Docstoc

Adaptation of Epithelial Sodium Dependent Phosphate Transport in

Document Sample
Adaptation of Epithelial Sodium Dependent Phosphate Transport in Powered By Docstoc
					       Adaptation of Epithelial Sodium-Dependent Phosphate Transport
  in Jejunum and Kidney of Hens to Variations in Dietary Phosphorus Intake

                                    K. Huber,*1 R. Hempel,† and M. Rodehutscord†
                                                        ¨
                *Physiologisches Institut, Stiftung Tierarztliche Hochschule Hannover, Germany; and †Institut
                       ¨      ¨                                               ¨
                     fur Ernahrungswissenschaften, Martin-Luther Universitat, Halle (Saale), Germany

ABSTRACT The objective of this study was to explore             mRNA expression studies by northern analyses. Plasma
the homeostatic response of jejunal and renal epithelia         Pi concentrations were additionally measured. The NaPi
regarding the inorganic phosphate (Pi) transport capacit-       II transporter mRNA could specifically be detected in
ies to variations in dietary total phosphorus (tP) supply       chicken jejunum and kidney. Functional parameters of
in hens. Adaptive processes were determined by quantita-        Na+-dependent Pi transport indicated that these trans-
tive measures of intake and excretion, Pi transport studies     porters were involved in chicken Pi transport across the
across brush border membranes, and semiquantitative             apical membranes of jejunal and renal epithelia. Increased
detection of sodium-dependent phosphate transporters            tP intake resulted in an increased overall tP excretion.
(NaPi II) based on mRNA expression in the jejunum and           Correlating individual data from all animals by linear
kidney. Twelve hens (4/group) were adapted to 3 tP              regression highlighted that the adaptive decrease of renal
feeding levels in a pair-fed manner (60 g/d): low P diet        Pi transport capacity and NaPi IIa mRNA expression was
with 0.073% tP, medium P diet with 0.204% tP, and high          associated with an increase in plasma Pi levels and re-
P diet with 0.343% tP. Excretion was measured during            sulted in a higher tP excretion. Jejunal Pi transport capac-
the last 5 d of a 16-d feeding period. After slaughtering,      ity and NaPi IIb mRNA expression did not react to varia-
jejunal mucosa and renal cortex were removed. Tissues           tions in dietary tP supply. In conclusion, the homeostatic
were used for 32P uptake studies in brush-border mem-           response was mainly based on the adaptive capacity of
brane vesicles by rapid filtration technique and NaPi II         the kidney in hens.
             Key words: hen, inorganic phosphate transport, kidney, jejunum, NaPi type II cotransporter
                                                                                        2006 Poultry Science 85:1980–1986


                    INTRODUCTION                                with functional and structural studies on inorganic phos-
                                                                phate (Pi) transport mechanisms in respective organs
  Balance studies with quantitative measurements of in-         mainly relevant for P excretion promise a more detailed
take and excretion of total P (tP) are difficult to interpret    view of P homeostatic processes in chicken. In chicken
with regard to the effects of variable supply of dietary tP     epithelia, the first step of Pi absorption is a secondary
on P homeostasis because excreta contain tP from feces          active, Na+-dependent process across the brush border
and urine in different proportions and different dietary        membranes in the small intestine and the kidney (Renfro
ingredients differ in P availability. Rodehutscord et al.       and Clark, 1984; Quamme, 1985). On molecular level, Na+-
(2002) studied the effects of supplementing an inorganic        dependent Pi transporters of the solute carrier (SLC) 34
P source to a low-P basal diet in hens and compared tP          family are detected in chicken kidney (NaPi IIa, SLC34A1)
flow at the terminal ileum with tP excretion. Whereas the        and in chicken small intestine (NaPi IIb, SLC34A2; Werner
prececal net absorption of supplemented tP in the small         and Kinne, 2001). Effects of dietary tP restriction on P
intestines was very high (90%), supplemented P was al-          homeostasis in chicken are not extensively studied with
most completely recovered in excreta in this study. Van         a combination of quantitative, functional and structural
der Klis et al. (1997) found that the prececal net absorption   approaches. Therefore, it was the aim of this study to
of supplemented tP in hens was 87%. These data suggest          explore the overall P balance, the jejunal and renal Pi trans-
that the kidney plays the dominant role in hens in the          port capacities and the expression levels of the regulatory
adaptation to variable P intake. However, the adaptive          important Na+-dependent Pi transporters at different P
capacities of intestines and kidney cannot separately be        feeding levels in hens.
examined in balance studies. Combining balance trials
                                                                           MATERIALS AND METHODS

  2006 Poultry Science Association Inc.
                                                                Diets, Animals, and Feeding
  Received March 20, 2006.
  Accepted May 4, 2006.                                           Three diets were used. The ingredients of the diets were
  1
   Corresponding author: korinna.huber@tiho-hannover.de         chosen to allow for a very low P concentration in the basal


                                                            1980
                                         EPITHELIAL PHOSPHATE TRANSPORT IN CHICKENS                                               1981
Table 1. Composition of the basal diet                                    Excreta were freeze-dried and ground through a 0.5-mm
Ingredient composition (%)                         Analyzed (g/kg)        screen prior to analysis. Samples of feed and excreta were
                                                                          hydrolyzed using H2SO4 and HNO3. Concentrations of tP
Rice flour (51.6)                                   Crude protein (206)
Dried sugar beet pulp (18.0)                       Crude fat (67)         and Ca were determined with an Inductively Coupled
Dried egg albumen (15.0)                           Starch (373)           Plasma Spectrometer (ICP-OES; JY 24, Jobin Yvon GmbH,
Soybean oil (5.00)                                 Sugar (21)             Grassbrunn, Germany) with details as given by Rodehut-
Sodium chloride (0.30)                             Phosphorus (0.73)
Premix1 (0.05)                                     Calcium (36)           scord and Dieckmann (2005).
Calcium carbonate2 (10.0)
   1
    Premix contained per kilogram: 29 g of Ca, 7.1 g of Mg, 1,200,000     Tissue Sampling
IU of vitamin A, 300,000 IU of vitamin D3, 4,200 mg of vitamin E, 650
mg of vitamin B2, 500 mg of vitamin B6, 200 mg of vitamin B1, 2,000          At the end of the experiment hens were slaughtered
mg of vitamin B12, 3,600 mg of nicotinic acid, 1,500 mg of D-calcium      conventionally. Blood was collected during slaughtering,
pantothenate, 100 mg of folic acid, 15,000 g of biotin, 6,000 mg of Fe,
5,100 mg of Zn, 500 mg of Cu, 62 mg of I, 20 mg of Se, 12,000 mg of       centrifuged at 600 × g at room temperature, and resulting
antioxidant.                                                              plasma was stored at −20°C until analyses. The gastrointes-
   2
    Calcium was provided either as limestone or as limestone plus re-     tinal tract was removed from the body cavity completely.
spective amounts of calcium phosphate.                                    Chymus samples were collected from the small intestines
                                                                          if available. Jejunum of hens was removed, cut open,
                                                                          washed in ice-cold saline, and shock-frozen in liquid N. A
diet (Table 1). Rice flour, ground sugar beet pulp, and dried              small piece of jejunum was separately dissected to isolate
egg albumen were the main ingredients with a presumably                   mucosa by scraping it off the underlying tissue for RNA
low P availability. Energy and all other nutrients were                   isolation. Kidneys were removed completely, were
contained at least at levels recommended by the Gesell-                   washed in ice-cold saline, and were also shock-frozen in
schaft fur Ernahrungsphysiologie (1999). In 2 other diets
         ¨      ¨                                                         liquid N. Tissues were stored at −80°C until analyses.
the tP contents were increased by inclusion of monobasic
calcium phosphate [Ca(H2PO4)2] at levels of 5 and 10 g/                   Determination of Plasma
kg at the expense of limestone. All ingredients with the                  and Chymus Pi and Ca Concentrations
exception of the variable ones were mixed in 1 batch to
ensure uniformity of the mix. This mix was divided in                       Plasma and chymus Pi was determined colorimetrically
3 portions, and monobasic calcium phosphate was then                      using the vanadate-molybdate method (Kruse-Jarres,
included at the respective level. The analyzed tP concentra-              1979) and Ca by the standard o-cresolphthaleine complex
tions in the diets were 0.73 g/kg (low P; LP), 2.04 g/kg                  method (Sarker and Chaunan, 1967).
(medium P; MP), and 3.43 g/kg (high P; HP).
   Twelve 24-wk-old hens (Lohmann Brown) were kept                        Functional Characterization
individually in balance crates and allocated to 1 of the 3                of Epithelial Phosphate Transport
diets randomly (n = 4 hens per diet). For a period of 15
                                                                          in Jejunum and Kidneys
d, the feed was placed into the crop in a 12-h interval
through a flexible plastic tube after addition of tap water                   Brush border membrane vesicles (BBMV) were pre-
at a rate of 60 g of feed/d. This procedure was chosen                    pared from jejunal and renal epithelia by a modified Mg2+-
because we intended to avoid the high variation in feed                   EGTA precipitation method (Schro   ¨der and Breves, 1996).
intake that was observed in previous trials and that had                  Enrichment of the brush border membrane in the final
caused additional variation in tP intake. The feeding level               vesicle preparations compared with the initial total ho-
was chosen on the basis of the voluntary intake of a tP-                  mogenates was determined by marker enzyme activities
deficient diet by hens measured previously (Hempel et al.,                 [alkaline phosphatase (AP) for brush border membrane,
2004). Hens responded to the low intake with a decrease in                Na+-K+-ATPase for basolateral membranes]. Protein con-
laying performance, and no eggs were laid at the end of                   centration was assayed by applying the DC method from
the experiment. The mean BW of the hens at the end of                     BioRad (Hercules, CA).
the experiment was 1.46 kg. The experiment was approved                      The Na+-dependent Pi uptake into BBMV was quantified
by the animal welfare authorities [Approval No. 2-643                     using the rapid filtration technique as described by
MLU Hal, Landesverwaltungsamt Sachsen-Anhalt, Halle                       Schro¨der and Breves (1996) and Schro  ¨der et al. (2000) for
(Saale), Germany] in accordance with the German Animal                    caprine intestinal and renal BBMV. In general, 20- L por-
Welfare Regulations.                                                      tions of vesicle suspensions containing 160 to 300 g of
                                                                          protein were mixed with 80- L transport buffer containing
Excreta Collection and Analyses                                           1.0 Ci 32P and nonlabeled Pi to create an inwardly directed
                                                                          Pi gradient. Extravesicular incubation buffers (100 mmol/
  At the end of the experiment, excreta were quantitatively               L of mannitol, 10 mmol/L of HEPES/Tris) contained 100
collected for 5 consecutive days from trays underneath                    mmol/L of NaCl to create an inwardly directed Na+ gradi-
the crates once daily. Excreta were bulk-stored at −18°C                  ent or 100 mmol/L of KCl to detect the diffusional compo-
for each hen separately. Thawed excreta were thoroughly                   nent of Pi uptake. The mixtures were incubated at room
mixed, weighed, and analyzed for dry matter content.                      temperature until the reactions were stopped by mixing
1982                                                   HUBER ET AL.

them with ice-cold stop solution and immediately filtered        MMuLV (moloney murine leukemia virus) reverse
by vacuum suction. The filters were washed twice with            transcription (MBI Fermentas, Vilnius, Lithuania),
5 mL of ice-cold stop solution to remove extravesicular         poly(A)+RNA were transcribed into cDNA. The PCR was
radioactivity. The stop solution contained 10 mmol/L of         performed at the following reaction conditions: 1× reaction
HEPES/Tris buffer, 150 mmol/L of KCl, and 1.0 mmol/             buffer (200 mmol/L of Tris-HCl, pH 8.4, 500 mmol/L of
L of KH2PO4 (pH 7.4 at 4°C). Filters with washed BBMV           KCl), 0.4 mmol/L each dNTP, 1.5 mmol/L MgCl, 2.5 u
were then transferred into vials with 4 mL of scintillation     Taq polymerase (Gibco BRL, Gaithersburg, MD), 20 pmol
liquid (Lumasafe plus, Lumac LSC B.V., Groningen, the           of each primer, and 1.5 L template in a total volume of 25
Netherlands). Measurement of radioactivity was per-               L. Using a Mastercycler gradient (Eppendorf, Wesseling-
formed in a liquid scintillation counter (TriCarb 2500 TR,      Berzdorf, Germany), 34 cycles were run with denaturing
Packard Instruments Co., Meriden, CT).                          for 30 s (after an initial denaturing for 2 min at 94°C) at
                                                                94°C, annealing for 1 min at 60°C, and elongation for 2
Time-Dependent Pi Uptake                                        min at 72°C. Finally, there was an elongation time of 15
  Time-dependent accumulation of Pi in jejunal BSMV             min at 72°C. Specific primers were derived from bovine
was determined from 10 s up to 4 h at 37°C in the presence      kidney cell line NaPi IIb mRNA sequence (Acc. No.
of 100 mmol/L of Na+ or K+ to verify the integrity of           X81699): sense 5′atggtggcctcctcactgctg3′ (nucleotides 609-
vesicles and the Na+-dependency of Pi transport. Time-          629), antisense 5′tggggtcatagcagacgtgaa3′ (nucleotides
dependent Pi uptakes of renal BBMV could not be per-            1406–1429). A band of 819 bp could be detected by agarose
formed because of low yield of BBMV.                            gel electrophoresis, which was identified by cloning and
                                                                sequencing (sequenced by Agowa, Berlin, Germany). This
Pi Concentration-Dependent Pi Uptake                            DNA fragment was used for detection of chicken-specific
                                                                NaPi IIb-mRNA in jejunum of the hens. For the detection
   The Pi uptake was measured at 0.01, 0.05, 0.1, 0.3, 0.5,     of chicken NaPiIIa in kidney, a goat-specific probe was
and 1.0 mmol/L of Pi in the extravesicular incubation           used. This probe was created by reverse transcription-PCR
buffer in the presence of Na+. Additionally, at a Pi concen-    using primers derived from the core region of murine
tration of 0.1 mmol/L, Pi uptake was measured in the            NaPi IIa nucleotide sequence, which reflected the trans-
presence of 100 mmol/L K+ to estimate the extent of the
                                                                membrane regions of the corresponding NaPi IIa protein.
Na+-independent, diffusible part of Pi uptake at this Pi
                                                                Transmembrane regions of Pi transporters were strongly
concentration and to ensure by the difference between
                                                                conserved within the animal kingdom and also in chicken.
Na+-dependent and -independent Pi uptake rates the in-
                                                                High homology of NaPi IIa structure was confirmed by
tegrity of the vesicle during uptake studies. This diffusible
                                                                detection of NaPi IIa protein using a murine NaPi IIa
Pi uptake value was not used to calculate the kinetic pa-
                                                                antibody (Dudas et al., 2002). Hybridization with this
rameters.
                                                                probe resulted in a strong 2.4 kb band in northern analysis
   The Na+/Pi uptake was calculated as total Pi uptake
                                                                that was the expected NaPi IIa mRNA size, indicating an
minus Na+-independent Pi uptake. The Na+-independent
                                                                adequate cross homology in chicken.
part of Pi uptake was calculated by using a modified equa-
tion according to Michaelis-Menten. The Michaelis-Men-
ten equation was extended by the term (+ A x) to introduce      Northern Blot Analyses
A as the estimated diffusible part of Pi uptake. Kinetic
parameters Vmax (nmol Pi/mg protein/10 s) and Km ( mol             Semiquantitative detection of specific NaPi IIa and IIb
Pi /L) were calculated fitting the Pi uptake rates in the        mRNA of jejunum and kidney was performed as described
presence of Na+ to y = Vmax x/(Km + x) + A x, where y is        in detail by Huber et al. (2002). In brief, RNA was isolated
the Na+/Pi uptake in nmol Pi/mg of protein/10 s and x =         by acid phenol/chloroform extraction, and jejunal
substrate (Pi) concentration in mmol/L. These values were       poly(A)+RNA was enriched by affinity chromatography
fitted to all measured x and y values to create an optimal       using an oligo-dT cellulose binding matrix. Renal RNA
curve with highest correlation coefficient. The Vmax repre-      (40 g/lane) or jejunal poly(A)+RNA (5 g/lane) were
sents the transporter capacity, and Km is the Pi concentra-     fractionated in 1.0% formamide/agarose gels and trans-
tion at which the transporter is half-maximal saturated         ferred by capillary blotting onto nitrocellulose membranes.
and that represents the affinity of the transporter for Pi.      Transferred RNA was fixed on the nitrocellulose mem-
Fitting Pi uptake rates to the above-mentioned algorithm        brane by heating at 80°C under vacuum. Fixed mRNA
was performed using Graphpad Prism software (Version            were hybridized to radioactively labeled NaPi IIa-, -IIb
2.01, GraphPad Software Inc., San Diego, CA).                   and β-actin-specific probes. Labeling was performed with
                                                                50 Ci [α32P]dCTP per probe using Readyprime II random
Structural Characterization of Epithelial                       prime labeling kit according to the manufacturer’s proto-
Phosphate Transporters in Jejunum                               col (Amersham Biosciences Europe, Freiburg, Germany).
and Kidneys: NaPi IIb-Specific Reverse                           The membranes were analyzed after exposure to a phos-
                                                                phorus imager screen for 2 to 4 h with a phosphorus
Transcription-PCR in the Jejunum                                imager system (BioRad, Munich, Germany). The relative
   The RNA from the jejunum of hens was isolated using          amounts of specific mRNA were quantified by reference
a commercial kit (Qiagen, Hilden, Germany). Using 500 u         to β-actin as an internal standard using the quantification
                                   EPITHELIAL PHOSPHATE TRANSPORT IN CHICKENS                                                 1983
                                                                                                                 1
              Table 2. The inorganic phosphate (Pi) and Ca concentrations in chicken plasma and intestinal chymus

              Item                                LP                            MP                             HP
              Plasma
               Pi (mmol/L)                    0.55 ± 0.32                   0.96 ± 0.35                     0.98 ± 0.33
               Ca (mmol/L                     3.99 ± 0.52a                  2.88 ± 0.44b                    2.70 ± 0.17b
              Chymus
               Pi (mmol/L)                        1.65                      3.43 ± 2.58                     5.79 ± 3.77
               Ca (mmol/L)                       80.25                     35.44 ± 33.42                   38.93 ± 30.94
                  Significance of difference is P < 0.01 within the row (1-way ANOVA with Tukey’s post test).
                a,b
                1
                 Values are given as mean ± SD; n = 4 animals/group for plasma data; n = 2 (LP)- 4 animals/group for
              chymus data. LP = low P diet; MP = medium P diet; HP = high P diet.



software Quantity One (BioRad). Northern blots were per-             account that determination of electrolytes in chymus is
formed at least in duplicate.                                        difficult because of strong variations in collectable
                                                                     amounts of chymus. Therefore, electrolyte concentrations
Statistics                                                           could not reflect the physiological situation absolutely.
                                                                        Hens from the LP group were in a negative P balance
   Values are given as means ± SD. Statistical analyses              (Table 3). With increased dietary tP intake, hens doubled
and linear regressions were performed with the software              their tP excretion from the LP to HP group significantly.
Graphpad Prism version 2.01. One-way ANOVA with Tu-                  The dependency of plasma Pi concentrations and tP excre-
key’s post test was used to compare means of LP, MP,                 tion on dietary tP intake is shown in Figure 1. From LP
and HP. Levels of significance were set at P < 0.05, P <              to MP plasma Pi concentrations and tP excretion increased
0.01, and P < 0.001.                                                 both, but from MP to HP the increase in tP concentration
                                                                     was more pronounced, whereas plasma Pi concentrations
                       RESULTS                                       were maintained at about 1 mmol/L. Overall, tP excretion
                                                                     was strongly dependent not only on dietary tP intake but
Effect of Dietary High Ca and Low tP                                 also on plasma Pi concentration (Figure 2).
Intake on Kidney Integrity
                                                                     Parameters of Pi Uptake
   Diets containing 3% Ca and less than 0.6% available P             in Jejunal and Renal BBMV
(aP) could generate urolith formation in chickens caused
by alkalinization of the urine. Urolithiasis caused kidney              Apical located alkaline phosphatase activity was en-
tissue damage, tubular degeneration, and interstitial ne-            riched 6.9 ± 1.3-fold and 9.4 ± 1.0-fold in LP, 5.4 ± 0.8-fold
phritis, which could result in a high mortality of hens              and 7.5 ± 1.2-fold in MP, and 6.2 ± 0.5-fold and 13.6 ± 2.4-
(Wideman et al. 1985, 1989). Although predisposition re-             fold in the HP group in jejunal and renal BBMV, respec-
garding urolithiasis generation might have been relevant             tively. The Na+K+ATPase activity located in the basolateral
with the experimental feeding design used, neither uro-              membrane was enriched 1.3 ± 0.6-fold and 2.4 ± 1.4-fold
liths nor mineralization of renal medullary regions were             in LP, 1.0 ± 0.2-fold and 1.7 ± 0.9-fold in MP, and 1.6 ±
found macroscopically. Also, morphology and size of kid-             1.1-fold and 1.3 ± 0.5-fold in HP group in jejunal and
neys was unchanged, indicating the lack of compensatory              renal BBMV, respectively. These enrichment values were
hypertrophic growth of undamaged renal tissue. Histolog-             comparable with those obtained in BBMV preparations of
ical examination of hematoxylin-eosin stained kidney tis-            goats and pigs and were set to be adequate for studying
sue slices did not show signs of inflammation or tissue               Pi transport processes across the apical membranes. Con-
lesion.                                                              taminations by basolateral membranes were comparably
                                                                     low in all feeding groups. Integrity of BBMV was con-
Effects of Dietary tP Intake on Pi                                   firmed by measuring time-dependent Pi uptakes into the
and Ca Plasma or Chymus                                              vesicles of 1 hen of each group (Figure 3). Intravesicular
Concentrations and tP Excretion                                      Pi accumulations were observed in the presence of 100
                                                                     mmol/L Na+ in the incubation buffer, whereas incubation
   Plasma Pi concentrations in hens increased with in-               with 100 mmol/L K+ resulted in low linear Pi uptakes into
creased dietary tP intake from LP to MP, reaching a plateau          jejunal BBMV. These results confirmed the presence of a
at about 1 mmol/L in MP and HP groups. Plasma Ca                     Na+-dependent Pi transport system in the apical mem-
concentrations were significantly enhanced in LP com-                 branes of jejunal enterocytes whereas K+-dependent Pi up-
pared with MP and HP groups, indicating a P depletion                take reflected only the diffusible part of Pi uptake. This
status only in the LP group (Table 2). Concomitantly, Pi             diffusible part was low and uninfluenced by dietary P
concentrations in small intestinal chymus increased with             supply. Time- and Na+-dependent uptake of Pi into the
increasing dietary tP intake, whereas Ca concentrations              vesicles showed an overshoot phenomenon in each BBMV
seemed to be constant (Table 2). But it has to be taken into         preparation. Elongation of incubation time up to 4 h did
1984                                                               HUBER ET AL.
                  Table 3. Daily dietary total P (tP) intake, tP excretion, inorganic phosphate (Pi) transport capacities (Vmax) in
                  jejunum and kidney and expression level of jejunal and renal NaPi type II transporters1

                  Item                                                                  LP                   MP                   HP
                           2
                  tP intake (mg/d)                                                      39                   111                  187
                  tP excretion (mg/d)                                              44   ± 7.2ac         56    ± 5.3a         88    ± 5.6bd
                  Vmax jejunum (pmol/mg of protein/10 s)                         64.0   ± 29.0        46.0    ± 28.0       43.0    ± 20.0
                  NaPi IIb mRNA expression level3 (NaPi IIb/β-actin)             2.66   ± 0.48a       3.13    ± 1.29a      4.97    ± 1.42b
                  Vmax kidney (nmol/mg of protein/10 s)                          1.87   ± 0.56        1.01    ± 1.16       0.49    ± 0.85
                  NaPi IIa mRNA expression level3 (NaPi IIa/β-actin)             1.46   ± 1.02        0.65    ± 0.14       0.38    ± 0.09
                    a,b
                       Significance of difference is P < 0.05 and c,dSignificance of difference P < 0.01 within the row (1-way ANOVA
                  with Tukey’s post test).
                    1
                     Means ± SD are given; n = 4 animals/group. LP = low P diet; MP = medium P diet; HP = high P diet.
                    2
                     The P uptake values are given without standard deviation because hens were fed by a crop tube.
                    3
                     Expression level values are given as result of 1 characteristic blot of a total of 2 to 4. Values are dimensionless
                  because the ratio of NaPi II to β-actin was given.



not result in equilibrium because of the low incubation                        were in the expected size range for these transporters,
temperature at about 18°C.                                                     indicating the specificity of the detection. Whereas the
   The Pi concentration-dependent Pi uptake in jejunal and                     NaPi IIb mRNA level significantly increased from the LP
renal BBMV was performed to calculate Vmax and Km val-                         to HP group, NaPi IIa mRNA level decreased successively
ues of Pi transport as dependent on dietary tP supply.                         from LP to HP (Table 3). However, this decrease in NaPi
Mean Vmax values representing the mean Pi transport ca-                        IIa mRNA expression was not significant.
pacity were highest in the LP group and tended to decrease
to HP group in the jejunum (64, 46, and 43 pmol/mg of                                                     DISCUSSION
protein/10 s) but more pronounced in the kidney (1.87,
                                                                                  The Pi homeostasis in chickens influenced by dietary
1.01, and 0.49 nmol/mg of protein/10 s; Table 3). However,
                                                                               tP supply is affected by the adaptive capacities of small
in both organs these decreases were not significant. Mean
                                                                               intestines and kidney, like in mammalian species. The aim
Km values representing mean transporter affinity were not
                                                                               of this study was to characterize the basic functional and
affected by the dietary tP supply. In jejunum and kidney,
                                                                               structural principles of Pi transport in the jejunum and
the mean Km values were 45 and 104 mol/L in LP, 43                             kidney. Influenced by variations of dietary tP supply, the
and 75 mol/L in MP, and 38 and 92 mol/L in HP                                  adaptation of epithelial Pi transport processes was com-
group, respectively.                                                           bined with balance data and plasma Pi concentrations to
                                                                               assess the physiological role of each of these components
NaPi Type II mRNA Expression Levels                                            of Pi homeostasis.
in Jejunum and Kidney
                                                                               Epithelial Pi Transport in Hens
   Hybridization of mRNA with a chicken-specific NaPi
IIb probe created on chicken jejunal cDNA resulted in a                          Apical-located NaPi IIb and NaPi IIa transporters repre-
strong signal at about 4 kb. Detection of renal NaPi IIa                       sent the rate-limiting steps for transepithelial Pi transport
mRNA with a goat-specific probe revealed a strong band
at about 2.4 kb in northern analysis. Both mRNA signals




                                                                                  Figure 2. Relation between plasma inorganic phosphate (Pi) and total
                                                                               P (tP) excretion. One hen of the medium group P was omitted because
   Figure 1. Dependency of plasma inorganic phosphate (Pi) concentra-          of its low tP excretion despite high plasma Pi concentration. Linear
tions (filled circles) and total P (tP) excretion (open circles) on dietary     regression resulted in r2 = 0.68, P < 0.01 significance of deviation of the
tP intake. LP = low P diet; MP = medium P diet; HP = high P diet.              slope from zero.
                                       EPITHELIAL PHOSPHATE TRANSPORT IN CHICKENS                                                 1985
                                                                         tubuli mediated by NaPi IIa is only one factor for influenc-
                                                                         ing renal Pi excretion. From elegant studies on renal Pi
                                                                         excretion in birds influenced by parathyroid hormone
                                                                         (PTH) and variations in dietary aP supply, a tubular Pi
                                                                         secretion was detected that is not expressed in mammalian
                                                                         species. This mechanistically unknown Pi secretion was
                                                                         stimulated by PTH irrespective of dietary aP supply
                                                                         (Wideman, 1987; Stanton et al., 1989). At which extent this
                                                                         Pi secretion participates in the adaptation to variations in
                                                                         dietary aP is still unclear, but PTH levels should be low
                                                                         at the relatively high dietary Ca intake in hens of this
                                                                         study. Therefore, adaptation to variations in dietary aP
                                                                         should be modulated by tubular Pi reabsorption mediated
                                                                         by NaPi IIa. To summarize, the assumption that NaPi II-
   Figure 3. Time-dependent inorganic phosphate (Pi) uptake in jejunal   mediated Pi transport mechanisms exist in kidney and
brush border membrane vesicles of 3 hens in the presence of 100 mmol/    jejunum of hens was proven by the presence of NaPi IIa
L Na+ (closed symbols) or K+ (open symbol) in the incubation buffer.     and IIb mRNA and the concordance of functional charac-
Each point represents the mean of 3 measurements of 1 individual hen;
   = low P diet (LP) hen, ▲ = medium P diet (MP) hen, ▼ = high P         teristics of Na+-dependent Pi transport with those known
diet (HP) hen,   = mean values of K+ dependent Pi uptake of LP, MP,      from NaPi IIa- or IIb-mediated Pi transport processes in
and HP hens (standard deviation was <0.016 nmol/mg of protein/10 s).     mammalian species.

                                                                         Adaptation of Epithelial Pi Transport
in jejunal and renal epithelia. Physiological regulation of
Pi transport capacities of renal and jejunal epithelia is medi-
                                                                         Influenced by Dietary P Restriction
ated by changes in the abundance of these transporters                      Regulation of P homeostasis in chicken should be analo-
(Murer et al., 2004). In hens, NaPi IIb and NaPi IIa mRNA                gously based on adaptive changes in NaPi II expression
could be detected in jejunum and kidney specifically. Be-                 and Na+/Pi transport capacity, like in mammals (Werner
cause antibodies against the respective proteins are not                 et al., 1994; Murer et al., 2000; Huber et al., 2002; Radanovic
available, BBMV uptake studies were performed to charac-                 et al., 2005). However, functional (Vmax) and structural
terize jejunal and renal Na+-dependent Pi transport func-                (NaPi II mRNA expression) parameters were not changed
tionally. The Km value for Pi is characteristically low in               significantly by dietary P restriction when the experimen-
Na+-dependent Pi transport mediated by NaPi IIb at about                 tal groups were compared. Neither chymus nor plasma
50 mol/L, indicating a high Pi affinity (Murer et al., 2004).             Pi concentrations influenced intestinal Pi absorption. It is
In chicken jejunum, Km(Pi) values of all groups were equally             noticeable that plasma Pi levels lowest in LP group were
low at about 40 mol/L, indicating that Na+-dependent                     combined with hypercalcemia, indicating strong P restric-
Pi transport is mediated by NaPi IIb in this species also.               tive feeding. Plasma levels of MP and HP group were only
In kidney, apparent Pi affinity was 100 mol/L for Na+-                    slightly higher than in LP but did not reach the level of
dependent Pi transport mediated by NaPi IIa (Murer et                    adequate tP-fed chickens (1.2 to 1.8 mmol/L; Boorman
al., 2004). In chicken kidney a comparable Pi affinity was                and Gunaratne, 2001). This could be due to the restricted
detected indicating that renal Na+-dependent Pi transport                amount of feed that was to be given in this study to stan-
was also mediated by NaPi IIa. The existence of NaPi                     dardize tP intake. This restriction in feed also caused a
IIa in chicken should be associated with the existence of                decrease in egg production of the hens, which also interacts
mammalian-type nephrons in chicken kidneys because,                      with the homeostasis of Ca and P. Therefore, plasma Pi
hypothetically, the evolution of NaPi IIa was paralleled                 levels did not reach higher values.
by development of this type of nephrons (Werner and                         However, increased plasma Pi levels significantly
Kinne, 2001). But Pi reabsorption capacity in the proximal               caused increased tP excretion, which could be the result


                 Table 4. Correlations between renal and jejunal inorganic phosphate (Pi) transport capacities (Vmax), sodium-
                 dependent phosphate transporters (NaPi IIa and IIb) mRNA expression levels, plasma Pi concentrations, and
                 total P (tP) excretions

                 Item                                                        r2                 Slope                P-value1
                 Vmax kidney/plasma Pi                                     0.60                  −2.0                  <0.01
                 Vmax jejunum/plasma Pi                                    0.05                  −0.01                  NS
                 NaPi IIa mRNA expression level/plasma Pi                  0.34                  −1.8                  <0.05
                 NaPi IIb mRNA expression level/plasma Pi                  0.005                  0.33                  NS
                 Vmax kidney/tP excretion                                  0.36                 −14                    <0.05
                 Vmax jejunum/tP excretion                                 0.10                −296                     NS
                   1
                    The P value gives the significance level of slope different from zero. Linear regressions were performed
                 using GraphPad Prism software (GraphPad Software Inc., San Diego, CA). Correlation coefficients (r2) at about
                 0.3 were set to be significant.
1986                                                       HUBER ET AL.

of a decreased intestinal or renal Pi absorption or both.           Hempel, R., E. Strobel, and M. Rodehutscord. 2004. Inevitable
Correlations of individual data of all animals between                 phosphorus losses of laying hens. Proc. Soc. Nutr. Physiol.
                                                                       13:31 (Abstr.)
renal and jejunal Pi transport capacities, NaPi IIa and IIb         Huber, K., C. Walter, B. Schro ¨der, and G. Breves. 2002. Phosphate
mRNA expression, plasma Pi levels, and tP excretion by                 transport in the duodenum and jejunum of goats and its
linear regression highlighted significant relations between             adaptation by dietary phosphate and calcium. Am. J. Physiol.
renal functional and structural parameters of Pi transport             Regul. Integr. Comp. Physiol. 283:R296–R302.
and plasma Pi or tP excretion (Table 4). The Vmax of renal          Kruse-Jarres, J. D. 1979. Klinische Chemie, vol II, Spezielle klin-
                                                                       isch-chemische Analytik. Fischer Verlag, Stuttgart, Germany.
Na+-dependent Pi transport as well as NaPi IIa mRNA                 Murer, H., I. Forster, and J. Biber. 2004. The sodium phosphate
expression was significantly reduced by increased plasma                cotransporter family SLC34. Pflugers Arch.—Eur. J. Physiol.
Pi levels, which gave rise to decreased renal Pi absorption            447:763–767.
capacity. As a consequence, renal Pi excretion should in-           Murer, H., H. Hernando, I. Forster, and J. Biber. 2000. Proximal
crease, which was supported by the significant negative                 tubular phosphate reabsorption: Molecular mechanisms.
                                                                       Physiol. Rev. 80:1373–1409.
correlation between renal Vmax and tP excretion (Table              Quamme, G. A. 1985. Phosphate transport in intestinal brush-
4). In the jejunum Pi transport capacity, NaPi IIb mRNA                border membrane vesicles: Effect of pH and dietary phos-
expression, plasma Pi levels, and tP excretion were gener-             phate. Am. J. Physiol. Gastrointest. Liver Physiol.
ally not correlated with each other. Therefore, Pi absorp-             249:G168–G176.
tion and NaPi IIb expression was obviously not modulated            Radanovic, T., C. A. Wagner, H. Murer, and J. Biber. 2005. Regula-
                                                                       tion of intestinal phosphate transport I. Segmental expression
by dietary tP supply in the jejunum of hens. In the study              and adaptation to low Pi diet of the type IIb Na+-Pi cotrans-
by Rodehutscord et al. (2002) an increased intake of tP                porter in mouse small intestine. Am. J. Physiol. Gastrointest.
resulted in an increased tP excretion of hens, but differ-             Liver Physiol. 288:G496–G500.
ences in the amount of tP measured in the terminal ileum            Renfro, J. L., and N. B. Clark. 1984. Parathyroid hormone effect on
were hardly found. The authors had suggested that the                  chicken renal brush-border membrane phosphate transport.
                                                                       Am. J. Physiol. Regul. Integr. Comp. Physiol. 247:R302–R307.
kidneys rather than the intestines play a major role in             Rodehutscord, M., and A. Dieckmann. 2005. Comparative studies
adaptation to variable tP intake, which is confirmed by                 with 3 wk-old chickens, turkeys, ducks, and quails on the
the results from the present study.                                    response in phosphorus utilization to a supplementation of
   In the duodenum of cockerels, Na+-dependent Pi trans-               monobasic calcium phosphate. Poult. Sci. 84:1252–1260.
port was increased by dietary P restriction (Quamme,                Rodehutscord, M., F. Sanver, and R. Timmler. 2002. Comparative
                                                                       study on the effect of variable phosphorus intake at two differ-
1985). This difference to the findings from the present                 ent calcium levels on P excretion and P flow at the terminal
study could be due to the fact that that study was per-                ileum of laying hens. Arch. Anim. Nutr. 56:189–198.
formed in younger, rapidly growing cockerels, in which              Sarker, B. C., and U. P. S. Chaunan. 1967. A new method for
disturbances of P homeostasis by dietary P restriction                 determining microquantities in biological materials. Anal. Bio-
could be more relevant due to the higher P requirement.                chem. 20:155.
                                                                    Schro¨der, B., and G. Breves. 1996. Mechanisms of phosphate
Additionally, another segment of the small intestines was              uptake into brush border membrane vesicles from goat jeju-
examined, which could result in location-dependent ef-                 num. J. Comp. Physiol. [B] 166:230–240.
fects on Pi absorption.                                             Schro¨der, B., C. Walter, G. Breves, and K. Huber. 2000. Compara-
   It is still unclear why jejunal NaPi IIb mRNA expression            tive studies on Na-dependent Pi transport in ovine, caprine
in the hens increased with increased dietary tP intake.                and porcine renal cortex. J. Comp. Physiol. [B] 170:387–393.
                                                                    Stanton, T. S., R. P. Glahn, and R. F. Wideman, Jr. 1989. The
   In conclusion, the adaptive capacity of the kidney re-              effects of dietary phosphorus and parathyroid hormone (PTH)
garding the Pi transport had the most important role for               infusion rates on the avian phosphaturic response to PTH. J.
regulation of P homeostasis in these hens. Plasma Pi level             Exp. Biol. 144:521–533.
seemed to have a relevant modulatory influence on renal              Van der Klis, J. D., H. A. J. Versteegh, P. C. M. Simons, and A.
Pi reabsorption capacity in chickens as it was observed in             K. Kies. 1997. The efficacy of phytase in corn-soybean meal-
                                                                       based diets for laying hens. Poult. Sci. 76:1535–1542.
mammals (Widiyono et al., 1998).                                    Werner, A., S. A. Kempson, J. Biber, and H. Murer. 1994. Increase
                                                                       of Na/Pi-cotransport encoding mRNA in response to low Pi
                      REFERENCES                                       diet in rat kidney cortex. J. Biol. Chem. 269:6637–6639.
                                                                    Werner, A., and R. K. H. Kinne. 2001. Evolution of the Na-Pi
Boorman, K. N., and S. P. Gunaratne. 2001. Dietary phosphorus          cotransport systems. Am. J. Physiol. Regul. Integr. Comp.
  supply, egg shell deposition and plasma inorganic phospho-           Physiol. 280:R301–R312.
  rus in laying hens. Br. Poult. Sci. 42:81–91.                     Wideman, R. F., Jr. 1987. Renal regulation of avian calcium and
Dudas, P. L., A. R. Villalobos, G. Gocek-Sutterlin, G. Laverty,        phosphorus metabolism. J. Nutr. 117:808–815.
  and J. L. Renfro. 2002. Regulation of transepithelial phosphate   Wideman, R. F., Jr., J. A. Closser, W. B. Roush, and B. S. Cowen.
  transport by PTH in chicken proximal tubule epithelium. Am.          1985. Urolithiasis in pullets and laying hens: Role of dietary
  J. Physiol. Regul. Integr. Comp. Physiol. 282:139–146.               calcium and phosphorus. Poult. Sci. 64:2300–2307.
Gesellschaft fur Ernahrungsphysiologie. 1999. Energie- und Nah-
              ¨     ¨                                         ¨     Wideman, R. F., Jr., W. B. Roush, J. L. Satnick, R. P. Glahn, and
  rstoffbedarf landwirtschaftlicher Nutztiere. 7. Empfehlungen         N. O. Oldroyd. 1989. Methionine hydroxyl analog (free acid)
  zur Energie- und Nahrstoffversorgung der Legehennen und
                       ¨                                               reduces avian kidney damage and urolithiasis induced by
  Masthuhner (Broiler). DLG-Verlag, Frankfurt a. M., Germany.
         ¨                                                             excess dietary calcium. J. Nutr. 119:818–828.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:10
posted:8/14/2011
language:English
pages:7