APPENDIX

W
Shared by: huanghengdong
Categories
Tags
-
Stats
views:
10
posted:
8/18/2011
language:
English
pages:
18
Document Sample
scope of work template
							APPENDIX
        Level 1: Inheritance, X-linkage, change over one generation
Learning Goals & Objectives

Between the laboratory exercise and the associated lectures, the students will
    set up control white-eyed fruit fly populations and experimental ones with a "mutant"
      red-eyed male added.
    directly observe greater activity and mating success of the red-eyed male.
    identify that, as a result of the red-eyed males greater mating success, the red-eye variant
      (allele) is more abundant in the next generation: a personally observed case of "evolution
      by natural selection."
    hear about other examples of natural selection relevant to them, such as the reason we
      need yearly influenza vaccines and the spread of lactase persistence in ancient humans.
    understand X-linkage, in part by seeing that none of the offspring males have red eyes
      even though most of the females do.

Materials

         Drosophila, wild-type
         Drosophila, sex-linked white-eye
         Culture vials with plugs and labels
         Culture media
         Sorting Brushes
         Method of anesthesia (CO2 or Flynap®)
         Magnifying glasses or stereomicroscopes
         Marking pens
         PowerPoint lectures (available online) and projector

                Materials Available from Carolina Biological Supply (www.carolina.com)

Levels 1 & 2                                                             Quantity needed      Item
                                                                           for 6 groups     Number
Natural Selection with Drosophila Kit includes below items plus          1                 171995
Teacher Manual and Student Guide
Drosophila, sex-linked white eye (not sexed)                             1                 172220
Drosophila, wild-type (not sexed)                                        2                 172100
Carolina Drosophila Kit (Flynap(R), 72 vials, 72 plugs, media, labels,   1                 173052
transfer cards)
Sorting brushes (12)                                                     1                 173094
                                              Optional Materials

Easy Fly Drosophila, sex-linked white eye (females only)                 1                 172633

                                                                                                     1
Drosophila Stand, Pack of 3                                             2                   173030


Preparation

Materials can be ordered from any science supply company, or can be purchased in a package or
individually at Carolina Biological Supply. Directions remain the same unless otherwise noted.
Before beginning, it may be helpful to view the Genetics Educational Videos on fly culture if
you are unfamiliar with handling Drosophila
(http://www.carolina.com/category/life+science/genetics.do). Minimal advance preparation is
needed for this exercise beyond obtaining the materials. However, the laboratory exercise
proceeds more efficiently and with greater clarity for the students if the teacher separates the
flies ahead of time by sex (see Carolina Biological Drosophila manual for pictures), using the
FlyNap anesthesia following the manufacturer's recommendations. It is easiest to sex flies when
the flies are on their backs (wings against the table). To reduce mortality, it is important that the
teacher minimize exposure of the flies to the FlyNap anesthesia: immediately removing the
"wand" when the flies have become nearly motionless, and dumping the flies immediately onto a
piece of paper for sorting. Even if the flies are moving a little, they are unlikely to fly away, so
the teacher should immediately begin separating them, and not use the same plug that may have
come in contact with the FlyNap anesthesia. If there is access to CO2 anesthetization facilities
for Drosophila, these can be used more safely than FlyNap, resulting in less fly mortality.

We recommend that the teacher set up two culture vials with fly food for each student group the
day before the exercise. The dry food (Formula 4-24 Medium) is mixed with water in the culture
vial as per the instructions that come with it. Be careful not to add too much water, as the flies
will drown. For experimental groups, one of the culture vials should have five white-eyed males
and one red-eyed male. For control groups, the vial should just have five white-eyed males. For
all groups, the other culture vial should house five virgin white-eyed females (OR five Easy
Fly™ white-eyed females). It is VERY IMPORTANT that the female flies be virgins (never
mated to another fly). When one receives flies from whichever company you ordered from, you
typically receive a vial of adult flies and a vial of larvae. It is highly probable that the adult flies
have already mated and are no longer virgins. Hence, you must wait for flies to begin emerging
from the vial of larvae. When flies begin to emerge, you must be vigilant. The easiest way to
collect virgins is to clear the vial of all adult flies in the late afternoon (by releasing adults
outside or into a fly “morgue”, a bottle filled with ethanol), so that the vial contains no adults.
The following morning, separate out sexes, as above, placing the females in a separate vial and
keeping the males in another vial (Note: this is an ideal time to use CO2 rather than FlyNap, if
available). These females will all be virgins (time to sexual maturity is as short as 8 hours, but
flies typically do not emerge overnight, so those collected in the morning will be fine). Virgin
collection is not necessary if you order the Carolina Biological Easy Fly Drosophila because
these flies will all be female. If you wish to skip the virgining step, you may still purchase the
Natural Selection with Drosophila Kit, but you must additionally order the Easy Fly Drosophila.




                                                                                                      2
By setting these up ahead of time, the students can put the adult flies together without applying
the FlyNap anesthesia, and they are more likely to observe greater activity and mating success of
the red-eyed male directly. In setting up, though, the teacher should not put the blue caps on the
vials- they're a pain with no added gain at this stage.

During the experiment, between day 1 and day 21, the teacher should monitor the vials. If they
appear to be drying out, then a squirt or two of water should be added using a plastic squirt bottle
or syringe. Again, use caution when adding water so as to avoid overwatering and causing the
flies to drown. When the food appears "soupy" and there are many larvae present, the teacher can
remove the adults- they can be killed or set free outside (they'll almost certainly die within a day
or so, and there are no environmental consequences).

Day 1: Crossing the Flies and Observing

After a brief presentation about inheritance and natural selection, students are set up in pairs or
groups and given two vials of flies- one with males and one with females. They should label
their vials (preferably on label tape) with their names so students can get their own vials back the
next day. They are directed how to gently tap all the flies (but not the media) from one tube into
the other. It's helpful if the teacher, teacher's aid, or someone with experience stand over the
students when they do this- the procedure should be to tap the two vials upright simultaneously
and gently on a book three times, have the partner quickly pull both plugs off the vials, gently tap
one more time on a book, and invert one vial such that the mouth of that vial is touching the
mouth of the other vial. The students should tap two more times gently, and then quickly place
the cap on the lower vial now housing all the flies. Common problems students encounter at this
stage are:

1) panicking and freezing after the plugs are removed (at which point the flies start to fly out),
2) hitting the vials too hard on the surface, causing the media to fall from the upper vial into the
lower vial (not a tragedy, but could potentially squish some flies), and
3) squishing some flies with the plug when putting it in the lower vial (again, not tragic).

Because of these common problems, and because this transfer of flies only takes a minute, we
recommend that someone stand over the student groups as they do this and facilitate, rather than
all the student groups doing this step simultaneously. Also, having extra vials of males and
females on hand is a good precaution. If one or two of the white flies escape or are squished, the
exercise can still proceed, but if the red-eyed male is lost, then a substitute vial is needed.

After fly transfer, the students should put the vial down on its side on a white piece of paper, not
manipulating it further, and be instructed to just watch the flies inside. The teacher should show
a picture of males and females, and describe that the male typically have "black butts" whereas
the females have white, more rounded, abdomens. Ask students to look specifically for any
differences in activity of the red-eyed male over the white-eyed males. In many cases, students
will observe courtship (such as the male extending one wing and vibrating it from behind the
female) or even copulation. Typically, the red-eyed males will be the most active and most
likely to mate given their better vision. In this regard, the red-eye gene variant (allele) can be
thought of as a "beneficial mutation" in this experiment. At this point, the teacher can elect to

                                                                                                       3
show students online videos of fly courtship. Each species has a species specific “song” and
dance that can be seen and heard in these videos:

       http://www.youtube.com/watch?v=KzWIuhXMUko
       http://www.biology.duke.edu/noorlab/song.html

This can be used as a demonstration of sexual selection and animal behavior, as seen in many
birds and mammals!


Day 2: The Next Generation (perhaps 14-21 days after day 1)

The teacher begins with a recap of the concepts of natural selection, what was done in the first
day of the exercise, and asks the students to guess what they may observe in today's laboratory.
The next-generation flies are then distributed to the students. The students anesthetize the flies
using FlyNap and wait for them to be motionless for 2 minutes. VERY IMPORTANT: the
vials should be left on their sides and not manipulated after the FlyNap wand is inserted. If the
vial is placed standing up, the anesthetized flies will get their wings or bodies stuck in the media
and will be very difficult to take out of the vial. The wand can be left in for as long as needed:
it's OK if the flies die. However, if some flies are still moving slightly, they will probably not
fully wake up and fly around during the class exercise, so again, students should not panic.

On a white piece of paper, the students designate four quadrants as "white male", "white female",
"red male", and "red female", and the flies are then poured onto the paper and sorted into the four
categories. (It's OK if some flies are left behind in the vial, so long as at least ~12 flies pour out.)
The flies can be manipulated with a very fine paintbrush, pencil, or even with just the students'
fingers.



                                       Red ♂        Red ♀


                                       White ♂      White ♀




Because of the X-chromosome linkage of the eye color gene, none of the males will have red
eyes. However, because of the greater mating success of the red-eyed male in the previous
generation, many of the offspring females will have red eyes. After sorting, the students should
determine the percentage of females with red eyes and percentage of males with red eyes (0).
The teacher will then give a presentation about the expectation, if there was no natural selection,
was that 1/11 (9%) flies should have had red eyes. Hence, the students have observed
evolution by natural selection before their very eyes: the abundance of the red eye allele has


                                                                                                      4
changed! The teacher then discusses evolution more broadly (it is merely "change through time,
over generation(s)"), and explains inheritance and why none of the males could have red eyes.

Occasionally, an experimental group vial will have all white-eyed flies. Rather than an "error",
the teacher should use this example as instructive- ask the students why this may be an outlier.
Evolution by natural selection will not proceed identically in every replicate because random
events can happen. For example, while the red-eyed male may have had an advantage in vision
and activity, he may have happened to be ill or unlucky in other respects unrelated to his
genotype at the eye-color gene.

If a large proportion of vials have little to no red eyed flies, it is likely that there was an error in
the initial cross. This is not an ideal situation and is difficult to address. Reiterate that chance
events can happen, and perhaps the red eyed male in these vials escaped or died. Instead of
focusing the class attention on these vials, focus on the few vials where students did see an
increase in number of flies with red eye color.

After the exercise is completed, the flies can be collected into a single vial and flushed down the
toilet, or thrown away in the trash if the vial is capped. This can be done easily by creating a
funnel out of a piece of paper and pouring them back into the vial. Most of them will be dead
already given the heavier dose of anesthesia.



  Level 2: Inheritance, X-linkage, change over multiple generations
This exercise is nearly identical to the one above, but it allows the students to view evolution
over multiple generations. The alterations are minimal:

Day 1: Crossing the Flies and Observing
Students should set up two vials rather than one vial on day 1. Alternatively, if supplies are
limited, the teacher can set up an extra 2-3 vials for the entire class.

Day 2: The Next Generation (perhaps 14-21 days after day 1)
On Day 2, just some of the vials are anesthetized and scored by the students. Flies in other vials
are transferred to new media by the teacher and allowed to continue to reproduce, though the
teacher should wait until there are at least ~20 flies (and clearly some of each sex) before this
transfer. The teacher will need to label the vials with each transfer so students can be given the
direct descendants of the original flies with which they worked. Flies are flipped to new media
for a total of 4 generations (about 3 months). Each week, the teacher should monitor the vials for
dryness, adding water as needed. As before, when the media appears "soupy" and there are
many larvae present, the teacher can remove the adults.

Day 3: Change over multiple generations (approximately 2 months after Day 2)
At the very end, the descendants of the original flies are returned to the students to observe the
extent of change in abundance of the red-eye variant. Most of the flies of both sexes will be red.



                                                                                                           5
 Level 3: Full Version- Inheritance, X-linkage, change over multiple
                   generations, genetic hitchhiking

Learning Goals & Objectives

Between the laboratory exercise and the associated lectures, the students will
    achieve all the same goals and objectives as in Level 1 above.
    learn about and apply polymerase chain reaction (PCR) and gel electrophoresis for the
      purpose of understanding an evolutionary process.
    learn about physical linkage of segments on the same chromosome.
    demonstrate the molecular evolution concept of "hitchhiking" of alleles at other genes
      along with the spread of an advantageous mutation.

Materials
   Drosophila simulans w138 (white)
   Drosophila simulans w195 (white)
   Drosophila simulans C167.4 (wild type)
   Culture vials, plugs, and food (media) for Drosophila rearing
   Carolina Biological FlyNap® Anesthetic Kit: 173010
   (Optional but strongly preferred) CO2 anesthetization facilities for Drosophila
   "Squishing buffer" and proteinase-K for DNA isolation
   Equipment and reagents for polymerase chain reaction
           including oligonucleotides for "Near" and "Far" markers in Appendix
   Equipment and reagents for agarose gel electrophoresis
   Magnifying glasses
   Sharpie markers
   PowerPoint lectures (available online) and projector

                Materials Available from Carolina Biological Supply (www.carolina.com)

Level 3                                                                 Quantity needed   Item Number
                                                                          for 6 groups
A Drosophila Genetic Linkage Kit is in development at Carolina. Check
www.carolina.com for updates.
Drosophila simulans w138 (white)                                        1                 Coming soon
Drosophila simulans w195 (white)                                        1                 Coming soon
Drosophila simulans C167.4 (wild type)                                  1                 Coming soon
DNA Gel Electrophoresis Reagent Set (EtBr, TBE, loading dye, agarose)   1                 211300
Taq DNA Polymerase                                                      1                 211750
Deoxynucleotide Mix                                                     1                 211760
DNA ladder                                                              1                 211478
                                             Optional Materials
Carbon Dioxide Anesthetizer                                             1                 173034
Electrophoresis and PCR equipment are also available from Carolina.


                                                                                                   6
Teacher Advanced Preparation

This exercise is similar to the ones above, but it allows the students to view evolution over
multiple generations, experiment with molecular techniques, and learn concepts of molecular
evolution. The inclusion of the molecular component makes many changes necessary. Most
importantly, this exercise requires considerable advance preparation (must be started
approximately 8 weeks before planned class start date). It is set up as the exercises above, but
then includes 3 additional class periods for molecular work. Read Teacher Preparation for each
section for more advance preparation (especially note section on ordering primers at least one
week in advance). Just as in Level One, the supplies and directions are listed out so that you may
purchase or use supplies you already have. Kits are available at Carolina Biological Supply and
eliminate the necessity of making many of the solutions needed. If you order a kit, follow the
directions associated with it.

We highly recommend that you order your fly stocks through Carolina Biological Supply. This
exercise requires existing variability in the DNA sequence of the white eyed fly population, so
you need 2 independently derived white-eyed stocks (so you must order both strains of white-
eyed flies). This variability is most easily accomplished through an F2 cross between the strains
w138 and w195. The first generation cross should be between w195 females and w138 males, so
that the X-chromosome marker alleles from w138 (which match those of C167.4) are least
abundant and will show the greatest change. The second generation involves the flies mating
with their siblings, so the teacher merely has to flip the offspring of the first generation to a new
vial (without sexing or manipulation).

It is VERY IMPORTANT in the first generation cross that the female flies be virgins (never
mated to another fly). If the female is not a virgin, then she will most likely bear progeny of the
w195 strain. When one receives flies from the supply company, you typically receive a vial of
adult flies and a vial of larvae. It is highly probable that the adult flies have already mated and
are no longer virgins. Hence, you must wait for flies to begin emerging from the vial of larvae.
When flies begin to emerge, you must be vigilant. The easiest way to collect virgins is to clear
the vial of all adult flies in the late afternoon (by releasing adults outside or into a fly “morgue”,
a bottle filled with ethanol), so that the vial contains no adults. The following morning, separate
out sexes, as above, placing the females in a separate vial and keeping the males in another vial
or releasing them (Note: this is an ideal time to use CO2 rather than FlyNap, if available). These
females will all be virgins (time to sexual maturity is as short as 8 hours, but flies typically do
not emerge overnight, so those collected in the morning will be fine).

Depending on the size of your class, you will want many replicate vials of crosses. You should
attempt to set up at least 10 first generation crosses (w195 females and w138 males). You can
accomplish this by either ordering more vials of each stock, or by perpetuating your own stock.
If you choose the latter option, you may simply allow brother-sister mating, and so allow flies to
remain in the same vial until larvae appear. Instead of disposing of the adults, transfer them to a
fresh vial and repeat.


                                                                                                     7
Once you have set up your first cross (10 vials of w195 females and w138 males), flip the
offspring of these crosses to fresh vials. Allow brother-sister mating to occur in these new vials
(no virgins necessary). Expand the stock as stated above. It is ideal to start with 10-20 vials of
the second generation cross.

When the offspring of the second generation cross begin to emerge, you must once again
separate males and females, ensuring females are virgins. This is extremely important for the
experiment to run as desired. You should have enough for each pair or group to have one vial of
5 females and 1 vial of 5-6 males (depending on if the group is experimental or control). You
should designate 1 pair or group as a “control” group, this group will receive a vial with 5 white
eyed flies. For the “experimental” groups, you will need your stock of red-eyed flies (C167.4).
You will need to sex the C167.4 flies to obtain males (you do not need any females from this
stock). You must obtain enough males to place 1 red-eyed male in each vial with 5 males of the
second generation cross except the control. For each experimental group, you should now have a
vial filled with 5 virgin females (white eyes) and a vial of 5 white-eyed males and 1 red eyed
male. For the control group you should have a vial filled with 5 virgin females (white eyes) and
one vial of 5 white eyed males (no red eyed fly). All of these vials should contain food media.

The experiment now proceeds as in Level 2 (see Appendix instructions for Level 1 for more
details).

 Day 1 - Students should set up two vials rather than one vial on day 1. Alternatively, if supplies
are limited, the teacher can set up an extra 2-3 vials for the entire class.

Day 2 – On Day 2, just some of the vials are anesthetized and scored by the students. Flies in
other vials are transferred to new media by the teacher and allowed to continue to reproduce,
though the teacher should wait until there are at least ~20 flies (and clearly some of each sex)
before this transfer. The teacher will need to label the vials with each transfer so students can be
given the direct descendants of the original flies with which they worked. Flies are flipped to
new media for a total of 4 generations (about 3 months). Each week, the teacher should monitor
the vials for dryness, adding water as needed. As before, when the media appears "soupy" and
there are many larvae present, the teacher can remove the adults. Day 2 is optional. Instructor
can elect to complete activities of Day 2 after multiple generations instead of just 1 generation
(conduct on Day 3 before DNA extraction).


Day 3 – DNA Extraction

Teacher Advanced Preparation

Below are instructions for preparing the solutions needed for the students’ DNA extractions.

   1. Prepare squishing buffer (SB):

10mM Tris-HCl, pH 8.2                      100µl 1M Tris-HCl
1mM EDTA                                   20µl 0.5M EDTA

                                                                                                     8
25mM NaCl                                 50µl 5M NaCl
Dilute to 9.9ml with dH2O
This can be aliquoted and frozen for use.

2. Prepare proteinase-K solution (Pro-k):

0.02g Proteinase-K (Sigma P-6556)
0.6ml 10mM Tris-HCl, pH 7.6
 0.4ml glycerol
 Store at -20C.

Mix 49.5µl SB with 0.5µl proteinase-K solution per fly. Make a DNA extraction master mix by
multiplying these proportions by how many flies your class plans to prepare (8 flies per group x
the number of groups). From this DNA extraction master mix, aliquot approximately 400 ul (50
ul per fly) into small tubes (1-2 ml), one for each group. While the Squish Buffer and pro-K
solution can be prepared in advance, making the master mix of the combined SB and pro-K
should be completed just prior to class. Place the DNA extraction master mix on ice.

Reference for protocol: Gloor GB, Engels WR (1992) Single-fly DNA preps for PCR. Drosoph.
Inf. Serv. 71:148-149.


Materials for students
Fly nap
Their vial of flies
Magnifying glass
Tweezers / Brush
Strip tubes
Sharpie
Bucket of ice
Cold (not frozen) squish buffer mixed with Proteinase-K
Pipettor
Thermal cycler

Student Instructions

   1. After 4 generations, the descendants of the original flies are returned to the students to
      observe the extent of change in abundance of the red-eye variant. Students should
      anesthetize their flies and dump them on to a piece of paper, as in Levels 1 and 2.
      Students should record the number of flies in each category. Most of the flies of both
      sexes will be red.


   Red-eyed Males        Red-eyed Females         White-eyed Males       White-eyed Females




                                                                                                   9
   2. Now students must select 8 male flies to prepare for DNA Extraction. Students should
      select a representative sample of their flies (but make sure to include both white and red
      eyed males if possible).
   3. With tweezers or fingers, students should place one male fly into each well of the strip
      tubes (total of 8 flies, one in each of 8 tubes), noting the eye color on the provided
      handout and on the top and sides of the tube with a fine-tipped sharpie.
   4. With a 100 or 200 μl pipettor, students should pick up 30 μl of the Squish Buffer solution
      and, without ejecting, stab the fly repeatedly with the pipettor tip. They can eject a small
      amount of liquid to help squish the fly. Remind them not to press too hard – the tube or
      tip can break! After the fly is squished (~20 seconds), instruct the students to eject the
      remaining liquid over the fly.
   5. Repeat for remaining flies, but be sure to change tips between flies- NEVER put a used
      tip back into the Squish Buffer/pro-K solution. Red-eyed flies will produce a pink colored
      liquid, white-eyed flies will remain colorless. The body of the fly should be visibly
      disassembled.
   6. Keep on ice until all preps are done. When all done, place in thermal cycler for 37C for
      30 minutes and 95C for 2 minutes.

Questions for class discussion (with key):
What was the frequency of the “red-eye” mutation before the experiment?
The original frequency was 1/11 (one red eyed male and 10 white eyed males and females)

What is the frequency of the “red-eye” mutation now in the experimental group?
This is dependent on your class data. In our experience, this has been roughly 60%.

What has happened? Why?
One expects to see an increase in the frequency of red-eyed flies. The most accepted definition of
evolution is simply a change in allele frequency over time, and the class saw a change in the
frequency of the red eye allele, thereby witnessing evolution! The red eye allele was
advantageous because it allowed flies to see better, thus giving them a competitive advantage
over their semi-blind white eyed neighbors. This allowed them to find mates quicker and live a
healthier life.


O Day 4 – Polymerase Chain Reaction (PCR)

This step can be combined with Day 3 activities if time allows (need 2.5 hours). This step
assumes that the teacher or instructor has some experience with PCR, and so does not go into
detail regarding specifics not pertaining to this experiment. Today, students will conduct a PCR
(Polymerase Chain Reaction) using each of our 2 primer combinations. These PCRs will amplify
a particular segment- one pair amplifies a segment near the "white eye" gene, while another
amplifies a segment far away but on the same chromosome (X).

Teacher Advanced Preparation



                                                                                               10
To begin with, primers must be ordered from IDT (www.idtdna.com). The specifications for the
primers are listed below. Once ordered, the primers take approximately 2 days for delivery, but
order a week in advance to be safe.

Navigate to http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx.
In the text box, enter in the sequence listed for each primer. (For example, for NearSim1
Forward, enter “CTATATGTAAATCAATCTGCAAGCGCTAACTAAACG” into the text box).
Click Analyze.
It should show you the details of this primer (length and annealing temperature, etc.), which are
included below.
Click “Add to Order.”
Repeat for remaining primers (you should order a total of 5 primers: NearSim1 Forward and
Reverse and FarSim3 Forward, Reverse1 and Reverse2).

Near Primers
Primer pair to show reduced diversity from sweep at w: NearSim1
Forward primer: CTATATGTAAATCAATCTGCAAGCGCTAACTAAACG 36bp, 59.0C
Reverse primer: GTAGTCACTCATTCTAAAAACACATGGTAATTTTCCG 37bp, 59.1C

Extra information:
D. melanogaster genome position: 1,971,527
Expected sizes: C167.4, w138: 260bp; w195: 156bp




Far Primers
Primer triplet to NOT show reduced diversity from sweep at w: FarSim3
DsimFar3F: GAGTTGACTCGGTTGAAAATTCGCTAATAC
DsimFar3R1a:
GTAATTCGACCACGACGTTATCAACCGACCTAATCTAATAGTTCACCACCGAATATA
ATGTTAGTTAGA
DsimFar3R2: TAAAACGACCTAATCTAATAGTTCACCACCGAATATAATGTTAGTTTAC

Extra information:
D. melanogaster genome position: 17,159,762
Size difference: 20bp: 167+9 vs 167+29
Expected sizes: C167.4, w138: 176bp; w195: 196bp




                                                                                              11
When you receive your primers, you must prepare them by finding the number of nm on the
tube, multiplying this by two, and adding that many microliters of TE buffer. For example, if you
have 33.2 nm, add 66.4 ul of TE buffer. (You may order TE buffer, or prepare it yourself: 10
mM Tris, bring to pH 8.0 with HCl; 1 mM EDTA). Vortex the primer + TE solution thoroughly
to mix, then microfuge it (if you have a microfuge available). Otherwise, shake it so that the
liquid settles at bottom of tube. For your PCR, you will need to make a stock of diluted primer.
Simply add 998 ul of H20 to a small tube (1-2 ml), then add 2 ul of your primer. Freeze both
your original primer solution and your newly diluted primer solution until ready to perform PCR,
but remember, you will only use your diluted primer for the PCR.

The exercise proceeds most smoothly if the teacher prepares two master mixes of PCR in
advance. Do not start until you have received your primers!

Formula for PCR for Primer “NearSim1” (per reaction)
2 ul 10X PCR buffer (w/ 15 mM MgCl2)
2 ul 2 mM dNTPs
1 ul 10 uM NearSim1 Forward Primer
1 ul 10 uM NearSim1 Reverse Primer
0.3 ul DNA polymerase
12.7 ul H20

Formula for PCR for Primer “FarSim3” (per reaction)
2 ul 10X PCR buffer (w/ 15 mM MgCl2)
2 ul 2 mM dNTPs
1 ul 10 uM FarSim3 Forward Primer
1 ul 10 uM FarSim3 Reverse (R1) Primer
1 ul 10 uM FarSim3 Reverse (R2) Primer
0.4 ul DNA polymerase
11.6 ul H20


                                                                                              12
Create a master mix for each of the above, adjusted for the number of flies and with some room
for pipetting error. (For example, if you have 100 flies you would like to PCR, multiply each
number by 110. So 2 ul of buffer becomes 220 ul of buffer, etc.). Vortex to mix contents! If you
fail to vortex, it is highly likely that the PCR will not work.

Note: One can add all ingredients except for DNA polymerase and freeze until use. Add DNA
polymerase right before use (and vortex). Do not freeze master mix with DNA polymerase, it
will not work after this!

Directly before class, aliquot approximately 200 ul of Near PCR (with DNA polymerase) (total
volume of PCR, 19 ul, multiplied by number of flies per group, 8, plus a lot of room for pipetting
error) into small tubes (1-2 ml tubes), one for each group. Repeat for Far PCR. Put these on ice.

Materials for students
Strip tubes of DNA isolation from last class
2 strip tubes per group
Sharpie
Cold (not frozen) PCR Master mix for “near” marker w/ polymerase added just beforehand
Cold (not frozen) PCR Master mix for “far” marker w/ polymerase added just beforehand
Pipettors (one that can pipette volumes of 1 ul, one that can pipette volumes of 19 ul)
Thermal cycler

Student Instructions

   1. Have students label each set of strip tubes and their worksheet. One set of strip tubes will
      be for the “near” marker and one set will be for the “far” marker
   2. Vortex both tubes of master mixes
   3. Using a 20 μl pipettor, pipette 19 μl of PCR master mix for near marker into each strip
      tube well for the near marker. You can use the same tip for this step.
   4. Using a different tip, pipette 19 μl of PCR master mix for far marker into each strip tube
      well for far marker. Note if in this step or the preceding one whether you don’t have
      enough master mix. If that’s the case, then you may not have pipetted correctly. You can
      still fix it at this point, but call one of the teaching assistants over to look.
   5. Now you are ready to add your DNA! Using the 2 μl or 10 μl pipettor, pipette 1 μl of
      DNA from your DNA prep strip tubes to your master mix near marker strip tubes.
      Important: Use a different tip for each fly prep! Close the lid after you add a fly prep to
      remind you which you have already done. Make sure you have labeled everything and
      know which fly is going into which strip tube well. Cap the tubes tightly afterwards.
   6. Repeat with the same flies into the master mix for far marker strip tubes.
   7. Now the strip tubes will be put in the thermal cycler. Program: Step 1: 1 x (95C, 60 s),
      Step 2: 3 x (95C, 30s; 56C, 30s; 72C, 30s), Step 3: 3 x (95C, 30s; 53C, 30s; 72C, 30s),
      Step 4: 30 x (95C, 30s; 50C, 30s; 72C, 30s)
   8. Refrigerate samples after thermal cycler is complete until ready to run on gels


Class discussion (with key)

                                                                                               13
What is the purpose of PCR?

The purpose of PCR is to amplify a target region of DNA for downstream analysis. It allows you
to select a certain piece of the genome and copy it over and over so that you have enough DNA
to analyze it in meaningful ways.

What are the “ingredients” of the reaction?

A PCR must contain the following ingredients: Buffer, dNTPs, Forward and Reverse primers,
DNA polymerase, and water.

What will the product of the reaction be?

The product of the reaction is a greatly amplified amount of a targeted region of DNA. You
should have millions of copies of your desired region that you can now use for other analyses,
such as gel electrophoresis.


O Day 5 – Gel Electrophoresis

Assemble equipment necessary for gel electrophoresis. Kits can be ordered from Carolina
Biological Supply. During class, the students add their samples to a pre-made gel, run the gel,
and analyze the results. Due to time constraints, the teacher should prepare the gels before class
and the students can use class time to load and run gels.

Teacher Advanced Preparation
The teacher should prepare one 2% Agarose gel for each group.

Teacher Instructions
4g Agar
200 ml 1x TBE
5 ul Ethydium Bromide (EtBr) or Sybr Safe (preffered)

Add agar to a flask then add 200 ml of 1x TBE. Heat until large bubbles appear (this can be done
with Bunsen burner or in a microwave). Use caution, as this easily boils over. You must watch
the whole time. Remove from heat if starts to bubble over, swirl, then return to heat. It is done
when large bubbles appear. Add Sybr Safe or EtBr. Cool for 1 minute. Pour into casting tray, add
a 16 well comb, let cool for 30 minutes. When agar has set, remove comb and place casting tray
in gel rig and cover with TBE. The gel is now ready to add samples. Cover gel rig with foil until
ready for loading, as the Sybr Safe is light sensitive. Making the gels can be done x hours in
advance of class.


Student Materials
PCR strip tubes from last class
Gel electrophoresis equipment

                                                                                                 14
Loading dye
Ladder
Pippettor

Student Instructions

   1. Prepare samples by adding 4 ul of 10x loading dye into each well of strip tube. Close the
      lids and tap gently to mix.

   2. Add 11 ul of your molecular ladder in one well. Carefully add 11 ul of each sample from
      strip tubes into remaining individual wells of your gel. Label the placement of each
      sample on the worksheet (it is very important to keep track of which sample went into
      which well).

   3. PCR samples for Near markers should run for 35-45 minutes at 150 AMPS. PCR samples
      for Far markers should run for 60-75 minutes at 150 AMPS.

   4. Gels can be visualized using a UV light box (Or Gel Doc station if available).
      Alternatively, one can use a stain per manufacturer instructions.


O Day 6 – Analysis of results

Have students look at their gel printouts and answer the following questions as a class.



Class discussion (see below for example answers using the example data)

The initial allele frequencies were calculated experimentally, but could also be calculated simply
by knowing which strains carried which alleles in the initial cross. The teacher should use these
values for comparison with the students data. The asterisks indicate the allele that the red eye fly
introduced into the population carried at the near and far marker (High at Near, Low at Far).


               Initial Allele Frequencies

Experimental                     Control
*Near High: 29.3%                *Near High: 27.8%
Near Low: 70.7%                  Near Low: 72.2%
Far High: 61.4%                  Far High: 72.7%
*Far Low: 38.6%                  *Far Low: 27.8%




                                                                                                  15
Example Data

         Experimental Near Marker



                                                  High
                                                  Low




   R    R       R       R   W   W   W     W



            Experimental Far Marker




   R    R       R       R   W   W   W     W




                    Control Near Marker




    W       W       W       W   W   W     W   W


                                                         16
       W     W      W     W      W      W     W      W



    1. Is one allele “associated” with the red-eyed phenotype at near? How about at far?

At the near marker, one should expect to see an association of the high banded allele, as the red
eye male added at the beginning had this variant. As the red eye trait spread through the
population (selective sweep), the neutral variation nearby “hitchhiked” along with the eye color
gene. More explicitly, the high allele hitchhiked with the red eye color. At the far allele, there
should be random association. This is because the far marker is located at a distance from the red
eye allele and can be disassociated with eye color over time through the process of
recombination.

    2. Calculate the overall fractions of “high” vs. “low” at the near marker (don’t worry about
       eye color now) in experimental vs. control groups. Is it the same in the two groups?
       Why did it change (or not)?

In the experimental group above, there are 6/8 high alleles (2/8 low alleles) at the near marker. In
the control group there are 2/8 high alleles (6/8 low alleles). While it is difficult to tell from this
limited dataset, the control dataset should remain similar to the starting allele frequencies. The
experimental group should see an increase in the high allele frequency.

    3. Calculate the overall fractions of “high” vs. “low” at the far marker (don’t worry about
       eye color now) in experimental vs. control groups. Is it the same in the two groups?
       Why did it change (or not or not as much)?

In the experimental group above, there are 3/8 high alleles (5/8 high alleles) at the far marker. In
the control group, there are 4/8 high alleles (4/8 low alleles). While it is difficult to tell from this
limited dataset, the control dataset and the experimental dataset should have similar allele
frequencies.

                                                                                                      17
   4. Now repeat questions Questions 2-3, but this time noting eye color.

     Red-eyed flies                White-eyed flies
     *Near High: 100%              *Near High: 50%

     Near Low: 0 %                 Near Low: 50%

     Far High: 50%                 Far High: 25%

     *Far Low: 50%                 *Far Low: 75%



   5. What has happened overall in this demonstration?


Overall, we saw evolution by natural selection (change in allele frequency over time, or even just
change over time). We introduced an advantageous mutation (red eye color) into a population of
white eyed flies. Because the red eyed male had a fitness advantage, he was able to mate more
and pass on his genes to the next generation. Over three generations, this resulted in a large
increase of the number of red eyed flies in the population. At the molecular level, we witnessed
the molecular evolution phenomenon of a selective sweep and the hitchhiking of linked neutral
variants.

   6. Explain the process that occurred in the control and experimental populations with
      respect to the eye color mutation, the near marker, and the far marker.

In the control population, we started with all white eyed flies and ended with all white eyed flies.
There should be a random association of eye color and the high or low allele at both the near and
far markers. In the experimental population, we started with 5 white eyed females, 5 white eyed
males, and 1 red eyed male. At the end of three generations, we saw a large increase in the
proportion of flies that had red eyes (of both sexes). There should be an association of red eye
color at the high allele at the near marker and a random association at the far marker.



For questions regarding the procedures of this lab, please contact:

Caiti Smukowski, css25@duke.edu




                                                                                                 18

						
Related docs
Other docs by huanghengdong
ME6105_Homework_4
Views: 0  |  Downloads: 0
15-11-0500-00-004e-tg4e-minutes-sfo-july-2011
Views: 156  |  Downloads: 0
SandlerPresentation
Views: 0  |  Downloads: 0
Power Point Slides 1
Views: 185  |  Downloads: 0
PROF_P_Counselor
Views: 1  |  Downloads: 0
PCSEGeorgetownSchedule
Views: 1  |  Downloads: 0