses of human neural stem cells.
practices. The act known as The               International Trade Court as                 Novogen Ltd has entered into
Trade Secret Act B. E. (2002) is              prescribed under the law relating        a license agreement with DuPont
effective since July 22, 2002. Some           to an established of the                 in November 1997 for protein
of the important definitions related          Intellectual Property and                technologies granting worldwide
to this Act are presented below:              International Trade Court and a          rights (except New zealand and
1. Trade Secret means trade                   trial procedure relating to the          Australia) for its Soy Isoflavone
   information which becomes a                intellectual property and                Technology to DuPont and has
   secret due to state of being               international trade.                     received $1.3 million. According
   unknown or inaccessible to a            Procurement of Trade Secret Rights          to the agreement Novogen Ltd,
   certain group of people normally                                                    who markets Prominsile, the
                                              No registration is required to
   engaging with the said trade                                                        menopause health supplement,
                                           obtain trade secret protection. Trade
   information which can be used                                                       Rimostil the postmenopausal
                                           secrets shall have protection as
   to seek commercial benefit on                                                       supplement, and Trinovin, the
                                           long as they are deemed secret.
   account of a state of its secret,                                                   prostate health supplement will
   and the holder of the trade secret      Rights of Trade Secret Owner                retain all its red clover-based
   has undertaken a proper action              A holder of a trade secret is           Isoflavone Technologies. The
   intended for keeping such               entitled to a right to disclose, take       Agreement also provides that
   information in secret.                  away or use the trade secret, or            Novogen shall receive regular
2. Trade Information means things          permit other person to disclose,            milestone payments and royalties
   which can communicate a                 take away or use the trade secret.          arising from sales of products
   statement, story, fact or any           A right to a trade secret is transferable   attracting Novogen patents relating
   matter by means of any method           by means of a juristic act made in          to soy Isoflavone applications. It
   of process and in any form,                                      Contd on...11                             Contd on...11
                                   Visit us at www.indianpatents.org.in
10
Contd from...10                          4. Reverse engineering.                   Contd from...10
Trade Secret ......                      Trade Secret Infringement                 International ......
writing or by way of inheritance.            The infringement of a trade secret    is in addition to the receipt of $11
Exceptions to Trade Secret               includes an act of disclosing, taking,    million followed by equity placement
   The following actions shall not       or using a trade secret without the       of $ 2.2 million and $ 826,000 in
be considered an infringement of         lawful consent of the trade secret        November 1998 and January 2002
trade secrets:                           owner and in a manner that breaches       respectively.
                                         fair commercial practice. In this             Changes have been made in the
1. Disclosure or use of a trade
                                         regard, infringer must know, or have      fee payable for the acceptance of
   secret by a person who obtained
   such a secret through a juristic      appropriate reason to know, that          patent applications in Australia. Under
                                         his action is contrary to fair            the new fee structure a AUD$140
   act, without awareness, or without
                                         commercial practices.                     constitutes base fee and a AUD$20
   any reason to be aware, that
                                         Litigation Limitation                     fee for every claim in excess of twenty.
   the other party acquired such
                                                                                   The deadline for paying the fee is three
   trade secret by violating another         Legal action against trade secret
                                                                                   months from the date the application
   person’s trade secret rights.         infringement shall not be entered
                                                                                   is advertised as “accepted” in the
2. Disclosure or use of trade secret     later than three years from the
                                                                                   Australian Official Journal of Patents.
   by government agency in charge        date the infringement and the infringer
                                                                                   The application lapses if the fee has
   of preserving such trade secrets      were known. However, this action
                                                                                   not been paid by the deadline. The
   in the circumstances in which:        shall be entered no later than ten
                                                                                   new fee only applies to standard
   a. It is necessary to protect         years from the date of infringement.
                                                                                   applications filed on or after1 September
      the public health and security;    Punishment                                2002 or PCT applications that enter
      or                                     Whoever discloses to the public       the national phase in Australia on or
   b. It is necessary for other public   a trade secret owned by other person      after 1 September 2002. The fee does
      interests, not for commercial      in a manner which is likely to put        notapplytoapplicationsforanInnovation
      purposes. In this regard, a        an end to the existence of the            Patent.
      particular agency that is          trade secret with intention to cause          PCT users will benefit from a
      charged with the keeping and       damage to the custodian of the            fee reduction for international
      maintaining of the trade secret,   trade secret in running its business      applications filed in electronic form,
      or a state agency or any           operation in way of an advertisement      following a decision to reduce
      concerned person that              in writing, radio broadcast, television   the cost of filing international
      obtained such trade secret,        broadcast, or by any other means          applications in electronic form
      shall take regular measures        shall be punished with imprisonment       by 200 Swiss francs, in line with
      to protect such trade secret       of not exceeding one year, or fine        the fee reduction granted to
      from unfair commercial use.        for an amount of not exceeding two        international applications filed using
   c. In case of disclosure made         hundred thousand baht, or both.           the PCT-EASY software. The
      to      an     international           Whoever being responsible for         amended schedule of fees entered
      organization or to a               work of custody of trade secret           into force on October 17,2002.
      government of a foreign country    illegally discloses or uses such             Three new members have
      being a member of the World        trade secret for the benefit of their     ratified the Patent Cooperation
      Trade Organisation as              own, or of other person shall be          Treaty (PCT) in 2002. The new
      stipulated under the Ministerial   punished with imprisonment of not         members include Nicaragua, the
      Regulation.                        exceeding one year, or fine in an         Seychelles and Saint Vincent.
3. Independent discovery as a result     amount not exceeding two hundred            Four new members viz
   of the expertise of the person        thousand baht, or both.                   Kyrgyztan, Nigeria, Slovakia and
   making the discovery:                                                           Solvenia have ratified the Patent
                                                                                                       Contd on...12
                                  Visit us at www.indianpatents.org.in
                                                                                                                       11
     Litigation Watch                    and Plastic from manufacturing and       Contd from...11
                                         selling pens which prima facie appear    International ......
    Intel Corporation has been hit
                                         to be similar in design to a product     Law Treaty in 2002.
with a $500 million infringement
                                         of Link Pens sold under the mark
lawsuit on an obscure IISC-                                                           South Korea’s patent numbering
                                         UniBall Vision Elite. The case
architecture patent developed by a                                                system has been adopted as the
                                         was filed by a Japanese company
once high-flying chip startup. The                                                global standard. KIPO’s patent
                                         Mitsubishi Pencil Co Ltd and its
patent at issue was awarded to                                                    numbering system consists of a
                                         sole distributor, Link Pen & Plastic     two-digit patent-type identifier, a
International Meta Systems Inc.
                                         Ltd. The Link pens were being            four-digit year for the patent
Later the rights to the patent were
                                         sold for Rs. 75 while the Flair pen      application number and a seven –
sold to Chicago based company
                                         was       being       offered      at    digit serial number, for example
called TechSearch, which has filed
                                         Rs. 20.                                  10/2003/1224567. It will be used
the suit against Intel and has charged
that Intel’s Pentium II and Pentium          A decision has been given by         to identify applications, published
Pro microprocessors infringe on          the Delhi High Court restraining         documents and registered rights
its technique for emulating the          the Mumbai-based Aftek Infosys           by industrial property offices round
instruction set of a target computer     Ltd and Calcutta based Jupiter Infosys   the globe. The first two digits
on a RISC architecture.                                                           classify whether the application is
                                         Ltd from marketing, advertising and
                                                                                  for an invention, a utility model, an
                                         dealing in goods and services under
    PolyMASC Pharmaceuticals Plc,                                                 industrial design, topography of
a wholly owned subsidiary of Valentis    the trademark or tradename
                                                                                  an integrated circuit or a trademark.
Inc has received a favourable ruling     ‘INFOSYS’.
                                                                                      Stressgen Biotechnologies
from the Japanese Patent Office in           In a lawsuit between Bloomfield      Corporation has been granted a
regard to patent invalidation            Co Ltd and Bagaria Business (P)          US patent (6, 524, 825) covering
proceedings brought by ALZA Corp,        Ltd, the Calcutta High Court has         fusion protein compositions
a unit of Johnson & Johnson. The         dismissed Bloomfield Tea Co Ltd’s        comprised       of    a    human
ruling received from the Trial Board     application to restrain Bagaria          papillomavirus (HPV) antigen
of the Japanese Patent Office has        Business (P) Ltd from using the          fused to a heat shock protein
dismissed the demand for invalidation    trademark/tradename ‘Bloomfield’         (Hsp), as well as DNA encoding
of claim 5 of Japanese patent No.        for tea produced in the Bloomfield       such fusion proteins, and methods
2948246, thereby maintaining the         area of Darjeeling.                      of treating an HPV infection using
validity of the claim. Claim 5 covers                                             these fusion proteins. This
a method for increasing the in vivo          Roche, ICN Pharmaceuticals           patent, owned by Stressgen, has
circulation lifetime of liposomes        and Riapharm have agreed on a            been exclusively licensed to
by pegylation.                           settlement regarding the pending         Roche for the development of
                                         patent disputes over ribavirin. The      HspE7.
   The Tokyo High Court has issued
                                         companies will stop all legal actions       With effect from 01 January
its decision denying Texas
                                         regarding ribavirin, including the       2003, the fee for filing an
Instruments’ appeal in the lawsuit
                                         lawsuits filed in the US. Roche          application for trademark
between Fujitsu Ltd and Texas
                                         will continue to register and            registration will be increased to
Instruments on Japanese patent
                                         commercialise its own version of         $335.00 per International Class.
320,275. The lawsuit was initiated
                                         ribavirin, Copegus, globally. The        The USPTO will not accept
by Fujitsu in 1991 seeking a
                                         financial terms of this settlement       applications that are filed on or
declaratory judgement that certain
                                         have not been disclosed, but it did      after that date that are not
Fujitsu semiconductor products do                                                 accompanied by a minimum of
                                         include Riapharm’s agreement to
not infringe the patent under dispute.                                            $ 335.00. Additionally, the fee
                                         license ribavarin to Roche.
   The Delhi High Court has                                                       for amending an existing
restrained Mumbai-based Flair Pen                               Contd on...13                            Contd on...13
                                 Visit us at www.indianpatents.org.in
12
Contd from...12                         upon their well known trademarks          Contd from...12
Litigation ......                       “Discovery Channel and Device”            International ......
   Netherlands company Applied          and “Discovery Channel”. The Beijing      application to add an additional class
Research Systems ARS Holdings           Administration for Industry and           or classed of goods/services will be
NV, has filed for patent infringement   Commerce ruled that China                 $335.00 per class for classes added
                                                                                  on after 01 January 2003.
in District Court at The Hague.         Engineering Drawing Society’s act
ARS alleges US company,                 had amounted to infringement and             USPTO has announced the
Transkaryotic Inc is infringing         had taken advantage in bad faith,         preliminary list of top 10 US universities
                                        of the goodwill of the Discovery          receiving the most patents during
European patent 0505, 500 covering
                                                                                  the year 2002. The list follows in the
an approach to gene activation          Communication in its trademarks.
                                                                                  table below.
relating to its Replagal (agalsidase
                                                                                  Organisation                Preliminary
alfa) product.                                                                                                #Patents
                                                                                                              in 2002
    Aristocrat Technologies Inc and         Some Important                        University of
International Game Technology have             Websites                           California                  431
settled their patent and trademark                                                Massachusetts Institute
                                        1. Canada          has      launched      of Technology           135
infringement dispute. The case
                                           DesignPlus, an electronic filing       California Institute of
involved patents and intellectual                                                 Technology                  109
                                           procedure explained at http://
property rights in the fields of                                                  Stanford University         104
                                           strategis.ic.gc.ca/sc_mrksv/
cashless technology, bonusing, and                                                University of Texas         93
                                           cipo/id/id_designplus-e.html.          Johns Hopkins
slot machine hardware. The terms
                                           With this system, the ID Office        University                  81
of the out-of-court settlement are                                                University of
                                           is now able to enter and
confidential.                                                                     Wisconsin                   81
                                           electronically capture all pertinent   State University of
    In a Canadian trademark lawsuit,       information relating to newly          New York                    55
a company called Ritvik manufactured       filed industrial design applications   Pennsylvania State
                                                                                  University                  50
building blocks that looked exactly        and amendments, including the
                                                                                  Michigan State
like LEGO building blocks                  data capture of new and amended        University                  49
manufactured by plaintiff Kirbi and        drawings by scanning.
                                                                                  For the tenth consecutive year
LegoCanada, except that they lacked     2. Chinese patents can now be             IBM has received the highest
the trademark logo which appeared          downloaded on the internet from        number of patents in 2002 followed
on the top of the knobs of the             a free site. The site itself is        by Canon. The top ten companies
LEGO blocks. Lego sued Ritvik              http://www.jiansuo.com but it          who got US patents in 2002 are
for statutory passing off under the        is entirely in Chinese. Preferably,    listed in the table below.
Trademarks Act. The Court however          one can consult the illustrated        Organisation                Preliminary
dismissed Lego’s case and ruled            instructions for using it at the                                   #Patents
                                                                                                              in 2002
that since the configuration of the        Mayall IP Links page at http:/         International Business
basic Lego building block was              /www.mayallj.freeserve.co.uk/          Machines Corporation
                                                                                  (USA)                       3, 288
functional, it could not be protected      china.htm
                                                                                  Canon Kabushiki
as a trademark in Canada.               3. SurfIP.com This intellectual           Kaisha (Japan)              1, 893
                                           property web portal launched           Micron Technology,
   US Discovery Communication                                                     Inc, (USA)                  1, 833
Corporation sued China Engineering         by Singapore offers patent search      NEC Corporation
Drawing Society who published the          in US, UK, EPO, Canadian,              (Japan)                     1, 821
                                           Japanese and PCT patent                Hitachi, Ltd (Japan)        1, 602
magazine, “Discovery-Popular
                                           database at the same time              Matsushita Electric
Science in Pictures” alleging that                                                Industrial Co,
                                                                                  Ltd (Japan)                 1, 544
the word ‘Discovery’ was infringing
                                                                                                            Contd on...14
                                 Visit us at www.indianpatents.org.in
                                                                                                                       13
                    Patents for Opposition                                            Contd from...13
                                                                                      International ......
   The following patent applications have been accepted by the Patent
                                                                                      Sony Corporation
Office and published in the Gazette of India. These can now be opposed                (Japan)                 1, 434
by filing opposition applications within a period of four months from the             General Electric
dates given. Six digit numbers allotted after acceptance by the Patent                Company (USA)           1, 416

Office are given before the applicant names and patent application                    Hewlett-Packard
                                                                                      Company (Japan)         1, 385
numbers given in brackets. Names of the branches of the Patent Office                 Mitsubishi Denki
are denoted in the application number, e.g. ‘Bom’ for Bombay branch. An               Kabushiki Kaisha(Japan) 1, 373
opposition application should be submitted at the appropriate office where
the concerned application was originally filed.
PATENT APPLICANTS                       INVENTION                                         Domestic News
A. 4 January, 2003
189215. Jonathan Aerospace Materials, A high strength structural material with             J B Chemicals and Pharmace-
Europe (917/Cal/96)                     three dimensional lattice structure and a     uticals has been granted patents
                                        method of producing the structural material
189216. Thomson Consumer Electronics A television apparatus on screen display         in the US and South Africa for 20
Inc,USA (941/Cal/96)                    system                                        new chemical entities (NCEs) in
189217. Deere & Company, Illinois       A cotton harvester for harvesting cotton
(1175/Cal/96)                           planted in narrow row
                                                                                      therapeutic areas of non-steroidal
189218. Siemens Aktiengesellschaft,     Method for the production of a read-only      anti-inflammatory drugs (NSAID).
Germany (1203/Cal/96)                   memory cell arrangement
                                                                                      The company is also considering
189219. Fenton Environmental            Thermal vaporization apparatus
Technologies Inc, Orleans (1837/Cal/96)                                               filing for patents in the EPO.
189220. Dr Tridibesh Mukherjee,         A device for the production of low
India (1903/Cal/96)                     phosphorous steel in converters                  (Ahuja Patent & Trademark
B. 11 January, 2003                                                                                News, Vol 5 No4)
189231. PPG Industries Ohio Inc,        An electrodepositable composition
Ohio (1341/Cal/95)                                                                       According to the Annual Report
189232. Siemens Aktiengesellschaft,     Steam turbine component                       (2001-2002) of Central Institute of
Germany (1119/Cal/96)
189233. Asta Medica Aktiengese-         Pharmaceutical powder cartridge with          Medicinal and Aromatic Plants
llschaft, Germany (1120/Cal/96)         integrated metering device and inhaler for    (CIMAP), Lucknow, 41 patents were
                                        powdered medicaments
189234. Daewoo Electronics Co,          An apparatus for encoding a contour of an     granted to CIMAP during 2001-
Korea (1193/Cal/96)                     object expressed in a digital video signal    2002. These included 20 Indian
189235. Siemens Aktiengesellschaft,     Start-up system for a continuous-flow steam
Germany (1373/Cal/96)                   generator
                                                                                      patents and 21 foreign patents.
189236. Aisa Automation Industrielle,   Process for producing a tubular body and a    Also 24 patents have been filed in
Switzerland (1426/Cal/96)               tubular body so produced                      India and abroad.
189237. Reckitt & Colman Inc,           A thickened pigmented aqueous
USA (1429/Cal/96)                       hypochlorite composition                          Jawaharlal Nehru’s Centre for
189238. Yukiko Hayashi, Japan           W ater treatment process and system
(1488/Cal/96)
                                                                                      Biotechnology (CBT) has to its
189239. Midwest Research Institute,     Process for preparation of a semiconductor    credit 7 (seven) patents till date
Missouri (1694/Cal/96)                  film
189240. Harnischfeger Technologies      A bucket rigging assembly
                                                                                      obtained during the last 17 years
Inc, Delaware (1760/Cal/96)                                                           of its existence.
C. 18 January, 2003                                                                       (Hindustan Times, 5 Feb 2003)
189241. ABB Alstom Power Inc, USA       A package boiler of unitary construction
(955/Cal/96)                                                                             The Bio-informatics Research
189242. Paul Damian Nelson of Suite,    A bicycle seat
Australia (1095/Cal/96)
                                                                                      Centre (BRC) of the USA and the
189243. Tai-Her Yang, China             A differential combined power distribution    Centre for Development of Knowledge
(1072/Cal/96)                           system
                                                                                      and Awareness (CEDKA) have
189244. Alstom Power Inc, USA           A sealing arrangement for a trisector
(1104/Cal/96)                           regenerative air preheater                    recently formed an alliance under
189245. Uponor Innovation AB,           A method and extrusion apparatus for          the research consortium Joint-Indo-
Sweden (1178/Cal/96)                    production of an oriented crystalline or
                                        semi-crystalline thermoplastic polymeric      American Bio-informatics Alliance
                                        article and article produced thereby          (JIABA). The alliance will aim at
189246. The Tensar Corporation, USA Bonded composite knitted structural textiles
(1500/Cal/96)                           useful as geotextile or geogrid                                      Contd on...15
                                   Visit us at www.indianpatents.org.in
14
189247. Daewoo Electronics Co, Korea                                                    Contd from...14
(1504/Cal/96)                           Apparatus for encoding a contour image of
                                        an object in a video frame of a video           Domestic ......
                                        signal
189248. Inter Wave Communications       A cellular adjunct system for extending         jointly conducting research and
International Ltd, Bermuda(1573/Cal/96) telephone service                               training in the field of multi-disciplinary
189249. Hoechst Celanese Corp, Jersey Process for improving productivity of a
(1828/Cal/96)                           carbonylation catalyst solution by removing     bio-informatics. Both organizations
                                        corrosion metals                                will become the nodal agencies for
189250. Manoharlal Mohta, India         A process for making eggless ice cream
(441/Cal/2000)                                                                          maintaining joint research data that
189251. Henkel Corporation, USA         A process of preparing a lubricant              can be used for multifarious
(1066/Mas/94)                           composition
189252. British Tele Communications     A system for pricing a telecommunications
                                                                                        applications. The programs initiated
Public, UK (263/Mas/95)                 call                                            by the alliance will further support
189253. Methanol Casalesa,              Mixing assembly for gaseous flows at            joint bio-informatics research and
Switzerland (298/Mas/95)                different temperatures in particular for
                                        heterogeneous exotherming synthesis reactor     intellectual transfer between the
189254. Coflexip Stena Offshore         A vessel for use in laying an under water       centres.
Limited, Great Britain (323/Mas/95)     pipeline
189255 The Cloroxy Company, USA         A bi-directional venting cap liner                  (The Tribune, 13 Feb 2003)
(350/Mas/95)
189256. Rosemount Inc, USA              A transmitter for measuring a process
                                                                                            Ranbaxy Laboratories Ltd has
(371/Mas/95)                            pressure                                        initiated talks with global
189257. Foster Wheeler Energia,         A pressurized reactor system                    pharmaceutical majors for an alliance
Finland (390/Mas/95)
189258. Lucas Industries Public         An actuator for a vehicle brake especially      in the filed of R&D. The alliance
Limited, England (517/Mas/95)           a disc brake                                    will straddle the whole spectrum of
189259. Indian Institute of Technology, An improved internal combustion engine for
India (554/Mas/95)                      achieving accelerated and more efficient        R&D ranging from discovery of
                                        combustion of air-fuel mixtures                 molecules to clinical trials. The
189260. Commonwealth Scientific And     An apparatus for conditioning textile fabrics
Industrial Research, Australia          and a process thereof
                                                                                        alliance will be on the basis of the
(574/Mas/95)                                                                            technology and intellectual property.
D. 25 January, 2003
189271. Rodger C Finvold, A US                                                             (Business Standard, 13 Feb 2003)
Citizen (989/Del/93)                    A planetary inertial power device                   India and US have signed a
189272. Regenesys Technologies          Electrochemical apparatus for energy
Limited, United Kingdom (1105/Del/93)   storage and/or power delivery                   protocol on hi-tech cooperation.
189273. Rollatainers Limited,           A pouch for storage and dispensing of fluid     The protocol is expected to boost
India (0030/Del/94)                     products
189274. CSIR, New Delhi                 An improved process for the preparation of
                                                                                        joint ventures in high technology
(1973/Del/98)                           high yielding technical dry amorphous oil-      including dual use items and
                                        free powder containing 10 to 17%
                                                                                        encouraging joint ventures capitals
                                        azadirachtin
189275. Smithkline Beechamp P L C,      A process for preparing a pharmaceutical        to fund projects in this field. The
England (2087/Del/98)                   composition for treatment of diabetes           protocol will also promote the
                                        mellitus and conditions associated with
                                        diabetes mellitus                               exchange of scholars giving both
189276. Ranbaxy Laboratories Ltd,       Process for preparing a highly pure             sides an opportunity to share
New Delhi (2235/Del/98)                 preparing a highly pure predominantly
                                        amorphous form of cefuroxime axetil
                                                                                        intellectual property or conduct
189277. CSIR, India (2384/Del/98)       A process for the preparation of a novel        research in critical technology
                                        fibrinolytic peptide from venom of snake
                                                                                        areas.
                                        indian king cobra (ophiophagus hannah)
                                        useful for pharmacological purposes                (The Indian Express, 7 Feb 2003)
189278. Bayer Corporation, Germany      A process for preparing n-(4-flurorophenyl
(3708/Del/98)                           (-n-(1-methylethyl)-2-[(5-(trifluoromethyl)-1      India has ratified the Cartagena
                                        3 4-thiadiazol-2-yl)-oxy]-acetamide using an    Protocol on bio-safety, the first
                                        aprotic aromatic solvent
189279. L Air Liquide Societe           Process and distillation installation for
                                                                                        framework for safe transfer,
Anonyme Pour L Etude,                   distilling a gas mixture                        handling and use of genetically
France (1461/El/99)
                                                                                        modified organizations.
189280. The Procter & Gamble            A unitary sanitary napkin
Company, Ohio (604/Del/2000)                                                               (The Times of India, 7 Feb 2003)

                                                                                                                  Contd on...16
                                    Visit us at www.indianpatents.org.in
                                                                                                                              15
                      PFC on the move…                                             Contd from...15
                                                                                   Domestic ......
   PFC organised 11 workshops                 PIC, Jaipur.
                                                                                       CentreforDevelopmentofTelematics
in the months of February and           6.    In association with Ministry of      (C-DoT) has received a US patent for
March 2003 at the following places            SSI at NOIDA on March 17,            Asynchronous Transfer Mode (ATM)
:                                             2003.                                switch fabric implementation, which
1.   Rajasthan University, Jaipur,      7.    Kerala Agriculture University,       enables higher speed data transmission
     Rajasthan on February 11, 2003           Trissur, Kerala on March 21,         through a new method of routing
2.   A half-day workshop with 4th             2003                                 information packets. C-DoT has filed
     All India People’s Technology      8.    St. Berchmans College,               18 other patents as well.
     Congress organised by Forum              Changanachhery, Kerala on            (The Economic Times, 7 Feb 2003)
                                              March 22, 2003                           Morepen Laboratoris Ltd has filed
                                        9.    Mahirshi Dayanand Saraswati          a PCT application for manufacturing
                                              University, Ajmer, Rajasthan         process of desloratadine, the $500
                                              in association with PIC, Jaipur      million drug patent meant for treatment
                                              on March 27, 2003                    of allergy, cough and cold. It has also
                                        10. In association with Patna              launched the generic version of the
                                            Science College, Patna on              drug in the domestic market and is
                                            March 27, 2003                         marketing the drug under the brand
       (Workshop at Patna)
                                                                                   name “Desnova’.
                                             A seminar on “International
     of Scientists, Engineers &
     Technology (FOSET) an NGO
     in association with PIC, West
     Bengal on February 23, 2003.                                                  PFC ......
3.   R M K Engineering College,
                                                                                   17-18, 2003. This was followed by a
     Kavaraipettai, Tamilnadu on
                                                                                   workshop on “Drafting of Claims” on
     February 26, 2003.
                                                                                   February 19, 2003. The faculty included
4.   Nagpur University, Nagpur,                                                    senior officials from EPO and patent/
     Maharashtra on March 8, 2003                                                  trademark attorneys from leading
                                                 (Seminar in Delhi)
     in association with Science &                                                 attorney firms in Germany, Japan,
     Technology Cell, of Maharastra     Scenario of Intellectual Property” was     USA, UK and UAE. The participants
     Government, Mumbai                 organised jointly with the Institute of    included 35 scientists and technologists
5.   BITS, Pilani, Rajasthan on March   Intellectual Property Research and         from industry, academia, government
     12, 2003 in association with       Practice (IIPRP) in Delhi from February    departments and R&D institutes.

                      Please send us questions and topics you
                       would like to see in the coming issues
                                        Published by: Patent Facilitating Centre (PFC)
 NEXT ISSUE                             Technology Information, Forecasting and Assessment Council (TIFAC)
                                        Department of Science and Technology (DST)
 • Case Study                           Technology Bhavan, New Mehrauli Road, New Delhi - 110 016
                                        Tel.: 26859581, 26863877, 26967458, 26567373 Fax: 26863866
 • Case Law                             e-mail: tifac@nda.vsnl.net.in website: www.indianpatents.org.in and www.tifac.org.in
                                        Editor: R. Saha, Director, PFC
 • Patents for Opposition
                                        Printed by Reliant Press Pvt. Ltd., New Delhi-110 020
                                        Telefax: 2638 4567, 2638 9593 e-mail : reliantpress@yahoo.com

                                Visit us at www.indianpatents.org.in
16

								
To top