CROP PROTECTION PROGRAMME

					                 CROP PROTECTION PROGRAMME

                               R7571 (ZA0376)

    Management of Virus Diseases of Vegetable Crops in Kenya
              FINAL TECHNICAL REPORT

                    01 March 2000 – 31 March 2003
                              Dr Nicola Spence

Horticulture Research International, Wellesbourne, Warwick, CV35
                             9EF UK

             Date FTR completed___2003_____________




"This publication is an output from a research project funded by the United Kingdom
Department for International Development for the benefit of developing countries. The
                 views expressed are not necessarily those of DFID.”
                   R7571, CROP PROTECTION PROGRAMME
Acronyms

AVRDC      Asian Vegetable Research and Development Centre
BtMV       Beet mosaic virus
BWYV       Beet western yellows virus
CABI-ARC   Centre of Applied Biosciences International – Africa Regional Centre
CaMV       Cauliflower mosaic virus
CPP        Crop Protection Programme
DAS        Double antibody sandwich
DBM        Diamond back moth
DFID       Department for International Development
ELISA      Enzyme Linked Immunosorbent Assay
HRI        Horticulture Research International
KARI       Kenyan Agricultural Research Institute
NRI        Natural Resources Institute
PRA        Participatory Rural Appraisal
PTA        Plate trapped antigen
PU         Peri-urban
SE         Socio-economist
TGM        Brassica juncea cv. Tendergreen Mustard (TGM)
TuMV       Turnip mosaic virus
TABLE OF CONTENTS


01 March 2000 - 31 March 2003



Executive Summary............................................................................................................... 1

Background..………………………………………………………………………………..3

Project Purpose ...................................................................................................................... 6

Research Activities ................................................................................................................ 7

   Research Activity 1.1 Stakeholder workshop to finalise the work plan and ensure co-
   ownership of the project. ................................................................................................... 7
   Research Activity 1.2 Survey, collection and identification of virus isolates from
   brassica and spinach crops on peri-urban vegetable farms................................................ 7
     Characterisation of samples........................................................................................... 7
   Research Activity 1.3 Screenhouse experiment to determine the effect of virus on yield
   in cabbage crops ................................................................................................................ 8
   Research Activity 1.4 Screenhouse experiments to determine effect of the timing of
   virus infection .................................................................................................................. 10
   Research Activity 1.5 Screenhouse experiment to determine the effect of BtMV on the
   yield of spinach................................................................................................................ 13
   Research Activity 2.1 To investigate methods to protect Brassica seed beds from virus
   infection........................................................................................................................... 17
   Research Activity 2.2 To determine any quantitative effects of reducing virus infection
   in Brassica seedbeds on the levels of virus disease in the transplanted crop .................. 19
   Research Activity 2.3 Evaluation of farmer acceptability of alternative control strategies
   ......................................................................................................................................... 20
      Phase one of the partial budget.................................................................................... 22
      Phase two of the partial budget ................................................................................... 22
      Statistical analysis of the yield data............................................................................. 22
      Farmer discussions and evaluation of the control strategies ....................................... 22
   Research Activity 3.1 To determine pathotype variability of TuMV isolates................. 23
     Attempt at CaMV classification.................................................................................... 23
   Research Activity 3.2 Evaluate local cultivars of cabbage and kale for resistance to
   TuMV and CaMV and a local cultivar of swiss chard for resistance to BtMV .............. 25
     TuMV inoculations...................................................................................................... 25
     CaMV inoculations...................................................................................................... 25
     BtMV inoculations ...................................................................................................... 25
   Research Activity 3.3 Screen promising cultivars and land races................................... 25
   Research Activity 3.4 To determine the potential of self-selection of seed .................... 26
   T14................................................................................................................................... 27
     Block 2......................................................................................................................... 27
       Block 1......................................................................................................................... 27
   T5..................................................................................................................................... 27
   Research Activity 4.1 PRA to assess farmer problems, perceptions and practices in
   relation to virus diseases and their aphid vectors ............................................................ 30
   Procedure for evaluation.................................................................................................. 31

Outputs….… ....................................................................................................................... 32

   Research Activity 1.1 Stakeholder workshop to finalise the work plan and ensure co-
   ownership of the project. ................................................................................................. 32
   Research Activity 1.2 Survey, collection and identification of virus isolates from
   brassica and spinach crops on peri-urban vegetable farms.............................................. 32
     Discussion.................................................................................................................... 32
   Research Activity 1.3 Screenhouse experiment to determine the effect of virus on yield
   in cabbage crops .............................................................................................................. 36
      Discussion.................................................................................................................... 36
   Research Activity 1.4 Screenhouse experiments to determine effect of the timing of
   virus infection .................................................................................................................. 38
      Discussion.................................................................................................................... 38
   Research Activity 1.5 Screenhouse experiment to determine the effect of BtMV on the
   yield of spinach................................................................................................................ 42
      Discussion.................................................................................................................... 42
   Research Activity 2.1 To investigate methods to protect Brassica seed beds from virus
   infection........................................................................................................................... 42
      Discussion.................................................................................................................... 47
   Research Activity 2.3 Evaluation of farmer acceptability of alternative control strategies
   ......................................................................................................................................... 52
      2.3.1 Results of initial PRA activity ............................................................................ 52
      2.3.2 Results of Participatory Budgeting activity........................................................ 52
      2.3.3 Results of evaluation of treatments .................................................................... 52
      Agreement by farmers to try the disease control strategies on their farms ................. 56
      Discussion.................................................................................................................... 56
   Research Activity 3.1 To determine pathotype variability of TuMV isolates................. 57
     Discussion.................................................................................................................... 57
   Research Activity 3.2 Evaluate local cultivars of cabbage and kale for resistance to
   TuMV and CaMV and a local cultivar of swiss chard for resistance to BtMV .............. 57
     Brassica napus ............................................................................................................. 59
     Spinacia oleracea ......................................................................................................... 59
     Discussion.................................................................................................................... 60
   Research Activity 3.3 Screen promising cultivars and land races................................... 60
     Discussion.................................................................................................................... 61
   Research Activity 3.4 To determine the potential of self-selection of seed .................... 61
       Plant selection.............................................................................................................. 61
   Research Activity 4.1 PRA to assess farmer problems, perceptions and practices in
   relation to virus diseases and their aphid vectors ............................................................ 65
      Results of PRA to assess farmer problems, perceptions and practices. ...................... 65
      Farmer wealth ranking................................................................................................. 66
      General problems and constraints in vegetable production and marketing................. 66
      Farmer ranking of common kale and cabbage varieties .............................................. 66
      Farmers’ perceptions of virus diseases........................................................................ 66
      Athi River .................................................................................................................... 66
      Ruiru ............................................................................................................................ 69
      Evaluation of the effect of various symptoms on marketability, pricing and
      palatability of kale and cabbage .................................................................................. 70
      Control methods used by farmers................................................................................ 70
      Discussion.................................................................................................................... 70

Contribution of Outputs to developmental impact .............................................................. 71
       What further research is necessary? ............................................................................ 72
       Pathways whereby present and anticipated future outputs will impact on poverty
       alleviation or sustainable livelihoods .......................................................................... 73

Biometricians Signature ...................................................................................................... 75
Appendices

  Appendix 1 - Survey of viruses of vegetable crops in the peri-urban production systems
  of Kenya – ZA0272 ......................................................................................................... 76

  Appendix 2 - Mechanical Inoculation ............................................................................. 86

  Appendix 3 - Tables ........................................................................................................ 90


  Appendix 4 -     Management of Vegetable Virus Diseases in Kenya: Farmer
  Perceptions and Evaluations of Control Strategies, J M Njuki, N A Phiri and A
  Mwaniki……………………………………………………………………………… 98

  Appendix 5 - Rural rapid appraisal on kale seed selection/in choice…………………..99


  Appendix 6 - Visit to Kenya for Stakeholders Workshop and field visit to Nyathona to
  observe virus diseases of Brassica and spinach…………………………………….…102


  Appendix 7 - A survey of vegetable (Brassicas) viral diseases in the peri-urban systems .
  Valerie Palapala, March 2000…………………………………………………………103


  Appendix 8 - Internal Reports………………………………………………………..109
  References…………………………………………………………………………….111

  Appendix 9 - Disseminations and Posters……………………………………………112
TABLE OF FIGURES:
Figure 1.3.1 Construction of screenhouses at Thika, NARL................................................. 9
Figure 1.3.2 Design of screenhouse experiment to assess the impact of TuMV & CaMV)
     both singly and in combination on the yield of cabbage ............................................. 11
Figure 1.3.2 Planting of screenhouse trial ........................................................................... 12
Figure 1.4.1 Design of screenhouse experiment to assess impact of timing of Turnip
     mosaic virus (TuMV) infection on cabbage yield. 1, control (buffer inoculated); 2,
     first TuMV inoculation; 3, second TuMV inoculation................................................ 14
Figure 1.4.2 Design of screenhouse experiment to assess the effect of timing of Turnip
     mosaic virus (TuMV) infection on yield of kale ......................................................... 15
Figure 1.5.1 Design of screenhouse experiment to assess the effect of timing of Beet
     mosaic virus infection on the yield of swiss chard...................................................... 16
Figure 1.5.2 Assessment sheets for swiss chard experiment............................................... 18
Figure 2.3.1 A breakdown of the farmer groups that participated at different stages of
     Activity 2.3 .................................................................................................................. 21
Figure 3.4.1 Field Design for On-Station Farmer Seed Selection Trial .............................. 27
Figure 3.4.2 Assessment sheets for on-farm trials of potential of self seed selection......... 28
Figure 3.4.3 Design of on-farm self-selection of seed experiments at Kinale .................... 29
Figure 3.4.4 Farmers assessement sheets for evaluation of self-seed selection .................. 31
Figure 1.2.1 Comparison of known Beet mosaic virus sequence (BtMV) with unknown
     swiss chard potyvirus sample sequence (Poty) ........................................................... 34
Figure 1.3.2 Results of the effect of Turnip mosaic virus (TuMV) and Cauliflower mosaic
     virus (CaMV) on yield of cabbage .............................................................................. 37
Figure 1.4.3 Effect of timing of TuMV infection on yield of cabbage, season 1................ 39
Figure 1.4.4 Effect of timing of TuMV infection on cabbage yield, season 2 .................... 40
Figure 1.4.5 Effect of timing of TuMV infection on kale yield .......................................... 41
Figure 1.5.3 Effect of timing of BtMV infection on swiss chard........................................ 43
Figure 2.1.1 Effect of treatments on average head number and weight of cabbage at
     Kabete, season 1 .......................................................................................................... 44
Figure 2.1.2 Combined effect of fleece and straw treatments on aphid numbers at Kabete,
     season 1 ....................................................................................................................... 45
Figure 2.1.3 Effect of treatments on aphid numbers at Kabete, season 2 ........................... 46
Figure 2.1.4 Effect of treatments on virus incidence at Kabete, season 1........................... 48
Figure 2.1.5 Effect of treatments on virus incidence at Thika and Kabete, season 2.......... 49
Figure 2.1.6 Relationships between aphid numbers and virus incidence at (a) Thika, season
     1; (b) Thika, season 2; (c) Kabete, season 1; (d) Kabete season 2 .............................. 50
Figure 2.1.7 Effect of treatments on diamond back moth numbers at Thika and Kabete,
     season 2 ....................................................................................................................... 51
Figure 3.3.1 Assessment of seed lots at NARL and Thika for percentage of marketable
     leaves and infected plants ............................................................................................ 62
Fig. 3.3.2 Assessment of seed lots at NARL and Thika for total number of marketable
     leaves per plot harvested over the season.................................................................... 63
Fig. 3.3.3 Assessment of seed lots at NARL and Thika for total marketable weight of
     harvested leaves per plot over the season.................................................................... 64
LIST OF TABLES

Table 3.1.1 Table of CaMV monoclonal antibodies produced at HRI and their isotype ... 24

Table 1.2.1 Sample locations in liquid nitrogen.................................................................. 33

Table 1.2.2 Summary of samples of TuMV and CaMV in different peri-urban regions ... 35

Table 2.3.1 Wealth indicators for Athi River and Ruiru ..................................................... 53

Table 2.3.2 Statistical partial budget (on a per ha basis)..................................................... 54

Table 2.3.3 Calculating the benefits .................................................................................... 54

Table 2.3.4 Farmers ranking of treatments in Athi River and Kariguini, where 1 = best and
4 = worst……………. ......................................................................................................... 54

Table 2.3.5 Merits and demerits of treatments by farmers in Athi River and Kariguini..... 55

Table 3.1.2 Pathotypic and serotypic groupings of TuMV isolates. ................................. 58

Table 3.2.1Brassica napus, B. oleracea and Spinacia oleracea tested for resistance to
Turnip mosaic virus (TuMV), Cauliflower mosaic virus (CaMV) and Beet mosaic virus
(BtMV)…… ........................................................................................................................ 59

Table 4.1.1 Vegetable production constraints considered important by farmers in Athi
River and Ruiru ................................................................................................................... 67

Table 4.1.2 Landraces and varieties of kale and cabbage considered priorities by farmers in
Athi River and Ruiru ........................................................................................................... 67

Table 4.1.3 Disease calendar for kale in Athi River and Ruiru........................................... 68
Executive Summary
The Department for International Development (DFID) funded this research project through
the Crop Protection Programme (CPP). It was implemented through a collaborative effort
between Horticulture Research International (HRI), UK, Kenyan Agricultural Research
Institute (KARI), Kenya and Centre for Applied Biosciences International – Africa Regional
Centre (CABI-ARC), Kenya.


Smallholder horticultural production is an important and expanding component of rural
livelihoods in Kenya. Vegetable production provides employment and income for farmers,
their families and employees in regions where unemployment levels are high. Pest and
disease damage threatens the yield of crops and to prevent them, vegetable farmers’ usual
response is heavy and frequent application of pesticides. These are expensive and are often
unsuccessful in protecting crops, especially against virus disease. Reliance on pesticides has
led to increasing concern about residues in produce, operator safety, pesticide resistance and
environmental damage. Few alternatives are currently in use.


The project arose as a result of concern expressed by KARI, CABI-ARC and the peri-urban
(PU) PSL that virus diseases were not being adequately addressed by the on-going PU
vegetable project cluster which focuses on insect pests and nematodes. A short programme
development study in February 1999 confirmed high levels of virus in cabbage, cauliflower
and kale crops but the impact of these viruses on crop yield was unknown. The overall aim of
the project was to develop improved methods for the control of virus diseases, in particular
Cauliflower mosaic virus (CaMV) and Turnip mosaic virus (TuMV), in brassica crops in the
PU vegetable systems being studied within the PU vegetable project cluster in Kenya.


The project developed recommendations for improved control of virus diseases in several key
areas:
•   The use of existing brassica varieties to best effect by screening land races of cabbage and
    kale for virus resistance.
•   The use of simple, low-input methods to control aphids (which are often unnoticed or not
    attributed as the causal organism of virus disease by farmers).
•   Development of an understanding of virus diseases and the control strategies available
    within the socio-economic context of peri-urban farming systems.


                                               1
•   Characterisation of TuMV and CaMV isolates in Kenya to identify amount of variability
    present in natural populations.
•   Discussion of all research work with farmers and other stakeholders so that farmer needs
    could be addressed throughout the project.
•   Consideration has been given to how virus disease management could be integrated with
    pest management.
•   Two concept notes have been submitted to CPP: one takes forward on-farm seed
    multiplication and improvement of seed quality in Kenya (CN802). The other (CN801)
    promotes sustainable approaches to nematode and virus control.




                                                 2
Background
Recent population explosions in towns and cities are major phenomena of the last three
decades in developing countries. This increase in the urban population presents a major
challenge to the agricultural production sector of these countries to provide an adequate food
supply to this growing urban centre. However, it also provides a major opportunity for small-
scale farmers to supply fresh food to towns, which can be an extremely lucrative market. The
small vegetable producing farms that surround Nairobi, while covering no more than 40,000
ha of smallholdings, provide a living for 150,000 people who produce food for the towns and
also vegetables for export. Production of fresh vegetables for towns is one of the few ways in
which very small farms can remain economically viable.


The intensive farming techniques used by smallholder farmers generate very high incomes
but unfortunately these practices are threatening the sustainability of such farms because it is
an ideal environment in which diseases and pests can thrive and build up to very high levels.
This problem has arisen in vegetable producing regions of Kenya where there is a high
incidence of virus diseases and insect pests. Insect pests, some of which can be vectors of
virus, are showing such high levels of resistance to chemical insecticides that both the total
productivity and the profitability of vegetable farming is affected. The frequent use of
chemicals is also increasing environmental pollution and poses an increasing hazard to the
workers, who must spray or handle the crops, as well as final consumers.


Virus diseases cause symptoms in crop plants that severely affect quality and reduce yield.
There are many reports of field studies designed to determine yield losses caused by virus
diseases. Examples are a 36% yield reduction caused by TuMV in cabbage (Walkey &
Webb, 1978); 24-75% yield reduction in cassava in Kenya (Seif, 1982) and 25-60% yield
reduction in maize caused by maize streak virus in Kenya (Guthrie, 1978). Virus diseases are
known to affect important vegetable crops in Kenya and previous work by HRI, KARI and
the Natural Resources Institute (NRI) revealed that TuMV and CaMV viruses infect Kale.
However, there is currently no information on the impact of virus diseases in the cluster of
projects on Integrated Pest Management in vegetable crops in Kenya.


This project arose from concern expressed by the PU-PSL, KARI and CABI that virus
diseases were not being adequately addressed by the on-going PU vegetable project cluster
which focuses on insect pests and nematodes. The need for a project to address virus diseases



                                               3
was upheld by a survey of virus diseases in vegetable production on farms around Nairobi,
supported by DFID Crop Protection Programme (CPP) (Spence, 1999 (Appendix 1)). The
survey provided more information about the distribution and relative importance of viruses
and found that cabbage, cauliflower and kale crops were virtually 100% infected with
combinations of TuMV, CaMV and Beet western yellows virus (BWYV). Although there is
no data for the economic significance of these viruses in Kenya, crop losses may be
considerable because virus infection causes stunting of plants and reduced leaf area (kale) or
head production (cabbage). However, in some crops there were reasonable yields despite
extensive virus infection. This could be due to the time at which the crop became infected
with virus where later infections probably have less impact on yield. All three viruses
infecting these Brassica oleracea crops (cabbage and kale) are transmitted by several aphid
species and are not transmitted in seed, however from observations and previous experience
BWYV is not considered to be causing significant symptoms or losses. KARI identified the
assessment of the economic significance of viruses in kale and cabbage as a research priority.


The non-persistent mode of transmission for TuMV means that it is very difficult to control
using insecticides because brief probes by aphids are enough to cause virus infection. There
may be more success in the control of CaMV as this is transmitted in a persistent manner,
which means that aphids have to probe for longer to allow transmission of virus therefore
allowing more time for the chemical control to take effect. Plant resistance is a more
environmentally friendly method of controlling virus and is likely to be more effective than
chemical control. Although no monogenic resistance has been identified in B. oleracea there
are quantitative differences in resistance and it was noted that in Kenya there was some
phenotypic variation in local cultivars of kale and differences in susceptibility to viruses in the
field. Such cultivars are probably land races and some interesting sources of resistance could
be present. Furthermore, partial resistance in these land races may be preferable to immunity
because with monogenic resistance there is strong selection pressure for matching virulence
genes in the pathogen. Seed was collected from land races of kale from the Kinale region, an
area where farmers save and sell seed for planting. As there is evidence of differences in
virus susceptibility of these land races in the field, seed should be screened for virus resistance
and the potential for self-selection of seed by farmers to reduce incidence of diseases
investigated. For evaluation of genetic resistance in land races of kale it will also be
necessary to determine pathotype variability.        This is currently possible for TuMV as
differential cultivars and monoclonal antibodies are available at HRI. There is no system for



                                                4
determining the pathotype of CaMV isolates, but local Brassica lines could be screened to
examine CaMV variation. Isolates of CaMV and TuMV collected in the survey have been
preserved for future use in these proposed studies.


In Kenya most brassica crops observed were initially grown in seed-beds where seed is
densely sown. Seedlings are transplanted from seed-beds directly into the field. High levels
of virus infection (10-50%) were observed in the seed-beds, although it is not known if this
influences the subsequent level of virus infection developing in the transplanted crop.


In the survey it was also noted that pepper crops were 100% infected with combinations of
pepper mild mottle virus and potyviruses, although as up to 10 different potyviruses can
infect pepper further identification work is required. Cucumber and spinach crops were
also severely affected by potyviruses, thought to be Watermelon mosaic potyvirus 2
(WMV-2) and Beet mosaic potyvirus (BtMV) respectively. Spinach is an important leafy
vegetable crop and further research on the economic significance of viruses in spinach may
also be appropriate. Other crops that were virus infected included celery, pumpkin and
lettuce. The viruses of importance in these vegetable crops are aphid-transmitted but not
seed-transmitted and the key to their control is the use of resistant cultivars and
management of the aphid vector.         With such a wide range of crops with possible
economically significant diseases it is necessary to prioritise research requirements,
therefore the proposed research focuses on Brassica crops, with the possiblility of some
work on spinach at a later time.




                                               5
Project Purpose
As defined in the Project Memorandum the Project Purpose was to develop improved
methods for the control of virus diseases, in particular CaMV and TuMV in brassica crops in
the peri-urban (PU) vegetable systems being studied within the PU vegetable cluster in
Kenya.


The project aimed to achieve virus control through:


•   identification of virus-resistant germplasm
•   cultural control methods to reduce virus incidence and spread
•   improved vector control.


The project will have contributed directly to the achievement of the PU output 101:
“Improved methods for controlling weeds, insect pests, diseases and nematodes in market
gardening and horticultural enterprises developed and promoted” and purpose for Kenya,
a DFID target country.”




                                                  6
Research Activities
Research Activity 1.1 Stakeholder workshop to finalise the work plan and ensure co-
ownership of the project.
Several institutes, CABI, HRI, KARI and NRI were collaborators in this project. To target
activities for maximum impact a workshop was held to facilitate co-ordination activities
and “face-to-face” brainstorming.
The objectives of the workshop were:
   •   To introduce project stakeholders to each other and encourage co-ownership of the
       project.
   •   To systematically discuss each of the project activities in detail and finalise i) what
       should be done, ii) how it should be done and iii) who should do it. As this project
       is part of a PU cluster it was also important to establish how the project activities
       could complemet the other projects.
   •   Some project stakeholders visited Nyathona to observe virus diseases of Brassica
       and spinach and to start survey and collection of virus infected samples.


Research Activity 1.2 Survey, collection and identification of virus isolates from
brassica and spinach crops on peri-urban vegetable farms.
Brassica oleracea samples were collected and characterised during a survey of virus diseases
in vegetable production in 1999 (Spence, 1999 (Appendix 1)). These isolates were stored
only in the UK. As Kenyan quaratine regulations do not allow re-importation of viruses
another 263 B. oleracea and Spinacia oleracea samples were collected from farms in the PU
regions of Nairobi during this project. Samples were identified and stored at HRI, UK and at
CABI/KARI, Kenya.



Characterisation of samples
After samples were collected they were characterised and stored for use later in the project.
Each sample was divided into two, one part was kept at CABI/KARI, Kenya and the other
was kept at HRI, UK.


At KARI/CABI the sample was further divided. One part was stored at –20°C, another
ground and mechanically inoculated (Appendix 2) to susceptible plants and the other part
ground for TuMV and CaMV ELISA tests (Appendix 2).



                                             7
At HRI the sample was divided, one part was ground in inoculation buffer and stored in
liquid nitrogen. The other part was mechanically inoculated (Appendix 2) to a universally
susceptible host, Brassica juncea cv. Tendergreen (TGM). Symptoms were observed and
recorded for three weeks. After three weeks, each sample was tested for the presence of
TuMV and CaMV using ELISA (Appendix 2). Some samples were tested by electron
microscopy (EM) to confirm ELISA test results. If the symptoms seen in TGM were good,
an infected leaf was ground and diluted in inoculation buffer and stored in liquid nitrogen
because success of revival from liquid nitrogen was previously found to be more successful
from TGM than from field samples (S. Muthumeenakshi, personal communication).


BtMV was previously isolated from swiss chard in Kenya. Swiss chard samples collected
during the project were mechanically inoculated (Appendix 2) to Spinacia oleracea. Once
symptoms developed, infected leaves were ground in inoculation buffer and the samples were
stored in liquid nitrogen.    For identification purposes the samples were mechanically
inoculated to a range of indicator plants (Nicotiana tabacum, N. benthamiana, N. glutinosa,
Chenopodium quinoa, TGM). Once symptoms appeared, the samples were tested for the
presence of a potyvirus using ELISA (Appendix 2) and the potyvirus identified using PCR
(Appendix 2). Samples were sent to Dr Willi Metzger, SequiServe for sequencing. BLAST
through the NCBI database and DNAStar were used to compare the sample sequence with
other known sequences.


Research Activity 1.3 Screenhouse experiment to determine the effect of virus on yield
in cabbage crops
Screenhouses were purpose built for research activities 1.3, 1.4 and 1.5 (Fig 1.3.1).


Cabbage cultivar Gloria was chosen for this experiment in October 2000 because it was
identified as the most commonly grown cabbage cultivar (Oruko & Ndun’gu, 1999).
There were four treatments: TuMV only, CaMV only, TuMV & CaMV combined and
inoculation buffer (control). Twelve two-week old seedlings were mechanically inoculated
(Appendix 2) per treatment. Isolates 89 (TuMV) and 24 (CaMV) were used (Appendix 3).
Once plants began to show symptoms, typically two weeks after inoculation, they were
assessed for presence or absence of TuMV and CaMV using TuMV-PTA ELISA and
CaMV-DAS ELISA respectively (Appendix 2). If ELISA results were as expected the



                                              8
Figure 1.3.1 Construction of screenhouses at Thika, NARL




                                            9
plants were planted out in the design shown in Figure 1.3.2 (Figure 1.3.3). The plants were
assessed every two weeks for disease symptoms.


The first attempt at this experiment was destroyed by black rot. The screenhouses were
successfully sterilised by wetting and heat solarization (S. Roberts, HRI, personal
communication) and the experiment repeated in September 2001. Cabbage cultivar Sugarloaf
was used rather than Gloria F1 because Gloria F1 was susceptible to black rot. Sugarloaf was
also chosen because virus disease symptoms were easy to identify. Unfortunately the second
attempt was not successful due to mixed virus infections in seedlings raised at KARI-NARL.
Vector proofing was found to be inadequate in the glasshouses and repairs were carried out.


The third attempt, in December 2001, was successful. There were four treatments as before
and 12 two-week old Sugarloaf seedlings were mechanically inoculated per treatment.
TuMV isolate 249 and CaMV isolate 189 were used (Appendix 3). Once plants began to
show symptoms they were assessed for presence/absence of TuMV and CaMV using TuMV-
and CaMV- PTA ELISA. The plants were planted into the screenhouse in the design shown
in Figure 1.3.2 and were assessed every two weeks for disease symptoms as before.


Ten weeks after transplanting the cabbages were harvested, weighed using hand-held
scales and assessed as marketable (firm heads) or unmarketable (not firm or de-formed
heads or severe virus symptoms). The data was then statistically analysed.


Research Activity 1.4 Screenhouse experiments to determine effect of the timing of
virus infection
In the project memorandum the activity described was to asssess the impact of different
timings of infection by TuMV and CaMV on yield of cabbage and kale. However, when the
results of Activity 1.3 showed that CaMV did not have any effect on cabbage yield it was
decided to investigate with just TuMV.


In April 2002 seedlings were mechanically inoculated (Appendix 2) with TuMV isolate 249;
12 seedlings were mechanically inoculated with inoculation buffer. After two weeks the
seedlings were tested for the presence of TuMV using TuMV-PTA ELISA (Appendix 2).



                                             10
Figure 1.3.2 Design of screenhouse experiment to assess the impact of TuMV & CaMV) both singly and in combination on the yield of cabbage


         House 1



                                            C               N         N             T              N           T&C




                                           T&C              T        T&C            C              T             C




         House 2



                                            C               N         T             C            T&C             C




                                           T&C              T        T&C            N              T             N




         Where C = CaMV, T = TuMV, T & C = TuMV & CaMV, N = None




                                                                          11
Figure 1.3.2 Planting of screenhouse trial




                                             12
Plants that were positive were planted in the design shown in Figure 1.4.1 in position 2. Buffer
inoculated plants were planted in position 1.


Uninoculated plants, the same age as those in positions 1 and 2 were planted in position 3. Four
weeks after the initial inoculation plants in position 3 were mechanically inoculated with TuMV
isolate 249.


Four weeks after transplanting (two weeks after the second inoculation) the plants were assessed
every two weeks for virus symptoms. At maturity (11 weeks after transplanting) the cabbages
were harvested, assessed as marketable (good head formation) or non-marketable (de-formed
heads) and weighed using a hand-held scale. The data was then statistically analysed.


This experiment is currently being repeated to get data for more then one season and the effect of
timing of TuMV infection on yield of kale is also being assessed (season 2). The design of the
kale experiment is shown in Figure 1.4.2.


Research Activity 1.5 Screenhouse experiment to determine the effect of BtMV on the
yield of spinach
During visits to farms it was noted that swiss chard is more widely grown than spinach therefore
this activity was modified to assess effect of BtMV on swiss chard. In addition, a timing element
was included to gain more information about the nature of BtMV infection at different levels of
maturity.


In May 2002, 200 seedlings were mechanically inoculated with inoculation buffer (treatment
1) and 200 were mechanically inoculated with BtMV isolate S8 (treatment 2). Two weeks
after inoculation the seedlings were tested for presence of BtMV using the Potyvirus PTA-
ELISA test (Appendix 2). Treatment 1 plants, which were all ELISA negative, were planted
in positions 1; treatment 2 plants that were positive were planted in positions 2 (Figure 1.5.1).
Uninoculated plants the same age as those in positions 1 and 2 were planted in positions 3.
Four weeks after the initial inoculations plants in position 3 were mechanically inoculated
with BtMV isolate S8.




                                                13
Figure 1.4.1 Design of screenhouse experiment to assess impact of timing of Turnip mosaic virus (TuMV) infection on cabbage yield. 1, control
(buffer inoculated); 2, first TuMV inoculation; 3, second TuMV inoculation.




                2             3             1                  2              1            3                  1              2             3




                1             2             3                  1              3            2                  2              3             1




                                                                      14
Figure 1.4.2 Design of screenhouse experiment to assess the effect of timing of Turnip mosaic virus (TuMV) infection on yield of kale




      Lay out for the Kale screen house TuMV timing experiment - October 2002



                                                          B              A                C                 A         B           C
      Area without plants




               C             B              A             A              C                B                 B         C           A




         Key           Net                             Treatments    A        Control (buffer inoculated)

                       Guard                                         B        TuMV Inoculated two weeks before transplanting

                       Inter plot space                              C        TuMV inoculated one week after transplanting

                       Space between reps              Spacing       Plants = 45cm X 60 cm

                       Passage                                       Inter plot & rep spaces = 20 cm wide

                       Entrance



                                                                         15
Figure 1.5.1 Design of screenhouse experiment to assess the effect of timing of Beet mosaic virus infection on the yield of swiss chard




               BLOCK 1                         BLOCK 2                             BLOCK 3                               BLOCK 4




                   2            1         3           2          3            1           3            2           1            1            3          2




ENTRANCE                                                  PASSAGE



                   3            2         1           3          1            2           1            2           3            2            1          3




            BLOCK 8                            BLOCK 7                             BLOCK 6                               BLOCK 5

                                                                          PLOT DETAILS
         1 = Inoculated with buffer                                       Net plot size = 3 rows X 7 plants (0.9 m X2.8 m)
         2 = BtMV inoculation 1                                           Plant spacing = 30 cm X 40 cm
         3 = BtMV inoculation 2                                           Interplot spacing = 60 cm
                                                                          Inter block spacing = 80 cm
                                                                          A guard row was put at each end of the plot, and at both ends of the trial.
                                                                          Guard rows were also put towards the entrance




                                                                         16
Two weeks after the second inoculation plants were assessed for symptoms using the
assessment sheet shown in Figure 1.5.2. Assessments continued once fortnightly for 16
weeks, after which they were harvested and weighed. The data was then analysed using
Genstat


Research Activity 2.1 To investigate methods to protect Brassica seed beds from virus
infection
As described in the project memorandum these activities investigated the spread of viruses
from seed-beds into the transplanted crop and the potential of alternative management
strategies to reduce the incidence of virus disease in brassica crops.


The effect of two alternative, low input treatments, synthetic, re-usable fleece and straw mulch
were compared with an untreated control. The fleece provided a physical barrier to the aphids
and so the crop from this treatment was exposed to any infestation only after transplanting,
whereas the straw and control were open to infestation by aphids and infection by virus diseases
at all times.


Two experimental sites were used – KARI, Thika and University of Nairobi, Kabete Campus.
Experiments were carried out in a Randomised Complete Block Design (RCBD). In the first
season (November 2000) the nurseries had treatments laid out in three blocks and in the second
season (June 2001) they were in six blocks. In the field, the crops from the three treatments in
the nurseries were randomised within six blocks and a total number of 18 plots. In the second
season, an additional treatment of straw mulch was added to field plots from straw mulch
nurseries therefore increasing the number of treatments to four and the total number of plots to
24.


Cabbage (Brassica oleracea) variety Gloria F1 was used and seeds were purchased from Simlaw
Seed Company, Kenya. The seeds were sown at Kabete and Thika in 2m by 1m nursery beds.
Broad-spectrum fungicide, Monceren T Pencyron + Thiram (4g.l-1) was applied to the nursery
beds at sowing, to protect against soil borne pathogens e.g. Fusarium spp. Farmyard manure and
di-ammonium phosphate (DAP) fertiliser were used to supply nutrients to the soil in the beds.
Daily watering and weeding were carried out until tansplanting, when the crop was 4 weeks old.




                                               17
Figure 1.5.2 Assessment sheets for swiss chard experiment


BtMV SWISS CHARD SCREEN HOUSE EXPERIMENT - DATA SHEET

Date____________________________          Recorder___________________

Block______________________               Treatment_______________


Plant number Symptoms          Severity   Remarks
                1
                2
                3
                4
                5
                6
                7
                8
                9
               10
               11
               12
               13
               14
               15
               16
               17
               18
               19
               20
               21
Symptoms                       Severity
Chlorosis = 1                  0 = none
Vein Clearing = 2              1 = symptoms 1,2,3, and 4
Leaf distortion = 3            2 = symptoms 1,2,3,4, and 5 + slight distortion of leaves
Mottling = 4                   3 = symtoms 1,2,3,4,5,6 + stunting
Mosaic = 5
Puckering = 6
Stunting = 7




                                                   18
The crop was tansplanted in 3.6m by 3.6m plots. Each plot had 49 plants, with 60cm between
and within the rows. DAP was applied to the planting holes and mixed well with soil before
introducing the seedling. The crops were irrigated by hand because most part of the seasons
were dry. Diamond back moth (Plutella xylostela) was controlled with the use of Thuricide ®, a
biopesticide with no effect on aphids.


Data collection started at the nursery level and continued into the field after transplanting until
harvest. The aphid scoring system used was modified from Sutherland et al. (1996). The aphids
were scored on a randomly picked leaf from each plant and a scale of 0-3 was used. A leaf score
of 0 had no aphids, 1 had no more than two colonies, 2 had up to 50% leaf coverage and 3 had
more than 50% surface covered by aphids. The virus severity scale 0-3 was modified from
Sutherland et al. (1996). A score of 0 was a healthy plant, 1 mottling and vein clearing, 2
mottling, vein clearing, mosaic and slight distortion, 3 mottling, vein clearing, mosaic, severe
distortion and stunting. Virus incidence was recorded as either positive or negative. Data
collection was carried out on a weekly basis.


Harvesting of the heads was done when the cabbage heads were hard and firm. The heads were
cut and the weight for each recorded. The cabbage heads were classified as either marketable or
non-marketable.


Analysis of variance was used to compare the differences of aphid scores and virus incidences in
the different treatments. Correlation analysis was carried out to determine the relationships
between aphids and virus incidences.


Research Activity 2.2 To determine any quantitative effects of reducing virus infection
in Brassica seedbeds on the levels of virus disease in the transplanted crop
The activity described in the project memorandum was to use an unpublished model (Jeger,
personal communication) to obtain quantitative data on vector dynamics, behaviour and
transmission characteristics. To do this it was necessary to obtain information on viruliferous
aphids collected in the field.    Attempts at PCR amplification of virus from aphids was
unsuccessful. The virus is unstable at high temperatures. The aphids were collected in the field
under high temperature conditions and this may have caused the virus to degrade, making




                                                19
detection difficult. Therefore extra information on other pests and diseases were collected and
included in the analysis of activity 2.1.


Research Activity 2.3 Evaluation of farmer acceptability of alternative control strategies
PRA activities were used to evaluate farmer acceptability of low input control strategies used
in activities 2.1 and 2.2.


More detailed descriptions of activities are in Njuki, 2002 Appendix 4.


2.3.1 Initial PRA activity
The aims of the PRA were to:
•   Identify constraints on improved control measures such as costs and practicability
•   Gauge farmers’ willingness to participate in on-farm trials


Two sites were selected, Ruiru and Athi River, for on-farm trials. Focus group discussions with
farmers were held at these two sites, a checklist was used to guide the discussions. A wealth
ranking exercise was also included to classify farmers into different social categories for the
evaluation of the control methods.


2.3.2 Participatory budgeting #
The feasibility, implications and sustainability of the disease control strategies were evaluated
using the participatory budgeting technique.      The budgets are simple to follow, use local
materials and also take into account non-cash resources, e. g. labour.


Two farmer groups were involved in the participatory budgeting process, Athi River and initially
Ruiru. The Ruiru group did not complete the experiment due to internal group and leadership
problems. The group was replaced with an organic group of farmers from Kariguini, who had
earlier been involved in a project on the control of root knot nematode. Figure 2.3.1 shows a
summary of which groups participated in which stages of the activity.




#
 methods developed by Peter Doward and Mark Galpin of the Department of Agriculture and
Derek Shepherd, Head of AERDD in a DFID funded project

                                                20
                               Stage in experiment
Site               Nursery   Transplanting    Harvest   Evaulation
Athi River
Ruiru
Kariguini


                             completed
                             not completed


Figure 2.3.1 A breakdown of the farmer groups that participated at different stages of Activity
2.3


The aims of the participatory partial budgeting exercise were to:
•     Evaluate the feasibility, implications and suitability of different viral disease management
      strategies
•     Stimulate farmer interest and participation in the off farm trials by using the budgets as the
      farmer led research component in the on farm trials
•     Stimulate discussion among farmers on viral diseases and the different control strategies.
•     Assess demand for appropriate control technologies.


Originally three treatments were to be evaluated however when discussions were held with
farmers they suggested a fourth treatment that they already used in the field. Hence four
treatments were evaluated at the nursery level: fleece, straw mulch, a farmer practice
treatment (dimethoate) and a control (no treatment). Eight treatments were evaluated at the
field level because each of the nursery treatments were divided into two in the field: fleece,
straw mulch and control were divided into mulch and no mulch while the dimethoate
treatment was divided into mulch and dimethoate.


The farmers in Athi River were literate therefore farmers participated extensively in recording
activities on flipcharts. In Kariguini, most of the farmers were literate but for the benefit of
those who were not, dramatisation or the use of physical objects were used to demonstrate the
various aspects of the experiments.


An inputs data sheet was developed and farmers were trained how to use the sheet and do basic
record keeping as part of their own farm management. The data was collected on-site at the



                                                  21
completion of each day’s activities. The SE did the first recording of inputs, subsequent
activities and inputs were recorded by farmers under the guidance of a team member.


Phase one of the partial budget
One month after initiating the trial the experiment was reviewed to ensure farmers still
understood the purpose of the experiment. Inputs common to all treatments and those that
would not be used in a real farm situation were removed for the second phase of the partial
budget. The input lists were transferred to the budget sheet and the quantities added up for
each input to make a quantities table. The inputs were priced as follows:
•   Farm labour: Ksh 100 for a 5 hour day.
•   Dimethoate and polythene bags: local market price.
•   Fleece: not available locally so the UK price was used.
•   The costs were then added up for each treatment.


Phase two of the partial budget
The inputs, outputs and extra costs were quantified. The methodologies for participatory
partial budgets require comparisons of treatments with each other however this was confusing
to the farmers hence the treatments were only compared to the control.


Statistical analysis of the yield data
The data of the gross plot prices was analysed using Analysis of Variance in Genstat (Genstat
4.2, 2000, Appendix 4). The budget was converted into a per hectare basis so that it would be
more logical to farmers (Appendix 4). It was necessary to statistically analyse the farmers
results because there was no consistency in the evaluation of results e.g. a 2kg cabbage was
priced at Ksh 10 whereas a 4kg cabbage was priced at Ksh 15 and this requirement was
explained to farmers.


Kariguini was unable to complete the experiment due to flooding of the experimental site
therefore the results from Athi River were discussed with all three groups (Athi River,
Kariguini and Ruiru) and were used for the evaluation of treatments.


Farmer discussions and evaluation of the control strategies
Due to the complexity of using all 8 treatments for the evaluation, farmers opted to evaluate
the treatments broadly as mulch, fleece, dimethoate and control. Farmers selected criteria to



                                              22
help them decide if a management strategy would be adopted: labour requirement, benefits,
availability of materials, ability to control the disease and use of other inputs. The farmers
ranked each treatment (best = 1, worst = 4) according to the criteria for adoption, discussed
the advantages and disadvantages of each treatment and gave a final score for each treatment
(total for all treatments = 100).


Research Activity 3.1 To determine pathotype variability of TuMV isolates
TuMV isolates identified in activity 1.2 were maintained by mechanical inoculation in TGM
(Appendix 2). Five B. napus lines (Walsh, 1989; Jenner & Walsh, 1996; Hughes 2001) were
used as differentials and were mechanically inoculated with isolates. Symptoms were observed
and recorded over a period of four weeks. Results that were not clear were assessed by TuMV-
PTA ELISA (Appendix 2).


Isolates were also evaluated using a panel of monoclonal antibodies (Jenner et al., 1999) in
TuMV-PTA ELISA as described in Appendix 2 but with the following changes to the primary
antibody:         EMA 58
                  EMA 67
                  EMA 70
                  EMA 84
                  EMA 115
Isolates were then classified into a serotypic group depending on their interaction with each of
the antibodies.


Attempt at CaMV classification
Five monoclonal antibodies were produced at HRI (Table 3.1.1) and used in CaMV PTA-
ELISA. Background levels were very high making the identification of positive results difficult.
A blocking step was incorporated which reduced background results to approximately 0 OD.
Three isolates were tested for preliminary classification with the five monoclonal antibodies.




                                                23
Table 3.1.1   Table of CaMV monoclonal antibodies produced at HRI and their isotype


Antibody                                        Isotype

EMA 195                                         IgG3

EMA 196                                         IgM

EMA 199                                         IgG2a

EMA 200                                         IgG2b

EMA 201                                         IgM




                                             24
Research Activity 3.2 Evaluate local cultivars of cabbage and kale for resistance to
TuMV and CaMV and a local cultivar of swiss chard for resistance to BtMV
TuMV inoculations
Seed lots collected in the previous 1999 survey were planted in M2 compost in FP9 pots at
HRI, UK. At the two leaf stage plants were mechanically inoculated (Appendix 2) with a
TuMV isolate (472/170, Appendix 3) and assessed weekly over a period of four weeks. After
four weeks, plants that had none or had questionable symptoms were assessed using TuMV
PTA ELISA (Appendix 2). Those that were classed as resistant were inoculated again with
the same isolate and assessed for a further three weeks. If they remained symptomless they
were transplanted into bigger pots and were vernalised at 4°C for 12 weeks. After 12 weeks
they were put in the glasshouse at 18°C. Once the plants flowered they were bagged with
plastic “bread bags” and allowed to set seed. Occasionally the plants would be shaken to
encourage transfer of pollen.


CaMV inoculations
Seed lots collected in the previous 1999 survey were planted in M2 in FP9 pots. At the two
leaf stage plants were mechanically inoculated with a CaMV isolate (472/25, Appendix 3) and
assessed over a period of six weeks (because CaMV symptoms take longer to become
apparent than TuMV symptoms). After six weeks plants that remained symptomless or were
questionable were assessed by CaMV PTA-ELISA (described in Appendix 2). Those that
were classed as resistant were inoculated again with the same isolate and were assessed for
another 4 weeks.


BtMV inoculations
As for TuMV inoculations but BtMV isolate 472/117 (Appendix 3) was used to mechanically
inoculate swiss chard. Plants were assessed for resistance using universal potyvirus PTA-
ELISA (Appendix 2).


Research Activity 3.3 Screen promising cultivars and land races
Sixteen seed lots were collected from Kinale in the peri urban area of Nairobi, and together
with one previously selected landrace, and a commercial variety of Kale were evaluated in a
Randomised Complete Block Design (RCBD) with four replicates at Kenya Agriculture
Research Institute Thika and National Agriculture Research Laboratories (NARL).         The




                                            25
plants were planted at spacing of 45 cm by 60 cm in the field. The plot sizes were 6 plants by
6 plants (gross), and 4 plants by 4 plants net.


Pest and yield data were collected at fortinightly intervals. Plants expressing
resistance/tolerance to viral diseases and insect pests were tagged, and seed collected.


Research Activity 3.4 To determine the potential of self-selection of seed
The purpose of this activity was to assess the potential of seed from resistant/tolerant varieties as
a strategy for virus disease management. An initial PRA was carried out to gain baseline
information on farmer perceptions and practices (Appendix 5). This activity was also linked
with PRA activity 4.


Farmers save their own kale seed in Kinale. Nine farms were selected in the Kinale area:
Simon Njugia                    John M Ngugi            John W Kimani
Robert Ngirishe                 James Njoroge Nene      Peter Njuguna
Benard Mbeki                    Rachael Nyoro           Jacinta Ngugi
Josephine Wangari               Gertrude Njoki          Loise Wanjiru
Tabitha Muthoni                 Jane Njeri              Josephine Wambui
Lucy Wambuku                    Grace Wambui            George Kan’goroti

Researchers identified and tagged both healthy and diseased plants for seed. To link these with
farmer participation the nine farmers were asked to identify plants they would consider suitable
as planting material (good) and plants they would consider unsuitable (bad) which were
subsequently tagged for seed. During the tagging process farmers were also shown how to
identify the viral symptoms.


When the seed were harvested, seed from each individual plant was kept separately. For the on-
station experiments seed from four farms was selected at random. Seed from individual plants
were planted into plots (Figure 3.4.1). Researchers assessed the plots for presence of pests and
diseases using assessment sheets in Figure 3.4.2.


On-farm seed from plants from each category were grouped and then planted into different
categories: farmer good, farmer bad, scientist good and scientist bad (Figure 3.4.3). Farmers




                                                  26
   Figure 3.4.1 Field Design for On-Station Farmer Seed Selection Trial
   Plot design in the field (inter-row spacing = 0.6m, intra-row spacing = 0.6m)




             X   X     X    X      X    X
                                                         Gross Plot = 6 rows x 6 plants (3.6x3.6m) = 36plants
             X   X     X    X      X    X
                                                         Net Plot = 4 rows x 4 plants (2.4x2.4m) = 16plants
             X   X     X    X      X    X       3.6m
             X   X     X    X      X    X

             X   X     X    X      X    X

             X   X     X    X      X    X
                       2.4m
   Block 4

  T9             T6                T2            T16          T15             T17            T8               T1    T14



  T12            T13               T3            T7           T11             T18            T4               T5     T10


Block 3
                                T16
  T2             T14                             T7           T8              T12           T13               T3     T15



  T5             T1             T18              T17          T10             T9             T6               T11     T4


Block 2
  T4             T12               T3            T6           T18             T15            T9               T13    T11



  T1             T8             T17              T5            T2             T7            T16               T14    T10


Block 1

  T7             T16          T5                 T14          T12             T6             T3               T15    T17



  T9             T11               T1            T4           T13             T10           T18               T8      T2


   Key
   Treatment         Description                       Treatment       Description
   T1                Farm 1, healthy plant 1           T10             Farm 3, healthy plant 2
   T2                Farm 1, healthy plant 2           T11             Farm 3, diseased plant 1
   T3                Farm 1, diseased plant 1          T12             Farm 3, diseased plant 2
   T4                Farm 1, diseased plant 2          T13             Farm 4, healthy plant 1
   T5                Farm 2, healthy plant 1           T14             Farm 4, healthy plant 2
   T6                Farm 2, healthy plant 2           T15             Farm 4, diseased plant 1
   T7                Farm 2, diseased plant 1          T16             Farm 4, diseased plant 2
   T8                Farm 2, diseased plant 2          T17             Collards (commercial)
   T9                Farm 3, healthy plant 1           T18             Thousand headed (commercial)




                                                                27
Figure 3.4.2 Assessment sheets for on-farm trials of potential of self seed selection

BLOCK___________ TREATMENT______________ DATE_________ RECORDER________WK___
           Aphid score                    Other insects                            Diseases

                        Myzus spp.
           Brevicoryn




                                                                       Macrosiph
                                                          Whiteflies




                                                                                           Black rot

                                                                                                        Powdery
                                     Lipaphis




                                                                       um spp.




                                                                                           mildew



                                                                                                        mildew
                                                                                           Downy
                                                 Thrips
Plant no                                                                                                      Remarks




                                                                                   Virus
                                     DBM
           spp.




1                                    spp.
2
3
4
5
6
7
8
9
10




                                                                                                       28
Figure 3.4.3 Design of on-farm self-selection of seed experiments at Kinale


    1.   FARMER NAME:_______________________________

1. SH:                        2. FG                          3. SINF   4. FB


    2.   FARMER NAME: _______________________________

4.FB                          3. SINF                        2.FG      1.SH


    3.   FARMER NAME: _______________________________

3.SINF                        1.SH                           4.FB      2.FG


    4.   FARMER NAME: _______________________________

4.FB                          2.FG                           3.SINF    1.SH


    5.   FARMER NAME: _______________________________

2.FG                          1.SH                           4.FB      3.SINF


    6.   FARMER NAME: _______________________________

1.SH                          4.FB                           2.FG      3.SINF


    7.   FARMER NAME: _______________________________

3.SINF                        2.FG                           1.SH      4.FB


    8.   FARMER NAME: _______________________________

3.SINF                        4.FB                           1.SH      2.FG


    9.   FARMER NAME: _______________________________

1.SH                          3.SINF                         2.FG      4.FB


TREATMENT DETAILS
TREATMENT                 TREATMENT DESCRIPTION
1. SH                     Non-diseased (selected by scientists)
2. FG                     Farmer’s good (selected by farmer)
3. SINF                   Diseased (selected by scientists)
4. FB                     Farmer bad (selected by farmer)
The seed bed size is 1m by 1m




                                                            29
were not informed which batch of seeds came from which category of tagged plants. Farmers
evaluated the seed- beds for germination rates, colour and disease symptoms using the
assessment sheets in Figure 3.4.4.


A farmer field day was held and 19 farmers attended it. A fact sheet was produced to help
farmers understand the purpose of the trial (Appendix 8).


Research Activity 4.1 PRA to assess farmer problems, perceptions and practices in
relation to virus diseases and their aphid vectors
The PRA was carried out at sites selected for Activity 2, Athi River and Ruiru, where farmers
grow brassicas for both commercial and domestic use.


The aims of the PRA were to:
•   Evaluate farmer perceptions of virus symptoms and relative importance compared to other
    production constraints
•   Obtain local knowledge of virus diseases and any current control measures
•   Evaluate perceptions of resistance/susceptibility of land races of kale and cabbage to virus
    symptoms
•   Compare social and cultural variations in farmer perceptions and practices.


Focus group discussions with farmers were held at these two sites with a checklist to guide the
discussions (Appendix 4). This activity was combined with Activity 2.3.




                                               30
Figure 3.4.4 Farmers assessement sheets for evaluation of self-seed selection


Farm No ……………………………………………………………………………………………………….…
Name of farmer...…………………………………………………………………………….
Procedure for evaluation
   1. For each of the evaluation criteria, give a total score of 20.
   2. Ask the farmer to give each of the treatments a score out of the 20 (To allocate the 20 scores to the 4 treatments.)
   3. Ask the farmer to combine all the criteria and give a general score for each of these treatments (these scores must also add up to 20)
Treatment Treatment Germination %                              Colour       Height        Disease      Pest attack General           General
            identity      time               Germination                                                              appearance score
            (not      to
            disclose to
            farmer))
T1

T2

T3

T4

Total                       20                20               20               20      20           20             20             20




                                                                         31
Outputs
Research Activity 1.1 Stakeholder workshop to finalise the work plan and ensure co-
ownership of the project.
A workshop was held, involving project stakeholders, to finalise the work plan and to
ensure co-ownership of the project. The outcome of the workshop is summarised in the
workshop report (Appendix 6).


Research Activity 1.2 Survey, collection and identification of virus isolates from
brassica and spinach crops on peri-urban vegetable farms.
Appendices 3 and 7 show a summary of the farms visited for sample collection, the
description of symptoms on sample plants, insects observed on plants and ELISA results.
Table 1.2.1 shows the location of characterised samples in liquid nitrogen storage at HRI.
Appendix 3 show results of ELISA tests to categorise samples into into either TuMV
infected, CaMV infected or not infected. Some samples collected (specifically samples
between 175 and 263) did not revive upon return to HRI, UK so were unable to be
classified.


The swiss chard potyvirus produced similar reactions on indicator plants as Beet mosaic
virus (BtMV) and Carnation vein mottle virus (CVMV). ELISA tests were not used to
further resolve the identification of the potyvirus as antibodies to BtMV and CVMV were
not available. Universal potyvirus PCR primers were used to amplify the coat protein of
the unknown potyvirus which was then sequenced and compared to other sequences in the
NCBI database (Figure 1.2.1). The unknown potyvirus coat protein was almost 100%
coincidental with the sequences of two known BtMV coat protein sequences.



Discussion
Overall singular infections of TuMV and CaMV were found in roughly equal proportions
(27% of samples collected each) whereas mixed infections were much less frequent (8% of
samples collected) (Table 1.2.2). A high proportion of the samples collected from Athi
River (60%) were infected with TuMV compared to 3% infected with CaMV and 22%
infected with both viruses. Nyathona had a relatively high proportion of samples with
CaMV (48%) and Kinale had the viruses in roughly equal proportions. These results
suggest that TuMV and CaMV may inhabit different areas, e.g. Athi River is lowland and


                                           32
Table 1.2.1 Sample locations in liquid nitrogen
 Sample       Location  Sample   Location              Sample     Location    Sample     Location
   1        GK1 6 H A1    34   GK1 6 H E4                94     GK1 6 G D4      155    GK4 1 A D7
   2        GK1 6 H A2    36   GK1 6 H E6                96     GK1 6 E J10            GK4 1 A D8
   3        GK1 6 H A3    37   GK1 6 H E7                       GK1 6 G D6     156     GK4 1 A D10
   4        GK1 6 H A4    38   GK1 6 H E8               98      GK1 6 G D8             GK1 6 G G8
   5        GK1 6 H A5    39   GK1 6 H E9               99      GK1 6 G D9             GK1 6 G G10
   6        GK1 6 H A6    40   GK1 6 F D4               100     GK1 6 G D10    157      GK1 6 H J5
   7        GK1 6 H A7         GK1 6 F D5               106     GK4 1 A F5             GK4 1 A E2
   8        GK1 6 H A8         GK1 6 F D6                       GK4 1 A F6     158     GK4 1 A E3
   9        GK1 6 F A1         GK1 6 H E10              107     GK4 1 A F7             GK4 1 A E4
            GK1 6 F A2    41   GK1 6 H F1                       GK4 1 A F8     159     GK4 1 A E5
            GK1 6 F A3    42   GK1 6 H F2               108     GK4 1 A F9             GK4 1 A E6
            GK1 6 H A9    43   GK1 6 H F3                       GK4 1 A F10    160     GK4 1 A E7
    10      GK1 6 H A10   44   GK1 6 H F4               110     GK4 1 A G1             GK4 1 A E8
    12      GK1 6 G F1    45   GK1 6 H F5                       GK4 1 A G2     161      GK1 6 H J6
            GK1 6 G F3    46   GK1 6 H F6               115     GK4 1 A G3             GK4 1 A E9
    13      GK1 6 F A4    47   GK1 6 H F7                       GK4 1 A G4             GK4 1 A E10
            GK1 6 F A5    48    GK1 6 E J8              116     GK4 1 A G5     162     GK1 6 G H1
            GK1 6 F A6    49   GK1 6 H F9                       GK4 1 A G6             GK1 6 G H3
    15      GK1 6 F A8    51   GK1 6 G F9               117     GK4 1 A G7     163     GK4 1 A H4
            GK1 6 F A9         GK1 6 G G2               136     GK4 A 1 A2             GK1 6 G H5
    16      GK1 6 H B6    52   GK1 6 H G2               137     GK4 1 A A4             GK1 6 G H7
    17      GK1 6 H B7    54   GK1 6 H G4               138     GK4 1 A A5     164     GK4 1 A H5
    18       GK1 6 E J9   56   GK1 6 H G6                       GK4 1 A A6             GK4 1 A H6
            GK1 6 F B2    57   GK1 6 H G7               139     GK4 1 A A7     165     GK4 1 A H7
            GK1 6 F B3    58   GK1 6 H G8                       GK4 1 A A8             GK4 1 A H8
    19      GK1 6 H B9    59   GK1 6 H G9               141     GK4 1 A B1     166     GK4 1 A H9
    20      GK1 6 H B10   60   GK1 6 H G10                      GK4 1 A B2             GK4 1 A H10
    22      GK1 6 H D2    61   GK1 6 G A1               142     GK4 1 A B3     167      GK4 1 A I1
    23       GK1 6 E I1   62   GK1 6 G A2                       GK4 1 A B4              GK4 1 A I2
            GK1 6 H D3    64   GK1 6 G A4               143     GK4 1 A B5     168      GK4 1 A I4
    24      GK1 6 F B5    65   GK1 6 G A5                       GK4 1 A B6     169      GK4 1 A I5
            GK1 6 F B6    67   GK1 6 G A7               144     GK4 1 A B7              GK4 1 A I6
    25      GK1 6 F B7    69   GK4 1 A F1               145      GK1 6 H J3    170      GK4 1 A I9
            GK1 6 F B8         GK4 1 A F2                        GK1 6 H J4            GK1 6 G H9
            GK1 6 F B9    70   GK1 6 G A10                      GK4 1 A B10             GK1 6 G I2
             GK1 6 H J1   71   GK1 6 G B1               146     GK4 1 A C1     171      GK4 1 A J1
             GK1 6 H J2   72   GK1 6 G B2                       GK4 1 A C2              GK4 1 A J2
    26      GK1 6 F C1    73   GK1 6 G B3               147     GK4 1 A C3     172      GK4 1 A J3
            GK1 6 F C2    74   GK1 6 G B4                       GK4 1 A C4              GK4 1 A J4
            GK1 6 F C3    75   GK1 6 G B5               148     GK4 1 A H1     173      GK4 1 A J5
            GK1 6 H D6    76   GK1 6 G B6                       GK4 1 A H3     174      GK4 1 A J6
    27      GK1 6 H D7    77   GK1 6 G B7                       GK1 6 G G4     189     GK1 6 G E2
    28      GK1 6 H D8    78   GK1 6 G B8                       GK1 6 G G6     214     GK1 6 G E4
    29      GK1 6 H D9    81   GK1 6 G C1               149     GK4 1 A C7     219     GK1 6 G E6
    30      GK1 6 H D10   82   GK1 6 G C2                       GK4 1 A C8             GK1 6 G E8
    31      GK1 6 H E1    83   GK1 6 G C3               150     GK4 1 A C9     239      GK1 6 G I8
    32      GK1 6 F C4    84   GK1 6 G C4                       GK4 1 A C10            GK1 6 G I10
            GK1 6 F C5    85   GK1 6 G C5               151     GK4 1 A D1     244      GK1 6 G J1
            GK1 6 F C6    86   GK1 6 G C6                       GK4 1 A D2              GK1 6 G J3
    33      GK1 6 F C7    89   GK1 6 G C9               152     GK4 1 A G9     249      GK1 6 G J4
            GK1 6 F C8    90   GK1 6 G C10                      GK4 1 A G10             GK1 6 G J5
            GK1 6 F C9    91   GK1 6 G D1               154     GK4 1 A D5     252      GK1 6 G I4
            GK1 6 H E3    92   GK1 6 G D2                       GK4 1 A D6              GK1 6 G I6




                                                  33
BtMV : 31 tggtgtattgagaatggcacatcaccaaatctcagtggagactgggtcatgatggatgga 90
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Poty : 982 tggtgtattgagaatggcacatcaccaaatctcagtggagactgggtcatgatggatgga 1041


BtMV : 91   gaggaacaagtttcattccccttgaagccgatagtagaaaatgctaaaccatcttttcgg 150
            ||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||
Poty : 1042 gaggaacaagtctcattccccttgaagccgataatagaaaatgctaaaccatcttttcgg 1101


BtMV : 151  caaataatgcatcacttttctgatgcagcagaagcgtatattgaaatgcgcaacagagaa 210
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Poty : 1102 caaataatgcatcacttttctgatgcagcagaagcgtatattgaaatgcgcaacagagaa 1161


BtMV : 211  aggccatacatgcctcgttatggcgctcagagaaatctgagagacaggacgctagctcgc 270
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Poty : 1162 aggccatacatgcctcgttatggcgctcagagaaatctgagagacagaacgctagctcgc 1221


BtMV : 271  tatgcattcgatttctatgaggtcacctcacgaacaactgatcgtgcacgtgaagctcat 330
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Poty : 1222 tatgcattcgatttctatgaggtcacctcacgaacaactgatcgtgcacgtgaagctcat 1281


BtMV : 331  ttccaaatgaaggcggcagcgttggcaagcgtgtccaacaagctctttgggcttgatggg 390
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Poty : 1282 ttccaaatgaaggcggcagcgttggcaagcgtgtccaacaagctctttgggcttgatggg 1341


BtMV : 391  agcgtggccaccacatcggaggatacagagaggcacacagccacagatgttaacgctcac 450
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Poty : 1342 agcgtggccaccacatcggaggatacagagaggcacacagccacagatgtcaacgctcac 1401


BtMV : 451  atgcatcacatgatgggcgttcgacaaggttaattctgtacctcgttctatggatagtta 510
            ||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||
Poty : 1402 atgcatcacatgatgggcgttaggcaaggttaattctgtacctcgttctatgaatagtta 1461


BtMV : 511  aatatggtaaccatttaaaagagtgaggttttacctccgttgcttatttctatttcgcat 570
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Poty : 1462 aatatggtaaccatttaaaagagtgaggttttacctccgttgcttatttctatttcgcat 1521


BtMV : 571  agttccaaaccactaccctcaataggcgtctcacagtgaggttttacctcggaggattct 630
            ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Poty : 1522 agttccaaaccactaccctcaataggcgtctcatagtgaggttttacctcggaggattct 1581


BtMV : 631  acggacggtacacaggtttacaa 653
            |||||||||||||||||||||||
Poty : 1582 acggacggtacacaggtttacaa 1604

Figure 1.2.1 Comparison of known Beet mosaic virus sequence (BtMV) with unknown swiss
chard potyvirus sample sequence (Poty)




                                          34
Table 1.2.2   Summary of samples of TuMV and CaMV in different peri-urban regions


   Region     No. samples       TuMV            CaMV         TuMV &            None
                                                              CaMV
 Nyathona          25              3             12             1                9
   Kinale          61             12             16             0               33
   Mwea             5              1              3             0                1
   Embu             6              0              5             0                1
  Giachia          1              0              1              0               0
  Kaitheri          2              0              2             0                0
  Mathira           4              0              4             0                0
  Karatina          4              0              3             0                1
    Guti            4              0              1             1                2
 Kamuyu-            2             1               0             0                1
   Nyeri
 Kibirigwi         8               0             6               0              2
  Mukuha           2               0             2               0              0
  Gatanga          2               0             2               0              0
   Karuri          3               0             3               0              0
  Ngong'            4              0             2               1               1
  Kiserian         5               0             2               1              2
  Kuranga          8               0             5               0              3
  Kirenga          8               6             0               0              2
 Kinangop          15              1             0               0              14
  Gacheru           4              0             0               0              4
  Yang’a
  Mukeu              4             0             0               0              4
  Cheese             5             0              0               0              5
 Athi River         77            46             2               17             12
   Total           259            70             71              21             97




                                           35
TuMV is more predominant here. They also suggest that mixed infections may not be
beneficial for either virus because these do not occur very often.


Swiss chard was also severely affected by an unknown potyvirus. The unidentified swiss
chard potyvirus was identified as BtMV confirming the suggestion in the project
memorandum.

Research Activity 1.3 Screenhouse experiment to determine the effect of virus on
yield in cabbage crops
Even though approximately one year was lost due to problems with black rot and mixed
viral infection successful, clear results were obtained in February 2002 shown in Figure
1.3.2.


Both TuMV singly and TuMV and CaMV in combination significantly reduced cabbage
yield by approximately 40% compared to the control. CaMV did not affect the yield of
cabbage.




Discussion
From these results it can be suggested that TuMV significantly reduced cabbage yield
whereas CaMV did not have a negative effect. The results from the TuMV + CaMV
treatment suggested that reduction in yield was due to TuMV rather than CaMV. These
results had a significant impact on activity 1.4 where originally the effect of timing of
TuMV and CaMV infection on cabbage yield were going to be assessed. It was decided
that subsequently only the impact of timing of TuMV on yield would be assessed. This
also has implications for control of CaMV in that it suggests that TuMV is a higher priority
both because of the negative impact on yield and the difficulty with which it is controlled
due to the non-persistent nature in which it is transmitted. In a field situation CaMV may
have a higher impact on yield with constant aphid pressure, in the screenhouse samples
were only inoculated once therefore giving the virus a limited chance of successful
transmission and subsequent infection.




                                             36
                                 Effect of TuMV & CaMV infection, both singly and in combination, on cabbage yield
                                                                                                                                   s.e.d=0.2803 (3)
                                                                                                                                   p<0.001
                          1.8


                          1.6


                          1.4


                          1.2
    Average weight (kg)




                           1


                          0.8


                          0.6


                          0.4


                          0.2


                           0
                                Control                     TuMV                         CaMV                        TuMV + CaMV
                                                                        Treatment



Figure 1.3.2 Results of the effect of Turnip mosaic virus (TuMV) and Cauliflower mosaic virus (CaMV) on yield of cabbage




                                                                                    37
Research Activity 1.4 Screenhouse experiments to determine effect of the timing of
virus infection
The effect of timing of TuMV infection on cabbage yield is shown in Figure 1.4.3 (season 1)
and Figure 1.4.4 (season 2). Both early and late infections significantly reduce the yield of
cabbage compared to the control in both seasons. In addition, early infection significantly
reduced yield (approximately 50% reduction compared to the control) in comparison to late
infection (approximately 25% reduction in comparison to the control). In season 2, the
number of marketable heads was the same for each treatment. The results also validate the
results obtained in activity 1.3 because the effect of TuMV on yield is similar in both
experiments even though they were carried out in different seasons.


The effect of timing of TuMV infection on kale is shown in Figure 1.4.5. The number of
marketable leaves for each treatment was not significantly different, however late infection
significantly reduced the weight of marketable leaves compared to both early infection and
the control. Early infection did not have a significant impact on yield.


Discussion
In cabbage it is interesting that TuMV infection had no impact on the number of
marketable heads produced but both early and late infection had a negative impact on
yield. It is also interesting that early infection significantly reduced head weight compared
to late infection. The results strongly indicate that it is more important to control virus
infection in cabbage at the seedling stage.         Farmers currently spray the transplanted
cabbage crop as well as the nursery in an attempt to control virus disease, but these results
suggest that this may be unnecessary as the diseases are already established. The benefits
of managing seed beds with alternative management strategies for control of virus have
been investigated in activities 2.1 and 2.2.


Kale was slightly different in that late infection had a more negative impact on yield. This
suggests that control of virus infection in the field is more important than control in the
nursery.




                                               38
Figure 1.4.3 Effect of timing of TuMV infection on yield of cabbage, season 1


                                          Effect of timing of TuMV infection on cabbage yield season 1

                          1.6                                                                                               s.e.d.=0.1744
                                                                                                                            (10)
                                                                                                                            p=0.005
                          1.4



                          1.2
    Average weight (kg)




                           1



                          0.8



                          0.6



                          0.4



                          0.2



                           0
                                Control                              Early inoculation                   Late inoculation
                                                                       Treatment




                                                                                         39
Figure 1.4.4                    Effect of timing of TuMV infection on cabbage yield, season 2



                                                     Effect of timing of TuMV infection on cabbage yield season 2

                          1.6                                                                                                          sed=1.791 (10)
                                                                                                                                       p=0.002

                          1.4



                          1.2
    Average weight (kg)




                           1



                          0.8



                          0.6



                          0.4



                          0.2



                           0
                                           Control                              Early inoculation                   Late inoculation
                                                                                  Treatment




                                                                                                    40
Figure 1.4.5                    Effect of timing of TuMV infection on kale yield


                                                         Effect of timing of TuMV infection on kale yield
                                                                                                                               Sed=0.0639 (58)
                                                                                                                               P<0.001
                          0.8



                          0.7



                          0.6
    Average weight (kg)




                          0.5



                          0.4



                          0.3



                          0.2



                          0.1



                           0
                                           Control                            Early inoculation             Late inoculation
                                                                                Treatment




                                                                                                  41
Research Activity 1.5 Screenhouse experiment to determine the effect of BtMV
on the yield of spinach
The effect of BtMV on number and weight of marketable and nonmarketable leaves and
stem and root weight is shown in Figure 1.5.3.           Both early and late infections
significantly reduced the number and yield of marketable leaves in comparison to the
control but were not significantly different from each other. In contrast, the number and
yield of nonmarketable leaves increased significantly in both early and late infections
and late infection had significantly more nonmarketable leaves and yield than early
infection. As well as having an effect on leaf weight, both early and late infections had a
significantly negative impact on stem and root weight.


Discussion
In swiss chard, BtMV had a significantly negative impact on the number and weight
of marketable leaves. As for kale infected with TuMV in activity 1.4, late infection
produced significantly more unmarketable leaves than early infection. As swiss chard
is harvested continually and sold at market, these results suggest that it would be more
important to protect the crop when it is in the field as well as in the nursery.


Research Activity 2.1 To investigate methods to protect Brassica seed beds from
virus infection
In both season 1 and season 2 at Thika, no significant differences were observed
between either theaverage number of heads obtained or the average weight. At Kabete
in season 1 both the number of heads and weight were significantly increased by the
fleece and straw treatments (Figure 2.1.1) however in season 2 no significant differences
were observed.


In season 1, at both Thika and Kabete, there were no significant differences in aphid
numbers between the treatments. However, upon closer inspection of the results from
Kabete both fleece and straw significantly reduced aphid numbers up to five weeks into
the experiment (Figure 2.1.2). In season 2 at Kabete the straw mulch in the nursery to
straw mulch in the field treatment significantly reduced aphid numbers (Figure 2.1.3),
however no significant differences were observed at Thika




                                            42
Figure 1.5.3 Effect of timing of BtMV infection on swiss chard
                                  Effect of timing of BtMV infection on number of marketable leaves of swiss chard                Marketable
                                                                                                                                  s.e.d=1.919 (158)
                        90

                                                                                                                                  Non-marketable
                        80
                                                                                                                                  s.e.d.=1.412 (158)
                        70


                        60
     Number of leaves




                        50


                        40


                        30


                        20


                        10


                         0
                                    Control                             Early Inoculation                    Late Inoculation
                                                                           Treatment

                                                               No. marketable    No. Non-marketable




                              Effect of timing of BtMV infection on marketable and unmarketable weight of swiss chard

                         2                                                                                                        Marketable
                                                                                                                                  s.e.d=0.0605 (158)
                        1.8


                        1.6                                                                                                       Non-marketable
                                                                                                                                  s.e.d.=0.01351 (158)
                        1.4


                        1.2
 Weight (kg)




                         1


                        0.8


                        0.6


                        0.4


                        0.2


                         0
                                    Control                              Early Inoculation                    Late Inoculation
                                                                            Treatment

                                                             Marketable weight   Non-marketable weight




                                      Effect of timing of BtMV infection on stem and root weight of swiss chard

                        3.5

                                                                                                                                  Stem
                          3                                                                                                       s.e.d=0.2257 (14)

                                                                                                                                  Root
                        2.5
                                                                                                                                  s.e.d.=0.2103 (14)
  Weight (kg)




                          2



                        1.5



                          1



                        0.5



                          0
                                    Control                               Early Inoculation                    Late Inoculation
                                                                            Treatment

                                                                     Stem weight     Root weight




                                                                                        43
Figure 2.1.1 Effect of treatments on average head number and weight of cabbage at Kabete, season 1




                            Effect of treatments on average head number and weight of cabbage
                                                                                                        Number       of
                                                                                                        heads
          14
                                                                                                        s.e.d.=1.611
                                                                                                        (10)
          12                                                                                            p<0.001

                                                                                                        W i ht
          10



          8
  Score




          6



          4



          2



          0
                       Control                               Fleece                             Straw
                                                           Treatment

                                                       No heads   Weight (kg)



                                                                            44
Figure 2.1.2                     Combined effect of fleece and straw treatments on aphid numbers at Kabete, season 1
                                                                                                                                      s.e.d=0.0931
                                                                                                                                      (10)
                                                 Comparison of average total aphid numbers at Kabete in season 1

                           1.6


                           1.4


                           1.2
   Average no. of aphids




                            1


                           0.8


                           0.6


                           0.4


                           0.2


                            0
                                 1       2         3        4         5         6           7         8     9          10   11   12
                                                                                    Weeks

                                                                              Control       Treated




                                                                                            45
Figure 2.1.3           Effect of treatments on aphid numbers at Kabete, season 2

                                                                                                                                       s.e.d=0.06738
                                                                                                                                       (15)
                                             Effect of treatments on aphid numbers, kabete season 2

                 0.8


                 0.7


                 0.6


                 0.5
   Aphid score




                 0.4


                 0.3


                 0.2


                 0.1


                  0
                       1       2        3        4        5         6             7           8          9         10   11   12   13
                                                                                 Week

                                                          Control       Fleece        Straw       Straw to straw




                                                                                      46
In season 1 no significant differences were observed at Thika. However, at Kabete
both treatments significantly reduced virus incidence compared to the control, but
there were no significant differences between fleece and straw treatments (Figure
2.1.4). In season 2 at both sites, the straw mulch in the nursery to straw mulch in the
field treatment significantly reduced virus incidence (Figure 2.1.5). At both sites and
in both seasons virus incidence increased with increasing numbers of aphids (Figure
2.1.6).


Diamond back moth (DBM) numbers were not significantly affected by the
treatments. However, in season 2 at both sites the straw in the nursery to straw in the
field treatment caused a significant increase in DBM numbers (Figure 2.1.7).


For Black Rot, no significant differences were observed overall. However, upon
closer inspection of data from Kabete in season 1 incidence of black rot was
significantly lower in fleece up to seven weeks into the experiment and then
significantly more in week 12. In the straw treatment, incidence of black rot was
significantly lower up to week 6 and then significantly higher in weeks 10 to 12. Data
was also collected for incidence of thrips, whitefly, downy and powdery mildew
however no significant differences were observed.




Discussion
The results of this activity in season 1 show that both fleece and straw had a
significant effect on aphid and virus incidence. In season 2, the extra treatment of
straw mulch in the seed-bed plus straw mulch in the field significantly reduced virus
and aphid incidence compared to both treatments used in season 1 and the control.
This effect can be explained by the relationship between aphid numbers and virus
incidence (Figure 2.1.6). The double dose of straw mulch (i.e. in nursery and field)
may act by confusing the aphid landing signals, hence reducing aphid feeding and
subsequent virus transmission.




                                          47
Figure 2.1.4   Effect of treatments on virus incidence at Kabete, season 1



                                     Effect of treatments on virus incidence at Kabete, season 1
                                                                                                                      s.e.d=0.03022 (10)
       1.4                                                                                                            p<0.001


       1.2



         1



    Vir 0.8
    us
    sc
    or
    e 0.6



       0.4



       0.2



         0
               1       2         3           4         5          6          7            8        9   10   11   12
                                                                      Week

                                                            Control    Fleece         Straw




                                                                                 48
Figure 2.1.5               Effect of treatments on virus incidence at Thika and Kabete, season 2


                                        Effect of treatments on virus incidence, Thika season 2                                                         s.e.d.=0.04 (15)
                                                                                                                                                        p=0.007
                 0.9


                 0.8


                 0.7


                 0.6


                 0.5
   Score




                 0.4


                 0.3


                 0.2


                 0.1


                  0
                       1   2        3           4        5           6              7             8              9        10        11        12
                                                                         Weeks

                                                    Control    Fleece             Straw        Straw to straw




                                        Effect of treatments on virus incidence, Kabete season 2
                                                                                                                                                              s.e.d.=0.06167 (15)
                                                                                                                                                             p<0.001
                 1.2




                  1




                 0.8
   Virus score




                 0.6




                 0.4




                 0.2




                  0
                       1   2    3           4        5         6              7            8            9            10        11        12        13
                                                                            Weeks

                                                     Control       Fleece          Straw        Straw to straw




                                                                            49
Figure 2.1.6 Relationships between aphid numbers and virus incidence at (a) Thika, season 1; (b) Thika, season 2; (c) Kabete, season 1; (d) Kabete
season 2




(a)                                                                                 (b)




(c)                                                                                 (d)




                                                                         50
Figure 2.1.7       Effect of treatments on diamond back moth numbers at Thika and
Kabete, season 2

                   Effect of treatments on numbers of Diamond Back Moth, Thika season 2
                                                                                                                                         s.e.d.=0.6133 (15)
                                                                                                                                         p<0.001
     10

     9


     8
Nu
m
be   7
rs
of   6
Di
a
m    5
on
d
     4
Ba
ck
M    3
ot

     2


     1


     0
          1    2           3        4           5         6             7          8             9        10        11        12
                                                              Weeks

                                         Control      Fleece      Straw        Straw to straw




                   Effect of treatments on numbers of Diamond Back Moth, Thika season 2
                                                                                                                                   s.e.d.=0.6133 (15)
                                                                                                                                   p<0.001
     10


     9


     8
Nu
m
be   7
rs
of   6
Di
a
m    5
on
d
     4
Ba
ck
M    3
ot

     2


     1

     0
          1    2       3        4           5         6           7            8             9       10        11        12
                                                          Weeks

                                        Control     Fleece      Straw       Straw to straw




                                                                      51
The results obtained with DBM numbers suggest that straw mulch may increase the incidence
of DBM and possibly black rot. These results highlight the need for an integrated approach to
controlling pest and disease management.


Research Activity 2.3 Evaluation of farmer acceptability of alternative control strategies
A more detailed account of research activity 2.3 can be found in Njuki, 2001 (Appendix 4).




2.3.1 Results of initial PRA activity
Farmers at Athi River and Ruiru identified indicators of wealth. Social categories that were
important included asset ownership, financial ability, type of household and education level.
Categories and definitions of wealth indicators are given in Table 2.3.1 and will be used to
calculate a wealth index, which will be used in the final PRA activity 4.2.



2.3.2 Results of Participatory Budgeting activity
The statistical partial budgets (Table 2.3.2) gave similar results to the farmer budgets (Table
2.3.3) with dimethoate to dimethoate, dimethoate to mulch and fleece to no mulch with
positive benefits in both budgets. The fleece to mulch treatment was the only treatment that
had negative benefits in the farmer budget that resulted in positive benefits in the statistical
budget. The rest had negative benefits in both budgets.



2.3.3 Results of evaluation of treatments
Table 2.3.4 shows the ranking of treatments according to criteria important for adoption of a
particular treatment. In Athi River the dimethoate was ranked top in terms of benefits and
disease control and the control ranked worst. However in terms of labour and use of other
inputs the results were reversed with the control ranked top and the dimethoate ranked
bottom. The farmers in Kariguini, an organic group, ranked mulch as top for benefits and




                                              52
Table 2.3.1 Wealth indicators for Athi River and Ruiru


Rich                                Medium                                Poor
Athi River
6 to 20 grade cows                  1 to 5 cattle                         0 cattle

11 to 50 goats                      6 to 10 goats                         0 to 5 goats

Hire land of >4 acres               Hires land of ½ to 3 acres            No land (squatting)

House with stone wall and iron      House with iron sheet wall and        Paper house
sheet roofing                       roof

Has access to irrigation water      Has access to irrigation water        No access to irrigation water

Has irrigation equipment            Rent or         borrow   irrigation   No irrigation equipment
                                    equipment

Has permanent hired labour          Uses own labour and sometimes         Provides own labour
                                    hires

Grows irrigated crops for export-   Grows irrigated maize, kales,         Grows rain fed maize, beans and
French beans, flowers, okra etc     beans, French beans, cabbage,         kales
                                    tomatoes and chillies for local
                                    market

Has enough operating capital        Minimum operating capital             No operational capital

Have modern farming experience      Uses traditional and         modern   Uses      traditional     farming
or hire experienced managers.       farming experience                    experience

Ruiru
Multistorey house with tiled roof   Stone walled house with iron          Brick walled house with iron
                                    sheet roof                            sheet roof

1 to 2 motorcars                    One bicycle                           1 wheelbarrow

3 acres of vegetables, access to    1 acre of vegetables, not enough      No inputs, borrows seeds and no
fertiliser and quality seed         fertiliser or quality seed            fertiliser applied

50 hp irrigation pump, tractor,     3 to 4hp irrigation pump, no          Bucket irrigation or money maker
sprinklers                          tractor, no sprinklers and uses
                                    pipes

Has hired labour                    Uses own or casual labour             Uses own labour only

2 to 5 grade cows, 0 local cattle   1 grade cow or 3 to 15 zebu           0 to 2 local cattle
                                    animals without grade cows

Children attend private boarding    Children attend local government      Children do not attend school
school                              school

Meat in diet everyday               Meat in diet once a month             No meat in diet

Ksh 30,000 and above operating      Ksh 5000 to 30,000 operating          Ksh 5000 and below operating
finance                             finance                               finance




                                                       53
    Table 2.3.2 Statistical partial budget (on a per ha basis)
                Control to mulch            Mulch to Mulch             Mulch to no mulch           Fleece to mulch                 Dimethoate to mulch           Fleece to no mulch              Dimethoate to Dimethoate
Inputs          118 915                     119,219                    304.2                       119 213                         119 077                       298.8                           18 019

Output          85 978                      103 174                    31 084                      186 507                         206 349                       89 947                          263 888

Extra output    41 666                      58 862                     -13 227                     142 195                         162 037                       45 634                          219 576

Benefits        -77 248                     -60 357                    -13 532                     22 982                          42 960                        45 336                          201 588
(Ksh)

Benefits        -702.3                      -548.7                     -123.0                      208.9                           390.5                         412.1                           1 832.6
(UK£)

Rank            7                           6                          5                           4                               3                             2                               1




    Table 2.3.3 Calculating the benefits
                Mulch to Mulch              Control to mulch           Mulch to no mulch               Fleece to mulch             Fleece to no mulch                Dimethoate to mulch         Dimethoate to Dimethoate
Extra output    82.1                        56.35                      -18.9                           196.85                      74.6                              243.40                      372.85

Extra Costs     213.55                      179.8                      33.75                           213.05                      33.25                             197.8                       45

Benefits        -131.45                     -123.4                     -52.65                          -16.2                       41.35                             45.6                        327.85

Rank            7                           6                          5                               4                           3                                 2                           1




    Table 2.3.4 Farmers ranking of treatments in Athi River and Kariguini, where 1 = best and 4 = worst
    Treatment                                                                                                 Criteria
                                       Labour                               Benefits                        Availability                            Disease Control                    Use of other inputs
                          Athi River            Kariguini      Athi River              Kariguini   Athi River          Kariguini             Athi River         Kariguini         Athi River          Kariguini
    Mulch                     3                     2              3                       1           3                   1                     3                  1                 2                   1

    Fleece                    2                      1             2                      2                4              4                      2                   2                 3                   2

    Spraying                  4                      4             1                      4                2              3                      1                   3                 4                   3

    Control                   1                      3             4                      3                1              2                      4                   4                 1                   4




                                                                                                                54
Table 2.3.5 Merits and demerits of treatments by farmers in Athi River and Kariguini


Treatment                                   Athi River                                                                       Kariguini
            Merits                                Demerits                                Merits                                 Demerits
Mulch       • Ability to retain water and • Expensive                                     • Easily available                     • Is dusty and can hurt the skin
                moisture                          • Can keep other pests such as          • Protects soil from direct sunlight • Arsonists can burn your shamba
            • Control pests (aphids) and               crickets and cutworms              • Preserves moisture                   • Can carry seeds for other weeds
                therefore viral diseases          • May retain more moisture than         • Increase soil fertility              • Snakes and reptiles can hide
            • Controls weeds                           necessary during heavy rains and   • Weed control
            • Prevents contact of plant with the       after watering                     • Control of aphids
                ground                                                                    • Can be used many times
Fleece      • Seedlings were of better quality • Expensive                                • Prevents aphids and all other • Not locally available
                than other treatments             • Seedlings etiolated                       insects                            • No knowledge of cost if it was
            • Little labour required              • Not easily available                  • Higher yield                             available locally
            • Kept aphids out and hence • Had weed problems                               • Can be used many times               • Can not be used in the whole field
                controlled the disease                                                    • Protects seedlings from the sun      • Can be stolen
            • Yield was high                                                              • Easier and moderated watering
            • Retains moisture                                                            • Seedlings grew faster
                                                                                          • Protected       seedlings    from
                                                                                              physical damage e.g. people
                                                                                              stepping on them
Spraying    •   Controlled most pests and hence   •    Offensive smell                    • Is easy to use                       • Makes people sick – poisoning
                diseases                          •    Labour intensive                   • Can be used against many pests • Kills beneficial insects
            •   Yield was high                    •    Expensive to apply (need pump,         and diseases                       • Requires many other accessories
            •   Good quality heads                     masks, gloves etc)                 • Leaves of cabbages and kales             e.g. gloves
            •   Affordable                        •    Could be toxic                         are healthy                        • Destroys the soil
                                                  •    Pests develop resistance                                                  • Pollutes the atmosphere
                                                  •    Farmer may buy when it has                                                • Are expensive
                                                       expired                                                                   • You can not access it unless you
                                                  •    Takes long to degrade                                                         buy from the shop – have to use
                                                                                                                                     money
                                                                                                                                 • Low farmer knowledge of which
                                                                                                                                     chemicals are bad or good
                                                                                                                                 • Storing it in the house is risky



                                                                                    55
disease control whereas dimethoate was ranked last for benefits and third for disease control.


Table 2.3.5 shows the advantages and disadvantages of each treatment according to each
group of farmers. Even though farmers in Athi River ranked dimethoate top for benefits and
disease control in the criteria for adoption exercise in the merits and demerits exercise it had
the most demerits of all the treatments.


In Athi River from the general score out of 100 dimethoate was top (score 50), fleece was
second (score 25), mulch was third (score 15) and the control was last (score 10). In
Kariguini, mulch was top (score 40), fleece was second (score 30), dimethoate was third
(score 20) and the control was last (score 10).


Agreement by farmers to try the disease control strategies on their farms
The two groups of farmers in discussion with the project team agreed to try the disease control
strategies, specifically the mulch and fleece, on their farms during the next planting season. The
project team will provide the fleece to the groups.



Discussion
It is interesting that the farmers in Athi River preferred dimethoate even thought this had the
longest list of demerits of all of the treatments. It is also interesting that Kariguini, as an
organic group of farmers, preferred the mulch treatment and ranked the dimethoate as worst.
Farmers in Kariguini have easy access to mulch because they can raise it themselves so do not
have to purchase it. This decreases inputs required therefore increases the benefits. However,
farmers in Athi River have to purchase mulch and have no way of raising it themselves so will
look at the overall positive impact on the yield of their crops rather than the health benefits to
workers or final consumers.       Fleece was also favourable but needs to be more readily
available to the farmers for it to be adopted. This baseline data will be used in the wider
promotion of virus disease management strategies proposed in a current concept note
(CN801) to the CPP.




                                                  56
Research Activity 3.1 To determine pathotype variability of TuMV isolates
The variability of 20 TuMV isolates were determined using the differential pathotyping
system as described by Jenner & Walsh (1996). All isolates tested were pathotype 1 (Table
3.1.2).


To further assess variability of isolates serotypic analysis was used. A panel of monoclonal
antibodies (Jenner et al., 1999) was used to group isolates into three serotypic groups (Table
3.1.2).


CaMV isolates could be divided into three serotypic groups (Table 3.1.3). However, these are
preliminary results because the groupings could not be consistently repeated as the plants got
older. Attempts at producing consistent results by altering the protocol, using sonication and
alterations in the pH of buffers were unsuccessful.




Discussion
The pathotypic group into which the TuMV isolates were grouped, pathotype 1, is the most
common pathotypic group in the world (Jenner & Walsh, 1996). The lack of pathotypic
variation suggests that it would be relatively simple to deploy resistance to TuMV to protect
crops. However, this may create a selection pressure for more virulent pathotypes as even
though the isolates fall into the same pathotype they fall into three different serotypes which
suggests that TuMV has mutated and could easily mutate to overcome resistance if selection
pressure was exerted.


The classification of CaMV into serotypic groups needs further work because the sensitivity
of the test is affected by age of the plant. A method for classifying CaMV isolates would be
useful to measure variation in virus populations for the deployment of resistance as a control
strategy.


Research Activity 3.2 Evaluate local cultivars of cabbage and kale for resistance to
TuMV and CaMV and a local cultivar of swiss chard for resistance to BtMV
Local cultivars of cabbage, kale and swiss chard have been screened for resistance to TuMV
and CaMV. Nine out of the ten lines tested had resistance to TuMV, the one line tested with
BtMV had resistance, however none of the lines tested showed any resistance to CaMV
(Table 3.2.1).    TuMV and BtMV resistant plants were taken forward for selfed seed

                                                 57
Table 3.1.2        Pathotypic and serotypic groupings of TuMV isolates.
* Isolates unable to be revived for further analysis.
TuMV Isolate                  Pathotype                 Serotype
334/16                        1                         *
334/29                        1                         BEL 1
334/30                        1                         *
334/32                        1                         *
334/45                        1                         BEL 1
334/68                        1                         *
472/12                        1                         BEL 1
472/18                        1                         Subtype UK 1
472/48                        1                         Subtype CDN 1
472/93                        1                         *
472/97                        1                         Subtype CDN 1
472/142                       1                         BEL 1
472/144                       1                         BEL 1
472/145                       1                         Subtype CDN 1
472/148                       1                         Subtype UK 1
472/156                       1                         Subtype UK 1
472/162                       1                         Subtype UK 1
472/163                       1                         Subtype UK 1
472/170                       1                         Subtype UK 1
472/184                       1                         Subtype UK 1
472/222                       1                         Subtype CDN 1
472/252                       1                         BEL 1
472/256                       1                         BEL 1


Table 3.1.3 Preliminary classification of three CaMV isolates

Antibody                      Isolate 472/137           Isolate 472/51    Isolate 472/95
EMA 195                       -                         +                 +
EMA 196                       +                         +                 +
EMA 199                       +                         +                 +
EMA 200                       +                         -                 -
EMA 201                       -                         -                 -




                                                        58
Table 3.2.1     Brassica napus, B. oleracea and Spinacia oleracea tested for resistance to Turnip mosaic virus (TuMV), Cauliflower mosaic virus (CaMV) and Beet
mosaic virus (BtMV)


                                                                                          No resistant plants/Total no.
                                                                                                  plants tested

Seed Lot                  Origin                    Type                              TuMV          CaMV         BtMV

Giant English             Commercial variety        Brassica napus                    26/95         -            -

Big Cropper               Commercial variety        Brassica oleracea (cabbage)       0/85          -            -

Glory of Enkhuizen        Commercial variety        Brassica oleracea (cabbage)       2/88          -            -

11                        Alice, Kirenga market Brassica oleracea (kale)              4/60          0/29         -

12                        Kirenga market            Spinacia oleracea                 -             -            12/40

13                        Anne       Wangare, Brassica oleracea (kale)                11/58         0/27         -
                          Kirenga market
14                        Kirenga market      Brassica oleracea (kale)                5/45          0/26         -

15                        Kirenga market            Brassica oleracea (kale)          5/50          0/29         -

16                        Jane Kisumi, Kinale       Brassica oleracea (kale)          6/56          0/29         -

17                        Jacinta Wanjiku                                             9/79          0/29         -




                                                        59
production. Unfortunately resistant plants from Giant English and Glory of Enkhuizen were
susceptible to mildew and blackrot so seed production was not possible.



Discussion
Big Cropper was the only B. oleracea variety that did not have any resistance to TuMV, the
rest of the seed lots had resistance, some of which has been taken forward for seed
production. No CaMV resistance was identified in B. oleracea, although virus levels were
lower than in TuMV susceptible plants suggesting there may have been a degree of tolerance.
The S. oleracea line had some resistance to BtMV and one plant has been taken forward for
seed production. The non-persistent mode of transmission of TuMV and BtMV makes it
difficult to control because chemicals are ineffective in controlling the spread of virus,
therefore plant resistance may be a more effective control strategy.             It is important to
characterise the genetic control of resistance so that it can eventually be deployed to produce
TuMV and BtMV resistant varieties.


Research Activity 3.3 Screen promising cultivars and land races
Figure 3.3.1 shows a summary of differences for proportion of marketable plants and proportion
of infected plants at both NARL and Thika. There were significant differences between the seed
lots. Seed lot 17 was consistently lowest for proportion of marketable plants and highest for
proportion of infected plants. The score for seed lot 17 was not significantly different from seed
lots 1, 2 and 18 for proportion of marketable plants at NARL but it was significantly different
from all seed lots at Thika and for proportion of infected plants at both sites. Seed lots 3, 4, 8, 9,
10, 12 and 13 were not significantly different from each other for highest proportion of
marketable plants and lowest proportion of infected plants at both sites.


There were higher total number of leaves harvested for all seed lots at Thika than at NARL (Fig.
3.3.2). However, there were significant differences (P≤0.001) in number of marketable leaves
harvested at both sites. Seed lot 17 produced the least number of marketable leaves at both sites.
Twelve of the seed lots at NARL produced more marketable leaves than the commercial variety,
but at Thika the commercial variety was the most productive.


Similarly, the seed lots produced a greater total marketable weight of kale leaves at Thika than at
NARL, and seedlot 17 yielded the lowest weights per season per plot (Fig. 3.3.3). Seed lot 3, 4,


                                                   60
12, and the commercial variety produced the highest total marketable leaf weights at Thika, but
at NARL the top four were seed lots 4, 8, and 9.


Several plants which showed resistance/tolerance to viral diseases and insect pests were tagged,
and monitored for flowering. However, only three tagged kale plants flowered. The inflorescence
of the three plants were covered in order to prevent cross pollination and bird damage. The seed
was collected.



Discussion
These results show that there is a direct relationship between proportion of plants infected and
proportion of marketable plants. Seed lot 17 had a high proportion of infected plants and a
low proportion of marketable plants therefore is not suitable for use on a larger scale where
field resistance would be used as a management strategy. Seven of the 18 seed lots tested had
a high proportion of marketable plants and a low proportion of infected plants which suggests
that there is virus resistance present in the landrace populations selected in Kinale. In
addition, three seed lots produced higher total marketable leaf weight per plot per season than
several other seed lots.    This suggests that there may be diverse germplasm from which
selections could be made for a wider breeding programme.


Research Activity 3.4 To determine the potential of self-selection of seed
Plant selection
The objective of the on-farm trial was to select seed from kale land races that showed
resistance/tolerance to Brassica viruses. Farmers decided to use the following criteria to
select their good and bad plants for seed production:


Good: Green leaves, many thick, long pods, late flowering (long harvest period), soil fertility
of the area around which the plant is


Bad:   Small seeds, thin leaves, stunted plants, weak plants, short and slender pods, leaf
yellowing/chlorosis, immature seeds, aphid-infested plants


Scientists used the following criteria to select plants for seed production:
Good: Aphid infested but still healthy, healthy green leaves, late flowering




                                                   61
Figure 3.3.1 Assessment of seed lots at NARL and Thika for percentage of marketable leaves and infected plants


                                                                                                                                             Marketability (NARL)
                                                                                                                                             s.e.d.=4.873 (457)
                                                                                                                                             p<0.001
                     Assessment of kale seed lots forvirus resistance and marketability at Thika and NARL

                                                                                                                                             Marketability (Thika)
      90
                                                                                                                                             s.e.d.=4.018 (459)
                                                                                                                                             p<0.001
      80

                                                                                                                                             Infected (both sites)
      70
                                                                                                                                             s.e.d.=3.453 (187)

      60


      50
  %




      40


      30


      20


      10


       0
           1     2      3     4       5       6      7        8          9      10      11     12       13      14       15   16   17   18
                                                                         Seed lot

                                  % marketable plants NARL        % marketable plants Thika   % infected plants both sites




                                                             62
                       Total number of leaves season-1plot-1




                                0.0
                                      100.0
                                              200.0
                                                      300.0
                                                              400.0
                                                                      500.0
                                                                                                600.0
                   Seed lot 1

                   Seed lot 2

                   Seed lot 3

                   Seed lot 4

                   Seed lot 5

                   Seed lot 6

                   Seed lot 7




63
                   Seed lot 8

                   Seed lot 9

                  Seed lot 10




     Kale entry
                  Seed lot 11

                  Seed lot 12

                  Seed lot 13

                  Seed lot 14
                                                                              Thika (P<0.001; s.e.d = 40.8)
                                                                              NARL (P<0.001; s.e.d = 48.8)




                  Seed lot 15

                  Seed lot 16

                  Seed lot 17

     Commerc. Var.
                                                                                                              Fig. 3.3.2 Assessment of seed lots at NARL and Thika for total number of marketable leaves per plot harvested over the season
                              Total marketable wt. season -1 plot-1 (kg)




                                   0.0
                                         2.0
                                               4.0
                                                     6.0
                                                           8.0
                                                                 10.0
                                                                        12.0
                                                                                                  14.0
                      Seed lot 1

                      Seed lot 2

                      Seed lot 3

                      Seed lot 4

                      Seed lot 5

                      Seed lot 6

                      Seed lot 7




64
                      Seed lot 8

                      Seed lot 9

                     Seed lot 10



     Kale entry
                     Seed lot 11

                     Seed lot 12

                     Seed lot 13

                     Seed lot 14
                                                                                                              Thika (P<0.003; s.e.d = 1.34)
                                                                               NARL (P<0.001; s.e.d = 48.8)




                     Seed lot 15

                     Seed lot 16

                     Seed lot 17

                  Commerc. Var.
                                                                                                                                              Fig. 3.3.3 Assessment of seed lots at NARL and Thika for total marketable weight of harvested leaves per plot over the season
Bad:   Stunted growth, aphid infested and showing virus symptoms, leaf chlorosis, vein
       clearing, mottling and mosaic, leaf distortion, leaf puckering


Screening of subsequent seed
Once seed was planted in the design shown above, farmers and researchers assessed the
nurseries for the criteria listed above. During the first sampling week none of the farmers
could identify diseased plants because they were too small. During the second assessments
only three farmers could identify disease symptoms.


Results are being analysed


Farmer field day
At the farmer field day two questions were frequently raised:
Q1     How can farmers identify healthy kale land race seeds from the market?
A1     It is very difficult to tell healthy from unhealthy seed either by colour or seed size,
       hence this research work.


Q2     How will farmers benefit from this research?
A2     Now that researchers have shown farmers how to select and harvest healthy seed using
       the criteria mentioned above the farmers can grow resistant/tolerant landraces with
       increased yield. This would also provide farmers with an opportunity to become
       agents of good seed by selling their surplus stock to markets.


Research Activity 4.1 PRA to assess farmer problems, perceptions and practices in
relation to virus diseases and their aphid vectors
A more detailed report of this activity can be found in Njuki, 2001 (Appendix 4).




Results of PRA to assess farmer problems, perceptions and practices.
In Ruiru farmers were already members of a group, all farming along the Ruiru River and
growing vegetables.    In Athi River, there was no formal organisation of farmers and
individual farmers were brought together to participate in the PRA and subsequent on-farm
trials. All farmers were growing vegetables under irrigation.




                                               65
Farmer wealth ranking
Described in results of Activity 2.3. Will be used in final PRA activity 4.2.



General problems and constraints in vegetable production and marketing.
Table 4.1.1 show the factors farmers consider to be important constraints on vegetable
production. Diseases and pests were considered the most important constraint in both Ruiru
and Athi River. Lack of finance and quality seeds were the second most important constraints
in the two districts respectively.


Importantly, farmers in Athi River ranked lack of information on diseases and their control as
the fourth most important constraint. Expensive inputs, especially pesticides were mentioned
as a production constraint in Ruiru. This is of relevance to this project, as activities 2.1 and
2.2 have looked at non-chemical control methods for viral diseases.



Farmer ranking of common kale and cabbage varieties
Table 4.1.2 shows farmer assessments of different varieties of kale and cabbage. Thousand-
headed variety of kale was considered more susceptible to diseases than the collard variety in
both Athi River and Ruiru. Farmers had not observed any differences in susceptibility to
diseases and pests among the cabbage varieties.



Farmers’ perceptions of virus diseases
A pest and diseases symptoms calendar was drawn for both crops, Table 4.1.3, and was used
to evaluate farmer perceptions of virus diseases and their control. In general, farmers in Ruiru
were more knowledgeable about the symptoms and causes of insect pests and diseases than
those in Athi River. This could be because the farmers in Ruiru were already members of a
group and some group members have been for farmer training on various crops and crop
management practices. Few farmers in Athi River had a clear perception of the relationship
between disease carrying vectors and the disease symptoms they cause.



Athi River
Viral symptoms were identified as yellowing of leaves and rough leaf surface, these were
attributed to too much water, too much manure and fertiliser or too much watering followed

                                                66
Table 4.1.1 Vegetable production constraints considered important by farmers in Athi River and Ruiru


             Rank               Athi River                      Ruiru
              1                 Insect pests & diseases         Insect pests & diseases

              2                 Lack of quality seed            Lack of finance

              3                 Lack of credit/finance          Market flooding

              4                 Lack of information on Transport to markets
                                diseases and methods of
                                control

              5                 Market flooding causing Soil nutrient deficiencies
                                low prices

              6                 Water pollution                 Expensive             inputs
                                                                especially pesticides

              7                 Lack of experience in Low quality of seed
                                vegetable farming

              8                 Weather                         Lack      of   technical
                                                                information on vegetable
                                                                growing
              9                 Wildlife menace

              10                Unavailability of water




Table 4.1.2 Landraces and varieties of kale and cabbage considered priorities by farmers in Athi River
and Ruiru


                                Kale                            Cabbage
Athi River                      Collard                         Gloria
                                Thousand Headed                 Sugarloaf
                                                                Drumhead
                                                                Copenhagen
                                                                Amukos

Ruiru                           Collards                        Copenhagen
                                Thousand Headed                 Gloria
                                Kinale                          Amigo
                                                                Amukos
                                                                Fortuna




                                                   67
Table 4.1.3 Disease calendar for kale in Athi River and Ruiru
Athi River                                                                Ruiru
Growth stage   Symptoms       Disease      or   Disease or   Control      Growth    Symptoms             Disease      or   Disease or   Control           Most
                              pest (farmer)     pest                      stage                          pest (farmer)     pest                           susceptible
                                                (actual)                                                                   (Actual)
Nursery        Whitish        Blight            Thousand     Ridomil      Nursery   Leaf perforations    Green        or   Diamond      Dimethoate        Thousand
               rusty leaves                     headed       Dithane                                     black             Back Moth    Karate            headed
                                                             Antracol                                    caterpillars                   Marshal
                                                                                                                                        Diazinon
                                                                                                                                        Bulldock
                                                                                                                                        Fastac
               Rotting of     Whitefly          Thousand     Karate                 Fine         leaf    Green             Diamond      Same as above     Thousand
               roots                            headed       Dimethoate             perforations         caterpillars      Back moth                      headed
               Drying on      Cold              Thousand     As blight              Rotting stem         Cold                           Ridomil copper    1000 headed
               stem base                        headed
               Leaf           Caterpillars      Thousand     Karate                 Stunted growth       Low     quality                None              1000 headed
               perforation    Leaf hoppers      headed       Dimethoate                                  seed, poor soil
               Curling of     Aphids            Thousand     Karate                 Eaten leaves         Birds                          Scare             All
               leaves                           headed       Dimethoate
                                                                                    Wilting              Nutrient                       None
                                                                                                         deficiency
                                                                                    Blight on leaves
Seedbed        Drying    of                     Thousand                  Seedbed   Small                whitefly                       Thuricide         Thousand
               stem                             headed                              perforations                                                          headed
               Yellowing &                      Thousand                            Curling of leaves    Aphids                         Dimethoate        Thousand
               drying    of                     headed                                                                                  Karate            headed
               stem& roots                                                                                                              Dry ash
                                                                                    Stem rot & drying    Caterpillars                   Remove and kill   1000 headed
                                                                                    Yellowish rough      Cold                           Ridomil           Thousand
                                                                                    leaves                                              Karate            headed
                                                                                                                                        Dimethoate
                                                                                    Black leaf veins     Cold                           Ridomil           Thousand
                                                                                                                                        Karate            headed
                                                                                                                                        Dimethoate
                                                                                                                                        Uproot
                                                                                    Whitish powder       Fly (type not                  Thioviate         Thousand
                                                                                    on underside of      specified)                                       headed
                                                                                    leaves               Sunny
                                                                                                         conditions
                                                                                                         Insufficient
                                                                                                         water
                                                                                    Yellowing      and   Mites                          Dimethoate        Thousand
                                                                                    drying of leaves                                    Karate            headed




                                                                  68
by heavy rains. Some farmers also thought the problem started from the stem based on their
observation of black and white strips on the stem of the affected plants. The farmers control
these symptoms by removing affected leaves because then younger ones remain healthy.
They attribute this to the fact that the plant is able to let water out through the injury that is
left when the infected leaves are removed thus releasing excess water from the plant.


One farmer related the relationship between virus symptoms and aphids. He thought that the
yellowing of leaves was due to aphids sucking water from the leaves, leaving the leaves
yellow and finally causing drying up of the leaves.


Other farmers felt that the high nutrient levels associated with the yellowing would mean the
plant would be too strong to be affected by aphids. Yellowing of leaves was also associated
to blight and potassium deficiency by some farmers. The blighted leaves were believed to
turn yellow when rained on.


Some farmers associated aphids with black rot believing that when the aphids settle on the
cabbage before the head forms, the aphids are engulfed and this causes them to die and rot
causing the whole cabbage head to rot.




Ruiru
Virus symptoms were identified as yellowing and curling of leaves and blackening or
colouration of the leaf veins. The farmers associated yellowing of leaves to aphids, cold
weather and mites. The virus symptoms were attributed to diamond back moth (DBM),
aphids which suck sap from the leaves, low quality seeds, insufficient fertiliser (nutrient
deficiency), lack of potassium, weeds which cover kale and prevent it from getting enough
sunlight and the cold. The whitish powder on the leaves was linked to powdery mildew,
which some farmers identified.


The farmers in Ruiru seemed to be more aware of other diseases, sometimes mentioning them
by name, than they were aware of virus diseases.          There is, however, some degree of
recognition of aphids, which are the vectors for viral disease to the yellowing of leaves, one of
the symptoms of viral diseases.




                                                 69
Evaluation of the effect of various symptoms on marketability, pricing and palatability of kale
and cabbage
Other pests and diseases rather than viral diseases appear to be considered more critical to the
marketability and prices of cabbages and kales. Yellowing and curling of leaves, which are
symptoms of virus diseases, were evaluated as having moderate effects on the marketability,
cost and palatability. This does not diminish the importance of controlling virus diseases due
to the prevalence and the differing opinions of farmers. It may be more of a reflection of the
market conditions in the two areas. Kale production in Athi River is higher and buyers have a
wider selection to choose from and will therefore not buy any yellow leaves, while in Ruiru
due to lower kale production there may be little choice for buyers in terms of general
appearance of the kale and cabbages.



Control methods used by farmers
Most control methods are based on the application of pesticides. However, in identifying the
production constraints, farmers in Athi River ranked lack of information on diseases and
appropriate controls as fourth most important. Evidence suggests that there has been too
much use of pesticides in the PU vegetable production system and there is need to focus more
on cultural control methods that are more environmentally friendly and affordable to farmers.



Discussion
The results show that farmers consider diseases and pests as the most important constraint and
that they associate aphids with virus symptoms. Increased knowledge of pests and diseases,
as requested by farmers in Athi River, would be advantageous to farmers because even though
they do associate aphids with virus symptoms they do not understand how the virus is
transmitted and how best to control them.            Farmers in Ruiru appeared to be more
knowledgeable than those in Athi River, which suggests that farmer consortiums are an
effective method for dissemination of knowledge rather than farmers being on their own, as in
Athi River, where increased knowledge was identified as a requirement.




                                                70
Contribution of Outputs to developmental impact
The anticipated outputs for activities completed in the project have been achieved as expected.
The PRA activities have determined farmers’ perception of virus diseases, how they currently
control the diseases and how receptive they would be to the adoption of alternative methods.
Farmers in Athi River and Ruiru considered and pests to be the major constraints of vegetable
production in the PU region. Farmers in Athi River considered knowledge about diseases and
pests to be an important method of combating this problem. This could be because farmers in
Athi River are lone farmers so there is no method for dissemination of knowledge, whereas
farmers in Ruiru work as a co-operative and generally had access to more knowledge than their
counterparts in Athi River. This project has directly contributed to increasing the knowledge of
farmers in terms of understanding how virus diseases spread and making them aware of the
appropriate control methods available to them. The participatory approach of the project has also
ensured that the management practices meet the demands of the farmers. The project has also
stimulated farmers to form groups for dissemination of information through farmer field days
etc.


The most common method of pest and disease control was by using chemical pesticides. Other
projects in the PU vegetable cluster have identified that the farmers in general often use pesticide
at a higher concentration than is necessary in the belief that more is better and they often use
pesticides that are out of date and also spray too frequently. These practices have a negative
impact on the environment and are particularly detrimental to the health of the farmer and the
consumer. Pesticides are often not effective in controlling virus disease, for example, pesticides
are useless in a scenario where virus disease has been spread through kale crops by the kale
pickers through mechanical contact during harvest. This project has addressed the problem of
inappropriate pesticide use by trialling alternative, low input, sustainable control methods of re-
usable fleece and straw mulch to control virus disease in the nursery bed. Farmers in Athi River
preferred to use their original method of dimethoate spray but were willing to use the fleece and
straw treatments if they were more readily available and cheaper. The organic group of farmers
in Kariguini favoured the mulch treatment and would like to try the fleece treatment again if it
was more readily available. They also thought that the straw mulch would be more attractive if
they could grow it themselves to make it cheaper, this is possible in Kariguini but not in Athi
River. The results of this project show that the straw treatment is multi-purpose in that it has an
impact on virus and aphid incidence. These low impact treatments could be combined with the
biorational and pesticide initiatives of other CPP projects to produce a coherent integrated pest
management programme.

                                                  71
The participation of farmers in the investigation of virus resistant germplasm has increased their
awareness of the benefits of using resistant germplasm as a method of control. In the Kinale
region farmers are able to grow and market their own kale seed due to the cold temperatures in
the region, which effectively vernalise the plants encouraging them to flower. Farmers selected
plants for seed based on length of time to flower and general health. A problem some farmers
raised was the difficulty they have in finding good quality germplasm. In this project we have
been working with the farmers to identify ways of improving seed quality by improving
selection criteria. The identification of pest and disease resistant, good quality seed would
increase yield, which would mean that less land would be required to grow the same amount of
food. This would also reduce environmental degradation in the region and IPM strategies would
reduce pesticide input.


The project has contributed to sustainable rural livelihoods in that the outputs will help farmers
to produce their vegetable crops (for consumption and sale) in a safer, more effective and
economic way. The benefits will include improved nutrition for whole families, reduction of
risks from pesticide use and their consumption in the form of residues in produce, better cash
returns from higher yields of better quality produce and an empowerment through agricultural
knowledge which will help them to make informed choices on other cropping options.
Dissemination activities included farmer meetings, workshops for extension staff and trainers
and study tours for relevant researchers.



What further research is necessary?
Blackrot was identified as a serious problem during this project because it destroyed a
screenhouse trial and was also an extensive problem in the samples collected throughout the
project. Screenhouse experiments in the future would benefit the farmer by identifying the
economic impact of blackrot on cabbages and investigating sustainable, low input control
methods. Seed-borne Xanthomonas campestris is a serious threat to brassicas therefore research
into management strategies in the field is urgently required.
The low input management strategies used in this project could have further impact by
combining with the management of aphids and soil borne organisms such as root knot
nematodes.




                                                  72
The close relationship between viruses and their vectors suggests that investigations into
integrated control strategies would be appropriate. Future work on control of aphids would need
to be combined with virus impact assessment.


Seed quality was identified as an area in which farmers required more research to be done.
Quality of seed research could be combined with disease resistance but this may require a global
effort including international partners such as AVRDC and HRI to ensure access to international
seed collections.



Pathways whereby present and anticipated future outputs will impact on poverty alleviation
or sustainable livelihoods
The results of the project have various established avenues for dissemination to intended
beneficiaries. KARI works with the extension service and NGO’s in dissemination of research
results through demonstrations, field days and distribution of seed or information materials etc.


KARI and CABI have taken up and integrated project outputs into their activities as part of their
training capability. It is also anticipated that CABI/KARI would participate in further stages to
develop outputs.


Farmers at Kinale produce and market their own kale seed. Future research would identify how
these markets could be expanded and promoted in a sustainable way.


The low input, sustainable management strategies identified in this project could be further
developed to improve their effectiveness in reducing virus diseases and aphid vectors in
brassicas. Promotional opportunities need to be exploited in the future to increase availability of
these alternative methods.


Smallholder vegetable production provides an important source of employment, income
generation and poverty alleviation for many households in rural areas. One of the major
constraints in vegetable production systems remains, i.e., loss of crop yield and quality to pests
and diseases. Smallholder farmers still rely heavily on the use of pesticides to reduce the damage
from pests and diseases. However, excessive and inappropriate use of pesticides can result in
residues in produce, induce resistance and be hazardous to human health and the environment,
particularly to natural enemies and other beneficial organisms such as pollinators.             By


                                                 73
developing an integrated pest management strategy for vegetable production, which reduces the
reliance on pesticides, the volume and quality of vegetable production will be increased in a
sustainable way in order to meet the requirements of an expanding urban population. A
dependable supply of safe and affordable vegetables is an important requirement for dietary
health, general health, especially low-income households.      By ensuring the availability of
alternative practices future research will decrease poverty and increase security of sustainable
livelihoods.




                                                74
Biometricians Signature

The projects named biometrician must sign off the Final Technical Report before it is
submitted to CPP. This can either be done by the projects named biometrician signing in the
space provided below, or by a letter or email from the named biometrician accompanying the
Final Technical Report submitted to CPP. (Please note that NR International reserves the
right to retain the final quarter’s payment pending NR International’s receipt and approval of
the Final Technical Report, duly signed by the project’s biometrician)



I confirm that the biometric issues have been adequately addressed in the Final Technical
Report:

Signature:
Name (typed):
Position:
Date:




                                               75
Appendices
Appendix 1
Survey of viruses of vegetable crops in the peri-urban production systems of Kenya –
ZA0272


Summary
A visit was made to Kenya during 12-19 February 1999, to conduct a survey of virus diseases
in vegetable production on farms around Nairobi to support pest management of
vegetables/horticultural crops in the Peri-urban Production System in East Africa supported
by the DFID Crop Protection Programme (CPP). In particular, to support the CPP research
project ZA0080/1:Pest Management for Horticultural Crops led by Jerry Cooper, NRI and
George Oduor, CABI respectively. Seventy-seven samples were collected from 18 different
vegetable crops from 14 different farms. Possible virus symptoms of each sample were
recorded in Kenya. On return to the UK each sample was inoculated to a range of host
indicator plants as appropriate. Each sample was also tested for several known viruses using
ELISA and samples of each crop were examined in the electron microscope (EM). After 7-10
days symptoms had developed in many of the indicator species and these were recorded.
Further EM and ELISA was performed on samples from the indicator species. All original
samples were stored in liquid nitrogen and samples of infected indicator species have been
freeze-dried for future use. The diagnostic work is summarised in Tables 1, 2 and 3.
       Cabbage, cauliflower and kale crops were found to be almost 100% infected with
combinations of Turnip mosaic virus (TuMV), Cauliflower mosaic virus (CaMV) and Beet
western yellows virus (BWYV). Pepper crops were 100% infected with combinations of
Pepper mild mottle virus and potyviruses. As up to 10 different potyviruses can infect pepper
further identification work is required. Cucumber and spinach crops were also severely
affected by potyviruses, thought to be Watermelon mosaic virus 2 (WMV-2) and Beet mosaic
potyvirus (BtMV) respectively.     Other crops which were virus-infected included celery,
pumpkin and lettuce.    Most of the viruses of importance are aphid-transmitted and the
importance of vector control and other aspects of disease management are discussed.
       Other objectives of this project were to provide advice to KARI and CABI staff on the
collection of field samples and diagnosis of virus diseases and to make recommendations for
the current demand-driven research needs in virology in vegetable/horticultural crops to the
CPP Programme Management.




                                               76
Background
Virus diseases are known to affect important vegetable crops in Kenya. Previous work by
HRI, NRI and KARI revealed that TuMV and CaMV infect kale, but there is currently no
detailed information about the distribution and relative importance of these viruses within
Kenya. Other crops that are thought to be at risk from viruses are cabbage, spinach, squash,
lettuce, tomatoes and onions.      In order to prioritise research requirements and develop
strategies for sustainable disease control, a survey of viruses of vegetable crops was
conducted.


Initial meeting on 15 February at KARI NARL
I met Gilbert Kibata, George Oduor, Jackson Kung’u, Alex Kuria and Peter Karanja to discuss
the purpose of my visit and plan the collection of field samples. We also discussed the current
virology capability in Kenya.


I then briefly visited the CABI laboratories and offices at the ICRAF campus before
embarking on a field visit to the Limuru district.


Kinale-Soko Mjinga Market in Lari division
Ten samples of kale seed produced by local farmers were purchased to investigate possible
sources of disease resistance at a later time. We then visited 3 farms in the Kinale region. I was
impressed by the good relationship with farmers abd Peter Karanja ensured the farmers
understood what we were doing and showed them disease symptoms and any insect predators
and parasitoids. The farmers were therefore friendly and co-operative.


Farm 1        Kinale
A 5 acre farm owned by Regina, mainly kale, cabbage and Irish potatoes. She had lost a crop
of carrots due to the drought. There were many Brevicoryne aphids infesting the cabbage and
kale. Crops had been sprayed with Ambush, but this had been ineffective, probably due to
resistance. There was much evidence of virus infection, with yellow vein clearing symptoms
in approx. 80% of the cabbage plants. Many aphids were parasitised, with evidence of
mummified aphids on leaves. Three cabbage samples (cv Copenhagen) with vein clearing
symptoms were collected (#1,2,3) and one kale sample with vein clearing (#4). There was
also some Alternaria leaf spot on the cabbage. Broad bean volunteer plants were infested
with Aphis fabae, but there was no evidence of virus. The cabbage samples were infected
with TuMV and the kale with TuMV and BWYV.


                                                 77
Farm 2       Kinale
Nicholas Karugu’s farm adjoining Farm 1. Kale and spinach (cv Fordhook Giant). The
cultivar is dark green and very curly. There was little evidence of diseases apart from
Cercospora leaf spot one spinach sample was collected to investigate a severe distortion and
stunting symptom (#5). The spinach was infected with potyvirus, probably BtMV.


Farm 3        Kinale adjoining Farms 1 and 2
We noticed a cabbage (cv Gloria) plot with almost 100% virus symptoms, also with evidence
of aphid feeding damage. Some plants had particularly severe vein clearing and were stunted
and could have been infected at a very early stage. The yield of such plants was severely
reduced and it seemed unlikely that they would form a head. Sample 6 was collected from a
severely infected plant and was infected with BWYV, CaMV and TuMV.


Tuesday 16 February        Field visit to Mwea District
Mwea is an important rice growing area as it has good water supplies. This also makes it
ideal for peri-urban vegetable production as farmers can irrigate their fields. Vegetable crops
in this area included green beans and tomatoes and crops were generally looking fairly
healthy. However, there was extensive insecticide and fungicide application,with every crop
visited having been sprayed that day or the day before. In several cases sprays had failed to
control diamond back moth (DBM) and aphids, and at one organic farm better control had
been achieved without any spray.        This suggested that some pesticide resistance had
developed and that sprays were killing beneficial parasitic organisms. Where there were high
aphid populations (Brevicoryne) in kale crops there were always high levels of virus infection,
but when aphids were controlled either with or without sprays, there was little or no virus
problem.


Farm 4        Wanguru
We visited a demonstration farm run by the Chrisitian Community Services. The manager,
Mary Gichobi showed us irrigated crops of beans, peas, tomatoes, cabbage and maize, as well
as a small organic crop of cabbage, groundnuts, tomatoes and chilli. The cabbage had been
sprayed with Karate, but this had not been effective as the whole crop was severely affected
by DBM. It was unlikely that the crop would yield any cabbages as no heads were forming.
Also, there was no sign of beneficial parasitoids on the cabbage plants. Samples (#7 and #8)
were taken, and whilst there were no obvious virus symptoms due to DBM damage, #7 was
infected with BWV and #8 with BWYV and TuMV. The cabbages were inter-planted with


                                               78
peas that had yellow vein clearing symptoms (#9) and although potyvirus was detected using
ELISA, no virus was isolated. Tomatoes were affected by bacterial wilt, late blight and early
blight and there was also evidence of root knot nematodes but no virus symptoms. French
beans had no diseases symptoms but a crop or dwarf beans were severely affected by angular
leaf spot and bean rust. In the organic plot, cabbages had not been sprayed and were less
severely affected by DBM. There was also evidence of beneficial parasitoids. Groundnuts
had thrips feeding damage, mealy bugs and possible virus symptoms of chlorotic spots (#10)
and although potyvirus was detected using ELISA, no virus was isolated.


Farm 5       Wanguru
A tomato crop of approximately 0.5 acres had recently been heavily sprayed with M45 and
pesticide residue covered the leaves. The main problems were bacterial wilt and root knot
nematodes, with possible Fusarium and Verticillium infections.          Some plants were also
stunted and distorted (samples #11 and 12) but no virus was detected.


Farm 6        Michael’s farm at Wanguru
This farm supplies kale (cv Collards) for the whole village which is inter-planted with maize.
There was little DBM damage and the kale had been sprayed, but not with Karate. Many
beneficial parasitoids were present. There was a high incidence of virus symptoms (c.80%)
with severe Brevicoryne infestations. Virus symptoms ranged from vein clearing (#15) to
chlorotic spots (#13, 14 & 16). Some plants were very severely affected and stunted. These
four samples were infected with combinations of BWYV, CaMV and TuMV. Some plants
with bluer foliage appeared to be resistant. A Datura stramonium plant had a possible
chlorotic symptom (sample #17) but no virus was detected.           Indicator plants (Brassica
perviridis) inoculated with sample 16 exhibited very severe symptoms. A field of tomatoes
nearby had severe bacterial wilt but there was no evidence of virus infection.


Wednesday 17 February         Field surveys at Athi River

Farm 7        Jane Mutsya’s farm
About 5 acres of French beans at different stages of maturity were being grown for export;
also some red onions. Older bean crops were severely affected by bean rust, although they
had been sprayed for rust. Sprays for red spider mite had been effective. There were several
yellow patches in a younger crop of beans, which was thought to be due to nutritional
deficiencies. Samples were taken for checking (#18-22), although no virus was detected. The




                                                79
red onions (cv Red Creole) had thrips feeding damage and some plants had yellow streaks so
samples were taken (#23 & 24) but no virus was detected.


Farm 8        Joshua Nzive Mulwa’s farm
Mainly kale and sweet pepper crops, with a few aubergines. The peppers had been planted 12
months previously and were 100% infected with viruses. The farmer reported that symptoms
first appeared approximately 6 months after planting. Plants were stunted with leaf and fruit
distortion and leaf mosaic (samples #25-28) and all contained potyviruses, although samples
also tested positive for tomato mosaic virus (ToMV) in ELISA. There can be up to 10
different potyviruses infecting sweet pepper so further characterisation will be required to
identify viruses present in Kenya. There were very severe symptoms in indicator plants
inoculated with these samples. The kale crop was also severely affected by virus, with
symptoms ranging from severe yellow mosaic to vein clearing (samples #29-32) and most
samples were affected by BWYV, CaMV and TuMV. B. perviridis indicator plants had very
severe symptoms after inoculation with these samples. An aubergine crop was severely
affected by red spider mite but there were no signs of pathogens.


Farm 8a      Joshua Nzive Mulwa’s farm
Approximately 1km away from Farm 8 there was a large crop of cabbage inter-planted with
sweet pepper. Cabbage (cv Gloria) was 100% infected with virus (sample #33 was infected
with BWYV), but many cabbages had formed good heads.


The sweet peppers were also 100% infected with potyvirus (sample #35) and an aubergine
plant with yellow leaves was sampled (#34) and found to be infected with potyvirus and
ToMV.


Farm 9       Simon Mangeli’s farm
A wide range of vegetable crops including French beans for export, kale, pumpkin, cowpea
and spinach. All crops had possible virus symptoms: yellow leaf blisters on the pumpkin
leaves (#37 – no virus detected), mosaic symtpoms on the cowpeas (#36, 38 & 39 – no virus
detected). Spinach had severe chlorosis and distortion (#40 & 41 – potyvirus), French beans
had chlorotic spots and distortion (#42-44 – no virus detected) and 100% of kale plants had
virus symptoms (#45 & 46 – BWYV, CaMV and TuMV).


Thursday 18 February          Field surveys around Nyathona District



                                               80
Farm 10      Mr Cheche’s farm, Wangigi
A kale crop growing alongside a crop of spinach, both with100% virus infection. Kale
symptoms were mosaic and vein clearing (#50 & 51 – BWYV and TuMV). The kale also had
a Brevicoryne problem. Spinach had severe chlorotic mottle and stunting symptoms (#47 &
48 – BWYV) and severe yellowing (#49 – TuMV). Another spinach crop also had a severe
Cercospora problem. A lettuce crop appeared to have extensive vein clearing symptoms,
however this could have been varietal. Other symptoms were leaf blistering (#52 & 53) but
only BWYV was detected in lettuce.        The lettuce crop was also severely affected by
Sclerotinia (30%). Further down the calley (10a), a large spinach field was >80% affected by
chlorotic mottle symptoms (#54 & 55 – potyvirus). Another kale crop was 100% affected by
virus (#56 – CaMV and BWYV). French beans were affected by Aphis fabae and had
mosaic, green vein banding and distortion (#57 & 58) caused by potyvirus, although no virus
was isolated.


Farm 11      Mrs Gathura
A number of spinach plots, all with >80% chlorotic mottle symptoms. Mostly the younger
leaves were affected and Mrs Gatura complained that the new leaves were very small,
distorted and not marketable (#60 & 61 – potyvirus). There were also severla coriander crops,
one of which had yellowing and reddening of leaf margins (#59 – no virus dtected). A carrot
crop looked very healthy. A cabbage crop had 100% virus (#63 – BWYV) and was also
affected by black rot. An adjoining cauliflower crop was 50-60% affected by virus (#64 –
BWYV and CaMV). A small squash crop had yellow blistering on the leaves (#62 – no virus
detected).


Farm 12      Mungai Kuria’s farm
A cucumber crop with 30-40% of plants exhibiting mosaic symptoms in the younger leaves
(#65, 66 & 67 – potyvirus, probably WMV-2).


Farm 13     David Karugu’s farm
A cucumber crop with approx. 80% of plants exhibiting severe mosaic and green vein
clearing symptoms in younger leaves (#69, 70 & 71 – potyvirus, probably WMV-2).
Cucumber plants were also severely stunted and some fruit were distorted. Many plants were
unlikely to produce any fruit. Kale crops were 100% affected by virus, cabbage approx. 70%
affected and cauliflower was approx. 70% affected by vein clearing (#68 – BWYV and
TuMV). Kale seed beds were approx. 10% affected by virus, with a higher incidence in older




                                              81
seed beds which had also been affected by aphids. There was very little DBM damage (high
insecticide input).


Farm 14        John Kbiaru’s farm
Shallots exhibited white tip symptoms but there were no virus symptoms. Leeks had thrips
damage but no virus symptoms and sweet peppers were 100% affected by severe mosaic (#75
& 76 – potyvirus). Approx. 70% of the celery crop had severe yellowing of the leaf margin
(#72 – 74 – Celery mosaic virus). Approximately 80% of lettuce crops were affected by
Sclerotinia and some plants had possible vein clearing symptoms (#77 – no virus detected).
There were many Brevicoryne aphids on the lettuce. Kale crops were approx. 70% affected
by virus.


Conclusions
 • Cabbage, cauliflower abd kale crops were virtually 100% infected with combinations of
     BWYV, CaMV and TuMV.                Crop losses are difficult to estimate but must be
     considerable as virus infection causes stunting of plants and reduced leaf are (kale) or
     head production (cabbage). All three ciruses are transmitted by several aphid species
     and are not transmitted in seed. However, from observations and previous experience
     BWYV was not considered to be causing significant symptoms or losses.
 • The key to control of the Brassica viruses is effective vector control in combination with
     identification and development of genetic resistance. There is no genetic resistance in
     commercial Brassica oleracea, however it was noted that there was some phenotypic
     variation in local cultivars of kale and differences in susceptibility to viruses in the field.
     These cultivars are probably land races and should be screened for potential sources of
     resistance. Seed was collected from 10 land races of kale from the Kinale region, an
     area where farmers save seed for planting.
 • For evaluation of genetic resistance in land races of kale it is necessary to determine
     pathotype diversity. This is possible for TuMV as differential cultivars have been
     identified and monoclonal antibodies produced at HRI. There is currently no system for
     pathotyping CaMV, but local Brassica lines could be screened to examine CaMV
     variation. Isolates of CaMV and TuMV from the present study have been preserved for
     future use.
 • Control of aphids as part of an IPM strategy is part of project ZA0080/1: Pest
     Management for Horticultural Crops led by J Cooper, NRI and G Oduor, CABI Kenya
     respectively. Future experiments should include a component to investigate the efficacy
     of treatments for control of viruses, as well as aphid vectors.
                                                 82
 • Pepper crops were 100% infected with combinations of Pepper mild mottle virus and
     potyviruses. As up to 10 different potyviruses can infect pepper further identification
     work is required.    Viruses of pepper and chilli are very damaging and can cause
     complete crop failure. However, there are sources of resistance to several viruses in
     Capsicum anuum that should be evaluated once the viruses have been identified. Also,
     some viruses are seed-transmitted so improvements in seed health management would
     reduce incidence of virus diseases.
 • Cucumber and spinach crops were also severely affected y potyviruses, which were
     probably WMV-2 and BtMV respectively. Neither virus is seed-transmitted but both
     are transmitted by several species of aphid so vector control is important.
 • Other crops that were infected by viruses were celery, pumpkin and lettuce. In each case
     the viruses were aphid transmitted so the importance on management if aphids is
     emphasised again.
 • KARI and CABI staff were advised on the collection of field samples and diagnosis of
     virus diseases and materials were left do that samples could be collected and sent to
     HRI, Wellesbourne for diagnosis at a later time. It was clear that the capacity for virus
     identification is extremely limited. The virology laboratory at KARI (NARL) had an
     ELISA plate reader and PCR thermocycler but this equipment did not appear to be in
     use due to problems in obtaining and maintaining reagents. The development of robust
     and cheap virus diagnostic techniques where reagents do not require refrigeration would
     make a significant impact to virus research in Kenya. At HRI the development of lateral
     flow technology for pathogen detection in a simple “pregnancy test” format could be
     utilised for detection of viruses in Kenya.
 • A confidential short report on institutional capabilities and facilities is provided
     separately.



Recommendations for the current research needs in virology in vegetable/horticulture crops
to the CPP Programme Management


Brassica viruses
A      Vector control

Objective: To determine the effect of vector control on virus incidence
• Include a component to determine the incidence of viruses (BWYV, CaMV and TuMV) in
   aphid control trials in project ZA0080/1: Pest Management for Horticultural Crops led by


                                                   83
    J Cooper, NRI and G Oduor, CABI Kenya. Future experiments should determine the
    efficacy of treatments for control of viruses, as well as their aphid vectors.


B      Genetic resistance
Objective: To assess pathogen diversity and identify sources of host resistance
•   Determine pathotype diversity of Kenyan isolates of TuMV collected in this survey using
    different cultivars and monoclonal antibodies already available at HRI.
•   Screen local cultivars and land races of kale collected in the present survey and evaluate
    for resistance to Kenyan isolates of TuMV and CaMV.


C      Diagnostics
Objective: To develop appropriate diagnostics methods for local use
•   The development of robust and cheap virus diagnostic techniques for TuMV using lateral
    flow technology. This technology could then be adapted for other viruses of importance.


D      Disease management
Objective: To protect seed beds from sources of virus infection
•   Investigate management methods to protect Brassica seed beds from virus infection e.g.
    mulches, fleece, straw etc.


1. Pepper viruses
Objective To idemtify viruses infecting pepper and develop disease control strategies
•   Identify and characterise potyviruses infecting sweet pepper using antibodies and
    molecular diagnostic techniques.
•   Determine the incidence of PMMV in sweet pepper seed and evaluate seed treatments to
    eradicate PMMV from seed.
•   Screen local cultivars and land races of pepper collected in the present survey and
    evaluate for resistance to kenyan isolates of PMMV and potyviruses from pepper.


2. Viruses of other crops
Objective: To determine the effect of vector control on virus incidence
• Spinach. Include a component to determine the incidence of viruses (BtMV in spinach) in
    aphid control trials in project ZA0080/1: Pest Management for Horticultural Crops led by
    J Cooper, NRI and G Oduor, CABI Kenya. Future experiments should determine the
    efficacy of treatments for control of viruses, as well as their aphid vectors.

                                                 84
•   Cucumber crops were severely affected by a potyvirus, which was probably WMV-2.
    This virus is not seed-transmitted but is transmitted by several species of aphid so vector
    control is important in this crop.
•   Other crops that were infected by viruses to a minor extent were celery, pumpkin and
    lettuce. In each case the viruses were aphid transmitted so the importance on management
    of aphids is important.




                                               85
Appendix 2
Mechanical Inoculation
Materials
Inoculation buffer – 1% K2HPO4, 0.1% Na2SO3
Carborundum (300 mesh)
Muslin

Method
Virus inocula were prepared by grinding systemically infected leaves in cold inoculation
buffer. Leaves of test plants were dusted with carborundum and then rubbed with a muslin
pad saturated with virus inoculum.



Turnip mosaic virus Plate Trapped Antigen Enzyme Linked Immunosorbent Assay (PTA –
ELISA) Test

Materials
Coating Buffer (Na2CO3, 1.6g.l-1; NaHCO3, 30g.l-1)
Phosphate buffered saline (Na2HPO4.12H20, 2.9g,l-1; KH2PO4, 0.2g.l-1; NaCl, 8g.l-1;
       KCl, 0.2g.l-1) containing 0.5% Tween-20 (PBS-T, pH 7.3)
EMA 67 (HRI, Primary antibody)
Goat anti-mouse conjugated to alkaline phosphatase (Sigma A-3562, Secondary antibody)
Substrate buffer (diethanolamine, 97ml.l-1, dH20, pH9.8)


Titertek Multiskan MCC/340 plate reader
96 well ELISA plate


Method
Samples were ground and the sap was diluted 1:10 in coating buffer. 100μl of the diluted sap
was loaded into duplicate wells on a microtitre plate. Positive and negative controls were
loaded onto each ELISA plate every time ELISA tests were done. The loaded microtitre plate
was stored at 4°C overnight.


After the overnight incubation the plates were washed three times for three minutes in PBS-T.
The plates were then coated with the primary antibody, EMA 67, diluted 1/2500 in PBS-T
containing 0.05% BSA (100μl per well) and incubated at room temperature for 2 hours. After
incubation, the plates were washed in PBS-T (as described previously) and coated with the
secondary antibody conjugate, goat anti-mouse IgG conjugated to alkaline phosphatase,
diluted 1/5000 in PBS-T containing 0.05% BSA (100μl per well). The plates were incubated

                                                86
for a further 2 hours at room temperature. After incubation the plates were washed (as
described previously) and the colour reaction developed by adding 100μl per well substrate
buffer to each well. The reactions were read with a plate reader at an absorbance of 405nm.
In all ELISA tests the sample readings were compared to the healthy control reading and a
reaction was considered positive if the reading was twice that of a healthy.



Cauliflower mosaic virus (CaMV) Double Antibody Sandwich ELISA test (used 03/2000 –
04/2001)


Materials
Freeze-dried γ-globulin (1mg.ml-1, HRI)
Antibody conjugate (HRI)
Sterile distilled water (SDW)
Coating buffer (Na2CO3, 1.6g.l-1; NaHCO3, 30g.l-1)
Phosphate buffered saline (Na2HPO4.12H2O, 2.9g.l-1; KH2PO4, 0.2g.l-1; NaCl, 8g.l-1;
       KCl, 0.2g.l-1) containing 0.5% Tween-20 (PBS-T, pH 7.3)
Grinding buffer (100ml PBS-T; 2g polyvinylpyrollidone (PVP))
Bovine serum albumin (BSA)
Substrate buffer (diethanolamine, 97ml.l-1, dH20, pH9.8)


Method
Freeze-dried γ-globulin was resuspended in 100μl SDW and then diluted to a final
concentration of 1μg.ml-1 with coating buffer. ELISA plates were coated with 100μl diluted
γ-globulin per well and incubated at 35°C for 3 hours. Test leaves were ground in grinding
buffer (1ml buffer per 1g sample) and stored on ice until required. The ELISA plates were
washed in PBS-T as described previously. Samples were loaded into duplicate wells on the
ELISA plates (100μl per well) and stored overnight at 4°C.


The plates were washed with PBS-T as described previously. Conjugate was diluted to a final
concentration of 1μg.ml-1 and 100μl added per well. The plates were incubated for 5 hours at
35°C. The plates were then washed as described previously with PBS-T and 100μl substrate
buffer added per well. The plates were read at 405nm using a plate reader after 1 hour and
again the next morning. A positive reaction was taken as twice the mean healthy control.




                                                 87
CaMV PTA-ELISA test (used 04/2001 – present)

Materials
Coating Buffer (Na2CO3, 1.6g.l-1; NaHCO3, 30g.l-1)
Phosphate buffered saline (Na2HPO4.12H2O, 2.9g,l-1; KH2PO4, 0.2g.l-1; NaCl, 8g.l-1;
       KCl, 0.2g.l-1) containing 0.5% Tween-20 (PBS-T, pH 7.3)
Bovine serum albumin (BSA)
EMA 95 (HRI, Primary antibody)
Goat anti-mouse conjugated to alkaline phosphatase (Sigma A-3562, Secondary antibody)
Substrate buffer (diethanolamine, 97ml.l-1, dH20, pH9.8)


Titertek Multiskan MCC/340 plate reader
96 well ELISA plate


Method
As for TuMV PTA-ELISA except that the primary antibody used was EMA 195, diluted
1/1000 in PBS-T + 0.05% BSA.


Potyvirus PTA-ELISA test

Materials
Coating Buffer (Na2CO3, 1.6g.l-1; NaHCO3, 30g.l-1)
Phosphate buffered saline (Na2HPO4.12H2O, 2.9g,l-1; KH2PO4, 0.2g.l-1; NaCl, 8g.l-1;
       KCl, 0.2g.l-1) containing 0.5% Tween-20 (PBS-T, pH 7.3)
Bovine serum albumin (BSA)
Anti-Poty (Agdia SRA 27200/0500, Primary antibody)
Goat anti-mouse conjugated to alkaline phosphatase (Sigma A-3562, Secondary antibody)
Substrate buffer (diethanolamine, 97ml.l-1, dH20, pH9.8)


Titertek Multiskan MCC/340 plate reader
96 well ELISA plate


Method
As for TuMV PTA-ELISA except that the primary antibody used was Agdia anti-Poty,
diluted 1/200 in PBS-T + 0.05% BSA.




                                                88
Potyvirus RT-PCR (Pappu et al., 1993)


RNA Extraction
RNA extracted from infected leaf material using Qiagen Rneasy kit.


RT-PCR and amplification
Extracted RNA was used as the template. The reaction was a two-stage protocol and included
400μM of each dNTP, 75 pmol of each primer (forward primer was CN48F, reverse primers
were CN47R, CN54R and CN55R), 10U of RNAsin, 10mM DTT, 50mM KCl, 10mM Tris-
HCl pH 8.8, 0.1% Triton X-100, 2.5mM MgCl2, 15 units of superscript, 2.5U of Taq
Polymerase and 20μl of template in a total reaction volume of 100μl.


The template was heated at 70°C for 3 minutes before adding to the reaction mix. First strand
cDNA synthesis was accomplished by incubation at 42°C for 30 minutes before the
amplification reaction. The amplification conditions used were as follows: 94°C, 2 minutes;
42°C, 2 minutes; 72°C, 2 minutes (40 cycles) followed by one cycle of elongation at 72°C for
10 minutes.


The PCR products were visualised on a 2% TBE agarose gel. The expected product size was
700 bp.


PCR clean up
The PCR products were at 700 bp but there was a faint product at 400 bp which was removed
using a Qiaquick PCR product purification kit.


Cloning and sequencing of PCR product
PCR product was cloned using the Amersham pMOS Blue blunt ended cloning kit. 1μg PCR
product was sent to SequiServe (Dr Willi Metzger) for sequencing. Used NCBI database
BLAST programme to obtain comparisons with other sequences.




                                                 89
Appendix 3
Sample   Farm     Location           Host   Symptoms          Insect   CaMV   TuMV
1        Farm 1   Nyathona           Kale   lc, sc, sm      DBM, BB    CaMV     -
2        Farm 1   Nyathona           Kale   sc                         CaMV     -
3        Farm 1   Nyathona           Kale   sc                   BB    CaMV     -
4        Farm 1   Nyathona           Kale   sc                   BB    CaMV     -
5        Farm 1   Nyathona        Cabbage   sc                         CaMV     -
6        Farm 2   Nyathona        Spinach   sc, sm                     CaMV     -
7        Farm 2   Nyathona        Spinach   sc                         CaMV     -
8        Farm 2   Nyathona           Kale   sc                         CaMV     -
9        Farm 2   Nyathona           Kale   sc                         CaMV     -
10       Farm 3   Nyathona           Kale   sc, sm               BB    CaMV     -
11       Farm 3   Nyathona           Kale   lc, sc, sm                   -    TuMV
12       Farm 3   Nyathona           Kale   sc, sm, sn                   -    TuMV
13       Farm 3   Nyathona        Cabbage   sc                   BB      -    TuMV
15       Farm 4   Nyathona        Cabbage   sc                         CaMV     -
16       Farm 4   Nyathona        Cabbage   sc                   BB      -      -
17       Farm 4   Nyathona           Kale   sc                   BB    CaMV     -
18       Farm 4   Nyathona           Kale   sc, sm                       -    TuMV
19       Farm 4   Nyathona           Kale   sc                   BB      -      -
20       Farm 5   Kinale          Cabbage   sc              DBM, BB    CaMV   TuMV?
21       Farm 5   Kinale          Cabbage   sc                           -      -
22       Farm 5   Kinale             Kale   sc                         CaMV     -
23       Farm 5   Kinale             Kale   purpling, sc         BB    CaMV     -
24       Farm 5   Kinale             Kale   sc, sm                     CaMV     -
25       Farm 5   Kinale             Kale   sc                   BB    CaMV     -
26       Farm 5   Kinale             Kale   sc                   BB    CaMV     -
27       Farm 6   Kinale          Cabbage   sc                         CaMV   TuMV?
28       Farm 6   Kinale          Cabbage   sc                           -      -
29       Farm 6   Kinale          Cabbage   purpling, sc                 -      -
30       Farm 6   Kinale             Kale   yellowing, sc       BB     CaMV     -
31       Farm 6   Kinale             Kale   sc                 DBM     CaMV   TuMV?
32       Farm 6   Kinale             Kale   sc                         CaMV     -
33       Farm 6   Kinale             Kale   sc                   BB    CaMV     -
34       Farm 7   Kinale          Cabbage   sc                         CaMV     -


                             90
Sample   Farm      Location                          Host   Symptoms               Insect   CaMV   TuMV
35       Farm 7    Kinale                            Kale   sc                      DBM     CaMV     -
36       Farm 7    Kinale                         Cabbage   sc                        BB      -      -
37       Farm8     Mwea, (Kimbamba)                  Kale   sc                      DBM     CaMV   TuMV?
38       Farm8     Mwea, (Kimbamba)                  Kale   sc, sm                  DBM       -      -
39       Farm 9    Mwea                              Kale   sc                      DBM       -      -
40       Farm 9    Mwea                              Kale   yellowing, sc                   CaMV     -
41       Farm 10   Embu                           Cabbage   sc                              CaMV     -
42       Farm 10   Embu                           Cabbage   sc                       BB       -      -
43       Farm 10   Embu                              Kale   sc                              CaMV     -
44       Farm 10   Embu                              Kale   sc                     DBM      CaMV     -
45       Farm 11   Embu                              Kale   sc                      BB      CaMV     -
46       Farm 11   Embu                           Cabbage   sc                              CaMV     -
47       Farm 12   Mwea West (Riambogo)           Cabbage   yellowing, sc    DBM, BB, LP    CaMV     -
48       Farm 12   Mwea West (Riambogo)              Kale   sc, sm                            -    TuMV
49       Farm 12   Mwea West (Riambogo)              Kale   yellowing, sc                   CaMV     -
51       Farm13    Giachia (Ndia)                    Kale   sc                              CaMV     -
52       Farm 14   Kaitheri                          Kale   sc              DBM, BB, MP,    CaMV     -
                                                                                      LP
53       Farm 14   Kaitheri                          Kale sc                DBM, BB, MP,    CaMV     -
                                                                                      LP
54       Farm 15   Mathira (Nyeri)                   Kale   sc, sm                          CaMV     -
55       Farm 15   Mathira (Nyeri)                   Kale   sc                   BB, MP     CaMV     -
56       Farm 15   Mathira (Nyeri)                   Kale   sc                   BB, MP     CaMV     -
57       Farm 15   Mathira (Nyeri)                   Kale   purpling                        CaMV     -
58       Farm 16   Karatina                          Kale   sc                  BB, DBM     CaMV     -
59       Farm 16   Karatina                          Kale   sc                  BB, DBM     CaMV     -
60       Farm 16   Karatina                       Cabbage   sc               BB, LP, DBM    CaMV     -
61       Farm 16   Karatina                       Cabbage   yellowing, sc     BB, LP, MP      -      -
62       Farm 17   Guti (Karatina-Mathira)        Cabbage   sc                   DBM, LP      -      -
64       Farm 17   Guti (Karatina-Mathira)        Cabbage   sc                        BB    CaMV     -
65       Farm 18   Giti (Karatina-Mathira)        Cabbage   sc                                -      -
66       Farm 18   Giti (Karatina-Mathira)        Cabbage   sc                      DBM     CaMV   TuMV?
67       Farm 19   Kamuyu-Nyeri                   Cabbage   sc                      DBM       -      -
68       Farm 19   Kamuyu-Nyeri                   Cabbage   sc                      DBM       -    TuMV?
70       Farm 20   Kibirigwi                         Kale   sc                  BB, DBM     CaMV     -
71       Farm 20   Kibirigwi                         Kale   yellowing, sc                     -      -

                                             91
Sample   Farm      Location                     Host   Symptoms                    Insect   CaMV   TuMV
72       Farm 20   Kibirigwi                    Kale   sc                                     -      -
73       Farm 20   Kibirigwi                    Kale   sc                            BB     CaMV     -
74       Farm 21   Kibirigwi                    Kale   sc                            MP     CaMV     -
75       Farm 21   Kibirigwi                    Kale   sc                            MP     CaMV     -
76       Farm 22   Kibirigwi                    Kale   sc                            MP     CaMV     -
77       Farm 22   Kibirigwi                    Kale   sc                            LP     CaMV     -
78       Farm 23   Mukuha                       Kale   sc                                   CaMV     -
79       Farm 23   Mukuha                  Cabbage     sc                        MP, DBM    CaMV     -
81       Farm 24   ?                            Kale   sc                            DBM    CaMV     -
82       Farm 24   ?                            Kale   purpling                       MP    CaMV     -
83       Farm 24   ?                       Cabbage     yellowing                  MP, BB    CaMV     -
84       Farm 24   ?                       Cabbage     sc                                   CaMV     -
85       Farm 25   Gatanga                      Kale   sc, sm                               CaMV     -
86       Farm 25   Gatanga                      Kale   yellowing, purpling, sc              CaMV     -
89       Farm 26   Karuri (Mangu)               Kale   none                                   -    TuMV
90       Farm 26   Karuri (Mangu)               Kale   purpling, sc                  BB     CaMV     -
91       Farm 26   Karuri (Mangu)          Cabbage     sc                            BB     CaMV     -
92       Farm 27   Ngong'                       Kale   sc                                   CaMV     -
93       Farm 27   Ngong'                       Kale   purpling, sc                 DBM     CaMV   TuMV
94       Farm 27   Ngong'                       Kale   sc                                     -      -
95       Farm 27   Ngong'                       Kale   sc                                   CaMV     -
96       Farm 28   Kiserian                     Kale   sc                                     -      -
97       Farm 28   Kiserian                     Kale   sc                                   CaMV   TuMV
98       Farm 28   Kiserian                     Kale   sc                           DBM     CaMV     -
99       Farm 29   Kiserian                     Kale   sc                                   CaMV     -
100      Farm 29   Kiserian                     Kale   sc                            BB       -      -
101      Farm 29   Kiserian                     Kale   sc
102      Farm 30   Athi River                   Kale   sc                                   CaMV   TuMV
103      Farm 2    Nyathona                Cabbage     purpling, sc                  BB
104      Farm 2    Nyathona              Cauliflower   sc
105      Farm 2    Nyathona              Cauliflower   sc, sm
106      Farm 2    Nyathona              Cauliflower   sc, sn                                -      -
107      Farm 2    Nyathona              Cauliflower   sc, sn                        BB      -      -
108      Farm 3    Nyathona              Cauliflower   sc                                    -      -
109      Farm 3    Nyathona              Cauliflower   sc


                                    92
Sample   Farm                 Location                 Host   Symptoms           Insect   CaMV   TuMV
110      Farm 3               Nyathona         Cauliflower    sc                            -      -
111      Farm 3               Nyathona                 Kale   none
112      Farm 3               Nyathona                 Kale   none
113      Farm 31              Nyathona         Cauliflower    sc
114      Farm 31              Nyathona         Cauliflower    sc                   BB
115      Farm 31              Nyathona         Cauliflower    sc                           -       -
116      Farm 31              Nyathona         Cauliflower    sc                           -       -
117      Farm 31              Nyathona          Cauliflower   sm                   BB      -       -
118      Mrs Gatura           Nyathona      Spinach, 7 mth    sm
119      Mrs Gatura           Nyathona      Spinach, 7 mth    sm               BB, MP
120      Mrs Gatura           Nyathona      Spinach, 7 mth    sm               BB, MP
121      Mrs Gatura           Nyathona      Spinach, 7 mth    sm               BB, MP
122      Mrs Gatura           Nyathona      Spinach, 7 mth    sm               BB, MP
123      Mrs Gatura           Nyathona     Spinach, 3.5 mth   sc, sm
124      Mrs Gatura           Nyathona     Spinach, 3.5 mth   sc, sm
125      Mrs Gatura           Nyathona     Spinach, 3.5 mth   sm
126      Mrs Gatura           Nyathona     Spinach, 3.5 mth   sm
127      Mrs Gatura           Nyathona     Spinach, 3.5 mth   sc, sm
128      Mr Karugu            Nyathona      Spinach, 2 mth    distortion       BB, MP
129      Mr Karugu            Nyathona      Spinach, 2 mth    sm               BB, MP
130      Mr Karugu            Nyathona      Spinach, 2 mth    sc, sm           BB, MP
131      Mr Karugu            Nyathona      Spinach, 2 mth    sm               BB, MP,
132      Mr Njunge Kuria      Nyathona         Spinach, 1yr   sm               BB, MP
133      Mr Njunge Kuria      Nyathona         Spinach, 1yr   sm               BB, MP
134      Mr Njunge Kuria      Nyathona         Spinach, 1yr   distortion       BB, MP
135      Mr Njunge Kuria      Nyathona         Spinach, 1yr   sm               BB, MP
136      Mr.Paul Maingi       Athi River               Kale   sm              BB, DBM     CaMV   TuMV
137      Mr.Paul Maingi       Athi River               Kale   sm                          CaMV   TuMV?
138      Mr.Paul Maingi       Athi River               Kale   sm                          CaMV   TuMV?
139      Mr.Paul Maingi       Athi River               Kale   sc              DBM, MP     CaMV   TuMV
140      Mr.Paul Maingi       Athi River               Kale   sc                 DBM        -    TuMV
141      Mr.Paul Maingi       Athi River               Kale   yellowing, sc               CaMV   TuMV
142      Mr.Paul Maingi       Athi River               Kale   sc                Thrips      -    TuMV
143      Mr.Paul Maingi       Athi River               Kale   sc                            -    TuMV
144      Mr. Samuel Mangeli   Athi River               Kale   sc                            -    TuMV


                                           93
Sample   Farm                  Location                       Host   Symptoms          Insect   CaMV   TuMV
145       Mr. Samuel Mangeli   Athi River                     Kale   sm                           -    TuMV
146       Mr. Samuel Mangeli   Athi River                     Kale   sc                         CaMV   TuMV
147       Mr. Samuel Mangeli   Athi River                     Kale   sm                           -    TuMV
148       Mr. Samuel Mangeli   Athi River                     Kale   sm                         CaMV   TuMV
149       Mr. Samuel Mangeli   Athi River                     Kale   sc                           -    TuMV
150       Mr. Samuel Mangeli   Athi River                     Kale   sc                           -    TuMV
151       Mr. Samuel Mangeli   Athi River                     Kale   sc                  BB       -    TuMV
152       Mr. Samuel Mangeli   Athi River                  Spinach   sc                           -      -
153      Ms. Jane Mutisya      Athi River           Gloria cabbage   black rot                    -    TuMV
154      Ms. Jane Mutisya      Athi River           Gloria cabbage   yellowing, sm                -    TuMV
155      Ms. Jane Mutisya      Athi River           Gloria cabbage   sc                           -    TuMV
156      Ms. Jane Mutisya      Athi River           Gloria cabbage   yellowing, sc                -    TuMV
157      Ms. Jane Mutisya      Athi River           Gloria cabbage   yellowing                    -    TuMV
158      Ms. Jane Mutisya      Athi River           Gloria cabbage   yellowing                    -    TuMV
159      Ms. Jane Mutisya      Athi River           Gloria cabbage   sc                         CaMV   TuMV
160      Ms. Jane Mutisya      Athi River           Gloria cabbage   yellowing                    -    TuMV
161      Ms. Jane Mutisya      Athi River           Gloria cabbage   yellowing, sc                -    TuMV
162      Daniel                Kirenga                Pructor (F1)   sc                           -    TuMV
163      Daniel                Kirenga                Pructor (F1)   sc                 DBM       -    TuMV
164      Daniel                Kirenga                Pructor (F1)   sc                           -    TuMV
165      Daniel                Kirenga                Pructor (F1)   sc                 DBM       -    TuMV
166      Daniel                Kirenga                Pructor (F1)   sc                 DBM       -      -
167      Daniel                Kirenga                Pructor (F1)   sc                           -    TuMV
168      Daniel                Kirenga                Pructor (F1)   sc                           -      -
169      Daniel                Kirenga                Pructor (F1)   sc                           -      -
170      Kula Akili            Kinale                  Victoria F1   sc                 DBM       -    TuMV
171      Kula Akili            Kinale                  Victoria F1   distortion         DBM       -      -
172      Kula Akili            Kinale                  Victoria F1   sc                 DBM       -      -
173      Kula Akili            Kinale                  Victoria F1   sc                 DBM       -      -
174a     Kula Akili            Kinale                  Victoria F1   sn
174b     Kula Akili            Kinale                  Victoria F1   sclerotinia
175      Mr. Charles Nduhiu    Ngajina, Kinangop              Kale   sm              DBM, BB
176      Jane Wanjiru          Ngajina, Kinangop              Kale   purpling, sc         BB
177      Jane Wanjiru          Ngajina, Kinangop           cabbage   sc              DBM, BB
178      Jane Wanjiru          Ngajina, Kinangop           cabbage   sc                 DBM


                                                   94
Sample   Farm              Location                     Host   Symptoms            Insect   CaMV   TuMV
179      Jane Wanjiru      Ngajina, Kinangop        cabbage    sc                DBM, BB
180      Jane Wanjiru      Ngajina, Kinangop        cabbage    none                 DBM
181      Jane Wanjiru      Ngajina, Kinangop        cabbage    none                 DBM
183      Jane Wanjiru      Ngajina, Kinangop         spinach   sm
184      Mr Kariuki        Ngajina, Kinangop        cabbage    sc                     BB     -     TuMV
185      Mr Kariuki        Ngajina, Kinangop        cabbage    sc
186      Mr Kariuki        Ngajina, Kinangop        cabbage    sc, sm
187      Mr Kariuki        Ngajina, Kinangop        cabbage    sc                DBM, BB
188      Mr Kariuki        Ngajina, Kinangop        cabbage    purpling
189      Mr Kariuki        Ngajina, Kinangop        cabbage    sc                DBM, BB    CaMV    -
190      Mr Kariuki        Ngajina, Kinangop        cabbage    sc                DBM, BB
191      Farm 32           Gacheru Yang'a               Kale   distortion
192      Farm 32           Gacheru Yang'a               Kale   sc
193      Farm 32           Gacheru Yang'a               Kale   sc
194      Farm 32           Gacheru Yang'a               Kale   purpling
195      John N'Jao        Mukeu                    Cabbage    sc                   DBM
196      John N'Jao        Mukeu                    Cabbage    sc                DBM, BB
197      John N'Jao        Mukeu                    Cabbage    purpling, sc         DBM
198      John N'Jao        Mukeu                    Cabbage    sc
199      Michael Mwanika   Cheese                   Cabbage    sc                   DBM
200      Michael Mwanika   Cheese                   Cabbage    sc                DBM, BB
201      Michael Mwanika   Cheese                   Cabbage    sc                   DBM
202      Michael Mwanika   Cheese                   Cabbage    sc                   DBM
203      Michael Mwanika   Cheese                   Cabbage    sn                            -     TuMV
204      Joseph Kiilu      Kinale, Kirenga              Kale   sc                   DBM
205      Joseph Kiilu      Kinale, Kirenga              Kale   sc                   DBM
206      Joseph Kiilu      Kinale, Kirenga              Kale   sm                    DBM
207      Joseph Kiilu      Kinale, Kirenga              Kale   sc                DBM, BB
208      Joseph Kiilu      Kinale, Kirenga              Kale   sc, sm                  BB    -     TuMV
209      Henry Kanaya      Kinale, Kambaa               Kale   sc                   DBM
210      Henry Kanaya      Kinale, Kambaa               Kale   sc, sm         DBM, BB, MP
211      Henry Kanaya      Kinale, Kambaa               Kale   sc, sm               DBM      -     TuMV
212      Henry Kanaya      Kinale, Kambaa               Kale   sc                   DBM
213      Henry Kanaya      Kinale, Kambaa               Kale   sc
214      Henry Kanaya      Kinale, Kambaa               Kale   sc                           CaMV    -


                                               95
Sample   Farm             Location                Host   Symptoms         Insect     CaMV   TuMV
215      Henry Kanaya     Kinale, Kambaa          Kale   sm             DBM, BB
216      Henry Kanaya     Kinale, Kambaa          Kale   sc             DBM, BB
217      Henry Kanaya     Kinale, Kambaa          Kale   sm                DBM        -     TuMV
218      Henry Kanaya     Kinale, Kambaa          Kale   purpling, sc      DBM
219      Joseph Mungai    Kinale, Kambaa          Kale   sc                          CaMV     -
220      Joseph Mungai    Kinale, Kambaa          Kale   sc                            -    TuMV
221      Joseph Mungai    Kinale, Kambaa          Kale   sc
222      Joseph Mungai    Kinale, Kambaa          Kale   sc, sm               BB      -     TuMV
223      Joseph Mungai    Kinale, Kambaa          Kale   sn, sc                       -     TuMV
224      Joseph Mungai    Kinale, Kambaa          Kale   sc                   BB
225      Joseph Mungai    Kinale, Kambaa          Kale   sc                   BB
226      Joseph Mungai    Kinale, Kambaa          Kale   distortion
227      Sarah Nyambura   Kinale, Was Huho        Kale   sc             DBM, BB
228      Sarah Nyambura   Kinale, Was Huho        Kale   sc                DBM
229      Sarah Nyambura   Kinale, Was Huho        Kale   sc, sm         DBM, BB       -     TuMV
230      Sarah Nyambura   Kinale, Was Huho        Kale   sc, sm         DBM, BB       -     TuMV
231      Sarah Nyambura   Kinale, Was Huho        Kale   sc, sm         DBM, BB
232      Ann Wambui       Kinale, Was Huho        Kale   purpling, sc   DBM, BB
233      Ann Wambui       Kinale, Was Huho        Kale   sc                  BB
234      Ann Wambui       Kinale, Was Huho        Kale   sc, sm            DBM
235      Ann Wambui       Kinale, Was Huho        Kale   purpling, sc      DBM
236      Ann Wambui       Kinale, Was Huho        Kale   sc             DBM, BB
237      Ann Wambui       Kinale, Was Huho        Kale   sc             DBM, BB
238      Paul Maingi      Athi River              Kale   sm                            -    TuMV
239      Paul Maingi      Athi River              Kale   sc                   BB     CaMV     -
240      Paul Maingi      Athi River              Kale   sm                 DBM        -    TuMV
241      Paul Maingi      Athi River              Kale   sc             LP, thrips     -    TuMV
242      Paul Maingi      Athi River              Kale   sc
243      Petero           Athi River              Kale   distortion     DBM, MP        -    TuMV
244      Petero           Athi River              Kale   sm             DBM, BB      CaMV     -
245      Petero           Athi River              Kale   sc             DBM, BB        -    TuMV
246      Petero           Athi River              Kale   sc                            -    TuMV
247      Petero           Athi River              Kale   sc                            -    TuMV
248      Petero           Athi River              Kale   sc                   BB
249      Petero           Athi River              Kale   sc                   LP      -     TuMV


                                             96
Sample   Farm           Location              Host   Symptoms     Insect   CaMV   TuMV
250      Petero         Athi River            Kale   sc              BB      -    TuMV
251      Petero         Athi River            Kale   sc              BB      -    TuMV
252      Petero         Athi River            Kale   sc             MP     CaMV   TuMV
253      Jane Mutisya   Athi River         Cabbage   sc            DBM
254      Jane Mutisya   Athi Riverh        Cabbage   sc            DBM      -     TuMV
255      Jane Mutisya   Athi River            Kale   sc         DBM, LP
256      Jane Mutisya   Athi River            Kale   sc            DBM      -     TuMV
257      Jane Mutisya   Athi River            Kale   sc            DBM
258      Edward Njer    Athi River            Kale   sc            DBM
259      Edward Njer    Athi River            Kale   sc         DBM, LP
260      Edward Njer    Athi River            Kale   sc            DBM
261      Edward Njer    Athi River         Cabbage   sc            DBM
262      Edward Njer    Athi River         Cabbage   sc            DBM
263      Edward Njer    Athi River         Cabbage   sc              BB




                                      97
Appendix 4




 MANAGEMENT OF VEGETABLE VIRUS DISEASES
                             IN KENYA:
   FARMER PERCEPTIONS AND EVALUATION OF
                   CONTROL STRATEGIES


Njuki JM, Phiri NA and Mwaniki, A.


March 2003




                                          Kenya Agricultural Research Institute




                                     98
ACRONYMS
CABI-ARC       CAB International, Africa Regional Center
FGDs           Focus Group Discussions
KARI           Kenya Agricultural Research Institute
PRA            Participatory Rural Appraisal
DBM            Diamond Back Moth
DFID           Department for International Development of the United Kingdom


ACKNOWLEDGEMENTS
We gratefully acknowledge the contributions of Mr. Duncan Chacha and Mr. Peter Karanja of
CABI-ARC and Steven Ndirangu and Alex Kuria of KARI during the on farm trials and the
evaluations. We appreciate the assistance provided by Anni McLeod of the University of
Reading on the methodology for participatory evaluation and Ms Jane Poole of CABI-ARC in
the data analysis.


We are grateful to the Department for International Development of the United Kingdom,
Crop protection Program, which provided the financial support to the Management of Virus
Diseases of Brassicas in Kenya project.


This report is an output from a research project funded by the Department for International
Development of the United Kingdom (DFID project code R7571, Crop Protection
Programme). However, the department for International Development can accept no
responsibility for any information provided or views expressed.


Extracts of material from this report may be reproduced in any non-advertising, non-profit
making context provided the source is acknowledged as follows:


Njuki et al. (2003) Management of Vegetable Virus Diseases in Kenya: Farmer Perceptions
and Evaluation of Control Strategies. An output from DFID project R7571, Crop Protection
Programme.




                                               99
                                   TABLE OF CONTENTS for Appendix 4

ACRONYMS ...................................................................................................................... 98

ACKNOWLEDGEMENTS................................................................................................ 99

LIST OF TABLES .............................................................................................................. 103

LIST OF FIGURES ............................................................................................................ 103

1. INTRODUCTION........................................................................................................ 104

2. PRA TO ASSESS FARMER PROBLEMS, PERCEPTIONS AND PRACTICES IN
RELATION TO VIRUS DISEASES AND THEIR INSECT VECTORS ................... 106

   2.1 Introduction ............................................................................................................. 106
   2.1 Objectives ................................................................................................................ 106
   2.3 Methods ................................................................................................................... 106
   2.4 Results ..................................................................................................................... 107
     2.4.1 General information on farmers involved in the FGDs........................................107
       2.4.2 Farmer wealth ranking..........................................................................................107
       2.4.3 General problems and constraints in vegetable production and marketing..........108
       2.4.4 Farmer ranking of common kale and cabbage varieties .......................................109
       2.4.5 Farmers’ perceptions of virus diseases.................................................................109
       2.4.6 Evaluation of the effect of various symptoms on marketability, pricing and
       palatability of kale and cabbage ....................................................................................111
       2.4.7 Control methods used by farmers.........................................................................112

   2.5 Discussion................................................................................................................ 112

3. EVALUATION OF ON FARM TRIALS BY FARMERS USING PARTICIPATORY
BUDGETING TECHNIQUES. ....................................................................................... 114

   3.1 Introduction ............................................................................................................. 114
   3.2 Objectives of the participatory budgeting ............................................................... 114
   3.3 The process .............................................................................................................. 115
      3.3.1 Viral disease control strategies and setting up the on farm trial...........................115
       3.3.2 Farmer understanding of the budgeting process...................................................115
       3.3.3 Implementation of the participatory partial budgeting process ............................116
          3.3.3.1 Inputs data collection.....................................................................................116

                                                                  100
          3.3.3.2 Constructing the partial budget-phase one ....................................................118
          3.3.3.3 Constructing the partial budget-phase two ....................................................119

   3.4 Statistical analysis of the data.................................................................................. 122
   3.5 Farmer discussions and evaluation of the various viral disease control strategies.. 124
     3.5.1 Evaluation of results in Athi River .......................................................................125
          3.5.1.1 Ranking of treatments....................................................................................125
          3.5.1.2 Merits and demerits of disease control strategies..........................................125
      3.5.2 Evaluation of results in Kariguini.........................................................................127
          3.5.2.1 Ranking of treatments....................................................................................127
          3.5.2.2 Merits and demerits of disease control strategies..........................................128

   3.6 Some achievements of the participatory budgeting exercise................................... 129
     3.6.1 Acquisition of record keeping skills by farmers .......................................................129
      3.6.2       Farmer empowerment and ownership of the trial ....................................................130
      3.6.3       Increase in number of participating farmers over the period of the trial ....................130
      3.6.4       Agreement by farmers to try the disease control strategies on their farms .................131

4. EVALUATION OF CHANGE OF FARMER PERCEPTION OF VIRUS DISEASES
OVER PROJECT PERIOD............................................................................................ 132

   4.1 Objective.................................................................................................................. 132
   4.2 Methodology............................................................................................................ 132
   4.3 Results ..................................................................................................................... 133
     4.3.1 Wealth ranking of the farmers ...................................................................................133
      4.3.2 Changes in farmer knowledge of viral diseases and their symptoms ............................133
      4.3.3 Individual farmer evaluation of disease management strategies ...................................134
      4.3.4 Final group evaluation of disease management strategies ............................................136
      4.3.5 Adoption .................................................................................................................136
      4.3.6 Farmers expectations from the project and their perceptions of how far these have been met
       .......................................................................................................................................138
      4.3.7 Priority crops and pests for future research ................................................................140

5. POTENTIAL FOR FARMER SELF SEED SELECTION ...................................... 142

   5.1 Objective.................................................................................................................. 142
   5.2 Methodology............................................................................................................ 142
   5.3 Results of the evaluation ......................................................................................... 143
   5.4 Field day to sensitize farmers on farmer self seed selection ................................... 144
                                              101
6. CONCLUSIONS AND RECOMMENDATIONS ..................................................... 145

   6.1 Evaluation of viral disease control strategies by farmers ............................................... 145
   6.2Change              of        farmer           perception             and          knowledge               of        viral        diseases
   ....................................................................................................................................... 146
   6.3Potential                         for                   on                     farm                     seed                     selection
   ....................................................................................................................................... 146

APPENDICES.................................................................................................................... 147

REFERENCE .................................................................................................................. 153




                                                                    102
LIST OF TABLES for appendix 4
Table 1. Vegetable production constraints ............................................................................108
Table 2. Landraces and varieties preferred by farmers in terms of least susceptibility to
      diseases ..........................................................................................................................109
Table 4. Summary of symptoms and their causes in Athi River ...........................................110
Table 4. Summary of symptoms and their causes in Ruiru ...................................................111
Table 5. Disease and pest evaluation in Ruiru.......................................................................112
Table 6. Treatment combinations ..........................................................................................115
Table 7. An example of an input sheet from Athi River .......................................................117
Table 8. Layout for the input budget sheet............................................................................118
Table 9. Calculations of extra costs of treatments compared to the control (Ksh)................119
Table 10. Comparing extra costs with outputs ......................................................................120
Table 11. Calculating the benefits .........................................................................................121
Table 12. Statistical partial budget (on a per plot basis) .......................................................122
Table 13. Statistical partial budget (on a per ha basis)..........................................................123
Table 14. Farmers ranking of treatments in Athi River.........................................................125
Table 15. Merits and demerits of treatments in Athi RIver...................................................126
Table 16. Ranking of treatments in Kariguini .......................................................................127
Table 17. Merits and demerits of treatments in Kariguini.....................................................128
Table 18. Symptoms and farmers perceptions of their causes ..............................................134
Table 19. Priority crops, pests and diseases for future research............................................140
Table 20. Criteria associated with good and bad plants for kale seed as selected by farmers
      and scientists..................................................................................................................142
LIST OF FIGURES for appendix 4
Figure 1. Farmers learning the concepts of record keeping and inputs entry for the
      participatory partial budgets. .........................................................................................117
Figure 2. Farmers explaining the on farm trial to visitors from NR International. ...............130
Figure 3. Farmer attendance to the on farm trials in Athi River ...........................................131
Figure 4. Percentage of farmers ranking each treatment first by group and wealth..............135
Figure 5. Adoption of disease control strategies ...................................................................137
Figure 6. Evaluation of on farm seed selection by farmers ...................................................144




                                                                   103
1.       INTRODUCTION

Market gardening and horticultural enterprises represent a significant source of income for
many small- to medium-scale farmers in Kenya. Farmers, especially around towns, rely on
vegetables for employment, income generation and as a source of food. Additionally, the
rapidly increasing urban population presents a major challenge to the agricultural production
sector to provide an adequate food supply to the growing urban centres. The production
system in these peri-urban areas is characterised by high value crops such as vegetables,
intensive land use and high use of pesticides. This intensive vegetable production, whilst
generating high incomes, also has disease and pest problems which can build up to very
high levels threatening sustainability of the farms. The excessive use of chemical pesticides
to control pests and diseases has led to increasing concern about residues in the produce,
operator exposure, development of resistance and environmental damage, and damage to
beneficial natural enemies.


The project “Management of virus diseases of important vegetable crops in Kenya” aims to
develop improved methods for the control of virus diseases in brassica crops in the peri-
urban vegetable systems through the identification of virus resistant germplasm, use of
cultural control methods to reduce virus incidence and spread, and improved vector control.
On-station trials of various cultural control methods have been undertaken and these have
proved promising for the control of virus diseases. The next step is to extend these trials on
farm in order for the methods to be tested under field conditions, and for them to be
evaluated by farmers who are the end users.


The objectives of the socio-economic component of the project were to;
     •   Evaluate farmer knowledge and perceptions of viral diseases and their vectors, any
         control methods being used, production constraints and the importance of viral
         diseases relative to other constraints
     •   Determine the potential for farmer selection of seeds of resistant/tolerant
         components of kale land races.
     •   Evaluate how farmers’ perceptions of viruses have changed over the period of study
         as a result of disease management strategies advocated by the project.

                                                  104
Based on the objectives of the project, it was apparent that there was need for participatory
research with farmers. One goal of encouraging farmer participation in this project was to
ensure more wider and quicker adoption of the disease control technologies and to
empower and strengthen the capacity of farmers to make decisions on disease control
(CIAT, 1997). There were several levels of participation;
   •    Participatory Rural Appraisals with groups of farmers to identify their production
        constraints and perceptions of some of these constraints and for farmers to
        contribute to the project objectives,
   •    A learning and empowerment process where farmers are empowered through
        knowledge acquisition and methodologies for evaluating technologies,
    •   Farmers validating technologies before making the decisions on whether to take the
        technologies or not and using farmer’s fields as the experimental fields


This project therefore took both a consultative and action oriented participation by the
farmers and the first step in this process was to find the interface between the project team
and the farmers. This project took an innovative step by using Participatory Rural Appraisal
(PRA) to identify existing farmer practices, and incorporating the outcome into the formal
project objectives.


This report is divided into 6 parts;
   1. An introduction
   2. PRA to gauge initial farmer perceptions of viral diseases and to find an entry point for
        farmer participation
   3. Farmer evaluation of technologies through participatory budgeting during on farm
        trials at two sites
   4. Change of farmer perceptions on viral diseases as a result of the on farm trial
   5. On farm farmer seed selection and its evaluation by farmers
   6. Conclusions and recommendations


Sections 2 to 5 describe the objectives, activities and results for each part of the study.



                                                105
2.       PRA TO ASSESS FARMER PROBLEMS, PERCEPTIONS AND
         PRACTICES IN RELATION TO VIRUS DISEASES AND THEIR
         INSECT VECTORS

2.1 Introduction
A PRA was carried out at two selected sites in Athi River and Ruiru where farmers grow
brassicas for both commercial and domestic use. A PRA was used as a quick and efficient
way of determining farmer perceptions, local knowledge and constraints in vegetable
production and as a starting point for involving the farmers in testing disease control
strategies under farm conditions.


2.1 Objectives
The aim of the PRA was to;
     •   Evaluate farmer perceptions of virus symptoms and relative importance compared to
         other production constraints
     •   Obtain local knowledge of virus diseases and any current control measures
     •   Identify constraints on improved control measures such as costs and practicability
     •   Evaluate perceptions of resistance/susceptibility of land races of kale and cabbage to
         virus symptoms
     •   Compare social and cultural variations in farmer perceptions and practices.
     •   Gauge farmers’ willingness to participate in on-farm trials.


2.3 Methods
Two sites were selected for on-farm trials on low input methods for reducing vector
transmission of viruses in seedbeds. These methods included the use of straw, mulch and
re-usable fleece. The two sites selected were Ruiru and Athi River both situated on the
outskirts of Nairobi. During a previous survey, these two areas were identified as having
high levels of diseases on cabbage, kale and spinach (Oruko and Ndungu, 2001). Focus
group discussions (FGDs) with farmers were held at these two sites with a checklist used to
guide the discussions. The checklist is shown in Appendix 1. A wealth ranking exercise was

                                                 106
included in the focus group discussion to enable the classification of farmers into different
social categories for the evaluation of the control methods. A team of 2 socio-economists, a
plant pathologist and a field technician facilitated the discussions.


2.4 Results

2.4.1 General information on farmers involved in the FGDs
In Ruiru farmers were already members of a group, all farming along the Ruiru River and
growing vegetables. In Athi River there was no formal organization of farmers, and individual
farmers were brought together to participate in the PRA and in subsequent on-farm trials. All
farmers were growing vegetables under irrigation. Farmers at both sites were growing
vegetables both for on-farm consumption and for sale in neighbouring markets.



2.4.2 Farmer wealth ranking
This activity involved classifying farmers based on various social and economic
characteristics as a first step in the evaluation of differences in perceptions of viral diseases
and their control between the different categories. Farmers at both sites initially identified
indicators of wealth or what they thought were the characteristics associated with wealth.
Social categories found important for this evaluation included asset ownership, financial
ability, type of household and education level among others.


Farmers in Athi River gave the indicators of wealth as; number of cattle, crop varieties and
number of crops grown, size of land, type of house, access to irrigation water, ownership of
irrigation equipment, access to hired labour, operating capital available and farmer
experience. In Ruiru wealth was associated with; type of house, number of cars, size of land
and number of plots, crop mix, access to irrigation and farming equipment, number of cattle,
children’s education, standard of living, access to hired labour, ownership of a bicycle and
the operating capital available. Farmers then identified three categories of farmers to be
rich, medium or poor and defined each of the indicators according to the categories. The
categories and the definitions of the indicators for each site are given in Appendix 2.


These indicators to categorise farmers during the evaluation of the tested and
                                                107
promoted technologies.

2.4.3 General problems and constraints in vegetable production and marketing
Farmers identified different vegetable production constraints and ranked them according to
their importance.


Farmers in both Ruiru and Athi River ranked diseases and pests as the most important
constraint in vegetable production and marketing whilst lack of finance and quality seeds
were the second most important constraints in the two districts, respectively.


Table 1. Vegetable production constraints
                  Athi River                                       Ruiru
Rank                  Constraint              Rank                  Constraint
1       Insect pests and diseases             1       Insect pests and diseases
2       Lack of quality seeds                 2       Lack of finance
3       Lack of credit/finances               3       Market flooding
4       Lack of information on diseases 4             Transport to markets
        and methods of control                5       Soil nutrient deficiencies
5       Market flooding causing low prices    6       Expensive       inputs       especially
6       Water pollution                               pesticides
7       Lack of experience in vegetable 7             Low quality of seed
        farming                               8       Lack of technical information on
8       Weather                                       vegetable growing
9       Wildlife menace
        Unavailability of water


Of significance is the fact that as well as ranking pests and diseases as the most important
constraint to vegetable production, farmers in Athi River also ranked lack of information on
diseases and their control as the fourth most important constraint. Expensive inputs,
especially pesticides, were mentioned as a production constraint in Ruiru. This is of
relevance to the vegetable virology project, which is looking at non-chemical control
methods for viral diseases.

                                               108
2.4.4 Farmer ranking of common kale and cabbage varieties
Farmers ranked the varieties of kale and cabbage grown in Ruiru and Athi River in order of
preference. Thousand-headed variety of kale was described by farmers in both Athi River
and Ruiru as being more susceptible to most of the diseases, including viral diseases, than
the collard variety. Farmers had not observed any differences in susceptibility to diseases
and pests among the cabbage varieties.


Table 2. Landraces and varieties preferred by farmers in terms of least susceptibility to diseases
                  Athi River                                         Ruiru
          Kales                Cabbage                   Kales                 Cabbage
Collard                 Gloria                  Collards                 Copenhagen
Thousand headed         Sugarloaf               Thousand headed          Gloria
                        Drumhead                Kinale                   Amigo
                        Copenhagen                                       Amukos
                        Amukos                                           Fortuna




2.4.5 Farmers’ perceptions of virus diseases
In general terms, farmers in Ruiru were more knowledgeable on the symptoms and causes
of insect pests and diseases than those in Athi River. One of the reasons for this could be
because the farmers in Ruiru were already members of a group and some of the group
members have been going for farmer training on various crops and crop management
practices. Few of the farmers in Athi River had a clear perception of the relationship
between disease carrying vectors and the disease symptoms that they cause.


Athi River
Farmers were given a leaf showing various symptoms of viral diseases, and were asked to
identify the symptoms and to suggest possible causes of these symptoms.                The group
identified the symptoms as yellowing of leaves and rough leaf surface. They attributed these


                                                 109
to too much water, too much use of manure and fertilizer or too much watering followed by
heavy rains. Some of the farmers also thought that the problem starts from the stem based
on their observation of black and white strips on the stem of the affected plants. The control
for these symptoms according to the farmers is removal of affected leaves. Indeed they
have observed that once the infected leaves are removed, the younger leaves remain
healthy. They attribute this to the fact that the plant is able let water out through the injury
that is left when the infected leaves are removed, thus releasing excess water from the
plant.


When probed on the possible relationship between the yellowing of leaves and aphids, only
one farmer related the two. Probed on what this relationship between aphids and yellowing
of leaves could be, they attributed the yellowing of leaves to the aphids sucking water from
the leaves, leaving the leaves yellow and finally causing drying up of the leaves. Other
farmers felt that due to the high nutrient levels associated with the yellowing, the plant would
be too strong to be affected by aphids. Yellowing of leaves was also associated to blight and
potassium deficiency by some farmers. The blighted leaves were believed to turn yellow
when rained on.


Some of the farmers associated aphids with black rot believing that when the aphids settle
on the cabbage before the head forms, the aphids are engulfed and this causes them to die
and rot causing the whole cabbage head to rot.


Table 4. Summary of symptoms and their causes in Athi River


Symptoms                 Causes                       Control
Yellowing of leaves      Excess use of manure         Remove yellow leaves
Rough leaf surface       Too much watering            Regulate watering
                         Blight                       Spraying pesticides
                         Potassium deficiency


Ruiru
When farmers in Ruiru were shown leaves infected with viral disease, they identified the

                                                110
symptoms as yellowing and curling of leaves and blackening or colouration of the leaf veins.
The farmers associated yellowing of leaves to aphids, cold weather and mites. Similar to the
lone farmer in Athi River who associated aphids to yellowing of leaves, farmers in Ruiru
hypothesized that the aphids suck sap from the plant reducing the amount of water available
for the leaves to be healthy. They attributed the virus symptoms to DBM, aphids which suck
sap from the leaves, low quality seeds, insufficient fertilizer (nutrient deficiency), lack of
potassium, weeds which cover the kale and prevent it from getting enough sunlight and
cold. The whitish powder on the leaves was linked to powdery mildew, which some farmers
identified by name.


Table 4. Summary of symptoms and their causes in Ruiru
Symptoms                 Causes                         Control
Yellowing of leaves      Aphids                         Sufficient fertilizer application
Curling of leaves        Cold weather                   Spraying dimethoate
Blackening of veins      Mites
                         DBM
                         Nutrient deficiency
                         Weeds


The farmers in Ruiru seemed to be more aware of other diseases, sometimes mentioning
them by name, than they are aware of virus diseases. There is, however, some degree of
recognition that aphids, the vectors for viral disease are linked to the yellowing of leaves,
one of the symptoms of viral diseases. The fact that they think aphids cause the yellowing
by sucking also indicates that they associate the infection to the feeding activities of aphids.
This has important implications for the on farm control trials since the major rationale for
these trials is to control aphids as a way of controlling viral diseases.



2.4.6 Evaluation of the effect of various symptoms on marketability, pricing and palatability
of kale and cabbage
Farmers were asked to evaluate different symptoms in terms of what effects they had on
marketability, price and palatability. On a scale of 0-5, farmers gave the following evaluation.

                                                 111
Table 5. Disease and pest evaluation in Ruiru
Disease/pest          Marketabilit       Price         Palatabilit   Total        Rank
symptoms                    y                              y
White fly                   1              1               1           3            B
Yellowing of leaves         3              2               3           8            A
Rot                         0              0               1           1            C
Curling of leaves           3              2               3           8            A
Mites                       0              0               0           0            D
0-total effect 5-minimum effect


This evaluation shows that there are other pests and diseases other than viral diseases that
farmers consider more critical to the marketability and prices of their cabbages and kales.
These cause total loss of the affected parts as they cannot be marketed or they cannot be
consumed. Yellowing and curling of leaves, which are symptoms of virus diseases, were
evaluated as having moderate effects on the marketability, cost and palatability, although
farmers had earlier indicated that affected leaves are normally just thrown away. Farmers
had differing opinions of the disease so generalization is difficult. It may be more of a
reflection of the market conditions in the two areas.



2.4.7 Control methods used by farmers
Most of the control methods used by farmers are based on the application of pesticides.
However, in identifying the production constraints, farmers in Athi River ranked lack of
information on diseases and appropriate controls as the number 4 problem whilst those in
Ruiru ranked expensive pesticides as their number 6 problem. There is need to focus more
on cultural control methods that are more environmentally friendly and affordable to farmers.
2.5 Discussion
Farmer knowledge of virus disease was very low with majority of the farmers associating
virus symptoms low soil fertility, over watering, over fertilizing and potassium deficiency. In
Athi River, there was a very weak link by farmers between aphids, which are the vectors for
viral diseases, and symptoms of viral diseases. In Ruiru, farmers were more knowledgeable

                                                 112
of the link between aphids and some of the symptoms. The most common methods used by
farmers for the control of virus diseases were the removal of affected leaves and spraying
dimethoate. Constraints that farmers faced were insect pest and diseases, lack of quality
seeds, lack of information on pests and diseases among others.


Collard kales were though by farmers to be less susceptible to diseases than thousand
headed. Farmers in Athi river ranked Gloria as the least susceptible, followed by sugar loaf
and drum head while farmers in Ruiru preferred Copenhagen as they found it to be less
susceptible to diseases than the others.


Farmers indicated that they require insect pest and disease control methods that are cheap
and simple to manage. In order to compare the control methods suggested by the virus
project and the current farmer practice, it was decided that a farmer control plot would be
included in the on-farm trials. There was a discussion on the common practice for viral
disease control by the farmers and this was included as a treatment. Apart from evaluating
yield, aphid and virus incidence, a participatory budgeting exercise was planned in order to
evaluate the cost and labour implications of the different control methods and to compare
them with the farmer practice.




                                              113
3.     EVALUATION OF ON FARM TRIALS BY FARMERS USING
       PARTICIPATORY BUDGETING TECHNIQUES.
3.1 Introduction
Participatory budgeting 1 is a technique that draws on farm management and participatory
rural appraisal principles. It helps farmers working with researchers and extensionists to plan
and analyze activities and their related resource use and production benefits. For the
purpose of this trial, the participatory budgets enabled farmers and the researchers to
evaluate the financial feasibility and implications of different disease control strategies and
the suitability of these strategies. The advantage of these budgets is that they are simple to
follow, use local materials and also take into account non-cash resources such as labour.
Two farmer groups were involved in the participatory budgeting process, Athi River and
Ruiru. The Ruiru group did not go through the whole experiment due to internal group and
leadership problems, which affected the activities of the experiment. The group was
replaced with a group of farmers focused on organic production (Kariguini) who had earlier
been involved in a project on the control of root knot nematode.


The purpose of these on farm trials, in addition to validating earlier on station experiments
on the effectiveness of various virus disease control strategies, was to provide the farmers
with a basis by which they could evaluate the different control options in terms of the cost
implications as well as other criteria that determine farmer decision making with respect to
pest controThe rationale for this was that farmers would be able to compare the control
methods not only in terms of their effectiveness in controlling the diseases but also in terms
of the cost implications. It was expected that farmers would appreciate cost savings
obtained when simple cultural methods that are effective are used for disease control. It was
also expected that once the farmers had their own evaluation of the treatments, it would
speed up adoption of the control methods.


3.2 Objectives of the participatory budgeting
       The objectives of the participatory partial budgeting exercise were




1
 The methods for participatory budgets were developed by Peter Doward and Mark Galpin
of the Department of Agriculture and Derek Shepherd, Head of AERDD in a DFID funded
                                            114
project.
           •    To evaluate the feasibility, implications and suitability of different viral disease
                management strategies
           •    To stimulate farmer interest and participation in the off farm trials by using the
                budgets as the farmer led research component in the on farm trials
           •    To stimulate discussion among farmers on viral diseases and the different
                control strategies.


3.3 The process

3.3.1 Viral disease control strategies and setting up the on farm trial
There were two management strategies to be evaluated, use of fleece and use of mulch. In
addition there was a control and arising from the initial PRA described in part 2, it was
decided to include a farmer practice treatment. This was the use of dimethoate for the
control of aphids. Therefore at nursery level there were four treatments; mulch, fleece,
dimethoate and control.      During transplanting each of the four nursery treatments was
divided into two in the field, mulch and no mulch treatment while the dimethoate treatment
was divided into a mulch and dimethoate treatment. This gave rise to eight treatment
combinations.


Table 6. Treatment combinations
No    Nursery treatment            Field treatment
1     Mulch                        Mulch
2     Mulch                        No mulch
3     Fleece                       Mulch
4     Fleece                       No mulch
5     Dimethoate                   Dimethoate
6     Dimethoate                   No mulch
7     Control                      Mulch
9     Control                      No mulch



3.3.2 Farmer understanding of the budgeting process
At the start of the budgeting process, the objective of the trial was discussed with farmers.
The participatory budgets were introduced as a way for the farmers to evaluate the disease
management strategies in terms of what is feasible for them. The difference between the

                                                  115
partial budgets and full budgets was explained; partial budgets look at the differences
between the strategies rather than the overall profitability of each of the strategies. All the
farmers in Athi River were literate and so the budgeting process was done on flipcharts with
a high level of participation by farmers in recording activities and inputs used in the
experiment. In Kariguini most of the farmers were literate but for the benefit of those who
were not, dramatization or use of physical objects to demonstrate the various aspects of the
experiment were used.



3.3.3 Implementation of the participatory partial budgeting process
3.3.3.1 Inputs data collection
An inputs data sheet was developed together with farmers and agreement reached on how
to use the sheet to record activities, dates when the activities took place, what inputs were
used, the quantities and where possible, the prices. Farmers were also trained on basic
record keeping as part of their own farm management.




                                               116
Figure 1. Farmers learning the concepts of record keeping and inputs entry for the
participatory partial budgets.


The input data collection was done at the site after each day’s activities. For each day a
record was made of the date, activity carried out, all input items including equipment, labour
and consumables, details of the amount of each input item and number of plots covered and
the cost of inputs. Separate input sheets were made for each treatment and a common
sheet input sheet was kept for all the activities that were done on all treatments. After the
first recording of inputs by the socio-economist, subsequent activities and inputs were done
by the farmers themselves under the guidance of the socio-economist or other team
member.


Table 7. An example of an input sheet from Athi River

                                              117
Treatment: Mulch
Date        Activity          Input              Quantity, unit and Cost
                                                 number of plots
2/1/2002 Putting mulch        Mulch              1 bale for 4 plots 180Ksh/bale
                              Labour for putting 40 minutes/4 plots
                              mulch

3/2/2002 Removing             Labour for removing 30 minutes/4 plots
         mulch                mulch

During each activity a farmer would be selected by the others to enter the details for that
activity for that day.


3.3.3.2 Constructing the partial budget-phase one
Phase one of the participatory budget was carried out before transplanting (a month after
initiating the trial). This started with a review of the experiment to ensure farmers still
understood the purpose of the experiment and the different treatments.


Inputs were reviewed to make sure all had been included in the input record sheet. At this
stage, all the inputs were listed in order to determine those that would go into the partial
budget and those that would not. All inputs that were common to all treatments were
removed from the partial budget. Inputs that would not be used in a real farm situation were
also crossed out of the list. For example, in the dimethoate trial, four farmers would hold a
sheet around the plot to ensure that the dimethoate did not blow over to other plots. In a real
farm situation, a farmer would have only one treatment and holding the polythene sheet
would not be necessary. The labour of these four farmers was therefore not included in the
partial budget. The input lists were then transferred to the budget sheet and the quantities
added up.
Table 8. Layout for the input budget sheet
Variable            Control           Mulch             Fleece            Dimethoate




                                               118
The quantities for each item in treatment were then added up one input at a time for all
treatments to make a quantities table as table 8.


The inputs were then priced as follows.
    •   Farm labour: A value for labour of ksh 100 for a 5 hour day was agreed on by
        farmers as appropriate. This used farm hired labour as an equivalent to family
        labour. Farmers gave a value of Ksh 80 for female labour and Ksh 130 for male
        labour. After discussions, they agreed to use Ksh 100 irrespective of whether it was
        male or female labour.
    •   Dimethoate and polythene bags: These were available locally and the market price
        for them was used.
    •   Fleece: The price was given based on the cost price of the fleece in the UK.
        However, it was understood by farmers that slight adjustments would be made to the
        costs if the fleece were available locally.


The costs were then added up for each treatment.


3.3.3.3 Constructing the partial budget-phase two
a) Input quantification and costing
This was done after maturity of the crop in the transplanted field. The inputs were quantified
and priced as in the first phase.


b) Output quantification and costing
As the harvesting was done, farmers evaluated the price of each cabbage based on how
much they would sell that cabbage for in the local market. Unmarketable cabbages were
excluded from the analysis. In addition, the weight of each cabbage was taken for later
statistical analysis.
c) Calculating the extra costs
The costs for the nursery and the field trial per plot were then combined for each treatment
as shown in Table 9.


Table 9. Calculations of extra costs of treatments compared to the control (Ksh)

                                                 119
         Control Control Dimethoate          Dimethoate    Fleece    Fleece    Mulch     Mulch
         to no to            to mulch        to            to        to no     to        to    no
         mulch     mulch                     Dimethoate    mulch     mulch     Mulch     mulch
Nursery 0          0         18              18            33.25     33.25     33.75     33.75
Field    0         179.8     179.8           27            179.8     0         179.8     0
Total    0         179.8     197.8           45            213.05    33.25     213.55    33.75
   (Conversion rate at Ksh 110 to UK£)


  This also formed the extra costs table comparing all other treatments to the control. The
  methodologies for participatory partial budgets require a comparison of each treatment with
  the others. This was however found to be confusing to the farmers due to the many
  treatments. At this stage therefore, the treatments were only compared to the control. The
  whole concept of the partial budget, extra costs, extra output and the benefits was illustrated
  using visual aids. This was done by one of the farmers using bottles. One treatment and a
  control were assumed. Farmers were then asked to put two piles for inputs, one for the
  control and one for the treatment. They rationalized that the treatment would have higher
  inputs than the control. The bottles from the control pile were then subtracted from the
  bottles on the treatment pile to get the extra inputs incurred from using the treatment instead
  of the control. They were then asked to put another two piles for outputs and repeat the
  process. Again, they assumed that since they had put more inputs in the treatment, they
  would get more output form it than from the control. To get the extra output, the bottles on
  the control pile were subtracted from the treatment pile. Now to answer the question of
  whether it was worth taking the treatment as opposed to having the control, the farmers
  counted the bottles left on the inputs pile and compared with those left on the output piles.
  The output pile had more bottles, so the conclusion was that the extra output from using the
  treatment would pay for the extra input and farmers would still be left with a profit. Therefore,
  it would be worth using the treatment.


  d) Comparing extra costs with output
  Combining the extra costs data and the output data allowed for calculation of the extra
  output as shown in Table 10.


  Table 10. Comparing extra costs with outputs



                                                  120
          Control    Control   Dimethoate Dimethoate Fleece         Fleece    Mulch     Mulch
          to no      to        to mulch   to         to             to no     to        to no
          mulch      mulch                Dimethoate mulch          mulch     Mulch     mulch
Costs     0          179.8     197.8      45         213.05         33.25     213.55    33.75
Output    61.90      118.25    305.25     434.75     258.75         136.5     144.0     43
Extra     0          56.35     243.35     372.85     196.85         74.6      82.1      -18.9
output

  The mulch to no mulch treatment had the lowest output while the dimethoate to dimethoate
  had the highest. The fleece to mulch also performed well in terms of output ranking third
  after the dimethoate to dimethoate and the dimethoate to mulch.


  The questions posed to the farmers to understand these concepts were;


  If you did not follow any of the management strategies, the output would have been ksh
  61.90 (which is the output of the control to no mulch strategy), how much more would you
  have got by adopting any one of the strategies compared to the control?


  Due to flooding of the experiment with the Kariguini group, there was no yield data and from
  this point onwards, the group used data from the Athi River group both for the inputs and the
  outputs for ease of comparison.


  e) Constructing the benefits table
  We then constructed the extra benefits table, which subtracted the extra costs of adopting a
  strategy from the extra output obtained from adopting that strategy.
  The question therefore was;
  Does the extra output for each of the treatments cover the extra costs that you put in to
  obtain this output?
  Table 11. Calculating the benefits
           Control   Dimethoate Dimethoate Fleece          Fleece   Mulch to Mulch to no
           to        to mulch   to         to              to    no Mulch    mulch
           mulch                Dimethoate mulch           mulch
Extra      56.35     243.40     372.85     196.85          74.6     82.1     -18.9
output
Extra    179.8       197.8             45       213.05     33.25         213.55    33.75
Costs
Benefits -123.4      45.6              327.85   -16.2      41.35         -131.45   -52.65
                                                121
Rank       6           2             1              4           3           7           5


  The extra output from the dimethoate to mulch, dimethoate to dimethoate and fleece to
  no mulch all paid for the extra inputs that had been incurred. The output from all the
  other treatments could not pay for the extra inputs used in these treatments.


  The initial reaction by farmers in Athi River was that spraying seemed to be the most
  profitable of the treatments. They ranked the spraying treatment as the best (spray in
  nursery and spray in field) followed by the spray/mulch treatment (spray in the nursery and
  mulch in the field). The reaction from Kariguini which is an organic group was however
  different. They preferred the mulch and fleece treatments, as these were more environment
  friendly than the dimethoate treatment. Since the output from these treatments was not very
  low, they concluded that if they reduced the cost of inputs by for example collecting mulch
  rather than buying it, then the benefits of using mulch would be positive.


  3.4 Statistical analysis of the data
  The data was statistically analysed in order to take account of such issues as missing
  values and to standardize the results across the treatments. Statistical analysis of the gross
  plot prices, assuming 42 plants, was carried out using Analysis of Variance in Genstat
  (Genstat 4.2, 2000). Inter-block variation was taken into account and a p-value for
  differences between the treatments was calculated. The standard error of the difference
  between any two treatments was used to make specific treatment comparisons. The partial
  budgets from this analysed data, both per plot and per ha are given below.




  Table 12. Statistical partial budget (on a per plot basis)
               Control     Dimethoate    Dimethoate to     Fleece to   Fleece to   Mulch to   Mulch to
               to mulch    to mulch      Dimethoate        mulch       no mulch    Mulch      no mulch
Inputs             179.8         197.8             45.0        213.1        33.3      213.6        33.8
Output             130.0         312.0            399.0        282.0       136.0      156.0          47
Extra               63.0         245.0            332.0          215        69.0       89.0         -20
output

                                                     122
Extra Costs          179.8         197.8              45.0       213.05         33.3         213.6         33.8
Benefits            -116.8          47.2             287.0            2         35.8        -124.6        -53.8
Rank           6             2             1                 4            3            7             5


  The budget was then converted into a per hectare basis so that it could be more logical to
  farmers. This was done using the following calculations.


  1 plot had 42 plants
  Spacing used was 60cm by 60cm Area of one plot was 15.12 sq metres
  One nursery measured 1m by 2m
  To plant 1 ha of cabbage, we would require 300g of seed
  To get enough seedlings for 1 ha of cabbage requires a nursery of 18 sq metres
  Therefore, the experiment would have required 9 nursery beds to transplant seedlings into I
  ha.
  The output and inputs per plot were calculated using the formula


                             inputs/outputs * 10 000
                             Area of plot (sq m)


  Nursery expenses were multiplied by a factor of 9.
  Table 13. Statistical partial budget (on a per ha basis)
              Control to Dimethoate Dimethoate to Fleece             Fleece    Mulch to Mulch to
              mulch      to mulch   Dimethoate    to mulch           to     no Mulch    no mulch
                                                                     mulch
Inputs         118 915           119 077        18 019       119 213     298.8 119,219       304.2
Output          85 978           206 349       263 888       186 507    89 947 103 174      31 084
Extra           41 666           162 037       219 576       142 195    45 634  58 862     -13 227
output
Benefits       -77 248            42 960       201 588           22 982       45 336       -60 357       -13 532
(Ksh)
Benefits           -702.3          390.5           1 832.6        208.9        412.1        -548.7        -123.0
(UK£)
                 7              3                 1        4           2          6            5
  Comparing these statistical budgets with the farmer budgets did not give a major difference.
  On a per plot basis, the fleece to mulch treatment, which had negative benefits in the farmer
  budget, now had positive benefits in the statistical budget. All other treatments with negative
  budgets in the farmer budget remained with negative benefits even with the statistical

                                                       123
budget.


On a per ha basis, the order of ranking according to benefits changed. Dimethoate to
dimethoate still had the highest benefits followed by the fleece to no mulch. The per plot
analysis had the treatment with the second largest benefit as the dimethoate to mulch. In the
per ha statistical budget, this treatment was ranked third. Four treatments (dimethoate to
dimethoate, fleece to no mulch, dimethoate to mulch and fleece to mulch) had positive
benefits in the per ha statistical budget while the other three (mulch to no mulch, mulch to
mulch and control to mulch) had negative benefits.


This budget was then discussed with the two groups of farmers and was used for the final
evaluation of the treatments.


3.5 Farmer discussions and evaluation of the various viral disease control strategies
The evaluation was done in form of a moderated focus group discussion with farmers. The
first step in the evaluation was for farmers to remind themselves of the purpose of the
experiment and the different treatments. Due to the complexity of using all 8 treatments for
the evaluation, the farmers opted to evaluate the treatments broadly as mulch, fleece,
dimethoate and control. The next step was then to identify what criteria other than financial
benefits farmers thought were important for the evaluation. This was based on what they
would consider if they were to make a decision on whether to adopt a certain disease
control strategy or not. Five criteria were selected; labour requirement, benefits, availability
of materials, ability to control the disease and use of other inputs. The farmers then ranked
each of the four treatments with the best getting a rank of 1 and the worst a rank of 4. The
farmers were then asked to give a final score for each of the treatments. This was done by
giving a total score of 100 for all the treatments and farmers allocating this 100 amongst the
four treatments.


The final step of the evaluation was then to critically look at the 4 treatments and discuss
what else they thought was good or bad about the particular treatment and would make
them adopt or not adopt it.



                                                124
3.5.1 Evaluation of results in Athi River
3.5.1.1 Ranking of treatments
Table 14. Farmers ranking of treatments in Athi River
Criteria/      Labour       Benefits        Availability   Disease   Use of other
treatment                                                  control   inputs
Mulch          3            3               3              3         2
Fleece         2            2               4              2         3
Dimethoate     4            1               2              1         4
Control        1            4               1              4         1



The control treatment was ranked the best in terms of labour requirement with dimethoate
being the most labour intensive. The mulch was ranked third. In terms of the benefits,
dimethoate was ranked top while fleece was second and mulch third. In the use of other
inputs, mulch was ranked second while dimethoate was ranked last. Dimethoate got a rank
of 4 due to other requirements such as gloves, masks, spray pumps and other protective
gear that is required for spraying.


Farmers were then asked to give a general score for each of the treatments from a score of
100. Dimethoate was given a score of 50, which was the highest score. This was followed
by fleece, which had a score of 25, mulch with a score of 15 and last was the control with a
score of 10.


3.5.1.2 Merits and demerits of disease control strategies
This involved farmers thinking beyond the disease control aspects of the treatments and
discussing what would encourage or discourage them from adopting these treatments. The
good points and the bad points of each of these treatments are summarized below.




                                                   125
Table 15. Merits and demerits of treatments in Athi River
Treatment Merits                           Demerits
Mulch     • Ability to retain water and • Expensive
           moisture                        • Can encourage other pests such as
          • Controls pests (aphids) and      crickets and cutworms
           therefore viral diseases        • May retain more moisture than
          • Controls weeds                   necessary during heavy rains and
          • Prevents contact of plant with   after watering
           the ground

Fleece       • Seedlings were of better             •   Expensive
              quality than other treatments         •   Seedlings etiolated
             • Little labour required               •   Not easily available
             • Kept aphids out and hence            •   Had weed problems
              controlled the disease
             • Yield was high
             • Retains moisture

Spraying     • Controlled most pests and            •        Offensive smell
              hence diseases                        •        Labour intensive
             • Yield was high                       •        Expensive to apply (need
             • Good quality heads                       pump, masks, gloves etc)
             • Affordable                           •        Could be toxic
                                                    •        Pests develop resistance
                                                    •        Farmer may buy when it has
                                                        expired
                                                    •        Takes long to degrade

Despite the many demerits of the dimethoate, it has been the most commonly used by the
farmers in the control of aphids. However, those farmers who had access to mulch were
willing to try it and see its performance under non-experimental conditions. The project team
also provided the group with a piece of the fleece used during the experiment for further
evaluation during the final PRA.




                                              126
3.5.2 Evaluation of results in Kariguini
3.5.2.1 Ranking of treatments
Table 16. Ranking of treatments in Kariguini
Criteria/treatment Labour           Benefits      Availability   Disease       Use of other
                                                                 control       inputs
Mulch               2               1             1              1             1
Fleece              1               2             4              2             2
Spraying            4               4             3              3             3
Control             3               3             2              4             4
1=best 4=worst


Fleece was ranked highest in terms of labour requirements and second in terms of the
benefits, disease control and use of other inputs. It was however ranked lowest in terms of
availability since it is not available locally. The dimethoate was ranked very low in all criteria
groups (lowest in terms of labour, benefits and third in terms of availability, disease control
and use of other inputs). The farmers argued that the financial benefits from the use of
dimethoate would be overshadowed by the environmental and health hazards as a result of
the use of the dimethoate. In terms of disease control, they argued that the dimethoate is
specific to only some pests and to control all the disease and pests that are a problem in
kales and cabbages, they would need to purchase other types of chemicals.


Mulch came out very favourably with this group of farmers, because it would exclude the
use of chemicals and because it is available locally. When probed on the high cost of the
mulch as per the budgets, farmers indicated that they would not need to purchase mulch, as
this was readily available. The only cost would be for the labour required to look for, cut and
carry the mulch to their plots. The farmers also favoured fleece despite its unavailability,
though they expressed a need for a local alternative to the fleece.


Farmers were then asked to give a general score to the treatments from a total score of 100.
Mulch was ranked highest with a score of 40 followed by fleece with a score of 30.
Dimethoate and control came third and fourth with scores of 20 and 10 respectively.




                                                 127
3.5.2.2 Merits and demerits of disease control strategies
The farmers agreed that the merits of both the mulch and the fleece outweighed their
demerits and they would like to try these two treatment options not only for the disease and
pest control but also to reap the other benefits of the treatments. The major handicap was
however availability of fleece. The project team agreed to provide the farmers with the fleece
used for the experiment, and one of the assessments during the final see how many farmers
had used either the fleece or the mulch and what the performance was compared to their
normal practice.


Table 17. Merits and demerits of treatments in Kariguini
Treatment      Merits                               Demerits




                                                 128
Mulch            • Easily available                        •    Is dusty and can hurt the skin
                 • Protects soil from direct               •    Arsonists can burn your shamba
                   sunlight                                •    Can carry seeds for other weeds
                 • Preserves moisture                      •    Snakes and other reptiles can hide
                 • Increase soil fertility                     in it
                 • Weed control
                 • Control of aphids
                 • Can be used many times
Fleece           • Prevents aphids and all other           • Not locally available
                   insects                                 • No knowledge of cost if it was
                 • Higher yield                             available locally
                 • Can be used many times                  • Can not be used in the whole field
                 • Protects seedlings from the             • Can be stolen
                   sun
                 • Easier     and        moderated
                   watering
                 • Seedlings grew faster
                 • Protected    the       seedlings
                   against physical damage such
                   as people stepping on them
Spraying         • Is easy to use                          • Makes people sick-poisoning
                 • Can be used against many                • Kills even the beneficial insects
                   pests and diseases                      • Requires a lot of other accessories
                 • Leaves of cabbages and                   such as gloves etc
                   kales are healthy                       • Destroys the soil
                                                           • Pollutes the atmosphere
                                                           • Are expensive
                                                           • You can not access it unless you
                                                            buy from the shop-have to use
                                                            money
                                                           • Low farmer knowledge of which
                                                            chemicals are bad or good
                                                           • Storing it in the house is risky.




3.6 Some achievements of the participatory budgeting exercise

3.6.1    Acquisition of record keeping skills by farmers

Alongside the budgets for the on farm trial, farmers were trained on how to keep their own
farm budgets and facilitated to do so through provision of notebooks.




                                                    129
3.6.2   Farmer empowerment and ownership of the trial

Farmers felt they controlled part of the trial and as the scientists showed them how to
recognize the disease, they had their own part of the trial; collecting and recording input
data, timing of operations and monitoring the progress of the trial. Towards the middle of
the trial, farmers were able to describe the trial activities to visitors and other scientists that
came to see the trial.




Figure 2. Farmers explaining the on farm trial to visitors from NR International.



3.6.3   Increase in number of participating farmers over the period of the trial

There was an increasing level of participation by farmers through the period of the on-farm
trial. In total 52 different farmers participated in the trial in Athi River. This coming together of
farmers also created a forum for them to discuss other issues of common interest such as
environmental issues, water use etc. By the end of the trial, the farmers decided to form a
group and registered themselves in order to get more assistance from the government and
other development agencies.

                                                   130
                   30


                   25


                   20
   No of farmers




                   15


                   10


                   5


                   0
                                                      Days

                                            Male       Female        Total

Figure 3. Farmer attendance to the on farm trials in Athi River



3.6.4              Agreement by farmers to try the disease control strategies on their farms

The two groups of farmers in discussion with the project team agreed to try the disease
control strategies specifically the mulch and the fleece, on their farms during the next
planting season. The project team will provide the fleece to the groups.




                                                              131
   4. EVALUATION OF CHANGE OF FARMER PERCEPTION OF
       VIRUS DISEASES OVER PROJECT PERIOD
4.1 Objective
A final PRA was carried out with the aim of establishing how farmer perceptions of viral
diseases and their management have changed over the period of the project. This was done
with the groups involved in the on-farm trials. These groups were Ruiru, Athi River and
Kariguini.


4.2 Methodology
The PRAs were called out in form of an individual questionnaire survey and focus group
discussions with the group members. The questionnaire is attached as Appendix 3.
Questions asked in the individual questionnaire survey included the symptoms of viral
diseases, the four management strategies used as a control for viral diseases, the farmers
perceptions’ of the importance of viral diseases, whether farmers had used any of the
management strategies and what problems they experienced, which pests and diseases still
pose a problem in vegetable production and what farmers think they have gained from the
project. During the group discussions, a format similar to that used in the initial PRAs was
followed. Farmers were given leaves containing symptoms of viral disease and were told to
identify the symptoms and what causes them. They were then asked to identify the
management strategies and rank them again in order of priority. The farmers’ perceptions
and practices were then based on a wealth indicator using criteria earlier identified by
farmers during the initial PRA.


A comparison was made between farmers’ expectations at the beginning of the project and
the achievements that they have made. Farmers gave a score out of 100 to the scientists
based on whether they helped them achieve their expectations or not. The scientists gave
scores to the farmers based on whether they thought farmers had met their expectations.


In order to avoid bias in answering the individual questionnaires, the individual surveys were
carried out before the group discussions.




                                               132
4.3 Results

4.3.1 Wealth ranking of the farmers

A wealth ranking as described by Bellon (2001) was used for categorizing the farmers into
different wealth categories. Wealth is an important social category and varies from place to
place. The wealth ranking was then used to analyze the preferences of farmers based on
their wealth and their adoption of the disease management strategies. This is because the
adoption of the management practices may be completely different between different wealth
groups since each may control different sets of resources.


The indicators for the wealth ranking for the different groups from the initial PRA were used
for Athi River and for Ruiru. Since an initial PRA had not been done in Kariguini, a new set
of indicators was discussed.


The procedure followed was:
All the farmers’ names were written on pieces of cards. Four farmers were then selected
from the group as key informants. Those selected had good knowledge of the households
represented in the groups. Both men and women were included in this group of key
informants. The criteria for wealth ranking and the indicators for each of the wealth
categories from the initial PRA were reviewed. Once everyone was conversant with
indicators for each category, the names from the cards were read out a loud and the
informants placed the farmer in a specific category. In case of discrepancy between the key
informants, the indicators were reviewed again until a consensus was reached. All the
farmers were then placed in respective wealth categories. In Kariguini since there were no
indicators, an agreement was reached with the key informants on what indicators define a
wealthy, poor and intermediate farmer. These indicators were then used to place the
farmers in the different wealth categories. Out of the 34 farmers in the individual interview,
10 were in the low wealth category, 22 in the medium wealth category and 2 in the high
wealth category.



4.3.2 Changes in farmer knowledge of viral diseases and their symptoms

When farmers were asked directly for the symptoms of viral diseases, 79% per cent of the

                                                 133
farmers were able to identify yellowing as a symptom of viral diseases while 26% identified
leaf curling as a symptom of viral diseases. Other symptoms that farmers associated with
viral diseases were leaf distortion, stunted growth, and aphids. Symptoms not mentioned by
farmers included clearing of veins.


As groups, the farmers were given leaves of kale with various virus symptoms and told to
identify the symptoms and what causes them. This was then compared to the results of the
initial PRA.


Table 18. Symptoms and farmers perceptions of their causes
Symptoms                                          Causes
                 Athi River
Leaf spots                                        Cold, Aphids
Curling of leaves                                 Aphids, cold
Yellowing                                         Low fertility, moisture stress
Clearing of veins                                 Do not know

                    Kariguini
Curling of leaves                                 Aphids
Drying of leaf ends                               Moisture stress, virus
Yellowing                                         Virus

                      Ruiru
Vein clearing                                     Do not know
Yellowing                                         Aphids
Leaf curling                                      Aphids
Stunting                                          Diseases including viral

Although farmers in Athi River knew some of the symptoms of viral diseases, they did not
remember the types of aphids and their relationship to viral diseases. Compared to the initial
PRA when most of the farmers associated viral symptoms to either fertility or moisture
stress, most of the farmers could now associate the symptoms of viral diseases to aphids.



4.3.3 Individual farmer evaluation of disease management strategies

Farmers ranked the disease control strategies according to preference. These have been
compared across groups and across wealth categories. The high wealthy category was not

                                                 134
included in this analysis as it had only two cases. In Athi River, most of the farmers (70%)
preferred spraying to the other strategies. Another 20 percent preferred fleece. Fleece was
most preferred by the farmers in Kariguini and Ruiru with the lowest preference for spraying
being in Kariguini.


The differences between these groups explain their preferences for the control strategies.
Farmers in Athi River are purely commercial farmers, and for them the most available option
is the most attractive irrespective of the environmental consequences. The fact that Athi
River is near an urban center and pesticides are more available makes spraying more
attractive than the other options. Kariguini, on the other hand is a group that has been
growing vegetables organically and therefore spraying is not an attractive option for them.



               80

               70

               60

               50
   % farmers




               40

               30

               20

               10

               0
                    Athi River   Kariguini      Ruiru               Low       Medium
                                        Group                             Wealth

                                      Control    Fleece   Mulch   Spray

Figure 4. Percentage of farmers ranking each treatment first by group and wealth

The low wealth category preferred fleece with only 30% preferring control, mulch and spray.
The medium wealth was split almost half and half between use of pesticides and fleece with
just about 10% preferring mulch.



                                                           135
4.3.4 Final group evaluation of disease management strategies

In Athi River, the group ranked spraying top followed by mulching and fleece. The fleece
was not available and farmers stipulated that even if it were made available in the country, it
would still be expensive, as it would be sold as an imported product. Mulching was favoured
as it serves different purposes including improving water retention in the soil and reducing
the number of weedings as well as preventing viral diseases. It was however also scarce
and farmers spent long hours looking for grass to cut and use as mulch. Out of the 7
farmers that had been given some fleece by the project, one had used it while the others
had not planted their nurseries yet. Farmers felt that the fleece would save them some
money since they would not have to spray in the nursery. It was safer to human health and
the environment.


In Kariguini fleece was ranked highest followed by mulch and control. This being an organic
group, they did not favour spraying due to its environmental and health effects. Since the
majority of them depend on rain fed horticulture, none had used the fleece as they were still
waiting for the rains.


In Ruiru, farmers ranked fleece highest followed by mulch, spraying and control. Although
these farmers are more commercialized than the farmers in Kariguini, they are still willing to
use fleece and mulch to reduce the cost of kale and vegetable production, especially in
cases where they can get the mulch locally without having to purchase it. Those who had
tried mulch, however, indicated they still had to use chemicals to control other diseases and
pests.



4.3.5 Adoption

The adoption of these management strategies did not always follow the farmer preferences.
The proportion of farmers who had tried any of the management strategies was compared
across groups and across wealth categories. The results are shown in Figure 5.


Almost half of the farmers interviewed (41%) had tried one of the control methods. Most of
the farmers had tried mulch. Others who indicated that they had sprayed were excluded


                                                 136
from this analysis as spraying had been part of the farmer practice prior to the study. More
farmers had tried mulch in the low wealth category than in the medium wealth category.
Although during the budgets the mulch treatment was more expensive than the spraying
treatment, if farmers obtain the mulch locally, the treatment becomes more attractive
especially to the low wealth category of farmers. A higher percentage of farmers in Ruiru
mulched compared to farmers in the other two groups. This is despite the fact that none of
these farmers had indicated mulch as their number one preference. In Kariguini, most of the
farmers had not planted their nurseries as they practice rain fed vegetable production in
contrast to farmers in Ruiru and Athi River who depend exclusively on irrigation. Problems
encountered in the use of mulch included infestation by ants and termites, and unavailability
causing farmers to spend long hours collecting the mulch.



                                    80
   % farmers using control method




                                    70

                                    60

                                    50

                                    40

                                    30

                                    20

                                    10

                                    0
                                         Low        Medium   Athi river         Kariguini   Ruiru
                                               Wealth                            Group

                                                             Yes     No

Figure 5. Adoption of disease control strategies

Adoption of fleece could not be evaluated since farmers had just received the fleece and
therefore had not had the opportunity of using it. Fleece posed a problem as apart from that
supplied by the project, it is apparently not locally available. It is this unavailability of fleece
that may have prompted farmers who had preferred it to try mulch.

                                                                          137
4.3.6 Farmers expectations from the project and their perceptions of how far these have been met


                                           Athi River
    1. Improvement of farmers’ income
This objective had been 590% met according to the farmers. Some of the achievements
were that the project team had made the farmers more cohesive by encouraging them to
form and register a group, had provided knowledge on disease and pest control enabling
farmers to reduce their costs of production. The farmers had also become model farmers for
other farmers in the district. The group felt that we should have helped them more in terms
of giving them loans, farm inputs including fertilizers, seeds and chemical sprays as well as
farming equipment such as a pump.
    2. Visits and study tours
The farmers expected the project team to take them for visits and study tours to see other
groups of farmers more experienced in vegetable production and other institutions dealing
with vegetable production and marketing. The project scored zero marks for visits and study
tours.
    3. Increased knowledge of pests and diseases
Farmers felt their knowledge had increased with respect to cabbage production, viral
diseases of kale and cabbage, record keeping and group work. However, they felt that due
to their multiplicity of problems, projects should not confine themselves to only one crop and
only certain diseases but should deal with different crops, different pests and diseases and
different aspects including marketing. In terms of knowledge on other aspects, the project
scored 20%.


                                            Kariguini
    1. Increased knowledge of pests and diseases
Farmers gave the project 85% for giving them knowledge on pests and diseases in a
practical and participatory way. Of importance to farmers was the knowledge gained in
disease control at nursery level, general nursery management, fertilizer application and the
importance of farmers planting their own nurseries. The farmers would however have liked


                                                  138
to see the experiment through to completion or to visit the Athi River group who finished the
experiment to the end.
    2. Good vegetable production
The farmers gave the project 80% for trying with them alternative control strategies
especially since they were an organic group trying to use less pesticide on their farms.
Record keeping was also appreciated as the farmers could now keep their own records and
budget for their activities.
    3. Follow up
Farmers would have wanted to have a repeat of the experiment since they did not see the
results and only discussed the results from Athi River with the project team.




                                            Ruiru
    1. Improvement of farmers income
Farmers’ incomes have improved and the farmers gave the project team a score of 80% in
this respect. They attributed this to increased awareness of diseases enabling them to
control at nursery stage and therefore reduce damage to the crop. The farmers would have
liked to repeat the experiment so as to see the final results.
    2. Follow up
The project team got 60% for follow up as the group was taken to the KARI station for a
study visit on vegetable production.
    3. Increased knowledge of pests and diseases
The project team got 80% for increasing farmers’ knowledge on disease and pest
management and offering farmers alternative control and record keeping skills. They lauded
the team approach of giving both theoretical information and putting it into practice with
farmers in a participatory way, a especially including a farmer practice trial for comparison
with the alternative management strategies. The problem, the farmers said, is that they are
still experiencing problems with other pests and disease such as nematodes.

Other gains from the research as expressed by farmers included cost effective means of
pest and disease control, good nursery management, good vegetable production including

                                                139
timing of fertilizer application, seedbed preparation, nursery preparation etc, record keeping,
profitable farming and farmer empowerment.




4.3.7 Priority crops and pests for future research
Farmers in the three groups were asked for the priority crops, pest and diseases that they
would like future research to focus on.


Table 19. Priority crops, pests and diseases for future research
Crops                               Pests and diseases
Athi River
Tomatoes                            Spider mites
French beans                        Early blight in tomatoes
Onions

           Kariguini
Bananas                             Fusarium wilt
Potatoes                            Bacterial wilt
Maize                               Maize streak virus

             Ruiru
Tomatoes                            Spider mites
Capsicum                            Nematodes
Coriander                           Leaf curl

                                                     140
Management strategies that farmers would like research on include use of less pesticide
and the effecting of burning debris and rotation on bacterial wilt of tomatoes and potatoes.




                                             141
5. POTENTIAL FOR FARMER SELF SEED SELECTION
5.1 Objective
The objective of this study was to determine the potential for self-selection of seed of
resistant/tolerant components of land races of kale as a strategy for disease management.


5.2 Methodology
Ten farms were selected in Kinale where farmers save their own kale seed. In these farms,
healthy and diseased plants were identified and tagged. In order to link these with farmer
participation, the 10 farmers were also asked to identify plants that they would consider
suitable as planting material and plants that were unsuitable as planting material. These
were tagged as good and bad. The disease free were tagged as healthy and infected ones
were tagged as diseased. During the tagging process, farmers were also shown how to
identify the viral disease symptoms. The criteria used by scientists and farmers to select the
plants are given in Table 20.


Table 20. Criteria associated with good and bad plants for kale seed as selected by farmers and
            scientists
                  Farmer criteria                                Scientists criteria
Good for seed                Bad for seed          Good for seed          Bad for seed
Green leaves                 Small seeds           Aphid infested but     Small seeds
                                                   still healthy
Many thick, long ponds       Thin leaves           Healthy green          Thin leaves
                                                   leaves
Late flowering (long         Stunted plants        Late flowering         Stunted plant
harvest period)
Soil fertility of the area   Short and slender                            Weak plants
around the plant             pods
                             Leaf yellowing                               Short and slender
                             (chlorosis)                                  pods
                             Immature seeds                               Leaf
                                                                          yellowing/chlorosis
                             Aphid infested                               Immature seeds
                             plants
                                                                          Aphid infested plants




                                                 142
.
The seeds were then harvested and sowed at each of the farms in nurseries. Farmers were
however not informed of which batch of seeds came from which category of tagged plants.
An evaluation was done with farmers after 2 weeks and again after 4 weeks. The farmer
was asked to allocate points to each of the treatments for each evaluation category from a
total of 20 points for each evaluation criteria. The treatments were evaluated for germination
time, % germination, colour, height, disease and pests. The evaluation sheet is given as
Appendix 4. During the first evaluation none of the farmers were able to tell the disease
symptoms on the kale seedlings while only 3 were able to do during the final evaluation.
During these two evaluations, the identity of the treatments was not disclosed to farmers.


5.3 Results of the evaluation
Figure 6 below gives a summary of the results of the evaluation after 4 weeks. In terms of
germination time and the % germination, the farmer selected good seed had the highest points
allocated. Scientists selected good seed scored the highest for crop colour, crop diseases and
crop pests while the highest score for crop height was given to the farmer selected good seed.
In summary, the scientists’ selected good seed and the farmer selected good seed were the
best placed treatments as compared to the scientists’ selected bad seed and the farmers’
selected bad seed.




                                              143
                                 100%

                                 90%       23.3         20                                        23.3
                                                                    27.5           25.6                       24.4         25
   % of total points allocated


                                 80%

                                 70%
                                                        30                                        21.7
                                           26.9                                                               26.3
                                 60%                                25.9           28.1                                    30

                                 50%

                                 40%       23.3                                                   31.7
                                                       24.4
                                                                    29.4            25                        32.5
                                 30%                                                                                      27.5

                                 20%
                                           26.4        25.6                                       23.3
                                 10%                                               21.3                                   17.5
                                                                    17.2                                      16.9

                                  0%
                                        Germination Germination Crop colour     crop height       Crop      Crop pests   General
                                           time        rate                                     diseases                  score


                                    Scientists bad            Scientists good                 Farmer good            Farmer bad


Figure 6. Evaluation of on farm seed selection by farmers

5.4 Field day to sensitize farmers on farmer self seed selection
In order to reach more farmers, a field day was organized in one of the selected farms. During
the field day the on farm trial was explained as a way to enable farmers to select promising
seed from kale that is resistant/tolerant to brassica viruses. The criteria used to select healthy
and diseased land races by farmers and by scientists were revisited for the benefit of farmers
who were not in the trials. A demonstration was then carried out on viral disease identification.
Farmers were also taught about the transmission of viral disease by aphids and the different
types of aphids. The three types were shortened for farmers as Brevi for Brevicoryne brassica,
Myzus for Myzus persicae, Lipa, for Lipaphis erysimi.


A total of 19 farmers attended the field day together with 3 staff from CABI-ARC and 4 from
KARI.




                                                                                144
6. CONCLUSIONS AND RECOMMENDATIONS
6.1       Evaluation of viral disease control strategies by farmers
The disease control strategies were well received by the three groups of farmers. The choice of
each group depended on the type of group and their circumstances. The commercial farmers
mainly in Athi River preferred spraying pesticides as opposed to using fleece and mulch. These
are farmers who have rented small pieces of land for vegetable production and mulch
availability is low. Those farmers who could obtain mulch tried it on their farms. In Ruiru, farmers
preferred mulch as they have bigger pieces of land and they can obtain mulch locally. Kariguini
who are organic farmers, preferred fleece and mulch and even the control treatment to spraying.
These strategies were associated with several advantages and disadvantages. Fleece kept the
vegetables protected from all other pests but was not locally available. Mulch on the other hand
was favoured as it served other purposes including weed control, preserving soil moisture,
controlling pests, and adding organic matter to the soil. It was, however, associated with fires
and was also hard to find locally, especially for farmers with small land sizes.


The implications of this evaluation are that before any technologies/strategies are
recommended to farmers, farmers need to be given a chance to evaluate them and assess their
suitability. Farmers will then have a choice on which management strategy is most appropriate
for them depending on their circumstances. For farmers to do this, they need to be equipped
with skills to enable them to do an informed evaluation. Skills such as record keeping and
budgeting proved to be very useful during this evaluation as farmers were able to cost each of
the strategies as well as to compare the returns from each. A two-season evaluation would be
desirable for farmers to make across season evaluations of the strategies.


Given the high preference for fleece, arrangements need to be put in place, preferably in
collaboration with either the private sector or a local NGO for the local supply of fleece to
farmers or to explore the possibility of a local alternative which can function as effectively as the
fleece.


During the final evaluation to assess impact of the project, more than 40% of those farmers that
had been involved in the evaluation had tried the disease control strategies of their choice on
their farms. The potential for adoption was even higher since the evaluation was done in the dry

                                                    145
season before farmers had made their nursery beds. There was an indication that more farmers
would adopt the strategies, especially mulching and the fleece provided by the project.
6.2    Change of farmer perception and knowledge of viral diseases
During the initial PRA the farmers’ perception of viral diseases was very low. Only one farmer in
all the three groups attributed viral disease symptoms to aphid attack. Other farmers associated
viral symptoms to moisture stress, low fertility, too much watering, potassium deficiency and
even excess use of manure. These causes were sometimes contradictory indicating the very
low knowledge farmers had on these symptoms and their causes. Asked for the control of these
symptoms, the farmer response was always spraying. Farmers did not have any other
alternative control. After the on farm trials, farmers were able to associate the symptoms to viral
diseases and more important, farmers were able to associate these symptoms to aphids.


6.3    Potential for on farm seed selection
Seeds from both the farmers’ and scientists’ selection of good plants outdid the seed from bad
plants in terms of germination time, germination percentage, crop colour, crop height pests and
diseases. Farmers were trained on viral disease identification in order to combine their criteria
for seed selection with the scientists’ criteria of disease free plants. With this knowledge, the
potential for seed selection in Kinale has increased. However, for farmers to benefit
economically from this, the seed market systems need to be streamlined to avoid exploitation of
the farmers by middlemen.




                                               146
APPENDICES
Appendix 4a. Check list for PRA on vegetable virus control for smallholder farmers
   •   A wealth ranking to get different social categories of farmers
                Develop indicators of wealth
                Assign values to different indicators for different social categories-rich, poor and
                medium.
   •   General problems and constraints in vegetable farming (List)
                Farmer priority constraints in vegetable farming (Rank)
   •   Priority pests and diseases
   •   List and rank important and common land races of kale and cabbage
   •   Disease and pest calendar for cabbage and kale
                For each of the crops, kale and cabbage, identify different growth stages of the
                crop, the symptoms of either pests or diseases observed in each, what farmers
                attribute the symptoms to, the control methods and rank land races according to
                susceptibility to these diseases/symptoms.
   •   A general discussion of the problems and constraints of the control methods mentioned
       above.
   •   Pick out from table the control methods used for viral diseases and symptoms and for
       aphids and rank them in terms of
                Effectiveness
                Cost
                Availability
                Practicability
                Environmental and personal safety




                                                147
Appendix 4b. Farmer indicators of wealth
ATHI RIVER                                                     RUIRU
Rich                Medium                Poor                 Rich                   Medium                    Poor
6-20 grade cows     1-5 cattle            No cattle            Multi-storey           Stone      walled         Brick        walled
                                                               house with tiled       house with iron
                                                                                                                house with iron
                                                               roof                   sheet roof
                                                                                                                sheet roof

11-50 goats         6-10 goats            0-5 goats            1 to 2 motorcars       One bicycle               1 wheelbarrow
Hire land of 4      Hires land of ½       No        land-      3     acres     of     1 acre vegetables,        No       inputs,
                    to 3 acres            Squatting                                                             borrows seeds
and       above                                                vegetables,            not           enough
                                                                                                                and no fertilizer
acres                                                          access            to   fertilizer          or    applied
                                                               fertilizer     and     quality seed
                                                               quality seed

House      with     House with iron       Paper house          50 hp irrigation       3-4hp        irrigation   Bucket
stone wall and      sheet wall and                             pump,      tractor,
                                                                                      pump, no tractor,         irrigation         or
iron      sheet     roof                                       sprinklers
roofing                                                                               no sprinklers and         money maker
                                                                                      uses pipes

Has access to       Has access to         No access to         Has hired labour       Uses own labour or        Uses own labour
                                                                                      casual                    only
irrigation water    irrigation water      irrigation
                                          water

Has    irrigation   Rent or borrow        No    irrigation     2-5 grade cows,        1 grade cow or 3-         0-2 local cattle
equipment           irrigation            equipment                                   15 zebu animals
                                                               no local cattle
                    equipment                                                         without grade cows

Has permanent       Uses           own    Provides own         Children attend        Children   attend         Children do not
                                                               private boarding       local government          attend school
hired labour        labour         and    labour
                                                               school                 school
                    sometimes
                    hires

Grows irrigated     Grows                 Grows         rain   Meat     in    diet    Meat in diet once         No meat in diet
crops for export-
                    irrigated maize,      fed         maize,   everyday               a month
French beans,
flowers, okra etc   kales,       beans,   beans         and
                    French beans,         kales
                    cabbage,
                    tomatoes       and
                    chillies        for
                    local market




                                                               148
Has       enough   Minimum             No operational   30,000 Ksh and    Ksh        5-30,000   Ksh 5000 and
                   operating capital   capital                            operating finance     below operating
operating                                               above operating
                                                                                                finance
capital                                                 finance

Have      modern   Uses traditional    Uses
                   and     modern
farming                                traditional
                   farming
experience    or   experience          farming
hire                                   experience
experienced
managers.




                                                        149
Appendix 4c; Evaluation questionnaire

Farmer Name……………………………………………………………………………………
Wealth category (defined by farmers)………………………………………………………

   Knowledge of viral diseases and their management
   1. What are the symptoms of viral diseases on kale/cabbage? Give two
        i)       …………………………………………………………………………………
        ii)      …………………………………………………………………………………

   2. What management strategies have we experimented on? Give all four
        i)     …………………………………………………………………………………
        ii)    …………………………………………………………………………………
        iii)   …………………………………………………………………………………
        iv)    …………………………………………………………………………………

   3. Rank the above strategies starting with the best (rank only what the farmer has identified
      above)
         i)     …………………………………………………………………………………
         ii)    …………………………………………………………………………………
         iii)   …………………………………………………………………………………
         iv)    …………………………………………………………………………………

Experimentation with disease management strategies
   4. Have you tried any of the strategies we have experimented on in your farm? YES/NO
      (circle)
   5. If yes, which one?………………………………………………………………………..
   6. Did you have any problems with the management strategy that you have tried on your
      farm? YES/NO (circle)
      If                                    yes,                                   what?
      ………………………………………………………………………………………………………
      ………………………………………………………………………………………

   Change in importance of viral diseases as a constraint to vegetable production
   7. Could you rank the symptoms on your farm now starting with the worst?
           1. …………………………………………………………………………………….
           2………………………………………………………………………………………
           3………………………………………………………………………………………
Other gains from the on farm evaluation
   8. What would you say is the most important thing you have gained from our collaboration
       in                                      these                                  trials?
       ………………………………………………………………………………………………………
       ……………………………………………………………………………………..
The future
   9. Are there other crop diseases or pests and their management strategies that you would
       like us to research on together with you?


                                             150
Disease/pest   Management   strategies




                151
Appendix 4d. Form for evaluation of self-seed selection by farmers
Farm No………………………………………………………………………………………………….…
Name of farmer ………………………………………………………...…………………………….

Procedure for evaluation
   4. For each of the evaluation criteria, give a total score of 20.
   5. Ask the farmer to give each of the treatments a score out of the 20 (To allocate the 20 scores to the 4 treatments.)
   6. Ask the farmer to combine all the criteria and give a general score for each of these treatments (these scores must also add
      up to 20)
Treatment Treatment Germination %                             Colour       Height       Disease      Pest attack General        General
            identity      time              Germination                                                             appearance score
            (not     to
            disclose
            to
            farmer))
T1



T2



T3



T4



Total                      20             20              20            20           20           20            20            20


                                                               152
REFERENCE
Bellon, M.R (2001) participatory Research methods for technology evaluation: A manual for scientists working with farmers. Mexico, D.F: CIMMYT


CIAT, (1997) New frontiers in participatory research and gender analysis for technology development. Proceedings of an International Workshop 9-14
September 1996, Cali, Colombo.


Genstat 5 Committee of the Statistics Department, Rothamsted Experimental Station (2000). "Genstat 5, Release 4.2 Reference Manual". Oxford:
Numerical Algorithms Group


Oruko, L and Ndungu, B (2001) Final Socio-Economic report for the Peri-Urban Vegetable IPM cluster. CABI/KARI/HRI/NRI/University of
Reading/IACR Rothamsted Collaborative project.




                                                                       153
Appendix 4e. Disease calendars for Kales and cabbages in Athi River and Ruiru - Kales
Athi River                                                                    Ruiru
Growth stage   Symptoms       Disease      or   Disease     or   Control      Growth    Symptoms              Disease      or   Disease or   Control           Most
                              pest (farmer)     pest (actual)                 stage                           pest (farmer)     pest                           susceptible
                                                                                                                                (Actual)
Nursery        Whitish        Blight            1000 headed      Ridomil      Nursery   Leaf perforations     Green        or   Diamond      Dimethoate        1000 headed
               rusty leaves                                      Dithane                                      black             Back Moth    Karate
                                                                 Antracol                                     caterpillars                   Marshal
                                                                                                                                             Diazinon
                                                                                                                                             Bulldock
                                                                                                                                             Fastac
               Rotting   of   Whitefly          1000 headed      Karate                 Fine           leaf   Adults of the     Diamond      Same as above     1000 headed
               roots                                             Dimethoate             perforations          green             Back moth    + thuricide and
                                                                 Polytrin                                     caterpillars                   Lannate
               Drying on      Cold              1000 headed      As blight              Rotting stem          Cold                           Ridomil copper    1000 headed
               stem base
               Leaf           Caterpillars      1000 headed      Karate                 Stunted growth        Low     quality                None              1000 headed
               perforation    Leaf hoppers                       Dimethoate                                   seed, poor soil
                                                                 Thuricide
               Curling   of   Aphids            1000 headed      Karate                 Eaten leaves          Birds                          Scare             All
               leaves                                            Dimethoate
                                                                                        Wilting               Nutrient                       None
                                                                                                              deficiency
Seedbed        Drying    of                     1000 headed                   Seedbed   Small                 whitefly                       Thuricide         1000 headed
               stem                                                                     perforations
               Yellowing                        1000 headed                             Curling of leaves     aphids                         Dimethoate        1000 headed
               and drying                                                                                                                    Karate
               of stem and                                                                                                                   Dry ash
               roots
                                                                                        Stem rot & drying     Caterpillars                   Remove and kill   1000 headed
                                                                                        Yellowish rough       Cold                           Ridomil           1000 headed
                                                                                        leaves                                               Karate
                                                                                                                                             Dimethoate
                                                                                        Black leaf veins      Cold                           Ridomil           1000 headed
                                                                                                                                             Karate
                                                                                                                                             Dimethoate
                                                                                                                                             Uproot




                                                                                        154
                                                                                        Whitish powder       Fly (type not                      Thioviate        1000 headed
                                                                                        on underside of      specified)
                                                                                        leaves               Sunny
                                                                                                             conditions
                                                                                                             Insufficient
                                                                                                             water
                                                                                        Yellowing      and   Mites                              Dimethoate       1000 headed
                                                                                        drying of leaves                                        Karate




Cabbages

Farmers agreed that in the nursery, the diseases and pests that attack kales are the same ones that attack cabbages. However in the seedbed, apart
from those attacking kales, there are other pests and diseases that are specific to cabbages.

Athi River                                                                     Ruiru
Growth stage   Symptoms            Disease or pest   Disease or   Control      Growth         Symptoms              Disease     or       pest   Disease or   Control
                                   (farmer)          pest                      stage                                (farmer)                    pest
                                                     (Actual)                                                                                   (Actual)
Seedbed        Curling of leaves   Aphids                         Dimethoate   Seedbed        Cabbage heads not     Sunny conditions
                                                                                              forming               Insufficient water
               Leaf perforations   DBM                                                        Yellow spots on       Cold                                     Copper
                                                                                              leaves
               Stem rot                                           Uproot                      Black ring on stem    Lack of crop rotation
                                                                                              leading to drying
                                                                                              Head rot from top     Water collecting on                      Uproot
                                                                                                                    cabbage
                                                                                                                    Worm/aphids inside
                                                                                                                    during head formation




                                                                                        155
Appendix 5

             Rural rapid appraisal on kale seed selection/in choice

                  KINALE DIVISION, LIMURU DISTRICT.




                                   BY
                               WACHIRA S. W.




                                11th April, 2001




                                      156
Introduction

The peri-urban area is major source or horticultural produce for the urban folk. Thus rapid
increase in population in the urban area means a larger market for the fresh produce from the
surrounding farms. This will encourage even the small scale producers to venture into
horticultural production.

SURVEY FINDINGS
kale production in Kinale division is mainly done at small scale level whereby the main
source of labour is the family. Hired labour is only used during the peak production times.
These are during the rainy periods. This is the case because the area is mainly dependent on
rainfed agriculture. Farmers are not aware of any specific varieties of kale, and are not able to
identify the varieties suitable to their area.
kale seeds are produced by farmers mainly on-farm. Alternatively, they buy seed from
neighboring farmers or in the market. This is because on-farm seed is cheaper to produce and
gives a better assurance of the expected production. This is made possible by the general
criteria used to select plants to be used for seed production.

Criteria for selection of kale plants for seed production
                 - Are the last to flower (long harvest period)
                 - Have healthy and strong stem and leaves
                 - Are not diseased or insects infested
                 - Produce a good crop
After identification, the plants are let to flower and when the pods are mature and ripening
they are harvested, dried and thrashed, thus, ready for use in the farm. Some farmers leave
their plants to flower and use that as animal feed.
Seeds availed in the market by various seed companies does not to meet their required
standard for the mainly small scale farmer who wants to fetch maximum output from the crop
because of the following reason:
                 - has stunted growth
                 - flowers with just a few pickings meaning its production life span is short
                 - is more prone to diseases
                 - is expensive as compared to seed sold in the market

None of the farmers are large scale producers of kale seed but produce for their own
consumption with what is left over being sold or stored for future use.
No major diseases/pests were highlighted in relation to seed production as only clean plant
materials are selected. In kale production however, many of viral diseases that were
identified, were spread by the major pests which are aphids and diamond moths. It should be
noted that the farmers are not keen on taking up any high cost pest and disease management
strategies. This is because the returns from kale sales are too low to meet these costs as well
as realize profit for the farmer.

Market issues for seed are not important as they only produce for own use or sale at farm gate
and it is also possible to store the seed for future use. On the other hand, there are major in
kale marketing because of exploitation by middlemen who take advantage of the poor
infrastructure to offer very low prices for the produce. The farmer should be encouraged to
form small co-operatives that will enable them exercise their collective bargaining power and

                                              157
fetch better prices for their produce. When this is carried out the farmer will now be willing to
invest more resources in kale production thus improving quality and quantity of output.

Farmers are well conversant with soil management practices that are suitable for kale
production. The use of both manure and fertilizer for those whose farms are near their
homesteads was rampant. Farmers who had hired land that was a distance from the homestead
use only fertilizer. The reason for this was that manure is too bulky to transport for a long
distance. The farmers who used manure were mainly those who had animals because the price
of manure is too high as opposed to that of fertilizer.

CONCLUSION

Improved production of kale is possible if and only if the economic returns to the farmer are
improved, seeds from companies are given specific standards to meet and pest and disease
management strategies that are cost effective are availed to the farmers. Collaboration among
all concerned parties should be ensured.




                                              158
Appendix 6
Visit to Kenya for Stakeholders Workshop and field visit to Nyathona to observe virus
diseases of Brassica and spinach

FILE NOTE
(Visit Number VS)


Visit to Kenya for Stakeholders Workshop and field visit to Nyathona to observe virus
diseases of Brassica and spinach


N J Spence and D M Teverson


File circulation                Loose copy                       Separate copies
1. Prof. R J Cooter             1. Dr R Hillocks                 1. Dr S Eden-Green
2. Dr N J Hayden                2. Richard Lamboll               2. Prof. J M Lenne
                                                                 3. Dr N J Spence



Background


1. The project ZA0376 “Management of virus diseases of vegetable crops” has been accepted
by NRInternational for DFID funding pending signing the contract.

2. Virus diseases of Brassica crops are widespread in PU vegetable production in Kenya but
it is not known how significant yield losses might be. The proposal aims to develop improved
methods for the control of virus diseases, in particular CaMV and TuMV in brassica crops in
the PU vegetable systems being studied within the PU vegetable project cluster in Kenya.
Virus control is to be achieved through identification of virus-resistant germplasm, cultural
control methods to reduce virus incidence and spread, and improved vector control. The NRI
contribution to the project will focus on farmer perceptions and practices that will be assessed
in relation disease management.

3. A stakeholders’ workshop was held in Nairobi at KARI NARL, with a visit to Nyathona
to observe virus diseases of Brassica and spinach. It was the first opportunity for all the
stakeholders to discuss project activities in detail, both to plan and co-ordinate activities.



                                                159
 Objectives

 •    To introduce project stakeholders to each other and encourage co-ownership of the
      project.
 •    To systematically discuss each of the project activities in detail and finalise i) what should
      be done, ii) how it should be done and iii) who should do it. As this project is part of a PU
      cluster it was also important to establish how the project activities could complemet the
      other projects.
 •    Some project stakeholders visited Nyathona to observe virus diseases of Brassica and
      spinach and to start survey and collection of virus infected samples.


 Activities and Achievements
 Drs Nicola Spence and Dawn Teverson had meetings with key CABI and KARI to discuss
 progress and finalise plans for research activities. They visited the NHRC at Thika to discuss
 location of the screenhouses for on-station trials and visited Nyathona to observe virus
 diseases of Brassica and spinach and start collection of samples infected with viruses.


 Itinerary
 Sat 19 Feb 2000         Leave UK for Nairobi, Kenya
 Mon 21 Feb 2000         All day meeting with project stakeholders
 Tues 22 Feb 2000        Maating with CABI/KARI virologists, visi to NHRC, Thika
 Weds 23 Feb 2000        Visit farmers’ fields at Nyathona, wrap up session at CABI
 Weds 23 Feb 2000        PM travel to Entebbe, Uganda
 Workshop participants
Valerie Palapala          KARI,NARL, Box 14733, Nairobi
Z M Kinyua                KARI, NARL, Box 14733, Nairobi
M J Otipa                 KARI, NARL, Box 14733, Nairobi
J N Kung'u                KARI, NARL, Box 14733, Nairobi
D Steverson               NRI,UK
George Oduor              CABI-ARC, Box 633,Village Market, NBI
Nicola Spence             HRI, UK
Sarah Simons              CABI-Africa Regional Centre, NBI
G N Kibata                KARI – NARL, Box 14733, Nairobi
Beryn A.O.                CABI-ARC, Box 633,Village,Market,NBI
Peter K Karanja           CABI-ARC, Box 633,Village Market, NBI
Leonard Oruko             CABI-ARC, Box 633,Village Market, NBI
Beth Waithaka             KARI, NHRC, Box 220, Thika
Ruth Amata                KARI, NARL, Box 14733, Nairobi
S G Muigai                KARI, NHRC, Box 220, Thika

                                                 160
Appendix 7
A survey of vegetable (Brassicas) viral diseases in the peri-urban systems
Valerie Palapala, March 2000
Visits were made to various peri-urban farms and viral diseased brassicas (kale, cabbage and
cauliflower) collected. For each vegetable type, viral diseases symptoms on the collected
samples were recorded, the percent virla incidence in each brassica crop estimated and each
sample designated a specific collection number (Table 1). Other vegetables and crops grown
on the farms were also recorded. Generally viral disease symptoms were observed in all types
of vegetables for example coriander, Capsicum, tomatoes and Cucurbita. Tomato leaf curl,
leaf roll and mottling incidences were unusually high in Nyeri with some farms recording
100% infection.

In the field, infected plant leaves with classical virus symptoms were placed between two
moist filter papers and stored in a cool box. In the laboratory each sample was divided into
two. One portion was placed in tubes containing fused calcium chloride to dry. The second
portion was homogenised in 2-3ml of 1% di-potassium hydrogen phosphate buffer containing
0.1% di-sodium sulphite solution. The resultant supernatant was divided into three portions,
placed in microcentrifuge tubes (1.5ml) and stored at -40°C in a freezer. Inoculations were
carried out using viral suspensions prepared by placing 20μl in 0.5ml distilled water.
Ordinary “scotch brite” was used as an abrasive to aid in application of the viral suspension
onto leaf surfaces. Isolate used for inoculation purposes included:1, 5, 9, 12, 13, 15, 18, 21,
26, 29, 32, 34, 35, 38, 39, 41, 43, 45, 46, 47, 49, 51, 53, 54, 59, 61, 62, 65, 67, 69, 72, 75, 77,
78, 79, 82, 84, 90, 91, 93, 97, 99, 102.




                                               161
Table 1        Summary of a survey of Brassica oleracea (cabbage, kale and cauliflower) viruses in the peri-urban farming system

Farm                 Sampling site   Symptoms observed and estimated % viral disease incidence                                   Other crops grown on farm
Farm 1 – Mr Chacha   Nyathona        Kale: 70% incidence on 2 month old local kale variety. Vein clearing, mosaic, leaf          Pepper, cabbage, maize, spinach
                                     curl, severe chlorosis and leaf distortion. Severe DBM and Brevicoryne infestation          (nursery), potatoes, lettuce, cauliflower
                                     (#1); 1 month old seedlings were chlorotic, had vein clearing, stunted (#2); #3 and #4      (seed bed), coriander and beans
                                     had vein clearing, chlorosis and Brevicoryne.
                                     Cabbage (Gloria F1): Chlorosis, vein clearing (#5)
Farm 2     –   Mrs   Nyathona        Spinach: 90% incidence. Severe chlorosis & mottling (#6); #7 was chlorotic                  Coriander, spinach, onions, cauliflower
Gathura                              Kale: Chlorosis & vein clearing (#8 & #9).                                                  & lettuce
                                     Cabbage: 70% incidence. Vein clearing, chlorosis, purpling of vein ends (#103).
                                     Cauliflower: 60-70% #104 leaf distortion, vein distortion & clearing, severe chlorosis,
                                     Brevicoryne. #105 leaf distortion and mosaic. #106 leaf distorion, necrosis, chlorosis &
                                     vein clearing. #107 leaf distortion reduced leaf size, necrotic spots, severe chlorosis
                                     and Brevicoryne.
Farm 3 – Mr David    Nyathona        Local kale variety: 60% incidence. #10 was Brevicoryne infested, chlorotic, mosaic          Bananas, napier, onions, mangoes,
Karuga                               and leaf distortion; #11 was chlorotic, vein clearing, mosaic and slight leaf distortion;   spinach, lettuce, coriander & cauliflower
                                     #12 mosaic, vein necrosis & chlorosis. #111 & 112 – clean samples amongst viral             (in seedbed)
                                     infected plants.
                                     3 month old cabbage: vein clearing, chlorosis and Brevicoryne (#13)
                                     Coriander (3 weeks) chlorosis, rosetting, vein clearing & stunting.
                                     Cauliflower: less than 5% incidence in the seedbed. #108 & #109 both had chlorotic
                                     spots. #110 severe chlorosis and vein clearing.
Farm 4 – Mungai      Nyathona        Cabbage: 50% incidence. #15 chlorosis, leaf distortion & vein clearing; chlorosis, leaf     Peppers (100% viral ioncidence),
Kuria                                distortion and Brevicoryne infested (#16).                                                  spinach, coriander, onions, bananas &
                                     Kale: 70% incidence; #17 – severe Brevicoryne infestation, leaf distortion, chlorosis,      lettuce
                                     vein clearing; #18 – mosaic, narrow leaf and chlorosis; #19 – severe leaf distortion,
                                     \brevicoryne, chlorosis & vein clearing.
Farm 5 – Geoffrey    Kinale          Cabbage: 10% incidence; #20 had leaf distortion and chlorosis DBM and Brevicoryne           Spinach, carrots & potatoes
Njoroge                              infested; #21 – vein clearing, chlorosis and leaf distortion.
                                     Kale: 60% incidence; #22 – leaf distortion, vein clearing & chlorotic. #24 – leaf
                                     purpling & distortion, chlorosis & Brevicoryne infested. #24 – chlorosis, mosaic, vein
                                     clearing & reduced leaf. #25 – Brevicoryne infested, leaf distortion & chlorosis. #26 –
                                     leaf puckering & distortion, chlorosis, vein clearing & Brevicoryne infested.

                                                                                    162
Table 1 contd          Summary of a survey of Brassica oleracea (cabbage, kale and cauliflower) viruses in the peri-urban farming system

Farm                   Sampling site    Symptoms observed and estimated % viral disease incidence                                   Other crops grown on farm
Farm 6 – Gilbert       Kinale           Cabbage: less than 10%; #27 – chlorosis, vein clearing & leaf distortion; #28 – stunted,    Leeks, kale, onion, spinach, carrots,
Mwangi                                  leaf distortion & slight chlorosis; #29 – slight purpling, chlorosis & slight leaf          cabbage & potatoes
                                        distortion.
                                        Kale: distorted leaf, yellowing, vein clearing and Brevicoryne infested (#30). #31 – leaf
                                        chlorosis, stunted vein clearing and DBM infested. #32 – severe chlorosis, vein
                                        clearing & leaf distortion. #33- chlorosis, vein clearing & Brevicoryne infested.
Farm 7 – Paul          Kinale           Cabbage: less than 1% viral infection. Significant cabbage ringspot infection (with         -
Macharia Muigai                         many local necrotic lesions). Generally a very healthy crop. #34 – vein clearing and
                                        chlorosis. #36 – chlorosis, leaf distortion & slight Brevicoryne infestation.
                                        Kale: 5% incidence. Many DBM adults. #35 – chlorotic.
Farm 8 – James Njagi   Mwea             Kale (1000 headed) intercropped with beans; 30% incidence. #37 – chlorosis, reduced         Maize, pigeon peas & beans.
Thiaka                 (Kimbamba)       leaf, severe DBM infestation and leaf distortion. #38 – mosaic, distorted leaf &
                                        chlorosis & severe DBM infestation.
Farm 9 – Francis       Mwea             Kale: 20% incidence. Severe DBM infestation, chlorosis, swollen veins, vein clearing        Maize, bananas & onions
Kireri                                  & distorted veins (#39). #40 – chlorosis & yellowing.
Farm 10 - Mungai       Embu             Cabbage Gloria F1 variety: 60% incidence. Head distorted, chlorosis, leaf severely          -
                                        distorted, leaf puckering & vein clearing (#41). #42 – Brevicoryne infested, chlorosis,
                                        vein clearing, necrotic spots.
                                        Kale: 30% incidence. #43 – distorted leaf, marginal chlorosis & chlorotic spots on the
                                        leaf. #44 – chlorotic spots, DBM infestation.
Farm 11 – Kamuithi     Embu             Kale: 50% incidence. Severe leaf distortion, vein clearing, chlorosis & Brevicoryne         Papayas, arrowroots, maize & cane.
Mwinyi                                  infested (#45).
                                        Cabbage: 70% incidence. #46 – chlorosis, leaf distortion, vein clearing, chlorotic spots
                                        on the leaf.
Farm 12 - Murimi       Mwea West        Cabbage (Copenhagen): 30% incidence. #47 – severe DBM infestation, yellowing, leaf          French beans, cane & sorghum.
                       (Riambogo)       defoliation, vein clearing, Brevicoryne, Lipaphis and DBM infestation.
                                        Kale: 60% incidence. Distorted leaf, mosaic & chlorosis (#48). #49 – severe chlorosis,
                                        reduced leaf surface & yellow striping.

                                                                                       163
Farm 13 – Elijah       Giachia (Ndia    Tomato: 100% leaf roll incidence.                                                          Bananas, coffee, tomato & maize
Njogu                  division)        Kale: #51 – foliar chlorosis.
Farm 14 – Samuel       Kaitheri         Kale: severe DBM attack, Brevicoryne, Lipaphis, Myzus, chlorosis & vein clearing.          Coffee, tomato, spinach, bananas &
Mugo                   (Kerugoya –      #53 – severe DBM, Myzus, Lipaphis, vein clearing & chlorosis.                              carrots.
                       Kirinyaga)


Table 1 contd          Summary of a survey of Brassica oleracea (cabbage, kale and cauliflower) viruses in the peri-urban farming system

Farm                   Sampling site    Symptoms observed and estimated % viral disease incidence                                  Other crops grown on farm
Farm 15 – Muchina      Mathira          Kale (collard): 95% incidence. #54 – mosaic, chlorosis, vein clearing. #55 – chlorosis,    French beans, cane, tea & tomato.
Karong’o               (Nyeri)          Myzus, Brevicoryne. #56 – chlorosis, vein clearing, Myzus & Brevicoryne. #57 – leaf
                                        purpling (marginal).
Farm 16 – Kiruiru wa   Karatina         Kale: 70% incidence. #58 & 59 – chlorosis, reduced leaf surface, vein banding,             Bananas, maize, cane & peppers.
Kamuyu                                  Brevicoryne & DBM infested.
                                        Cabbage: 95% incidence. #60 – chlorosis, vein clearing, leaf distortion, Brevicoryne,
                                        Lipaphis, Myzus, chlorosis, yellowing and vein clearing.
Farm 17     –   John   Guti (Karatina   Cabbage – Gloria F1: 100% incidence. #62 – distorted leaf, chlorosis, DBM &                Bananas
Maina                  – Mathira)       Lipaphis infested. #64 – chlorosis & Brevicoryne infested.
                                        Cucurbita: #63 – chlorosis, vein clearing & mosaic
Farm 18                Giti (Karatina   Cabbage Gloria F1: small sized leaf and chlorosis (#65). #66 – chlorosis, distorted leaf   Carrots, peppers.
                       – Mathira)       & DBM infested.
Farm 19 – Dr Maina     Kamuyu       -   Cabbage: #67 – chlorotic & severe DBM infestation. #68 – chlorotic spots & severe          Papayas, bananas.
                       Nyeri            DBM attack.
                                        Pepper: 80% incidence. Leaf puckering & curling (#69).
Farm 20 – Kinguru      (Kibirigwi)      Kale: 50% incidence. #70 – vein clearing, distorted veins, chlorosis, Brevicoryne and      Maize, spinach & tomato.
Gatimbia                                DBM. #71 – yellow spots & chlorosis. #72 – chlorosis, distorted leaf & vein clearing.
                                        #73 – Brevicoryne, distorted leaf, chlorosis & vein clearing.
Farm 21 – Francis      “”               Kale: 40% incidence. #74 – vein chlorosis & Myzus. #75 – leaf curl, chlorosis, leaf        Tomatoes & beans.
Kamungu                                 distortion & Myzus.
Farm 22                “”               Kale: 10% incidence. #76 – chlorosis, veinal clearing & Myzus attack. #77 – Lipaphis,
                                        vein clearing & chlorosis.
Farm 23     –   John   Mukuha           Kale interplanted with cabbage. #78 – vein clearing & chlorosis.
Kimiti                                  Cabbage: chlorosis, vein clearing, severe DBM & Myzus attack (#79).
                                        Tomato: leaf curl, distorted leaf (#80).
                                                                                      164
Farm 24: Gachero                        Kale: 40% incidence. #81 – vein and leaf chlorosis, DBM. #82 – leaf puckering               Spinach, bananas, onions, maize,
(Gachoka Ltd.)                          (varietal), Myzus and veinal purpling.                                                      potatoes, cowpeas & sweet potatoes
                                        Cabbage: 80% incidence. #83 – yellowing, Brevicoryne & Myzus. #84 – slight
                                        marginal & veinal chlorosis.
Farm 25     –   Mary   Gatanga          Kale: #85 – vein chlorosis & mosaic. #86 veinal chlorosis, yellowing, leaf distortion &     Maize & cane
Njoka                                   purpling.
                                        Sweet pepper: #87 – chlorotic patches & mosaic. #88 – severe leaf distortion, leaf
                                        mottling & leaf curl.


Table 1 contd          Summary of a survey of Brassica oleracea (cabbage, kale and cauliflower) viruses in the peri-urban farming system

Farm                   Sampling site    Symptoms observed and estimated % viral disease incidence                                   Other crops grown on farm
Farm 26 – Joseph       Karuri           Kale: 20% incidence. #89 – clean kale. #90 – veinal chlorosis & purpling &                  Sunflower, tomato, bananas, capsicum,
Maweru Kariuki         sublocation      Brevicoryne.                                                                                onions & roots
                       (Mangu           Cabbage: 50% incidence. Chlorosis, Brevicoryne (#91).
                       location)
Farm 27 - Momanyi      Ngong’           Kale: 20% incidence. #92 – veinal chlorosis. #93 chlorosis, vein purpling, distorted leaf   Tomatoes, oranges
                                        & slight DBM infestation. #94 – vein clearing & chlorosis. #95 – severe leaf distortion,
                                        chlorotic patches & vein clearing.
Farm     28    –John   Kiserian         Kale: 80% incidence. Chlorosis & vein clearing (#96). #97 – vein clearing & chlorosis.      Tomatoes
Kamau                                   #98 – severe DBM infestation, chlorosis & vein clearing.
Farm 29 – Simon        Kiserian         Kale: 60% incidence. #99 – localised chlorosis & vein clearing. #100 – foliar chlorosis     Tomatoes, bananas,     french   beans,
Mang’ehi                                & Brevicoryne infested. #101 – chlorosis.                                                   mangoes & onions.
Farm 30 – Bernard      Athi RIver       Kale (a very old crop): 20% incidence. #102 – chlorosis and vein clearing. #103 & 104
Muthe                                   – chlorosis.
Farm 31 - Kabiero      Nyathona         Cauliflower: 100% viral incidence. #113 – reduces leaf size, vein clearing, chlorosis,      Cabbage, kale & peppers.
                                        leaf distortion. #114 – severely distorted, severe chlorosis, vein clearing &
                                        Brevicoryne. #115 – severely distorted, reduced leaf size, severe chlorosis & vein
                                        clearing. #116 – chlorotic spots, slight vein clearing, chlorotic spots. #117 – mosaic &
                                        Brevicoryne.




                                                                                       165
Appendix 8

Internal Reports

Back to Office Reports
Spence NJ and Hughes SL. Visit to Kenya for project activities and field visits, 21 Oct – 28 Oct
2000 (Project No. ZA0376; R7571).

Spence NJ and Hughes SL Visit to Kenya for project activities and field visits, 8 April – 20 April
2001 (Project No. ZA0376; R7571).

Hughes SL Visit to Kenya for project activities and field visits, 3 November – 9 November 2001
(Project No. ZA0376; R7571).

Hughes SL Visit to Kenya for project activities and field visits, 8 December – 16 December 2001
(Project No. ZA0376; R7571).

Spence NJ and Hughes SL Visit to Kenya for project activities and field visits, 13 May – 17 May
2002 (Project No. ZA0376; R7571).

Phiri NA and Chacha D. Visit to HRI, UK for training, 7 – 26 July 2002 (ZA0376, R7571)

Quarterly Reports
Quarterly Report. 1 April 2000 - 3 June 2000.
Quarterly Report. 1 July 2000 - 31 September 2000
Quarterly Report. 1 October 2000 - 31 December 2000
Quarterly Report. 1 January 2001 - 31 March 2001

Project Progress Reports
Project Progress Report 1. 1 April 2001 - 30 September 2001.
Project Progress Report 2. 1 October 2001 - 31 January 2002.
Project Progress Report 1. 1 April 2002 - 30 September 2002.
Project Progress Report 1. 1 October 2002 - 31 December 2002.

Annual Reports
Annual Report 2000
Annual Report 2001
Annual Report 2002

PRA Reports
Oruko, L & Ndun’gu, B. CABI/KARI/HRI/NRI/University of Reading/IACR Rothamstead
collaborative project Final Socio-Economic Report for the Peri-Urban Vegetable IPM Thematic
Cluster, January 2001.

Wachira, S. Rural rapid appraisal on kale seed selection/in choice Kinale Division, Limuru
District, April 2001.

Njuki, J. Farmer perceptions of virus diseases of vegetables in Ruiru and Athi River., September
2002.




                                               166
Factsheets (see Appendix 9)
Hughes, SL, Phiri, NA, Chacha, C, Kuria, A Mwaniki, A, Achieng, B. Ndirangu, S, Simons, S,
Kibata G & Spence, NJ. Potential of self selection of seed of tolerant/resistant components of
land races of kale for disease management in Kinale.

Hughes, SL, Phiri, NA, Chacha, C, Kuria, A Mwaniki, A, Achieng, B. Ndirangu, S, Simons, S,
Kibata G & Spence, NJ. On-farm epidemiology and management of virus disease of Brassica
crops.

Research Highlights
Hughes, SL, Phiri, NA, Chacha, C, Kuria, A Mwaniki, A, Achieng, B. Ndirangu, S, Simons, S,
Kibata G & Spence, NJ (2001). Management of virus diseases of important vegetable crops.
Annual report.

Posters (see Appendix 9)
Spence, NJ, Hughes, SL, Nywandam, L, Briddon, RW, Bull, SE, Bedford I & Kibata, G An
emerging Begomovirus problem in tomato crops in Kenya. Abstracts of the 3rd International
Gemini Symposium, 24-27 July 2001. [Science, academic poster]

Hughes, SL, Phiri, NA, Chacha, C, Kuria, A Mwaniki, A, Achieng, B. Ndirangu, S, Simons, S,
Kibata G & Spence, NJ. Characterisation of viruses that infect vegetables in Kenya. AAB
conference, Advances in Plant Virology 17-19 April 2002, Homerton College, University of
Cambridge. [Science, academic poster]

Hughes, SL, Phiri, NA, Chacha, C, Kuria, A Mwaniki, A, Achieng, B. Ndirangu, S, Simons, S,
Kibata G & Spence, NJ. Towards managing virus infection of field vegetables in Kenya. BSPP
Presidential Meeting, Plant Pathology & Global Food Security 8-10 July 2002, Imperial College,
University of London. [Science, academic poster]

Anticipated publications in peer reviewed journals
Activity 1
• Identification of Beet mosaic virus in swiss chard in Kenya
• Characterisation of virus samples in peri-urban regions of Nairobi, Kenya
• The economic significance of viruses of Brassica crops and the effect of timing of virus
    infection

Activity 2
• Methods of protecting Brassica seedbeds from virus infection and their effect on reducing
    virus infection.




                                             167
References
CIAT, (1997). New frontiers in participatory research and gender analysis for technology
       development. Proceedings of an International Workshop 9-14 September 1996, Cali,
       Colombo.

Genstat 5 Committee of the Statistics Department, Rothamsted Experimental Station (2000).
        "Genstat 5, Release 4.2 Reference Manual". Oxford: Numerical Algorithms Group

Guthrie, EJ (1978). Measurement of yield losses caused by maize streak disease. Plant Disease
         Reporter 62, 839-841.

Hughes, SL (2001). Interation of Turnip mosaic virus (TuMV) with members of the
       Brassicaceae. Thesis, University of Birmingham.

Jenner, CE & Walsh, JA (1996). Pathotypic variation in turnip mosaic virus with special
        reference to European isolates. Plant Pathology 45, 848-856.

Jenner, CE, Keane, GJ, Jones, JE and Walsh, JA (1999). Serotypic variation in turnip mosaic
         virus. Plant Pathology 48, 101-108.

Njuki, J (2002). Interim report of the socio-economic activities for the vegetable virology project.

Oruko, L & Ndungu, B (2001) Final Socio-Economic report for the Peri-Urban Vegetable
        IPM cluster. CABI/KARI/HRI/NRI/\University of Reading/IACR Rothamsted
        Collaborative project.

Seif, AA (1982). Effect of cassava mosaic virus on yield of Cassava. Plant Disease Reporter
        66, 661-662.

Spence, NJ (1999). Survey of viruses of vegetable crops in the peri-urban production system of
        Kenya. Final Technical Report for DFID CPP Project ZA0272.

Wachira, S (2001). Rural rapid appraisal on kale seed selection/in choice Kinale Division,
        Limuru District.

Walkey, DGA & Webb, MJW (1978). Internal necrosis in stored white cabbage caused by
        turnip mosaic virus. Annals of Applied Biology 89, 435-441.

Walsh, JA (1989). Genetic control of immunity to turnip mosaic virus in winter oilseed rape
        (Brassica napus ssp. Oleifera) and the effect of foreign isolates of the virus. Annals of
        Applied Biology 115, 89-99.




                                                168
Appendix 9



Disseminations


On-farm epidemiology and management of virus diseases of Brassica crops (Factsheet)


Potential of self selection of seed of tolerant/resistant components of land races of kale for
disease management in Kinale (Factsheet)




POSTERS:
An emerging begomovirus problem in tomato crops in Kenya


Characterisation of viruses that infect vegetables in Kenya


Towards managing virus infection of field vegetables in Kenya




                                             169

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:10
posted:9/2/2011
language:English
pages:177