publication - Excel by SeRyan

VIEWS: 14 PAGES: 20

									                  BN / Wis                                                                     BN > alt
Chr    Position   specific   map ID               external ID                    ref_id         allele

1     003034177     yes      1001                                           ENSRNOSNP175434      T/C
1     005202951     yes       23                  Cpn_1005202951            ENSRNOSNP2783268     C/T
1     008050217     yes       24      gnl|ti|896881254_19866868168665_285   ENSRNOSNP249917      C/T
1     011778331     no       1013                                           ENSRNOSNP2642396     C/A
1     015852941     yes       25               gko-38a22_rp2_b1_613         ENSRNOSNP2783348     T/C
1     017138704     no        2       gnl|ti|896756722_19866867105261_309    ENSRNOSNP90775      G/A
1     026531466     yes       26                gko-47p5_rp2_b1_330         ENSRNOSNP169586      A/G
1     029764495     yes      1025                                               rs13454273       G/A
1     036208800     yes      1037                                           ENSRNOSNP2678021     T/C
1     039643806     yes      364            rdahl-80l23_rp2_b1_431          ENSRNOSNP191848      T/C
1     044500339     no       1049                                           ENSRNOSNP198009      G/A
1     044878370     yes       27            gko-13m15_rp2_b1_456            ENSRNOSNP2783493     T/C
1     046918010     yes       28             gko-16l18_rp2_b1_439           ENSRNOSNP200993      A/G
1     053396511     yes      1061                                           ENSRNOSNP2675873     A/G
1     056498291     yes      1073                                                rs8161747       C/T
1     058606326     yes       29            gko-104g21_fp2_b1_425           ENSRNOSNP228204      C/T
1     068071562     no       1085
1     070020809     no       1002                                           ENSRNOSNP238975      T/A
1     077594585     no       1014                                           ENSRNOSNP2685844     T/C
1     087411991     yes      1026                                           ENSRNOSNP2663199     T/A
1     090749408     yes       30               Cpn_1090749408               ENSRNOSNP258519      C/T
1     093760176     no       1038                                           ENSRNOSNP2711994     A/G
1     100829033     no       1050                                           ENSRNOSNP2754848     C/T
1     101121890     yes       31             gko-99b15_rp2_b1_235           ENSRNOSNP2783816     T/C
1     109198245     yes      1062                                            ENSRNOSNP14986      C/T
1     111943004     yes       33             rdahl-84b9_rp2_b1_347           ENSRNOSNP18796      T/C
1     115008622     yes      365                     J585062                 ENSRNOSNP28439      T/A
1     118843159     yes      1074                                           ENSRNOSNP2783940     T/C
1     126031585     yes      366            rdahl-65l17_fp2_b1_264          ENSRNOSNP2651750     A/C
1     131711026     yes       34             SHRSPa43c12_s1_448             ENSRNOSNP2680549     T/C
1     133433124     yes      367                    J661392                 ENSRNOSNP2711451     G/T
1     135112460     no       1003                                           ENSRNOSNP2784050     T/G
1     136218350     yes       35              WKYc92c06_s1_584              ENSRNOSNP2728750     C/T
1     138884787     yes       36              DS-g-a-36b12_f1_125            ENSRNOSNP47258      T/C
1     141991143     yes       37            rdahl-54a23_fp2_b1_378           ENSRNOSNP51435      C/T
1     144367481     no       1015                                                rs8168393       C/T
1     146119192     yes      368                    J669647                  ENSRNOSNP59392      T/A
1     148596494     yes      369             SHRSPa16b06_r1_329              ENSRNOSNP62860      G/C
1     151502658     yes       39             gko-84o14_fp2_b1_603           ENSRNOSNP2784204     T/C
1     153483576     no       1027                                            ENSRNOSNP69691      T/C
1     154390719     yes       40              DahlSa01f01_r1_140            ENSRNOSNP2729916     C/T
1     157603989     yes       41              DS-g-a-04f12_f1_621           ENSRNOSNP2765504     T/C
1     159502725     yes      1039                                            ENSRNOSNP74918      T/C
1     162391700     yes       42            rdahl-96c10_rp2_b1_335          ENSRNOSNP2784311     C/T
1     164909020     yes       43             SHRSPc09g06_r1_639              ENSRNOSNP82990      T/C
1     168569897     yes      1051                                                rs8165089       G/T
1     171442718     yes       44            SHRSPa19e09_r1_1104             ENSRNOSNP2755163     C/T
1     173376457     yes      370                 J697407                    ENSRNOSNP2658627     G/A
1     175944948     no       1063                                            ENSRNOSNP95978      C/A
1     179862388     yes      371              WKYa70e11_s1_159              ENSRNOSNP100412      C/T
1     184935644     no       1075                                                rs8161014       G/C
1     187978763     no        3                Cpn_1187978763                    rs8169112       C/A
1     193106681     yes      1087                                           ENSRNOSNP113664      T/C
1     196176285     yes       46             SHRSPc76b12_r2_867             ENSRNOSNP2778841     C/T
1     197823092     yes      372                  J535903                   ENSRNOSNP2784647     A/C
1     201205817     yes      1004                                                rs8166965       T/C
1     204258541     no       1016                                                rs8155439       G/A
1     204573537     yes       47             gko-34e12_rp2_b1_147           ENSRNOSNP2784717     C/T
1     213369475     yes      1028                                           ENSRNOSNP2644124     T/C
1     219988698     no       1040                                           ENSRNOSNP2784820     A/T
1     227335895     no       1052                                           ENSRNOSNP2784873     T/C
1     230917961     yes      373           rat105_017_h23.p1ca_437              rs13456942       T/G
1     240576215     no        4                    J474918                  ENSRNOSNP2773186     A/T
1     245350235     no       1064                                                rs8149933       A/T
1     247347259     yes      1076                                                rs8157523       A/G
1     249940523     yes       48             SHRSPc63e12_r1_708             ENSRNOSNP2692912     C/T
1     253423962     yes      374              gko-6d5_rp2_b1_412            ENSRNOSNP154707      A/C
1     257307659     yes      1088                                           ENSRNOSNP160114      A/G
1     260544878     yes       49             SHRSPa9b08_r1_918              ENSRNOSNP164337      C/T
1     263619558     yes       50             SHRSPc44h05_r1_198             ENSRNOSNP167442      G/A
1     267269141     yes      1005                                           ENSRNOSNP171634      T/C
2     004393495     no       1017                                           ENSRNOSNP1384438     C/T
2     008218082     no       408                      J583281               ENSRNOSNP2775338     T/C
2     012679612     yes      157      gnl|ti|896815391_19866855455698_311   ENSRNOSNP1176209     C/T
2     018025745     yes      1029                                           ENSRNOSNP2706499     G/T
2     020175992     yes      1041                                           ENSRNOSNP2785321     T/C
2     022725789     yes      158                Cpn_2022725789                   rs8158776       A/G
2     025178391     yes      159                Cpn_2025178391                   rs8170587       T/C
2     027732087     yes      160            rat108_044_j16.p1ca_494         ENSRNOSNP2785409     T/C
2     028121542     no       1053                                           ENSRNOSNP1362677     A/G
2     030781432     yes      161              DS-g-c-05f06_f1_228           ENSRNOSNP2705008     C/T
2     033025098     yes      162              WKYc70f04_r1_467              ENSRNOSNP1368901     T/C
2     036525003     no       1065                                           ENSRNOSNP1373494     T/C
2   039159994   yes   163           SHRSPc53b08_r1_573             ENSRNOSNP1377044   T/C
2   041239474   yes   164            gko-50a7_rp2_b1_65            ENSRNOSNP2785524   T/C
2   044634570   yes   1077                                             rs8160961      C/G
2   046707751   yes   409                J509970                   ENSRNOSNP2785576   C/T
2   049169776   yes   410                J879462                   ENSRNOSNP1392227   G/C
2   051852237   yes   165          WKY-G-h-02c01_f1_1509           ENSRNOSNP1396402   T/C
2   052461715   no    1089                                             rs8170947      C/T
2   057457967   no    411          WKY-G-i-13h09_f1_1278           ENSRNOSNP2685506   G/A
2   060343621   yes   1006
2   063790992   no    412    gnl|ti|896715041_19866866899161_257   ENSRNOSNP1409733   T/G
2   067666143   yes   1018                                         ENSRNOSNP2642959   C/A
2   070714622   yes   166    gnl|ti|897013443_19866868057586_369   ENSRNOSNP1422921   T/C
2   072455288   yes   167             gko-96n23_fp2_b1_626         ENSRNOSNP1426236   G/A
2   075269078   no    1030                                         ENSRNOSNP2745566   A/T
2   075962301   yes   168           gko-92g17_rp2_b1_343           ENSRNOSNP2785843   T/C
2   078056971   yes   169           WKYOa35d04_s1_214              ENSRNOSNP2672444   G/A
2   080237511   yes   170           SHRSPc52c07_r1_253             ENSRNOSNP1438506   A/G
2   083364646   yes   1042                                         ENSRNOSNP2785908   C/T
2   086275290   yes   413           gko-73g13_fp2_b1_349           ENSRNOSNP1448854   A/T
2   090095409   yes   171            gko-73h2_fp2_b1_369           ENSRNOSNP2659806   A/G
2   093279903   yes   1054                                         ENSRNOSNP1459491   C/T
2   095748260   yes   172           DS-g-a-13e10_f1_1066           ENSRNOSNP2695756   C/T
2   099252711   yes   1066                                         ENSRNOSNP2650418   T/G
2   101621644   yes   414    gnl|ti|896917919_19866868468116_449   ENSRNOSNP1146043   A/G
2   105294894   yes   1078                                         ENSRNOSNP2657773   A/T
2   107427259   yes   173    gnl|ti|896523353_19866867257863_175   ENSRNOSNP1153951   T/C
2   110361843   yes   174               WKYe4g06_s1_660            ENSRNOSNP2715615   T/C
2   112682393   yes   175              gko-77i4_rp2_b1_523         ENSRNOSNP2696550   A/G
2   114126834   no    1090                                         ENSRNOSNP1163375   A/G
2   116065020   yes   176             Cpn_2116065020               ENSRNOSNP1165258   C/T
2   119118615   yes   177             Cpn_2119118615               ENSRNOSNP2786185   A/G
2   121300790   yes   1007                                         ENSRNOSNP1171098   T/A
2   123693944   yes   178          rdahl-62h12_rp2_b1_458          ENSRNOSNP2745371   C/T
2   128961947   yes   1019                                         ENSRNOSNP2706749   T/C
2   134711622   yes   1031                                         ENSRNOSNP1182446   C/T
2   136533768   no    415                 J580497                  ENSRNOSNP1186624   A/G
2   144756546   yes   1043                                              rs8164841     C/T
2   146915059   yes   179             Cpn_2146915059                    rs8162367     A/G
2   150472365   yes   1055                                         ENSRNOSNP2688605   T/C
2   152316327   yes   180    gnl|ti|896559164_19866867220440_309   ENSRNOSNP1206689   T/C
2   155147396   yes   181                Cpn_2155147396                 rs8157952     C/T
2   158844297   yes   182    gnl|ti|896551349_19866867261096_306   ENSRNOSNP1216367   A/G
2   160253646   no    1067                                         ENSRNOSNP1218035   T/C
2   161451202   yes   183          rdahl-98k15_rp2_b1_308          ENSRNOSNP2656539   C/T
2   163056044   yes   184            gko-6k4_rp2_b1_620            ENSRNOSNP1223264   C/T
2   165548640   yes   416                  J563564                 ENSRNOSNP2786517   C/A
2   167913511   yes   185           gko-66k13_fp2_b1_370           ENSRNOSNP2774212   A/G
2   168204884   no    1079                                         ENSRNOSNP1232787   C/T
2   173244340   yes   417           WKYOa63g02_s1_247              ENSRNOSNP1241582   A/G
2   176217674   yes   1091                                         ENSRNOSNP2745120   A/G
2   178871056   yes   187    gnl|ti|896703610_19866866702795_286   ENSRNOSNP1248275   C/T
2   181269500   yes   188             rat101_011_i10.q1ca_612           rs8166982     A/G
2   183995849   yes   189              rdahl-85e2_rp2_b1_103       ENSRNOSNP2668723   T/C
2   190383702   yes   1020                                         ENSRNOSNP2719023   C/T
2   192382797   yes   190             Cpn_2192382797                    rs8169914     G/A
2   195414521   yes   191           DS-g-a-20f01_r1_806            ENSRNOSNP1271115   T/C
2   198053093   yes   192           gko-82c15_fp2_b1_38            ENSRNOSNP2786831   T/C
2   200100625   yes   193          gko-118k13_fp2_b1_421           ENSRNOSNP1275872   G/A
2   201215853   no    1044                                             rs13458557     G/A
2   203258115   yes   194              gko-16a7_fp2_b1_661         ENSRNOSNP2786885   T/C
2   205024126   yes   195              SHRSPc48a04_r1_752          ENSRNOSNP1282639   T/C
2   207723272   yes   196    gnl|ti|896653438_19866868031547_272   ENSRNOSNP1286450   T/C
2   210190102   no    1056                                              rs8158765     A/G
2   210708786   yes   197           gko-78j14_rp2_b1_632           ENSRNOSNP2786950   A/G
2   212538318   no    418             Cpn_2212538318               ENSRNOSNP1294845   A/G
2   215059687   yes   419                  J474230                 ENSRNOSNP1297687   C/G
2   218300252   yes   1068                                         ENSRNOSNP1301211   T/C
2   222130080   yes   198            gko-69j5_rp2_b1_253           ENSRNOSNP1307677   T/C
2   225489827   yes   1080                                         ENSRNOSNP2736356   C/A
2   227461835   yes   199                Cpn_2227461835                 rs8163122     C/T
2   230321118   yes   420                    J596917               ENSRNOSNP1319997   T/C
2   235134942   yes   200                Cpn_2235134942            ENSRNOSNP1326323   A/G
2   237592410   yes   421                    J551835               ENSRNOSNP1329642   A/G
2   240195738   yes   201              SHRSPc44h06_r1_778          ENSRNOSNP1333726   C/T
2   242470200   yes   202              SHRSPc07f06_r1_308          ENSRNOSNP1336972   T/C
2   244989178   yes   422               WKYe16f06_r1_262           ENSRNOSNP1340459   T/A
2   247576691   yes   203    gnl|ti|896616412_19866867247523_305   ENSRNOSNP1344176   T/C
2   250800552   yes   1021                                              rs8161689     T/C
2   258128900   yes   1033                                         ENSRNOSNP1358962   A/G
3   007914311   yes   1045                                         ENSRNOSNP1677183   G/A
3   011181841   yes   1057                                         ENSRNOSNP1544158   C/T
3   014536738   yes   1069                                         ENSRNOSNP1579679   G/A
3   018365332   yes   1081                                         ENSRNOSNP1604944   A/C
3   021453429   yes   212           gko-70c9_fp2_b1_513            ENSRNOSNP2671120   C/T
3   022796991   yes   423                 J1262950                 ENSRNOSNP1611776   A/C
3   024991343   no    1093                                         ENSRNOSNP2744755   T/C
3   025897311   yes   424          rdahl-19p14_rp2_b1_263          ENSRNOSNP2679657   C/A
3   031224510   yes   1010                                         ENSRNOSNP1620505   A/G
3   035987568   yes    5                  J640506                  ENSRNOSNP1623720   C/T
3   039894067   yes   1022                                              rs8158014     A/T
3   045007080   no    1034                                         ENSRNOSNP2741977   G/A
3   047843287   yes   213            gko-6l6_rp2_b1_668            ENSRNOSNP1637038   A/G
3   049736711   yes   214             Cpn_3049736711               ENSRNOSNP2787820   G/A
3   050179789   no    1046                                         ENSRNOSNP2747282   T/C
3   053626436   yes   215           gko-103b12_fp2_b1_93           ENSRNOSNP2726637   C/T
3   055692593   yes   1058                                             rs13455337     G/C
3   058367917   yes   216             Cpn_3058367917                    rs8146182     C/T
3   061647346   yes   217          rdahl-45g12_rp2_b1_489          ENSRNOSNP1651806   T/C
3   062729881   no    1070                                         ENSRNOSNP1653135   C/T
3   065194877   yes   218           gko-36f8_rp2_b1_404            ENSRNOSNP1657567   C/T
3   067526097   yes   1082                                         ENSRNOSNP1660268   A/G
3   071270201   no    425                J498900                   ENSRNOSNP1666013   T/A
3   073412727   yes   219           WKY-G-j-27b10_f1_617           ENSRNOSNP2700362   A/G
3   077229026   yes   1094                                             rs13450271     A/C
3   081681138   no     6          rat105_016_b04.q1ca_584              rs13456875     C/T
3   086868207   no    1011                                         ENSRNOSNP2788160   A/G
3   087072777   yes   220           SHRSPa97c11_r1_856             ENSRNOSNP2685929   T/C
3   090725479   no    1023                                         ENSRNOSNP2699615   A/G
3   099964087   yes   1035                                              rs8150502     G/T
3   101897115   yes   221            SHRSPa45c01_r1_789            ENSRNOSNP1534326   T/C
3   104700164   yes   222          rat105_005_f02.p1ca_385              rs8168417     A/G
3   107522090   yes   1047                                         ENSRNOSNP2788274   A/C
3   111323882   yes   223           SHRSPa7b02_r1_718              ENSRNOSNP1543661   T/C
3   114435599   yes   224           gko-17b4_fp2_b1_99             ENSRNOSNP2788348   A/G
3   117293874   yes   1059                                         ENSRNOSNP1550500   G/A
3   119304920   yes   225           WKYc100a05_s1_847              ENSRNOSNP1552281   T/C
3   122592684   yes   1071                                              rs8164562     C/T
3   124904209   yes   226            WKYa70g08_s1_143              ENSRNOSNP1558835   C/T
3   128063310   yes   1083                                         ENSRNOSNP1563084   G/A
3   129991723   yes   426                    J632967               ENSRNOSNP1565222   T/C
3   133621934   yes   227             SHRSPa87g02_s1_525           ENSRNOSNP1569425   C/T
3   135862594   yes   228    gnl|ti|896627178_19866867546740_280   ENSRNOSNP1572179   C/T
3   143043644   no    1012                                         ENSRNOSNP2788607   G/A
3   145887124   yes   229             Cpn_3145887124                    rs8146004     C/T
3   149215134   no    1024                                         ENSRNOSNP1581338   G/A
3   151014369   yes   230           WKYOa50e06_r1_264              ENSRNOSNP2676890   T/C
3   156505597   no    427           SHRSPc07g12_r1_805             ENSRNOSNP2682582   T/C
3   158905160   no    1036                                         ENSRNOSNP1589630   A/G
3   159394276   yes   231             Cpn_3159300312               ENSRNOSNP2788735   C/T
3   161930315   yes   232           SHRSPc41f12_r1_421             ENSRNOSNP2660573   G/A
3   164603697   no    1048                                         ENSRNOSNP2788782   A/G
3   167427020   no    428    gnl|ti|896981100_19866867422358_278   ENSRNOSNP1601099   A/G
3   170047527   yes   1060                                         ENSRNOSNP1603279   C/T
4   004146604   no    1072                                         ENSRNOSNP1801023   C/T
4   007560618   yes   429                 J498542                  ENSRNOSNP1843813   C/G
4   008355098   no    1084                                         ENSRNOSNP1851570   G/A
4   009969234   no    1096                                         ENSRNOSNP2663351   C/T
4   011093964   yes   233           WKYOa50d01_r1_646              ENSRNOSNP1710593   T/C
4   012274626   yes   234           WKYOa02c04_s1_353              ENSRNOSNP2725171   C/T
4   015152352   yes   235         rat105_030_o14.p1cb_142               rs8154689     A/G
4   021511671   no    1097                                             rs13457775     C/T
4   022917798   no    431            WKYc43e01_r1_125              ENSRNOSNP1781223   C/T
4   025580353   no    1109                                         ENSRNOSNP2742456   T/C
4   026068233   yes   236            gko-2l8_rp2_b1_166            ENSRNOSNP2789034   G/A
4   031032008   yes   1121                                         ENSRNOSNP2704648   A/T
4   033704015   yes   237            WKYc81h11_s1_476              ENSRNOSNP1788248   C/T
4   037603232   yes   1133                                              rs8168428     G/A
4   040488514   yes   238    gnl|ti|896573636_19866868329816_225   ENSRNOSNP2789125   T/C
4   042950745   yes   432              DS-g-a-09c12_r1_418         ENSRNOSNP1803338   C/T
4   045648970   yes   239             rdahl-17o15_fp2_b1_97        ENSRNOSNP1807555   T/C
4   049203916   yes   1157                                         ENSRNOSNP1812950   C/T
4   052160248   no    433          rdahl-56f24_rp2_b1_241          ENSRNOSNP1817217   T/C
4   055410551   no    1169                                         ENSRNOSNP2670062   C/T
4   058082684   yes   240           WKY-G-j-23g06_r1_99            ENSRNOSNP2728747   A/G
4   061070648   yes   1181                                         ENSRNOSNP1823489   T/C
4   062962493   yes   241            WKYc44b10_s1_477              ENSRNOSNP1825440   A/G
4   066269294   yes   1098                                             rs13450826     A/G
4   068771571   yes   242            WKYc99a04_s1_542              ENSRNOSNP1832696   C/T
4   071692416   yes   1110                                         ENSRNOSNP2687620   A/G
4   076549142   yes   1122                                         ENSRNOSNP1844806   C/G
4   078764004   yes   243           SHRSPc39f10_r1_686             ENSRNOSNP1847359   T/C
4   081038868   yes   244           gko-75i1_rp2_b1_135            ENSRNOSNP1849071   G/A
4   082415573   no    1134                                         ENSRNOSNP1850635   G/A
4   083359531   yes   245          rat110_029_j12.p1ca_224             rs13452348     G/A
4   088201347   no    1146                                         ENSRNOSNP2758356   C/T
4   090987156   yes   246           DS-g-a-48g01_r1_311            ENSRNOSNP2675073   T/C
4   094001517   yes   434           gko-33c7_fp2_b1_243            ENSRNOSNP1867572   T/C
4   099157433   no     7                  J474609                  ENSRNOSNP2789638   T/C
4   102755702   no    1170                                         ENSRNOSNP1696639   T/C
4   103604377   no    435    gnl|ti|896794227_19866867081264_296   ENSRNOSNP1700772   T/C
4   106289730   no    1182                                         ENSRNOSNP2725824   T/C
4   111717646   no    1099                                         ENSRNOSNP1711289   C/T
4   117954254   no    1111                                              rs8170404     T/G
4   119414234   yes   247           DS-g-c-08g10_f1_275            ENSRNOSNP1715317   G/A
4   121833196   yes   1123                                         ENSRNOSNP2776293   G/A
4   128295155   yes   1135                                         ENSRNOSNP1718782   A/G
4   134145660   yes   1147                                         ENSRNOSNP1722079   G/A
4   136302449   yes   248           WKYc08d03_s1_610               ENSRNOSNP2642134   T/C
4   138687268   yes   436           DS-g-a-20g10_f1_598            ENSRNOSNP2768089   A/G
4   140443482   no    1159                                             rs13453192     A/T
4   142050680   yes   249           gko-105p17_fp2_b1_23           ENSRNOSNP1732044   T/C
4   143848958   yes   250            WKYc30f10_s1_529              ENSRNOSNP2691299   T/C
4   147048302   yes   1171                                             rs13457146     T/C
4   149406645   yes   251             Cpn_4149406645               ENSRNOSNP2790029   T/C
4   152402069   yes   1183                                              rs8156261     C/A
4   154741867   yes   252           gko-69b17_rp2_b1_735           ENSRNOSNP2695222   T/C
4   158149103   yes   1100                                              rs8165371     A/G
4   160895624   yes   253             Cpn_4160895624                    rs8170786     A/G
4   164101895   yes   1112                                         ENSRNOSNP1761613   G/A
4   171152980   no    1124                                              rs8165839     A/G
4   174960526   no    1136                                         ENSRNOSNP1769095   C/T
4   182534077   no    437    gnl|ti|896557976_19866867123417_232   ENSRNOSNP1773289   C/T
4   183579386   no    1148                                              rs8155973     C/A
4   184675426   no    438           SHRSPc67c04_r1_563             ENSRNOSNP1776091   T/C
4   186573510   no    1160                                         ENSRNOSNP1778213   A/G
5   002285335   no    1172                                              rs8143665     C/T
5   002438043   yes   254            gko-76m2_rp2_b1_155           ENSRNOSNP1957651   T/C
5   005230907   yes   439          rat013_016_f22.q1ca_260             rs13448399     T/G
5   008432988   yes   255           gko-83p21_rp2_b1_295           ENSRNOSNP2790392   C/T
5   011200633   yes   1184                                         ENSRNOSNP1892190   G/A
5   013500275   yes   256             gko-70o16_fp2_b1_504         ENSRNOSNP2666294   A/G
5   017021061   yes   257       gnl|ti|842485902_50097256_425      ENSRNOSNP1951033   C/T
5   019065397   yes   1113                                         ENSRNOSNP2765940   T/G
5   024758623   yes   1125                                              rs8163476     C/G
5   026686753   yes   258             WKYc45f09_r1_89              ENSRNOSNP1960360   C/T
5   029805791   yes   1137                                         ENSRNOSNP1964810   C/A
5   031880351   yes   440                 J632948                  ENSRNOSNP2712309   C/G
5   035137291   yes   1149                                              rs8168290     T/C
5   039835852   yes   1161                                         ENSRNOSNP1982649   A/G
5   043195162   yes   259          rdahl-10g16_rp2_b1_468          ENSRNOSNP2647720   T/C
5   045391272   yes   1173                                         ENSRNOSNP1990734   T/G
5   047566697   yes   260           gko-96g14_fp2_b1_143           ENSRNOSNP1994261   G/A
5   051190345   no    1185                                         ENSRNOSNP1997778   T/C
5   055870664   yes   1102                                         ENSRNOSNP2648495   G/A
5   058332574   yes   261            WKYc69f05_r1_479              ENSRNOSNP2674002   T/C
5   061101163   yes   1114                                         ENSRNOSNP2719355   G/A
5   063930386   yes   262             Cpn_5063930386                    rs8156834     A/G
5   066283611   no    1126                                              rs8153461     G/A
5   068810072   yes   441    gnl|ti|897054721_19866868410669_308   ENSRNOSNP2790899   T/A
5   071006120   yes   442            rat105_002_k13.q1ma_302            rs8158625     C/T
5   071915533   no    1138                                         ENSRNOSNP2770766   T/A
5   073907931   yes   263          rdahl-21n23_fp2_b1_592          ENSRNOSNP2752109   C/T
5   076853652   yes   1150                                         ENSRNOSNP2030788   A/G
5   079495338   yes   264         rat108_009_b04.q1ca_368               rs8159792     T/C
5   082349335   yes   1162                                         ENSRNOSNP2037291   G/A
5   087208826   yes   1174                                         ENSRNOSNP2765583   C/T
5   090159814   yes   443            gko-32f9_rp2_b1_59            ENSRNOSNP2791092   T/C
5   094202106   yes   1186                                         ENSRNOSNP2054752   G/A
5   096763943   no    265    gnl|ti|896837924_19866867063561_219   ENSRNOSNP2058465   G/A
5   098164940   no    1103                                         ENSRNOSNP2714098   A/T
5   100242340   no    266           WKY-G-i-42f06_f1_272           ENSRNOSNP1877832   T/C
5   103475050   yes   1115                                         ENSRNOSNP2715987   C/T
5   106713527   no    267           gko-44f5_rp2_b1_282            ENSRNOSNP2791237   T/C
5   108839002   no    1127                                         ENSRNOSNP1888529   C/T
5   109856728   yes   268           rdahl-8b21_rp2_b1_548          ENSRNOSNP1889561   T/C
5   112476401   yes   269           SHRSPa04h04_r1_376             ENSRNOSNP1893141   T/C
5   115248769   yes   1139                                             rs13457116     A/T
5   119486484   yes   1151                                             rs13447842     C/A
5   121479303   yes   270          rdahl-25n23_fp2_b1_154          ENSRNOSNP1903758   C/T
5   124899137   yes   1163                                         ENSRNOSNP1909163   T/C
5   126940512   no    271            WKYc98c03_s1_683              ENSRNOSNP1911804   T/C
5   129926036   yes   1175                                             rs13457340     A/G
5   132772036   yes   272          rdahl-54o11_rp2_b1_466          ENSRNOSNP1917609   T/C
5   136072542   yes   273         rat013_004_b08.p1ca_518          ENSRNOSNP2791507   C/T
5   139846126   no    1187                                              rs8160912     T/C
5   141173487   yes   275    gnl|ti|896498444_19866867486423_271   ENSRNOSNP1926677   T/C
5   144814740   yes   1104                                         ENSRNOSNP2690567   G/A
5   147163722   yes   276           SHRSPa27g06_s1_67              ENSRNOSNP1933729   T/C
5   150198728   no    1116                                         ENSRNOSNP1937140   G/A
5   150949241   yes   444                 J534834                  ENSRNOSNP2791668   G/A
5   156075868   yes   1128                                              rs8171723     T/C
5   158085094   no    445         rat108_026_h06.p1ca_447              rs13450066     T/C
5   161571992   yes   1140                                         ENSRNOSNP2735609   A/C
5   167191382   yes   1152                                         ENSRNOSNP2652557   G/A
5   169967628   yes   277    gnl|ti|897028105_19866868285450_322   ENSRNOSNP1950836   T/C
5   172831800   yes   1164
6   004418670   yes   1176                                              rs8173809     C/T
6   007184882   yes   446                 J522168                  ENSRNOSNP2791911   A/G
6   010938237   yes   1188                                         ENSRNOSNP2791933   G/A
6   018532134   no    1105                                         ENSRNOSNP2116657   C/T
6   020470875   yes   278            WKYc64e09_s1_59               ENSRNOSNP2119365   T/C
6   026458168   no    1117                                         ENSRNOSNP2121857   T/C
6   034350151   yes   279           gko-58f18_rp2_b1_533           ENSRNOSNP2792030   T/C
6   036135620   yes   1129                                         ENSRNOSNP2126640   A/G
6   039738440   yes   280           SHRSPc48a06_r1_730             ENSRNOSNP2729159   T/C
6   042062689   yes   281           gko-118g2_rp2_b1_248           ENSRNOSNP2133634   T/C
6   045740293   yes   1141                                         ENSRNOSNP2669006   A/T
6   047975867   yes   282             rdahl-16k19_rp2_b1_260       ENSRNOSNP2140173   T/C
6   051835068   yes   283    gnl|ti|897055464_19866868185329_262   ENSRNOSNP2143971   T/C
6   054236229   yes   1153                                         ENSRNOSNP2690513   C/T
6   056865797   yes   284          rdahl-20p12_fp2_b1_160          ENSRNOSNP2150811   G/A
6   058889256   yes   447                  J527825                 ENSRNOSNP2792256   A/T
6   061834747   no    448          rdahl-13h16_fp2_b1_415          ENSRNOSNP2157137   T/G
6   063189206   no    1165                                         ENSRNOSNP2731883   C/T
6   064437011   no    449          rdahl-77h12_rp2_b1_521          ENSRNOSNP2160378   C/T
6   067724683   no    450           rdahl-10n12_rp2_b1_57          ENSRNOSNP2749914   T/C
6   070039596   no    451            gko-118l4_rp2_b1_482          ENSRNOSNP2726892   T/A
6   072502425   no    1177                                         ENSRNOSNP2169483   C/T
6   073355453   yes   285            rat106_015_f18.p1ca_409            rs8159324     C/T
6   074894731   yes   286    gnl|ti|896964944_19866868155160_263   ENSRNOSNP2172170   A/G
6   077885031   yes   287              gko-13f7_rp2_b1_439         ENSRNOSNP2792416   C/T
6   080924303   yes   1189                                         ENSRNOSNP2179144   A/G
6   083473235   yes   288           gko-13o2_fp2_b1_154            ENSRNOSNP2792454   C/T
6   085843360   yes   289           SHRSPa87f08_r1_472             ENSRNOSNP2187388   T/C
6   089065238   yes   452                 J683749                  ENSRNOSNP2190849   T/C
6   090244650   no    1106                                         ENSRNOSNP2722438   T/C
6   092136933   yes   290    gnl|ti|896684628_19866866856268_171   ENSRNOSNP2194580   C/T
6   093837741   yes   453    gnl|ti|896729563_19866867399101_328   ENSRNOSNP2196352   G/T
6   096214734   yes   291               WKYc68f06_s1_574           ENSRNOSNP2771275   A/G
6   099379576   yes   1118                                             rs13450824     A/T
6   101479940   yes   292         rat101_017_m06.q1ca_633              rs13449256     A/G
6   105586757   yes   293              Cpn_6105586757                   rs8172725     C/T
6   107837451   yes   1130                                              rs8161737     G/A
6   110227676   yes   294           SHRSPc64c04_s1_122             ENSRNOSNP2658039   A/G
6   113909893   yes   295           gko-18h1_rp2_b1_549            ENSRNOSNP2792728   C/T
6   117006942   yes   1142                                         ENSRNOSNP2083427   C/G
6   119869699   yes   296           WKY-G-i-37d07_r1_301           ENSRNOSNP2707666   T/C
6   122545223   yes   297            WKYe7h11_s1_175               ENSRNOSNP2093525   C/T
6   126258644   yes   1154                                             rs13450401     C/T
6   129241985   yes   298             Cpn_6129241985                    rs8156171     A/G
6   131975203   yes   299          rdahl-56i20_rp2_b1_118          ENSRNOSNP2730986   T/C
6   135115022   no    1166                                         ENSRNOSNP2735603   T/C
6   136836425   no    454                 J644055                  ENSRNOSNP2105173   C/T
7   009941086   yes   1190                                         ENSRNOSNP2793038   A/G
7   010846104   yes   1107                                         ENSRNOSNP2720615   G/T
7   013504218   yes   300           WKYOa48h07_s1_243              ENSRNOSNP2248188   C/T
7   019836599   yes   1119                                         ENSRNOSNP2265684   G/A
7   022336483   yes   301         rat103_007_a10.q1ca_220              rs13454862     A/G
7   024942278   yes   302         rat013_030_d05.q1ca_259               rs8152386     G/A
7   028086703   yes   1131                                              rs8145523     A/G
7   030891572   yes   303            WKYc06h05_r1_551              ENSRNOSNP2695260   G/A
7   033397853   yes   304            WKYc67c07_s1_451                  rs13453564     G/A
7   036442948   yes   305           gko-37h12_fp2_b1_126           ENSRNOSNP2793253   T/C
7   036688099   no    1143                                         ENSRNOSNP2793256   C/T
7   037793762   yes   306         rat102_034_g18.q1ca_351              rs13454648     G/A
7   040740012   yes   307             WKYc24f04_r1_278             ENSRNOSNP2777063   C/T
7   043709939   yes   1155                                         ENSRNOSNP2295423   T/C
7   047491941   yes   1167                                         ENSRNOSNP2300258   A/G
7   049490449   yes   455                 J504741                  ENSRNOSNP2793356   A/T
7   057060581   no    1179                                              rs8158861     G/A
7   060397471   yes   308           SHRSPa32b09_r1_568             ENSRNOSNP2307690   C/T
7   062229462   yes   309             Cpn_7062229462               ENSRNOSNP2793426   A/G
7   065101729   no    1191                                         ENSRNOSNP2314099   A/G
7   070713267   yes   310          gko-120d18_rp2_b1_250           ENSRNOSNP2761518   C/T
7   072733608   no    1108                                         ENSRNOSNP2317984   G/A
7   081012884   yes   1120                                              rs8167830     A/G
7   083305119   yes   311           SHRSPa61b11_r1_860             ENSRNOSNP2642758   C/T
7   086854847   yes   312             Cpn_7086854847                    rs8160067     G/A
7   090081323   yes   1132                                         ENSRNOSNP2338215   A/G
7   095807223   yes   313    gnl|ti|896794522_19866867034398_354   ENSRNOSNP2344693   C/T
7   098318988   yes   1144                                         ENSRNOSNP2660388   G/A
7   101649500   yes   314           rdahl-1c19_rp2_b1_142          ENSRNOSNP2204878   T/C
7   104464098   yes   315              Cpn_7104464098                   rs8167467     T/C
7   106774406   yes   1156                                         ENSRNOSNP2662944   T/A
7   110476792   yes   316           rdahl-16i12_rp2_b1_60          ENSRNOSNP2758700   T/C
7   112668446   yes   456                  J876227                 ENSRNOSNP2218932   G/T
7   115680727   yes   1168                                              rs8159302     T/C
7   118353203   yes   317            Cpn_7118353203                     rs8169394     A/G
7   121148690   yes   318           DS-g-a-10c09_f1_673            ENSRNOSNP2226824   T/C
7   124606598   yes   1180                                         ENSRNOSNP2231128   C/A
7   127007291   yes   319           SHRSPa98h12_r1_878             ENSRNOSNP2234639   A/G
7   130845108   yes   320             Cpn_7130845108                    rs8159412     A/G
7   133328485   yes   1192                                         ENSRNOSNP2245434   T/A
7   135707598   yes   321             Cpn_7135707598                    rs8164458     T/C
7   139954435   yes   322           SHRSPa54d08_s2_78              ENSRNOSNP2683282   T/C
7   142150324   yes   1193                                         ENSRNOSNP2675429   A/G
8   002254939   yes   457           gko-37k2_fp2_b1_591            ENSRNOSNP2388262   A/G
8   003826916   no    1205                                         ENSRNOSNP2794176   C/T
8   004667396   yes   323            rat103_037_o03.p1ca_370           rs13449127     G/A
8   008349684   yes   324    gnl|ti|896883002_19866868310900_153   ENSRNOSNP2441491   C/T
8   011193100   no    1217                                         ENSRNOSNP2366179   A/G
8   013689550   yes   458           rdahl-16l3_fp2_b1_298          ENSRNOSNP2385632   C/A
8   018808604   no     8                   J559774                 ENSRNOSNP2794263   T/A
8   024349739   yes    9          rat109_042_n23.q1ca_248          ENSRNOSNP2388715   C/T
8   027926394   no    1229                                              rs8172893     T/C
8   028450553   yes   325             rdahl-82f18_rp2_b1_242       ENSRNOSNP2664265   A/G
8   031077049   yes   459                     J876655              ENSRNOSNP2704124   T/A
8   034040414   yes   326    gnl|ti|896697522_19866868458705_247   ENSRNOSNP2396754   T/C
8   034370425   no    1241                                              rs8167373     C/T
8   036215760   yes   460           DS-g-a-35c06_f1_550            ENSRNOSNP2736575   A/G
8   038885283   yes   327           SHRSPc30h02_r1_822             ENSRNOSNP2401119   T/C
8   043255860   no    1253                                              rs8143759     A/T
8   044043629   yes   328            gko-23j8_rp2_b1_266           ENSRNOSNP2794427   T/C
8   048844101   no    461         rat104_060_o03.q1ca_278              rs13447831     A/G
8   050160706   no    1265                                         ENSRNOSNP2676219   G/A
8   051764984   yes   462         rat105_028_e22.p1ca_369              rs13457306     A/G
8   055310332   yes   329         rat109_016_p06.q1cb_767               rs8173865     T/C
8   057318916   yes   1277                                              rs8163435     T/C
8   060049464   yes   463           gko-38a18_fp2_b1_223           ENSRNOSNP2425774   A/G
8   065095744   yes   330           SHRSPc26b09_r1_321             ENSRNOSNP2739051   C/T
8   065256739   no    1194                                         ENSRNOSNP2430743   T/C
8   073479860   no    1206                                         ENSRNOSNP2693035   G/A
8   077767696   yes   464             Cpn_8077767696               ENSRNOSNP2436579   T/A
8   079334949   yes   331          gko-105e22_fp2_b1_428           ENSRNOSNP2730567   A/G
8   082384701   yes   1218                                         ENSRNOSNP2439777   C/T
8   085449591   yes   332            SHRSPc52f05_s1_497            ENSRNOSNP2761396   T/C
8   087718630   yes   333           rdahl-12d12_rp2_b1_82          ENSRNOSNP2447307   G/A
8   089044009   no    1230                                         ENSRNOSNP2747662   A/G
8   090626521   yes   334            WKYc49c10_s1_68               ENSRNOSNP2451457   A/G
8   092481077   yes   465               J1310409                   ENSRNOSNP2454005   A/T
8   095617159   yes   1242                                         ENSRNOSNP2457486   T/C
8   098305132   yes   335             gko-40g11_fp2_b1_567         ENSRNOSNP2461554   T/C
8   100673928   yes   336    gnl|ti|896507703_19866866873596_304   ENSRNOSNP2351166   G/A
8   103976387   yes   1254                                         ENSRNOSNP2355089   A/G
8   106089950   yes   337             gko-84h5_rp2_b1_42           ENSRNOSNP2795007   T/C
8   109109215   yes   338          rat105_024_l02.p1ca_454             rs13457176     G/A
8   111853052   yes   1266                                              rs8171225     C/T
8   116684830   yes   340           SHRSPc26e05_r1_537             ENSRNOSNP2371356   G/A
8   119763365   yes   1278                                         ENSRNOSNP2375015   T/C
8   122175102   yes   341             rdahl-48i19_fp2_b1_143       ENSRNOSNP2378259   T/C
8   125881580   yes   342    gnl|ti|896698597_19866868018381_199   ENSRNOSNP2382409   C/T
9   000531774   no    1207                                             rs13447862     G/A
9   002376500   yes   343           gko-94g1_rp2_b1_109            ENSRNOSNP2496083   C/T
9   009058468   yes   1219                                         ENSRNOSNP2795318   T/C
9   011203996   yes   344                Cpn_9011203996                 rs8154212     G/A
9   013788149   yes   345    gnl|ti|897032587_19866867411848_266   ENSRNOSNP2795389   G/A
9   017179073   yes   1231                                         ENSRNOSNP2487287   G/C
9   019291001   yes   346           gko-8g23_fp2_b1_329            ENSRNOSNP2795422   T/C
9   022413572   yes   1243                                         ENSRNOSNP2493759   C/A
9   027351512   yes   347    gnl|ti|896615548_19866867216021_409   ENSRNOSNP2503128   C/T
9   034031666   no    1255                                         ENSRNOSNP2507322   G/A
9   040211947   no     10                 J512776                  ENSRNOSNP2795527   A/G
9   043066039   yes   1267                                              rs8160130     G/A
9   045395756   yes   1279                                         ENSRNOSNP2652484   A/G
9   047745902   yes   348          gko-91m15_fp2_b1_294            ENSRNOSNP2515251   C/T
9   051530444   yes   1196                                         ENSRNOSNP2732515   A/G
9   054021743   yes   349           SHRSPa42e05_r1_796             ENSRNOSNP2523741   A/G
9   057829798   yes   1208                                         ENSRNOSNP2778509   G/A
9   059708371   yes   350    gnl|ti|896509238_19866866840409_247   ENSRNOSNP2533492   A/G
9   064324186   yes    11                    J700472               ENSRNOSNP2535391   T/G
9   068097757   yes   1220                                         ENSRNOSNP2745234   C/T
9   069049280   yes   1232                                         ENSRNOSNP2538789   A/G
9   071302925   no    351             Cpn_9071302925               ENSRNOSNP2795785   A/G
9   079582613   no    1244                                         ENSRNOSNP2651878   C/T
9   081816446   yes   352    gnl|ti|896617320_19866867375924_299   ENSRNOSNP2552367   C/T
9   086585973   no    1256                                         ENSRNOSNP2645790   G/A
9   090974618   no     12                 J687683                  ENSRNOSNP2558651   G/T
9   094672377   yes   1268                                         ENSRNOSNP2707167   G/A
9   096904895   yes   353           gko-19f8_rp2_b1_523            ENSRNOSNP2795983   C/T
9   099976905   yes   1280                                         ENSRNOSNP2739849   T/C
9    103521444   yes   354         rat105_024_b23.p1ca_428               rs8157008     T/C
9    106447461   yes   1197                                         ENSRNOSNP2471035   C/A
9    109879299   yes   467                 J639481                  ENSRNOSNP2472567   C/T
9    112329883   yes   1209                                         ENSRNOSNP2475345   A/T
10   003067952   yes    51            gko-6j19_rp2_b1_658           ENSRNOSNP2796093   C/T
10   005989172   yes   1221                                         ENSRNOSNP322916    A/G
10   008131820   yes    52           SHRSPa56e03_r1_340             ENSRNOSNP2722003   T/C
10   011192300   no    1233                                         ENSRNOSNP2725565   G/C
10   014489522   yes    53         rat106_030_p02.q1ca_609               rs8170995     T/C
10   016753113   yes    54             Cpn_10016753113                   rs8167128     C/T
10   019065385   yes   1245                                         ENSRNOSNP279474    C/T
10   021443421   yes    55             Cpn_10021443421              ENSRNOSNP282548    G/A
10   024935656   yes   1257                                         ENSRNOSNP287101    G/C
10   028060758   yes    56           rdahl-78j1_rp2_b1_447          ENSRNOSNP291871    C/T
10   032079597   yes   1269                                         ENSRNOSNP296448    A/G
10   034855258   yes   375            WKYc46b05_r1_120              ENSRNOSNP299431    T/C
10   037954559   yes   1281                                         ENSRNOSNP2729501   A/G
10   041468986   yes    57            WKYa70d10_s1_732              ENSRNOSNP306830    T/C
10   044464087   yes   1198                                         ENSRNOSNP309892    A/G
10   046998198   yes    58             Cpn_10046998198                   rs8165048     T/C
10   048962052   yes    59            gko-76o4_fp2_b1_28            ENSRNOSNP314313    C/T
10   050887582   no    1210                                         ENSRNOSNP316154    A/G
10   052179164   yes    60          gko-121n18_rp2_b1_502           ENSRNOSNP2796607   A/G
10   054102210   yes    61          WKY-G-i-21a11_f1_491            ENSRNOSNP2759867   T/C
10   057261171   yes   1222                                         ENSRNOSNP2656578   A/C
10   062950570   yes   1234                                             rs13447785     C/T
10   065511005   yes   376             gko-54p13_fp2_b1_286         ENSRNOSNP2796748   T/C
10   068730129   yes    63       gnl|ti|842485733_49984395_525      ENSRNOSNP330809    C/T
10   069963163   no    1246                                         ENSRNOSNP331749    T/C
10   071663694   yes    64    gnl|ti|896783259_19866868138970_309   ENSRNOSNP332677    G/A
10   075226367   no    1258                                         ENSRNOSNP335485    C/T
10   079529065   yes    65    gnl|ti|896527502_19866867615276_348   ENSRNOSNP339766    A/G
10   082102231   yes   1270                                         ENSRNOSNP2702269   T/C
10   087242415   yes    66             Cpn_10087242415                   rs8143304     T/C
10   089822839   no    1282                                              rs8171226     T/C
10   090109697   yes    67          rat108_011_l08.q1ca_602              rs8170329     C/T
10   093011723   yes   377          rat108_044_f14.p1cb_767              rs8154780     T/C
10   096000878   yes   1199                                             rs13454439     T/C
10   098749045   yes   378          rat110_031_f02.p1ca_633             rs13452382     A/C
10   102862125   yes   1211                                              rs8147992     G/C
10   108734458   yes   379          gko-120i20_rp2_b1_124           ENSRNOSNP271251    T/G
10   109996764   no    1223                                              rs8146462     A/G
11   008975264   yes   1235                                              rs8162166     T/G
11   011494897   yes    68           gko-31i2_fp2_b1_439            ENSRNOSNP2797188   G/A
11   016000396   yes    69           gko-66n3_fp2_b1_434            ENSRNOSNP367585    T/C
11   018507292   yes   1247                                         ENSRNOSNP371280    G/A
11   021052896   yes   380           WKYOa73g01_s1_209              ENSRNOSNP374770    T/C
11   027990069   yes   1259                                         ENSRNOSNP2773946   G/A
11   030532498   yes    70    gnl|ti|896817623_19866855417273_318   ENSRNOSNP389082    T/C
11   033515208   yes    71               WKYc14g07_r1_771           ENSRNOSNP392514    T/C
11   037137841   yes   1271
11   041560479   yes    13                 J509382                  ENSRNOSNP2797457   T/C
11   044387299   no     14                 J483094                  ENSRNOSNP2797477   C/T
11   050389784   no    1200
11   056334690   no    1212                                             rs13450010     G/A
11   064497121   yes    73           rdahl-45l6_rp2_b1_611          ENSRNOSNP418863    T/C
11   065646004   no    1224                                              rs8147831     G/A
11   067494411   yes    74               Cpn_11067494411                 rs8156393     A/G
11   070121003   yes    75              SHRSPc13h11_s1_754          ENSRNOSNP424794    T/C
11   072556117   yes    76    gnl|ti|896512965_19866867047045_316   ENSRNOSNP2797696   G/A
11   076113425   no    1248                                             rs13447786     T/A
11   077560490   yes    77    gnl|ti|896507830_19866866704857_399   ENSRNOSNP433758    T/C
11   079724076   yes    78             rat110_019_l12.p1ca_656          rs13452084     G/A
11   082478350   yes    79                 Cpn_11082478350               rs8147406     T/C
11   086115520   no    1260                                         ENSRNOSNP441277    G/A
12   001591146   yes   1272                                         ENSRNOSNP2683122   A/C
12   003680125   yes    80             Cpn_12003680125              ENSRNOSNP2797842   T/C
12   006627121   yes   1284                                         ENSRNOSNP2715898   C/T
12   010042041   yes    81             Cpn_12010042041                   rs8162548     T/C
12   012420583   yes   1201                                         ENSRNOSNP2656532   T/G
12   017842937   yes   1213                                              rs8162524     T/C
12   021360235   yes   382                  J1285611                ENSRNOSNP461035    T/C
12   023481777   yes    82            gko-1j18_fp2_b1_141           ENSRNOSNP2798008   T/C
12   024014906   no    1225                                         ENSRNOSNP2647566   C/A
12   027041023   yes   383                 J642268                  ENSRNOSNP464741    A/G
12   030131355   yes   1237                                              rs8164143     A/G
12   032365258   yes    83           SHRSPa25b05_s1_30              ENSRNOSNP2664483   A/G
12   035310082   yes   1249                                              rs8164814     A/G
12   037651304   yes    84           SHRSPa41g11_r1_959             ENSRNOSNP473801    C/T
12   041421266   no    1261                                              rs8148040     A/G
12   046591999   yes   1273                                              rs8172732     T/C
13   003256258   yes   1285                                         ENSRNOSNP2772701   T/G
13   007165599   yes    86            DahlSc01e09_r1_784            ENSRNOSNP2683565   C/T
13   009060056   yes    87           gko-88c17_fp2_b1_438           ENSRNOSNP579903    C/T
13   012754069   yes   1202                                         ENSRNOSNP496040    C/A
13   017962195   yes   385          rdahl-64n16_rp2_b1_446          ENSRNOSNP505109    T/C
13   020299432   yes    88          gko-103n21_rp2_b1_146           ENSRNOSNP2657246   T/C
13   022773475   yes    89            WKYc110g10_s1_74              ENSRNOSNP2692276   C/T
13   024824555   yes    90           WKY-G-i-11f07_f1_949           ENSRNOSNP2756085   G/A
13   027836201   yes    91           gko-75m4_fp2_b1_692            ENSRNOSNP2709418   T/C
13   030023153   yes    92           rdahl-75k13_fp2_b1_81          ENSRNOSNP2772163   A/G
13   031902385   no    1214                                         ENSRNOSNP2650550   C/T
13   033037612   yes    93               WKYc64f10_r1_179           ENSRNOSNP513855    C/T
13   035237509   yes    94    gnl|ti|897042615_19866868248188_318   ENSRNOSNP518150    G/A
13   038395942   no    1226                                         ENSRNOSNP522465    G/A
13   040151607   yes    95           gko-49g21_fp2_b1_232           ENSRNOSNP2798514   T/C
13   045258577   yes    96            DS-g-c-03a11_f2_210           ENSRNOSNP2651215   T/C
13   048407181   no    1238                                         ENSRNOSNP2764729   C/T
13   051530303   yes    97          gko-116g16_fp2_b1_425           ENSRNOSNP2657162   T/C
13   053570321   yes   1250                                         ENSRNOSNP2756531   A/C
13   060093452   no    1262                                         ENSRNOSNP2651621   G/C
13   064376824   yes    98    gnl|ti|896803680_19866866973910_282   ENSRNOSNP551658    C/T
13   066200380   yes   1274                                         ENSRNOSNP2757719   G/A
13   068151289   yes   386         rat106_013_p24.p1ca_496               rs8152742     T/C
13   072001540   no    1286                                             rs13454081     G/A
13   077933937   no    1203                                         ENSRNOSNP567188    T/A
13   083837734   yes   1215                                             rs13453302     G/A
13   090733073   yes   1227                                              rs8161225     A/G
13   094100642   no    1239                                         ENSRNOSNP584913    G/A
13   095095370   yes    99           gko-89m6_fp2_b1_102            ENSRNOSNP2798959   C/T
13   098331254   yes   100           gko-90g9_fp2_b1_594            ENSRNOSNP2798966   T/C
14   001613874   yes   1251                                              rs8171023     A/G
14   004739911   yes   101           gko-14n15_rp2_b1_193           ENSRNOSNP671419    T/C
14   006637297   yes   102             Cpn_14006637297                   rs8156073     A/G
14   009169940   yes   1263                                         ENSRNOSNP724607    G/A
14   012091865   yes   103    gnl|ti|896820323_19866867304800_293   ENSRNOSNP604672    G/A
14   013776720   yes   104             SHRSPa21d10_r1_1010          ENSRNOSNP606991    G/A
14   017032077   yes   1275                                              rs8159779     T/C
14   019864570   yes   387                 J668454                  ENSRNOSNP615565    G/T
14   023845494   yes   1287                                         ENSRNOSNP2731992   G/A
14   027234971   yes   105    gnl|ti|896496907_19866868291408_280   ENSRNOSNP628127    C/T
14   029803161   yes   1204                                         ENSRNOSNP632990    C/T
14   032910451   yes   106           SHRSPc56f04_r1_762             ENSRNOSNP2722599   A/G
14   036607884   yes   1216                                              rs8161381     C/A
14   039706672   yes   107         rat105_030_n10.p1ca_387              rs13457393     A/G
14   043256177   yes   1228                                         ENSRNOSNP654848    T/C
14   047376732   yes   1240                                         ENSRNOSNP2783157   A/G
14   050613160   yes   388                    J340422               ENSRNOSNP2700327   A/G
14   053606421   yes   108    gnl|ti|896810376_19866866979396_282   ENSRNOSNP684193    A/G
14   056621155   yes   1252                                         ENSRNOSNP688796    T/C
14   059051496   yes   109           gko-33n9_rp2_b1_177            ENSRNOSNP2799525   T/C
14   062880129   yes   1264                                              rs8155825     T/C
14   068104980   yes   111           gko-30m20_fp2_b1_22            ENSRNOSNP704911    C/T
14   074692011   yes   1288                                         ENSRNOSNP710698    G/A
14   077659592   yes   112            DS-g-a-06e04_f1_193           ENSRNOSNP2648366   C/T
14   079624545   yes   113         rat110_020_h10.p1ca_530               rs8161091     C/T
14   081163941   no    1289                                         ENSRNOSNP719512    T/C
14   088706702   no    1301                                         ENSRNOSNP722887    C/T
14   097125179   yes   1313                                         ENSRNOSNP727490    A/G
14   099272073   yes   114               WKYc83d03_r1_560           ENSRNOSNP2697328   T/C
14   101857003   yes   115    gnl|ti|896541660_19866867286917_124   ENSRNOSNP2799858   C/T
14   104633863   yes   1325                                              rs8158940     T/A
14   108229489   yes   389                 J880401                  ENSRNOSNP597108    A/G
14   111988544   yes   1337                                         ENSRNOSNP602802    G/A
15   001718639   no    1349                                         ENSRNOSNP2737885   T/A
15   010627062   no    1361                                         ENSRNOSNP740745    C/A
15   013633171   yes   116            gko-6b5_rp2_b1_51             ENSRNOSNP2800032   T/C
15   016696030   yes   1373                                         ENSRNOSNP749686    A/G
15   019067906   yes   117           rdahl-7l12_rp2_b1_221          ENSRNOSNP753158    A/G
15   022822009   no    1290                                             rs13455041     A/C
15   024278467   yes   118             gko-9i16_fp2_b1_53           ENSRNOSNP2800116   A/G
15   027359058   no     15            gko-94j3_fp2_b1_221           ENSRNOSNP2800139   T/C
15   032631605   no     16          rat104_027_l08.q1ca_357         ENSRNOSNP763845    T/C
15   037823346   yes   119           gko-85b11_fp2_b1_478           ENSRNOSNP765333    C/T
15   043492038   no    1302                                         ENSRNOSNP2738128   T/C
15   045542631   yes   120       gnl|ti|842491068_50710873_313           rs8163696     T/C
15   051117386   yes   1314                                         ENSRNOSNP2743099   G/A
15   053033470   yes   121          gko-114h20_fp2_b1_183           ENSRNOSNP2690953   T/C
15   055985058   yes   122           SHRSPc31g04_r1_824             ENSRNOSNP2655608   T/C
15   061515939   no    1326                                              rs8170699     A/G
15   064826600   yes   123            rdahl-73j3_fp2_b1_88          ENSRNOSNP2694512   C/T
15   072019331   yes   124           gko-117h4_fp2_b1_495           ENSRNOSNP791502    T/C
15   074176447   yes   125            gko-39b5_fp2_b1_595           ENSRNOSNP793626    G/A
15   077545391   no    1338                                         ENSRNOSNP2753115   T/A
15   079967694   yes   1350                                         ENSRNOSNP2663798   T/C
15   082591135   yes   126          rdahl-22k21_fp2_b1_745          ENSRNOSNP2704347   C/T
15   085627752   no    1362                                         ENSRNOSNP811620    G/A
15   091134944   yes   127          rdahl-22l18_fp2_b1_342          ENSRNOSNP2744363   C/T
15   094355935   yes   1374                                         ENSRNOSNP822383    G/C
15   096241628   yes   128    gnl|ti|896926491_19866868247776_332   ENSRNOSNP2800555   C/T
15   099334907   yes   129              WKY-G-j-46f07_f1_976        ENSRNOSNP830896    T/C
15   101925111   yes   1291                                         ENSRNOSNP735010    A/G
15   105596780   yes   130             Cpn_15105596780                  rs8157955      A/G
15   108744933   yes   1303
16   003416660   yes   1315                                         ENSRNOSNP2800685   A/G
16   005374192   yes   131            DahlSa02a08_r1_355            ENSRNOSNP908192    A/G
16   008574657   yes   1327                                         ENSRNOSNP931231    T/G
16   013533715   yes   1339                                         ENSRNOSNP838625    G/A
16   015624951   yes   390          rdahl-15l16_fp2_b1_187          ENSRNOSNP841608    A/G
16   019189599   yes   1351                                              rs8163216     T/G
16   022330845   no    391             Cpn_16022330845              ENSRNOSNP854953    A/G
16   024757742   yes   1363                                         ENSRNOSNP858540    C/T
16   028073717   yes   132    gnl|ti|896505554_19866866875850_333   ENSRNOSNP2800917   C/T
16   031874440   yes   133              WKYOa02e10_r1_523           ENSRNOSNP2679562   C/T
16   037076034   yes   392                    J560799               ENSRNOSNP2800954   C/T
16   039671284   no    1292                                              rs8168264     G/A
16   045498747   yes   1304                                         ENSRNOSNP2778911   T/G
16   054664607   no    1316                                         ENSRNOSNP2801061   G/C
16   059287995   yes   1328                                         ENSRNOSNP2781185   T/A
16   065015297   yes   1340                                         ENSRNOSNP2732371   C/T
16   070908169   yes   1352                                         ENSRNOSNP2752095   A/G
16   073031634   yes   134             Cpn_16073031634                   rs8147747     C/T
16   076841235   no    1364                                         ENSRNOSNP2685762   T/C
16   079975736   no     18                 J587118                  ENSRNOSNP2801248   G/A
16   087513598   no    1293                                         ENSRNOSNP933164    T/A
17   001996364   no    1305                                         ENSRNOSNP947838    A/T
17   003823042   no    1317                                              rs8162243     C/T
17   011830347   yes   1329                                         ENSRNOSNP2691142   T/C
17   014482237   yes   135           gko-27d6_rp2_b1_445            ENSRNOSNP2801414   C/T
17   018522152   yes   1341                                         ENSRNOSNP2671077   A/G
17   020786675   yes   136            WKYc21a04_s1_635              ENSRNOSNP949169    C/T
17   024434479   yes   1353                                         ENSRNOSNP2677713   T/C
17   027691335   yes   137             Cpn_17027691335                   rs8167628     C/T
17   029714977   yes   1365                                         ENSRNOSNP961913    A/G
17   032657905   yes   138          rdahl-100h14_rp2_b1_168         ENSRNOSNP965810    T/C
17   035180554   yes   393           SHRSPd03d01_s1_155             ENSRNOSNP2777682   T/A
17   038175280   yes   139            WKYOa47g05_s1_595             ENSRNOSNP2754320   T/C
17   041805286   yes   1294                                         ENSRNOSNP2774567   G/A
17   044747291   yes   140           WKY-G-f-09f05_f1_915           ENSRNOSNP2754381   T/C
17   047748626   yes   1306                                         ENSRNOSNP2734049   T/G
17   050199152   yes   394                 J338859                  ENSRNOSNP985056    C/T
17   054078191   yes   1318                                         ENSRNOSNP990599    C/G
17   060427997   yes   1330                                         ENSRNOSNP996636    T/C
17   063788042   yes   396                 J526990                  ENSRNOSNP1000379   A/G
17   066871781   yes   1342                                         ENSRNOSNP1004233   T/C
17   069382663   yes   141               WKYc20e09_s1_407           ENSRNOSNP1009965   A/G
17   072714014   no    397    gnl|ti|896533487_19866867356509_273   ENSRNOSNP1013457   T/C
17   077359812   yes   1366                                         ENSRNOSNP1019554   T/C
17   082366276   yes   142            WKYc46d04_r1_621              ENSRNOSNP1021519   T/C
17   084939422   yes   143            Cpn_17084939422                    rs8167434     A/G
17   087277918   yes   144            Cpn_17087277918                    rs8160953     T/C
17   089031060   no    1295                                         ENSRNOSNP1030971   G/A
17   090937924   yes   145           WKYOa64g08_s1_292              ENSRNOSNP1033671   T/C
17   092832542   yes   146          rdahl-65n17_rp2_b1_266          ENSRNOSNP2754630   T/C
17   095848964   yes   1307                                         ENSRNOSNP2780700   C/T
18   002230191   no    1319                                             rs13449181     G/A
18   003523854   no    398                 J558774                  ENSRNOSNP2802200   G/A
18   005871283   no    399         rat101_031_b14.p1ca_428              rs13447794     T/C
18   009908642   yes   1331                                         ENSRNOSNP2767013   C/T
18   012031594   no    1343                                         ENSRNOSNP1045219   A/G
18   015480840   no    401                J484571                   ENSRNOSNP1050304   A/G
18   017570230   yes   147            WKYc16c08_s1_647              ENSRNOSNP1052877   A/G
18   021661309   no    1355                                         ENSRNOSNP1057845   C/T
18   026310939   yes   1367                                         ENSRNOSNP2668259   A/G
18   032271147   no    1379                                              rs8169651     T/C
18   036823716   no    1296                                         ENSRNOSNP2694868   T/C
18   040879034   no     19                 J688777                  ENSRNOSNP2746190   C/T
18   048434791   yes   1320                                         ENSRNOSNP1073533   C/T
18   050929529   yes   148    gnl|ti|896690050_19866866867645_289   ENSRNOSNP1076360   A/G
18   053978385   no    1332                                         ENSRNOSNP1079448   T/A
18   054453995   yes   149           SHRSPa39e07_r1_458             ENSRNOSNP1080260   G/A
18   061679610   yes   1344                                         ENSRNOSNP1084298   T/C
18   064092507   yes   150            gko-80j24_rp2_b1_98           ENSRNOSNP2802679   C/T
18   064691388   no    1356                                              rs8161767     C/T
18   066472047   yes   151           gko-54h1_fp2_b1_226            ENSRNOSNP1090438   A/G
18   069260244   no    402                 J523560                  ENSRNOSNP2802734   A/G
18   071728843   no    152           DS-g-a-45f04_f1_681            ENSRNOSNP1097342   A/G
18   074157797   yes   153            Cpn_18074157797                    rs8167879     T/C
18   074418865   no    1368                                              rs8143445     A/G
18   077502278   yes   1380                                         ENSRNOSNP2802790   C/T
18   082639735   yes   154            WKYc52c06_s1_259              ENSRNOSNP2656573   A/G
18   085589351   yes   1297                                         ENSRNOSNP2650336   T/G
19   009495962   yes   1321                                         ENSRNOSNP1142513   T/G
19   012471644   yes   155            WKYc14g02_s1_645              ENSRNOSNP1110974   T/C
19   018044986   yes   1345                                         ENSRNOSNP1121234   C/T
19   021095900   yes   404              SHRSPc33b05_r1_166          ENSRNOSNP1121914   A/G
19   022729938   no    405    gnl|ti|896932857_19866868188270_296   ENSRNOSNP2803050   T/C
19   025795055   yes   156               Cpn_19025795055                 rs8163892     A/G
19   030040203   no    1357                                              rs8173311     C/T
19   033673339   yes   1369                                         ENSRNOSNP1131224   A/T
19   038941406   yes   406    gnl|ti|896615379_19866867112398_294   ENSRNOSNP2803162   A/C
19   041190381   yes   1381                                         ENSRNOSNP1134063   A/C
19   045430433   yes    20                 J679042                  ENSRNOSNP2656382   G/C
19   049524696   no    1298                                         ENSRNOSNP2645383   G/A
19   052682098   no    407           WKY-G-j-23b05_f1_216           ENSRNOSNP2660156   G/A
19   055415520   yes   1310                                         ENSRNOSNP2803309   A/T
20   001409180   yes   1322                                         ENSRNOSNP2724339   A/G
20   004071738   yes   204         rat013_032_c12.p1ca_658              rs13448591     A/G
20   008182794   yes   1334                                         ENSRNOSNP1530182   C/A
20   010751145   yes   205             Cpn_20010751145              ENSRNOSNP1470284   T/C
20   014757476   yes   1346                                         ENSRNOSNP1475306   A/G
20   017137501   yes   206           SHRSPa36b02_r1_807             ENSRNOSNP1479846   C/T
20   019701050   no    1358                                         ENSRNOSNP2735228   G/A
20   027717809   yes   1370                                         ENSRNOSNP2803595   A/G
20   029751648   yes   207         rat102_030_o16.p1ca_264              rs13454528     A/G
20   032233820   yes   208           SHRSPc18c04_r1_600             ENSRNOSNP1490105   A/G
20   035422202   yes   1382                                              rs8160806     T/A
20   040995478   yes   209    gnl|ti|896891593_19866868469253_302   ENSRNOSNP1506832   A/G
20   043297520   no    1299                                              rs8161176     T/G
20   043807524   yes   210           SHRSPa69g10_r1_128             ENSRNOSNP1512675   C/T
20   049189263   no    1311                                         ENSRNOSNP2760489   T/C
20   051411129   yes   211    gnl|ti|896995583_19866867446482_267   ENSRNOSNP1521501   T/C
20   054874641   yes   1323                                              rs8168162     A/G
X    000492306   yes   1335                                         ENSRNOSNP2762223   C/T
X    003531573   yes   355           WKY-G-i-24g03_r1_706           ENSRNOSNP2614285   G/A
X    006153902   yes   1347                                         ENSRNOSNP2741427   A/G
X    008922540   yes   356               DS-g-a-37a11_f1_326        ENSRNOSNP2636245   C/T
X    011514689   yes   468    gnl|ti|896790284_19866867140167_293   ENSRNOSNP2581284   A/C
X    013325440   yes   469             rdahl-80h16_rp2_b1_219       ENSRNOSNP2708377   G/A
X    015976128   yes   357               rdahl-4a9_fp2_b1_23        ENSRNOSNP2600461   A/G
X    019370278   yes   470    gnl|ti|896817369_19866855412222_243   ENSRNOSNP2603306   A/G
X    022264334   no    1371                                              rs8157581     T/C
X    024382167   no    472           gko-50k12_fp2_b1_479           ENSRNOSNP2803942   A/C
X    026606667   yes   473             Cpn_21026606667                   rs8162172     T/C
X    029129095   yes   358           gko-20p8_fp2_b1_330            ENSRNOSNP2803963   A/G
X    032309204   yes   1383                                         ENSRNOSNP2731745   A/C
X    035698931   yes   359           WKY-G-j-36g07_r1_138           ENSRNOSNP2707151   T/C
X    037889392   yes   1300                                         ENSRNOSNP2614897   T/C
X    040248670   yes   474             rdahl-63b21_fp2_b1_189       ENSRNOSNP2689818   G/A
X    042299207   yes   475    gnl|ti|896451949_19866867643377_247   ENSRNOSNP2618937   G/T
X    044849233   yes   476              gko-39p12_fp2_b1_532        ENSRNOSNP2621607   G/C
X    047655803   no    1312                                         ENSRNOSNP2732070   G/A
X    048285290   yes   360           gko-77l19_fp2_b1_254           ENSRNOSNP2751745   T/C
X    057740097   no     21                  J337098                 ENSRNOSNP2628564   A/G
X    063031901   no     22                 J1285364                 ENSRNOSNP2755384   G/A
X    086209156   yes    1                                           ENSRNOSNP2777978   A/G
X    096457403   yes   1336                                         ENSRNOSNP2708279   C/T
X    100174923   yes   477                 J675964                  ENSRNOSNP2567774   T/G
X    102627779   yes   478                 J636803                  ENSRNOSNP2700887   T/C
X    108613039   yes   1348                                         ENSRNOSNP2576513   C/T
X    112483874   yes   361           gko-41h1_fp2_b1_590            ENSRNOSNP2804174   C/T
X    116110562   yes   1360                                         ENSRNOSNP2722495   T/G
X    131733064   yes   362    gnl|ti|896803151_19866867010504_313   ENSRNOSNP2587648   G/A
X    133938197   no    1372                                         ENSRNOSNP2590098   G/A
X    137830540   yes   363           WKY-G-j-05h08_r1_195           ENSRNOSNP2736169   C/T
X    139271672   no    479                J505648                   ENSRNOSNP2804234   G/A
X    146032693   no    1384                                         ENSRNOSNP2731135   T/C
                                      sequence
CCTTTGCAACTTACTCTTTCTCTCCCTCTCCCTATCTCCC[T/C]CTTCTTCATGGTGCTAAGGATTGAACCCAAGAACTTATAC
TGTCAGGAACTATCCTGAATGATTACTGTAAGTTAACAAA[C/T]GTTGTAAAGAAGGACAGATTGAGTACAATAATTCTCATTT
AAGGAAAAAAAAACCCAGAGTAATAGATCCTTATTTTCCC[C/T]GAATACAGTATATCCATTATTTTTCATATGATTGTGACAA
AATTCTTTCTTTTATTAACCACTGGTCATCACAGTGCCTC[C/A]CATGATCTTAACACCATCCTTTGCTGCAGCTAGGAAGATC
GTCCATGGCCAATCAGACCTGGCTGGCAGCTGATGTGGGT[T/C]CTGCAGAAGTGTGTGTGTGCAGAAAAGCAGCTGGGAACAG
AAAAGAACAAATACTACATCCTCTTTCATGACGCAAGTCT[G/A]TTTCCTGTATCCATACAAACACGAGCTCTTACTTGTTCTC
ATACCGATATGGAGAAAAGCTGTGCTCAGACTTTTAGCCC[A/G]AAACGGGATATGTCATTTTAAGTCATTTCTTTTGTCAGTG
AGGAATGTTAAAATGTAAATGGAAAATAGAGAAGTAGGGC[G/A]GGTCCTTAATAATTTGAAGCAAAGTTTGGATATGGTAAGT
TAACAATACCTTCAGGAGTATGAGAGAAGCAGTGCTGGGG[T/C]GGAGGGAGATGCCAAACTGGGACGCAATTTTATCCCGGAA
AATAATGTACGCTTATACCACAGTATAAAGCTTCAGATAA[T/C]TTCTATCATTTATACTTACCAATATTATACATTATACACA
GCATGGTGAGCAGGGAAGAAGGATGCTGATTCTATACTGC[G/A]TGCTGGAATGTGGCCCATTCACACCTCAGGAGCCATGATC
ACCAAACATGGTCCCAGCTGAGCCAATACCTCTACGTGTC[T/C]ATAGGGCAAGCGAATGAAAGAGTGAATATGAATCAAGTCT
AAGACTAATATTGTTAACAAGACAAAGCCCTGAAGTACAC[A/G]ATGCTTCACAGGACAGGCTCACCATCGCCATCGTGTGGCC
CTGACTGTCCTGTGACTGTCAGAAGAATGTTGTAGCTACA[A/G]AGTGCCTCTTAGGTTCTGTCACTGATGCCTCAGAGTTGGA
CAGGCCCCAGAACTTCTTCGGATATAGGAGTCCAGGTCTG[C/T]TCTGTCTTATGTAACCCATGAGTCCTGATACCAATTCTCC
TAATCTGGGAACATAGGAGGAAAAAAAATGTCTATTTCTC[C/T]CTGTACCCTCTCACCCAACCGAAGACTTAGGATAGCACAC
CTATTTTTGCTGCCTCCTCCCCACCTATTGTCTGGGGAGG[A/G]GGAGAAGGTATTTTTGAGACAAAGCACAGGCACCATAAAT
CTGTTTGATTGTAGCTGTACAGAATGACAATAATGGGGCC[T/A]CTGAGCCAGGTTATGAGCCCAAAAAAGATTTCAGGGCATA
TGAGTATACCTGCTCAGGACAGTGTCTCATTTTACCAAAA[T/C]ACAAAGGCCCCAATTAATCAGATCTCTCTCTTCACTTCTA
GGTTGCTTTGTACATGGACTCAACTGGAGGGGTGGCTTGC[T/A]CACTGTGATGAGTAGTTTTAATTATTGACTTGATACAACC
GTTCTTCAAGGAAAAGTGAACACTCAGGGTGTTTCCAGTT[C/T]TCAGGTGTCAGGGACATCTGTCTCCAGTGGCAAAGAGTTC
CATCTCTGTGACCTTCACTTGCCATATCATTTAGAAATGA[A/G]GCTTTACTAGAAACTCCATACTATGGAATATCAATATCTT
AGAAATCCTGGAAGGTCTCTTCATCTGACACGGTGCACTA[C/T]GGAGGGGGTACCTGGACTCCATACCCTTCCTATCTGTTGT
CCTCAAGTAACATCTGTCAAAACACACTTCAGAATTTGAT[T/C]TGTGTCACCCCTTTTAAATTTTCAAAAAAAATTGGGGGTG
ATATGTATGAATGGTATAAAGATGGGTATGTGCTTCTGAC[C/T]CAATGCTTCTAGAGTAGACACTATGATTGGATTAAAGAAT
AAAGTTATTTTGAAAAAGGCACATGAAGCAAACATCTGTA[T/C]GAGAGGCTTCACTACACAATTATACATATAACAATTTCAA
TTTTCCAATCAAAGTAAACTCCCTCATTCAACAATGATTC[T/A]GTTGAATGTCTCATTTCCCACTTCAAGTACAGCATCAATT
GAAATACGAAGATGGAACTGCTTCATCCACTGGGGAGTGA[T/C]AGTCCGATCGCAGGCTTCCTGCAGAAGAACAAGGCTGGAG
AGAAGATTGTATTCCACTTTGTGTCGTGGCATATATATAT[A/C]TATTATCAGCTGTGTTTTCTTTCCTATTCTGTGCATACAA
ACCATTCAATGTTATTTCTCCCTCCCCCATTTCCTCTTTC[T/C]GTTGTTTTGAAGTAAATACCAGTGACCACTAGGATTGCCA
TTCATGTTCATACTTGGTAATGCCTGGTAGAGCTACCTAG[G/T]TTCAGAATAAATGTAATAGGATCTTCTGCTTTATTGGATG
AGTTCTACCCAAGATCTAACTGATACCAAACAACCCAAAA[T/G]TTGGATGTGAGTTTGAAGAAGTGTATTTCCGGCTAAGAGA
GCTTGGCTACCTGCTGCTCCAGCCACTTCACCTAGGAAGA[C/T]GGTAGAGGTGTGGGGGTTGCAGAGTGAGGGAGACTCAGAA
ACGATTGCAGGCAAACAAAGTCAATCACAGTCTAGTACTG[T/C]AGTGCTGTTGCCTTGGCCACACACAAAACCAAACACCAAA
GATGTTCTCTATATTTTATTCCAGTTCTGTTGTTACAAAC[C/T]GACCTATAACTTTAAGGAAAGTGACTCCTTCTCATCTAGT
GTGGCTCCCATTGTGTTTCCATTGAGCTCACTGGTTATGT[C/T]TGCAAAGCTGAAGACCGAACACAAATAGTCCTGTACGTCC
CATCCAGTGAAAATAGTGGAAAAGAATGGAGACAATCAGA[T/A]GATGAGGAAGGCTCTTGGAGGGAAAGGGGATTTCAAGCTC
CAGGTATAATTTTCTTATCTGTTTCCGGATTATTAATGTG[G/C]TCTTATATCTCTCTTTTAACTTCTTTTCAGACTTTTCTTT
AAGAAACTACCACCTAACTGACTCCCAAGACAGATTTGAG[T/C]ATAAACATATTCCAAATGTCCACGGATATTTTCACACAGA
AGACCTTGTTCAAAGTGCCATCCTTGTGTGCATCTCACCC[T/C]GATGTCGTCCATGCCTGCCCTGAAACAGAATGACTGCTCA
TTATCCTAAGTCCCTTTAATATAGTCAAGAATTGTTAGCT[C/T]TACATTTAGAACCTTGATCTTTTGTGGCTTCTCTCCTGTT
ATATATTTTAAATAACCTCGTAGTGGACTTGAGAATCGCA[T/C]ATCAATGGAGTTGAAATGCCCTCTACTTTTTTGTTTAATT
CAGAGCATTACCTTGTGTTTGTTACCAAAGAGCACCAATG[T/C]ACAACAGTTCTCACAGCCCAGCAGGGTGGCACGCCTTTAA
GAATATATGGTTCTGTGAATTTGTGACTCAGACAGGAAAT[C/T]AAAGAGCATGTTGTTATGGGAAAGTCAGTTGCTTTGTTTA
AGGCTCAGTTGCCTTTGATGGCCCCTGCTAGATGTGCACA[T/C]AGTCCTTGCAAGCAGATCTTATCTCCTCATGCACAGATAC
TTACTGAGCATGCACAGCACTAACATACAATTTACAACAG[G/T]TCCCCAAAGCAGGAGGCCGTTCACACTCCTCTGAAGGCAC
CTGTGTTTAAATAAACTTTTGCTTTCAGTTTTCTCTGATT[C/T]TTACTCTTCGGGTAGCAGGTATCTCGTAGGAACCCAGAAA
CTTGTATATCAACAAATGATTAGCTATGTGCTCTCTACAT[G/A]ATCATTTGGCCAAGCACTGTGACGAAACAGTTAGAGAGAC
AGTTCGTGCAGAGTCTGGCGCAGGCGTAAAGATGCATCCC[C/A]AAAACACAGCCCAGGCTGTTGTTGCCGCTGATTGCTACTG
CAAGCCAGGAAAAGGGCAAATGTTCTACCACTGAGTTACA[C/T]TTAAAAAAAAGTTTTTGTTTTACAGCAGGGTCTCATTAAA
GTGTATTCCATGCACTCTCAGAGGGAAGGCGCTGGCACAA[G/C]CATTAACTGTCAAACAAATGTTTATTTTTTCTTACAAAAT
CCTGGTATCCCATTTGTCTTATGGAAAAAAGACATGACAA[C/A]AAGAGTCTGAAGCAGTGTGAGACAGGGGAAACCCATCTTT
CTCGGAGCAAATTAGCTCTCGTTCTCATTGGCCAGAGCAG[T/C]TGTGACTTTTGCCTGGACAACCCAGGGAATGTTCCAGCGA
GAGGCCTCTTTGCAGGGCTCTCTGGGGATATGCCAAGCAA[C/T]GCTCTGGGCATGGCAAAGGAAGGCCAGGGAGTCTAGACTT
AAAAGACATGATGGCCACAACAACTCTTATGCAGGAAAAA[A/C]GTTTAATTGGGGCTGGCTAAAAGTTTCAGATGTTTAGTCC
TCAGGAAAATTGTGCTGAATGTGGACCAGGCGACATAATC[T/C]GGCTGGATAGTGTCACTGTTGATGTAAACCACAGTGGATG
TAGGTTCTTTACTGTTTTTACCCGAGGAATGCCAAGCAGC[G/A]GACTGGAATATCCCACTCTGCACATCCCTGGCTGACTTGA
CAGAACAGAGGGGCTGGCAGGAGGACTGGCTACAGACAGG[C/T]GAGGTGTTCGGGCTTGAAGCTTGCACCCCATAGGGACCTG
GCCCTGGGGGAGGCAGGCTGGGAGCCACCCCTTGACTGAG[T/C]ACCTGGCAGAGGACAGGTTCTCTTCTCTCAGCTAGGGGCT
GTAAATCCATGGAGTTCTCCTGAGGAAGTATTTATAAGGC[A/T]AAAAGGATCTGGAGGGGTCTTTATTTTTGGGGTTATGATA
ACCCCTTGGGGATACTGTGAGATTCAGCAGACAAAGGAGC[T/C]CTCCCTGCCTTCTCCTCCAGCCGGGAACACGCAGCCTGGA
TCATTCACCACAATGACCTAACCATCAGGCCAAGAAGACA[T/G]TCTGCAGTTGACTTGCTGCCCTTACCAACTGTTCCCACAG
CACATGCATTTCCTGCCAGCCCTTCCTGAGATAATCTGTC[A/T]GTGTTGTGTCCCTGGGATGAGATACCTGTGTGTAGACTTA
AAGAAGGTGCATTGTGGTGTGGGTGAGGGGACAGGGACAA[A/T]ACCACCTCCCGGTAATGTAAAAGCAGGTGTCACACTGCCA
TACAGAGTCCTGTCCCCAAAATCAAGTTGTCTGAGGAGCC[A/G]GCTGTGACTGTGGATGTTGGCATTAAAACTCACCATTTCC
GGTAGGTAGGCTAGGCGTCTCAGATACACTGAACATCTGC[C/T]GGAAGTCTCCCAGCACTTCACCCAGACCCAGGAATGTAGT
AGAGATTTCGTAGCTCAGTTTGAGCCAGATTCCCTACCCC[A/C]TACATGCAATAGTGTGTCTTCAAGCCCAGTGAATTACAGG
TTAAATAGAGAGAAACGTTTCCAAAAATAAAGCTATAATC[A/G]CATGTTTGAACCTTTCTTTTGGAAGCTACTAATTTATAAT
CCATGATGTACACAGATCCCTTGAAACTATAAGCCCAAAG[C/T]GATCTGGCCATACTGTTTGTATTAGTTATTTTGACACCAT
CTTTTGTTACCATGTGCAGATAGGATACTAAAATCCAACC[G/A]AGGGACCCTGACAAATTTCATTAAATCTAAGTACATTGAT
TGAAATGAAATCCAGGCACAGAAGAAAGCCCGGAGCTTAT[T/C]CTACTACTTCTGAAGACATACGCTAAAATGAAGCCGGTGC
CCTATCAGATGAGAATCCTTGCATGCAAACACTGCTACTT[C/T]TTCCCACCTGGATTCAGATGCTTGGTTTAAATCTTATAGT
AGACATTTCTGTTCTGTGAGCCATAAATCTCCTGATGTTT[T/C]GATTCACAATTGCCATATGTATACATATACTAGAGGATGA
AACTTTTCAACAAATAAAGCTACAATTTTATTTGCAAGTA[C/T]GTAGTGGACCTCAAAGTTGCTTGATGTTCTAGAACTGTAA
TAAAAAGGAAAGGGTAATTCTGATTTGATATTTTTGACCC[G/T]AAAAATAAGTTGTATTAACAAAATCAGTAAAAATTACTGA
TAAATTGGTTTTAATAGTTTTAAAAAGTTAAAATATCAAT[T/C]CGGTGTCTTGCTGATGTCTTTAATATGCTGGAAACTACCA
TCGTCTGGCCTGTCGTCATCTGAAGAGTGTTAAATACAGC[A/G]ATGTACTTTGTAAGGAAGGAGAAAGAGAATGCACCCTGAT
TGGAGAGGAGCTTCGCCAAGACTCACTACCCCGACATCTT[T/C]ATGCGTGAGGAGCTAGCGCTGCGTATCGGGCTGACCGAAT
CTGGAAAACATCCATTTTGATACAATGTAAACGTTAGTGT[T/C]CACCCTTAGATACATGTTGAAAGAGAGCTTTGGTACGCGG
CAGCCAGAGGAAAAGGGAACTTGGTGGAAAGTAGTGGAGG[A/G]AGAAAACGAACGGAAACAAAGGAAGATGAATATGTTTACA
AGCTTTTCCTCGCTGGACAGCTGAGCCTGGGGAAGCAGGA[C/T]GTTAAAGACAGAAGTGTCCTTTCTCCTGACACACGCAGAG
GCTCTTTTCTACTTTTATTTTTTACTAGTTCAAGTATTTT[T/C]TTAGTATATATTCATTGTACATAATGATTAGTTTAATTAA
TAAGGCCTTCATCCTTAACCTTCCCTGCTAGTTTTACTCT[T/C]CCATGAGTTGATTGTGATCTAAGAGTTTGCTTCCTAAATA
CAGCCATTCAATGACAGCTGACGATGAGTGAACAGCCCAA[T/C]GGAGCAGCAGTAACTGTGGCACTCAGCCTTAAGAACATGA
CATAGTAGGACTTTGTGACTTTTCCTTATTGTTTTATTTA[T/C]AATAAATGCCAAAAAACATGATAATAGACAGTTTAAAGAT
GCCGAGGCTGGGGGATATTTGCCTGAGTGTTTTATTTGGA[C/G]TGAAGAACTTATTTAAGAAGTATTTCATTATTTACTTATA
TATCATCATCATGAGATGTGATTTTAAGGCAGAATCCTGC[C/T]TTTCCAGTGTGATGGGGTATCCAGGCCTTACTGTGATGGG
GCACCGATCTACGACTGTTGCGGAATGTCACGTGGATTTA[G/C]TTTATCGCTAACTTCCTTTAGTAGAACACTAGTGTTTTAT
AGAACGGAATTTGAATGACAGAACCAGCAAGAGGGCTCTG[T/C]ACTCACCACACAAGCTTGACAAAGTTGCATCTGATTCCCA
GCAACTGAAAAGTGATTGCGGCCATTGGTTAATATGTCTT[C/T]CTTTTTCTTTCTCCAGTGTTCTAGTTACATTGATGAGAAC
TTGTGACACTGTACAGAAATATTAAGCTTTTCGATTCCCT[G/A]TTTCCATATTATGTTCCTAGATCAGTTCAAGATAGACATA
GGAACTCCCCAGCCAGATGAGCATAGAAGATTGGCCAGAA[G/A]TGAAGAAGAAATTTGCAGATGTGTTTGCAAGGAAGACTAA
ATTTTTTATCAGGACAAAAATATTTTAAAGGGCTAAATGT[T/G]ATGCTTTGTAAATGGTCATTTAACTTGTTTTTAAATTTTA
GCACAAAATCACCCCACCAATAAAGCTGCCTTTACTAGTG[C/A]CAACACAAAACACTCAGTTATTCTCATTCGAAGTTCTTTT
GTGCCAAGTTTTATAGCCTTTACATAATGCAATTGATTTT[T/C]CTGTCTGCTTTTTCTCATTTGTCTACATTGTCAGTCATTT
TTTTTAAATTAGGTTGATGTACCAGTCTCACTTCAGAAAC[G/A]AGGGCTCTTTTATAACAAGGAATATATCCTTTGATTGACT
AAGTTTTATACACATTTTATATGTAATATTATTGTTCCCA[A/T]AATATTTATATTGTGATAGATCATGACATAAATGTGTTAT
GTGGACACTTTCGTTCAGTCTGTGGGTCTGCACAAGAAAA[T/C]GGTCATTGGAGGTTTGAGGAACAGGGCTCAGCAGTTAAGT
GGTTTGTTTTGTTTTTATTGTTATAGAATTGCTAAGGTAT[G/A]GGTAAAAGGAGATGGGGAAGAAAAATCAGGTTAAGTAGTA
AGCTGGTGCTGACTGACCTGTGAAATCCGACAGCCATGAC[A/G]GCTCTCTCAGCTGCAGAACTTCCCATCACATGCATACATT
GCCAGGAGGAGGAACCCCAACCCTGGCGGTGCAGGTCTCC[C/T]TCTGTCCCCACTTGCTGGAGACCCTCACACCCTGCAAATG
ACATGAACACCATCACAGTTTCCCTCTTTGTTTTTTTCTT[A/T]GATTTCTTCCATGAATTTGTATCCTAAGCTTCCACAGTGA
ATTCCCTCTCCCTCATTCTCTCCCTATTTGCTCTGCTCTC[A/G]GTTTACAGAGTGAAAAGCTTGTCTGGCCCTCCCCCCTACC
TGTCTGTTAGCCAGAGATCATTGTTAGAACCAGGGTCCAT[C/T]CTTGTATGTGGTTGCTCCATCTTTAAAGTTGCAGCCTAAC
CAATGAGTTCTGTTTTTCTGTTCAGGACATTGAGGATATC[C/T]TGCAAATGGTGGGTTCCTAGATACCATTTCAAATATCATA
TATTCTCCAGCCCCAACTGCCTCTGGAAAAACTCACAAAG[T/G]AACTGATTGAACAAACTTACAATGATCAAACTAAATGAAC
GTCACAAAGGTGCCTATTGGGCTTAATTAATCACTGTGAA[A/G]TCTTTGATGCGACCTCACAAATTCATCTTTCTGAATACAG
TATCCTGCTTAAATGAGAGGTGAAGGTAAGTTTTGAAATA[A/T]CAAGTCAGCGGACTTGATAGGAACACAGGTGAGGGCAGTC
AAAAATCCTAAAGTCTAATGGAATGATAAAAAAGTACTTC[T/C]CTTTCATTGTTCTAGGTGTCGACAGGGCTTAGTCACAGGC
GGTATTCTATAGAAAATCAATCTGGTACACTTACAGTGAT[T/C]TGCTACACTTAAATGCAGACTTAGCTCCTGGCAGATCAAT
AAGCTGCAGCATTTGCTGTTAGCCATATTGACAGCATTTC[A/G]GTGTAGATGGGAGGGGCTCTGGAACATAATGCCCCTGCTT
GAGGCATAAGAATATCTAGACAGTTGCCATAGACAAAAGA[A/G]CAAAGCTGTCCATCAATTTATTTTTAGTCTCATAGGGGTG
AGCTGCCTAAAATCCAGGAACAGACCAGAAGGGAACCATG[C/T]GCTCCCTCTTAACTCGAATCCTTCATGAGTGTAGGACTAC
GTGTGGAAACTACTTCAAGTGTTTGGGAGACTACTTGGCT[A/G]TAACGGAAAGAGATGGATAATTTATTGCTTTGATAGTTTT
TAATGTTCAACTCCAGGCTCTTGCCTTGGCTAGATTCCTT[T/A]GTATCTAAAAGACACCATCTGCTTGACTCCATATGACCAC
GACGGCCCATTGCTCCTCACTAACCTAGCACCTGCTTATG[C/T]GTTAGACCAGACAGGTGCAGGGCTGGAGACAAGAGAGGCT
AAGCAAGCAAGAAATTTCACTTTGCAGCAAGCATAAAAGA[T/C]TGGCAGAATGCTTCAAAAATTATTTAAAACATTAGGCATT
CATGCTAAATCTTTGTTGTGAGGCAGTGGACCATGTGCCA[C/T]GCAGAAGGCTTGGTTAAGGTTGGGTTGATTCAAGAAGCCA
AGTCATGAAAACATACTACTCCCCAAGGAACACACCAATT[A/G]ATTACTTAATACCAAATAGTCAATGCCCTTTTTATAGTAA
CCATAATTAAAGGTGGAATGGTATCCAATTTCCCCCCAAT[C/T]CTTCAGTTTAAGCTCATAAATTGTAGGTGAATGTGGAATG
CTGCCACTCCTGAACTGCCAGCCGGAAGGAAGGGGACCTC[A/G]GGCTACTTGATGCTTCGGACCACTCTCCTGCAGTGGTTTG
TTATTCATTGACCACCCCCTCAACCCAGTGTGAAGAGATG[T/C]TGTTCTATTGCTGTGAAAATCCACGAGGACCACACCAACT
GAATAAGTGCATGCTCTGACAGCACACGTAGTGGTTGCTG[T/C]GTTTGATAAACATTATAGCTTGGTATGAATATTGGTTTTC
AAAACAAAGTTTAATCATACTTATTAATAACAAGACTTTA[C/T]ATAAAAATGCAGAGTATAAATTCAACTTCCATTATTTCAG
AAAGCAATGGCTTTAACATTACGGAATGCTATTTCTTCAT[A/G]AATGGATATTAATGAATTACCACATTCTTATAATGAGAAA
GGCTTTTTGTAATTTTCAGCTCAGGGCTGAGTAGTCTGGA[T/C]GGGAGAGATTCTTTGGATTGCTCTGTCAGATAGGATAAAT
TTCCCAGTGTCTACTAACATTTAAGTATAATACATCTACT[C/T]CCATAACCAAAGTTCAAGTGTCCCCACATCTGTCTTGTAC
AATGGGTAATCAAGGACCCACTTTGTTCTTCATGACTAAC[C/T]TTGATGGTGAAGATAATGCTGTTGATATCTTCTGATTTCT
AATATAAACAAAGCAATAGCAGAAAAATCAAGCTTCTTGT[C/A]CTAATATATTTGTCAACATGTAGGTAGCAGTAATGCTTGA
ACCTTCTAATTCTATAATCCCAAATATTTAGAATATTCAT[A/G]ATAGAATTGTCCAACTTTATTTTTATTTATTCCAAATCAC
ATTATAACAGAGAACCAGACAAATAATTCTATAATTCTCC[C/T]TTCAGTAATTTCAATTATTATAGGCAGATTCCATTCGCTT
CTTAGCACACATACTAAATTCCATTATATTAACTGAGATG[A/G]CATTTCTTTTCATTTCACTGCTAACAACCTGTTTATTTAT
ATTCCAAGCTTCCCACATGAATCCAACATTGGGGACTTCC[A/G]ACTTCCTCACTGAAAGGTCTAGCACCTTCACCCCACAAGC
AAGGAAGTCAAGTAGTCTATCACTAAGCTAACCATGGTGC[C/T]ATCTTTTACCTGCTTATAATCACATGAGAGTAAGGTTAGT
CAATGAACAGGTCAGAGGAATGCTAGAGCCATATGCATCC[A/G]CTGGTTAGGACCAGCGGCCCTCAGCAGCCCTGTGCACCAC
AATCAAATAGCGAAAACCAAGGCAATGCTAAGGTATGGGT[T/C]CAGAATTTCTTCACACACTTTTTTGAATAATGATCATCAT
CAATCTTTATATATAAAACAGGCAATGGATTAGAGTTGGT[C/T]TGTGGATCAAAGCTTCCTGCAGAGCATAGTCTCCTCTCAC
AATTAGAATTCGGAAAAGACTAGCTCAGAAATTCCACAGC[G/A]GAGGACATGACCAAAGACAGCCTTGTTTTCTGAAAACTAA
AGACACAGTTTGCACAGTAGCCTGGGGTATGGGAAGTCTT[T/C]TGGGTGGAAAAATGAGTCACCAAAGAAAGCCAAAGATTGT
AAAAGTTTCTCATTGTCTAATAAGCTTGTGTGCCTGAAAT[T/C]ACTGTTTGAATTCTTGGCTTCGAGATACTTCTTAGCATCA
GCAATACTCTAGGAGGCATGAAATGTGATTGTTGGTTTGC[G/A]GTGCTAACCCACACTGAGTACCTTGCACAGGCTAGTCAAA
ATCCACCATGTTGTGCCGTTAGAGCCTCTCCCAGCCCCTG[G/A]ACCTGACAGTGTTGTGGAGTAGAATGGATTGCAGAAGAAA
TGAAGTCCTGAGATCAAGTCATCCTTTACCTGCCTTAGCC[T/C]TCAGTTGCTGGGACGCCCTCCCGGCATGAGCCACAGAACC
AATTCCATTCGCCGTGCTTTGCCTCACAGTTGTAGTTTCT[T/C]GTAGGCCATAGACCATGAAGGCAATAACCCTTCCTACTTT
TAAAAGTTTGCATTCCCCCACTCCTCTGAGATCCTCCCCA[T/C]GTTACCTACTATCTGACCCACTTCATTTCTATTTGCCTTA
AAGGCAATTCCATCAATATGGTACAAATGACATTCCTGAA[A/G]CTCCTGACTGCCTCTGCCAGACAAAACTTCACCTACAATT
CTCGGTTTCTGTTTCTCCTTGTGTGAGTGGCCTGGACTTC[A/G]AGTACCAAGGAGTCTTTAGGTTCAGCACAGTGTCTCCCTA
AAAGGCCTCTGATTGACTTTTCAGGTCTGAAAGAAAGAAG[A/G]CAGTCAGTCCCTCGTGCCTATTCCATAATTTGTGACAGAT
ACAGAAGTTACAAATAGTTGTGAGCCGCAATGTGGGGATT[C/G]AGAGTTCAATACAAGCCCTTGGGAGGATCAGGAAGCACTT
CATGCCTTGTAGTCACCCTTTCCTCTTCAACCCACGTGAA[T/C]CCCACATTGTATGAAAAGCCAGAAGGAAGAACACTCAAGC
AAGCAGAGCAGTCTGAGAGGGCAGATGTAAAGCAAGACTT[T/C]TGAACAGCTGGTGTTTTTCATTTTAAGTGAAGGCAAAAGA
TATGTGTTTGTGCTGTGCATGTTGAGCACAGTGCCGCACG[C/A]GGAGAGGTTATGGACACACACCGAGGAAGGAATTTCACCT
CAGGGAAAATGCTGAATTCATTTAATGGACATGAGTCATC[C/T]GTATTTAAGTAAATCATACAGACGAGTACTGTGGTACCGC
AATGCTTATCAATTTCATGTGTTGGAATTCCACTGTGTGT[T/C]TGTGTTTGTGCCGAATATCTTCTCCTCCTTCCACTGCCCA
CTGTGTTCTGGAGCTGTTTTGAGTGACGCCAAGGAGGACC[A/G]TGAGGCTTCTCAGGCATGGGCATGGATCTTTACCCACTAG
AACCAACAACTGTGAGCTGGGAGAGTTCATTGATTTTTAC[A/G]AAGAGTTGTTGGGCCCCCAGGAGCAAAAGTGATATTGCCA
TTTTCCCTTTGGGGAATTTAAGAGACAATAAAATAGATTT[C/T]GAAGAAAATGCTTGAACGATATATCCTAATACTTAAGGCA
TGATGGTGCTCTCGCTCCCCCTAGAAATGGATTTCAAATG[T/C]GACAGTGATTCCTTAATGCTGCCCTATTAACAGGTTCCAA
ATTTTGGCAGCATCTTATTTTCAGAATTAGTATTTTAAAA[T/A]TAGTGCCCAAAAGAAGCTAACAAAAAATAGTATTTGGATA
GAAGCACCATAGAAAATGGCAGAAACACTACTTGGGATAT[T/C]AAAGTAATACAAATTCAAATTCAGTTTGGTGCAAAAGCCT
GCCTCCGTCTGCTGTGGCCTCACGTGGGAAACAGGCCTTC[T/C]GAGGCACCTGTGTCGCACATTATGGAAAGCGTCACTGATG
GCTCTTGTCTTTATGCCTTTTTCTAACCTGGTGAGTATTA[A/G]ATAGGTGTGCAGTCAATTGTACCCAACATCCACTTACTGA
GATCTTGCCTTTTACCCTGGGGAAGCCTCACTGCTCTTCA[G/A]TGTCTGAGGTCTTTGTGTGTGACCTAGACCCAGAACCCAC
TGGGCATGCTCTGCTCGGTGTATGCCAGGTGGCTGCAGCC[C/T]CCAGCTCTACTGGCTGAGAATGACCAGACATTAAGTAGCC
AGAAAACAGCCTTGCCTCTTCAGCTGGCTCCAAGGAAGGC[G/A]CGCCCAGCATTGTTGAAAAGGTCAGCGCCCTCTGAGCTTG
CCCATGCTGGGTACCCAACAGCTGCACTCACATCTGTTCC[A/C]TGTGAGGAGACACCTGTGAGGGCGAGGGAGTCTGACTGAC
TTGGCAACTTCACAGTAGCTACTGATAAAAGTGAGTTGGA[C/T]GTTGAAAGAAATGGTAGCTGCGTTTTACAGAATGAGGAAA
CACGAGGAAGGACCAGAGGAGAGCCATGAGAAATCAAACT[A/C]CAAAAATATTTGGCTTTAATAAGTTTTCAGGGGCTGCTAG
CCATGCCTTACGAAGCTACTCTATGGTTGTATTTAGTAGG[T/C]AGCAATGTCACAGGATGTGGGAAAGACACCAGAATTACTT
CTCGGACTTCCTCTCTAGCAAGTCACTCTGGATTGGTAAC[C/A]GTTGTGTAGCTATGAGAGTGTCCATGGCCCACGCCGCAGT
ATGGCTGTCTGCTGTTGCATTAGTGAAGATACTTCCCACA[A/G]CCACATGAGTGCCCCAGAGACCATGACGGATCACCTTACA
AGTGACACACCTCTTCCAACGAGGCTACATGCCCTGGTCT[C/T]GCCCAAACAGTCCCACCAACTGGGAAGCAGATAGTGACAG
TTATATTCTGTCAGTCCATATTCACACGTGACTCCAAGAA[A/T]TCTCCACGTTTTACATGCATAGTTCGTATAATAAATACTT
ATACAATTTAAGATGACAGTTAAAACATTAACGGAATTCG[G/A]ATAACGTTCCAAAGGAAGGCAGCTCAGATTTATTTGCCAG
TGTCCTAAGGCTTCTTCTCCTGTGCCCTTCAAGATGGATT[A/G]AAACTGGAGTTCTCTCTGTTCTGTTGTGAATGTCACCTGC
GCCTTGTAGTGTTTTTAATGTAAGCATGTTTGATTTCCAG[G/A]AACTTTTGCTCACAAAATAATATCAAATTGCTACTTAAAA
CCACATGCTAAAGCTTGCAAACATATGAAAACACGTGAAA[T/C]AAGTAATCACACCAGTGGGGATTCACTTTTACAGACTACT
CTGTTGCCGTTTGCATCCAATATGGCTCCTTACTTTCCCA[C/T]GTGTGCACAAGAAAACTGTCCCTTATATAGCTCCAACTAA
CTACAGGAGGTTGACTCCATTCACTCAAGTGTAACAAAGC[G/C]TGCACTGATTTCCAAAACCAGACCTATTCTGATACTTACA
CAGAGTGCTCTGGGGATGCTCGGCTGGGACTTGTGTTCAG[C/T]GAAATGCCGGAGTCAGAGTCATTGAACTCCACCGTGCCTT
AAGGAAAAACAAACAAAAAACCCGAGGGCTGACGGAATGG[T/C]GGGCCAGTGACTGGTCACTGAAGTCAAGCCCATTGAAGAC
TGTGAACATGAGCAGAGGGGACAGGCCCATAGCATGTACA[C/T]ACTCCTTGCCTTTTACATACTCTACTGCTACAGGTAGGTC
TTAGTGTGCATCTCTTTGGGTTCAGTTATTTTTTGATCCT[C/T]TTTACAAACTTATATCATCTTGCTTTCCGATTAAAGCCAT
TCCTAACTTTAATAGTGTATTTGACATTGTTTGTCCATCT[A/G]TTTTTCTTCCTGCTCTTAAATGACCGCTCCTCTTCCACGT
GAGTTTACAACAGAGGAACATCAGGTGGTCAAGAAGCACC[T/A]AAAGAAATGTTTACTCTCCATAGTCATCAGGAAAATGAAA
CTCTCCTTCTCAAGTGCTCAGTTCATCATGGTTGTTGAAT[A/G]AAACATAAACTCCTCCCTTACTGCATCAGAAATTTAAAGA
GGGAACCTCAGAGGCAGGACTCAGGCTTGAGAAAATGGGG[A/C]CTTTGATGTTTTCTGCACCATGAGCCCTGCAACCTTCTGG
TTCGCTGTGGAAGGCATGGAAAACTTACATCAACTCCTAG[C/T]TTCTACTAAGGCTGACAGTCTGAATCTTGCTGTCTTAATA
CACATTTTACAAATTCAAGTGAAATCCAGGTACAGTCTAC[A/G]TCAGCTTCTGTCAGCAGCCTCTCGTATACACAACAGAAAA
AAAGGCTCTTCACGTAGCTGGGATTTACCTTCTGAGCCTG[T/C]AGAAAAGCCAAAGTCTGCTACTGGTTCACAACCATTTATT
GATAGAAGGAGGATGATTATTATGTAGTTAGTGAAAAGAA[A/G]CTTGAATGTGTTCAACACAAAGAAAGCTTTGCAGTGATAT
TTACCTCAGATGCAGTCAGCAGTCAAATTAGTTTCTCTTC[G/T]GAATAAACAAATGAAACTAGAGTTGTTTTTATATTTATAA
ATAAAGCTCCAATATAGATTGAGACGCATTAATACATTTG[T/C]GCGCTGTCACATAGTTCATTAGTTAGGACCTCCTGGTCAT
ATGAGCTTGGAGGGCCACAGCATTAACACAGCATCAGGAC[A/G]AAGAGCTACAGATGGCAGGTACACAGGGCCCAGAGGGCCA
TAGAAACCCAATTAGTATGGTAGACCTTTGGGACTGACTG[A/C]CTACTCCATGTTGACCACAATGAAAATAGGCACATCTACA
TTGCTCTCTCTCTGCATCAGAATGTAAGCCTGTTCTACAC[T/C]GAAGCACTTAGCCACCTTTTCAATGTTGTTCGGTTGTAAA
GGTATATAACAACTCTAAAATAATCAGCTATTTCCAGTGT[A/G]GGGAAGCACAGAAAGAACTGGCAGCCACACACAAAGGCTC
GAGAGCCCAGCCCCACGGAGCAGATCCCGATAGTGTCATG[G/A]GGACGGCTTCTACCAGGAGACTGAACTTGGAGGTGCCAGG
TGACTCAGTTGATGGAAGCAGAAGTTAAGAAGCAAACGAA[T/C]GCCTGAAAGTGGGAAGGACTGTGCACCTCTGAATGGAACT
CAAGCGTGTTTGCCTTCCACTGCACTAGTTACTATAGTAA[C/T]AGGTACAGAGCCTATGTATAGGATGAGACTGCAGTGACTG
TTCTCCAAAATAAATAGCTCTCGAATCACATATGCATCAT[C/T]TTCTAACCAAAATATCTCACCCTCCACTCTTTCCCATTCC
GTTTCATTTCAATTTAAAGCCCCAAAGATTAGCTTTCCTC[G/A]AAAGTCAATATTAGCCTACAGAAAAAGCATTCCATATGTA
ACATATATGAAAACTAGTTTTTTCTTCAAGATCTTCTGTA[T/C]TATCTTGGGAATTAAGTAGGTAAGAGTGATTGGGAAATAA
TTTTATAGCTTTTTAAGTGTTCTAGACATCCACCACTGCC[C/T]GAGGGTTTCTTTTATCCCAACAGCTACTGTTCTTTCTGCC
AGCTAATGCAGTACGGCGTATTTAACTCACTTGTAAGGCG[C/T]ATGCCCCGCCGCTAAGCTAGCCCACAGCATCATTTGTGAA
AAGTCAACAGGGTAATTAACATGGGAGAGATGTGATTCCC[G/A]TAGTAGGAGATGATGACACGTGCCTTTAGCCCCAGTAACC
TACAAGATCTACAAATGTTCACCCTGTACTCTAGGCTGCT[C/T]AAGAAATGTGAAACTAATAACATTTACAATGGCATTAGCT
GGCGGTTGTGGCTAAAAACTAAGCATCATTATTTGCTCGA[G/A]ACCATATTTACAATTTGTATGAATTTCGGTATATTGCCAA
CTGTTCTTACAGGACTGTTGCTTAAATGGTTGCCATGGAT[T/C]CCATTTCCTCTGGTGTAAAAAACTAAATCACTCCCACAAG
GCTGGGTCAGGACACTCGATCTAGCTCCCTGCCGAGCCAC[T/C]GGGAACCATGCCGGCCTGTTTACACACCTGGCAGAAGTGG
GGGATGAGGCAGGGGGTGGGGGCAATGGCCCAGCAGGGTG[A/G]GCAGGCCTTCTGTAGCCAGAAGCTGTGGCTGTGGGCAGCA
TGGCCGGCCGGCCGCTAGTGTCTGCCAGTGCGCTGCGCTT[C/T]GAGGGTCAGATGACCGTCTATCACTACGATGATGGGCCCT
CGGAGTAGCGTTGATGCTCCGGGAACCCACCAGAGCATTC[G/A]AAAATAATGGAAGCCTTTGAATACAGAACTGCACATTGAC
GTGCATGCTCTGTCACTAAAAAACTCATATGAAGAATGGC[A/G]TGTGAACATTTTGCTAATAAAATGCTACGTTTACAGATGC
CTACATAGAGCAGTCCACTCAGGTGGCCGTGGAGCTATGC[A/G]TATGCAGTCACATAGGACACTCTGAGCTGGGAAACAGAAT
CTTTATCAGACTAAAGCTGGAAATGCATGAGCTCAATGCC[C/T]GTGAGACCTTACCCAGCTCAGGTGCAGGCAGTGGTCCCTC
TCTCCTCTCTGTCCCTCTACTTTACCCTTCAACTTGCATA[C/T]TGGGAAAAGGCAGCTAAGCTTGTGACTTCCAGAGCCCTAG
TAACTGAAACAGTTATAGAGACCCCCAGCCAAACATTGAA[C/G]GGAAAGCAGGAACTCTTGTGGAAGAATTGGGGGAAGGATT
GGTCGATGGCGGTGACCAAAACTGAATACGATTCATACCA[G/A]AAGCAATGGTTCAGTCCTCAGCTGTGTGGAGAAACTCGAG
CAGTCACAGGAGAAATGCCAGTGTGTATATCAGCTGGATG[C/T]GTGCACGGCTGAGGGAAGGGGTGTTTTTCAGGTAAATTGA
ACATTTTTTTTCATTTACTGAAAACATTTTATCCAGTTGA[T/C]ATTGTTTTTGTCAAGATTCATGTTTCTCCCGTGGTTAATG
GGTGCCTAATGGAAGAAATAGCAATCCCTTTAGAGACTGA[C/T]ATAATTCAGTGAATAAAGGTAACAGGGATTGATACAATTC
TAGTATCGTTCTTGAAGAAGTACTGAGTTTGTTCTGTGAT[A/G]CAGCTCTGCTTAGACAGGGAAGCTGTGAAGTCATCCTCTT
CATAATGTAAATGATTGACATTTTTAGTGACTAACGACGC[C/T]TATCTAATATTTTTGTAGGGAATATATTTTCACTGGTGAT
TTTCATTCAATACCATCTATAAGTTTGGAGAACAAAGGTA[C/T]ATAGCTGTGCTTTCTCCCAAGTGAATTTGTCTTCCGAATA
CTATTACTCATGCTCTGGAAAGGACTCTTTTAACAACATA[T/C]GAATGCAAAAATGACCATGTAGAGTGTTTACCCCTCTTGC
TCTAGAGATTTCTGATGACCATGCAGACCCAGGCAATCAC[G/A]GAAAACAGATGCCGTTTATCTCAATGCTTTGAAACCTCTG
TTCTGGATAACATAGCCAACAAGTAGTAGTGCTGATACCC[A/T]GTCGAGCTCATGTTTGTAACCACCCTTTGCTCATTATACT
TTTTCACAAATGAGTATGGCTTTACCATAAAGCACACACT[C/T]TGTAGTCATCTTGATGTTAGAGATAACTGCCGAACACTCA
ATGTAGTTTAATAACAGAATGTACAGAACCATTACGGCTT[G/A]TCTAGCTGACGTAAGATATTAAAGTCATTCACTGAGAAAG
ATAAAACAAAGCAGAGCAGCTTCTCTCTCACCCTAGAAAT[T/C]TAATCAGGACAGTGTTTTCTCACATAATACTATTCAATCT
TTGTTTACTGGTTGGTTTATGGTTGGTTGATTTAGTTTGG[C/T]TTTAGTTTTTTGGAACGGTTGAGAGATGCTTCCCAAAGCA
AATAACTCAGTCAACTGAAGGGCTGGAATGAATAGTCTAT[T/C]ATGTGATTAAAATAATGAAAGGCAATGTATCAGCATAGTT
ACAAGTGGTTAGTGGATTCCTGATAAGGCAACTTGATGAG[C/T]ACAGCCTCTTTTCAGAGGTCATGGGTCAGATAGCGGTAGA
TAATGTAGATGGTATGAACACAAAACTCATAAGCATGGAA[T/C]CAAAAGGGCATGTGACTGACTAAAGTATTATTAGGTCAAG
CCGTGTCTCTTTCACCAGAGTCATTGAGTTGGGATTTTGA[C/T]TTGTAGTTTTAAACTTGCATCAAGAAAAATCTCAGTGAAG
GGGGGGTGGTGCCTGTCTTGATTTCTATTCTACTAGTTAC[A/G]GTTTTTAATAAAAAAAGAAACTTCACTGGCCGCTAATAAT
TGAATGTTAAAGTCCAATTCCTGAACCTCAGGCCAATAGA[T/C]GAGATCTGCCTTTTCAGTATTCCTGTTTCTGTAAATCACA
CGAGGGGCATAGTCTATTCTAGGTGACTGGATAGGGAGCC[A/G]ATGGGGAAGACAGGGTTAATTTTCACAGGCTTGTTGGTGC
CCGGGAAGGGGCTACCTCTCCTAAGTCACCCCAAAGACTC[A/G]GGAACCAGCCCTCAGGCGGTTACTGCGTGGGCCATAGTGC
TCCCAGTCTCAGGTTTGCACAGCTGTGCTTGTGTGACTGT[C/T]CTCCCTCAAGTCCTCACTTGCACCTTCACTTTAAACAGGG
GATGTTCTGTACTAAGTCAATCTTTAACTGCAGGACCATC[A/G]TGAGAAGAATTTAGAAAACTGGATGAAAAAGAGGAAAATA
CCACCCATGTCCTCCTCTAATAGCCTGGCTTTCTCTGTTC[C/G]TACTGCTGTGAGGATAGGGGTGGAGCATGTAGGATACTTT
CGGATGTGTGCAAGCCCATCATTGCCTGCATGCTTTTTCT[T/C]GACCCAGCCTAGCCAGGATGCCTCTGAGAGCCTGCTCCCA
GTTGACATCCTTGAGGAGTGCTCTTGAATAGGTCTCATTT[G/A]GGATTAGTTTGCTCATGGTTAGATCTAATATATATATTTA
GGACTGCACATTGTGGGGGAAATCCTTTAGGATGACATGG[G/A]TGTTCATAGTCCTCAGACAGAGGGCTAAGGAACCAGCCAA
AACTCTACAATTCAGGAATGGGTGGGTCTGCCATCTGACC[G/A]GCAGCTGCACTGTACTGACCGCATGATCCAGATAGCTTTC
ATGCAACAGGACTTGGATTCTGTAGAAACTGCTGATTTTC[C/T]ATTGGTAGTGGCTGTGTGAATATAAGTGGTTTTAATATCC
TACTTGTTGAAATTTGTGTTTTTGAGGAACAGTAAATGGC[T/C]AGGAGTCATAAAGATTTTTACTATCAGAAGTAGATTTTTG
CTTATATGCAAATCAACTTTTTGTGAGTAGAGTCTATATA[T/C]CAAAGATTTCTAAATTTAAAAGAACTTTGCCTCTAATGTT
ATAGAGAGAAATTCTGTAAGTTCTGTGACTTTAGAGAATT[T/C]TGAATAATACAACATCCTCCCCCAAAAGGGTGGGTTTATG
AAATTCCTGATGTTTCAATAAATACTTTACAGGTGATATT[T/C]TACTTCAGACACATGGGTCACAAGCTCCTGAACTCACACT
TTTTATTTTTCTGGCAATTTGTTTCAGAGTGAAGGTCTAT[T/C]AGGCATGATTTTGATCTCACAACATTTCATGTACCTCTTT
ATTTGGAGAGTTTTTCTGTGTGTCTTCCGTGACATTCACA[T/C]GCACATTTAAATCAGTATTTGCTGGGTGTATGTGGAGTGT
ACTCTCCTTTTGTTTTTATGAGCCTTGCCAGGTACATTGT[C/T]ACAGAAATCAGAAACTTCATGATGTACCTTGCCTTTCCTC
AAGCACGATCCAGAGCAAAGGCACGGCAGTGTGTGGGAGC[T/G]GTCAAACATCTGCGGAAACTGACTGCCGAGGTGGTCGGCT
AGAGACCAATTGTGGAGTCCAGTGAATATCTAAGGGGTCT[G/A]AGGGGTACCCAGGAAGATATGACATAGACATGTGCAGTTT
TAATATGACAAGAAACTGCTGTACTTTGCTTGAGACTATC[G/A]TGAAGAAAATCTCCCTAAAGGACAAAACTGTGTTGCTTCG
CTATGGAAAAGAGATGACACTACGCAGAGAAGCGATGGCC[A/G]CATTAAAACAACGGAATGGAGCAGCCAATAAAACCACCTA
GATAGACTGATGTAGCAGAATGCATGCCACGGATGTCCAC[G/A]CAGTCCTGCAAAAGCAGCTTCTCATTTGCATCATGTATAT
AGTGTAAAAATCGCACAGTCATCCGTTCTCATTTGAATGC[T/C]CGACTTAACTGAAAATAATCAAGAAAGGACAGACAAAGAA
GAGCGCCTAACTAGAAACTCCCCTGGATCCTCCCAGAGGC[A/G]CTGGACTCGCTGGTCCCCTTTTGCCCCACTGAGCCACCTT
GAAATGTTCATCAGAGGTCACACATAAACACCCAAGGTGT[A/T]AGAGGTGGAACAGCTTTAATGAAACATTGAAGGCAGCCCT
TGCCTGGGCAGGTCTTGTACCGATGGAACAGGCAAAGCAG[T/C]ACATCTGTCATTGAAACGAACAAAACGTCAGTGGAGCTTT
GAGGGTCTTACTTGTATCCAAGAGACTGGAAGCACAGCAT[T/C]GGTCTCCATAGGCAAGTGTTAGCCTTGAGAAGACCCTGTT
GCATGCTCATCTGCCAGCTCCCCCCACTTTCACAGAGTAA[T/C]GAGAGCTGTGCAGTCTGCCCTCTCAGCCAAGACTTATACT
AGGGGGCCCCAGCTCAGACAAGAACGAGCCTCGCTGCACC[T/C]GCCAGCCCCTCCTTTTCATTCTCAGAGGCTCCAGCTCCAC
CCAATCTGCTGAGGCAGCATCTGAATTAAGGTCTGAGAAC[C/A]AAGTGTCCAACATTTTTGATGACCCTCTGAATGCCTTTGG
CAATATAGAGAAGACTCAGCAGAACGAGTTTCCTTAGAGT[T/C]ACTGAAAAATAATGAAAGGATAACCTCCCCCATTTTGCTA
ACTTTCACAAGAGCTAAGAAAGCTGCACAGGTGACCATCC[A/G]TTCTTCGGGCACATTTTCTACAAAATTCCAAGTCAACAAC
ACTTGTCCTTGATGACCCCCTTGAGTGTGTGGTACACCTC[A/G]GCCCCAAGTCGCATGGCATCCCGAAAGCTCTCAGCACCCA
AAATAAAGACCTTGTCCCTCTTCTAGTCATCAGCTGAGAG[G/A]CAGAGAGGGCTTACTGGAGACAGCCAAGATCAGCTGCCCC
CAGGCTTCTTGCCCAGTACATTCAGGGCCCTCTGAGCAGC[A/G]TCTTTTTACACTAGTACCTTGTCCAGATAAGAATGTCACT
CGGGGCCTGGAGGGAAGGGTGCTTGTTACCAGACCTGACA[C/T]CCTGTTCCGCTCTCAGTAACTACAGGGTGGACGGGGAGAA
TCCAGGGGTTGTTCTTGCAAAGCAAACTGCTTCAGTGCTT[C/T]CTGTCAACAAGGCGAAACTGGAATCTCGTAGCATAAACAT
CTTTTATCCATGTCCAAGACCTGAGGATCTCCTGATACTT[C/A]TTCACTCATGTCTCTGTGCATTATATCTGGGGCATATTTA
TCAATACTGGGGAATGAGAAACATCTTTTAAGCCACTGGA[T/C]GGTCTGTTTTAACATCTGAGGAAACTGTTCTTTTAGTCAT
GGAGCTGTTTGGATCTTAAGATGAAAGCCTACCTGGAGGA[A/G]AACACTGAAGTCACCAGCAGTGGCAGCCTTACCCCTGAAA
TTTAGAAAACTTCCTGATTAGTAAAGTTGGCTTCTTTGAA[C/T]AGCCTTAAACATTGGTCACCGTTTAAACAAGACATCCTAA
GATGGTAGAGAGGGCAAGGACAATAGGCAACCAGAAAATT[T/C]GAACGGGGTAAGTGCAGTGATTCAGAACCCCAGTGGGAAC
GTCACTAAAACTAAGGCCTTTGTTTGCCTTGTTCTGACAC[T/G]GTCTTCTTTCTCTACTGGCAAAAATGCATCATGAAGACTT
CCAAGGGTCACAGTTGCCATACACATAGTACATTTGAGGA[C/T]ACTGTCTCTGCAGACAAAGTCTGATAGTTACCACACCACC
AAAGCATAAGTCAAGGTTAAAAGGCTATTTTTATCTAATA[G/A]TTGGGAGAACTGTAAATTGTTAGTAAGAAAACAAGAATAT
ACTGTATTTTTATTCTTTTACAAACTCATCTTCTAATACT[A/G]GAAAGAGTGTTATGAGACAGGAAGAGTCAGATTATCACAC
TGAAGACCTTGCAGCATGACAAGCTAGTGCGGCTGTATGC[C/T]GTGGTCACCAAGGAGGAGCCCATCTACATCATTACCGAGT
CATGATGAATCCAGCTTCCTGGTGCATTGCCAGAGCATTG[T/G]TGGGCAAGATTATCGAAGCCCTATGTATCCTCTGCGGTCA
TGTAGACAAAAGAAGACAAAGAGGCAAGCTTTTCCTGACT[C/G]TGACACATTTGTGTACTGAAAAACCTTTAATTGCAGCAAA
CCAGCAACATCTTCCTCCAGGGCCTTTGCACATATCCCTA[C/T]ACCTAGAGTACTTCTCTTGTCTTCATGTCTTTGTTTAAAC
CCTTTTGGTAATTTGTAATAACTTCTTCCAAATGTTAACA[C/A]TTTCCCTGGTAATTGTATTACATATGTGAAGAGAAAAGAA
CACAACAAAATAGTTTTATCATCTGTATTTCCAAACAACT[C/G]TGATTTTGCCTTCTACCAATCTGTAAGCCATCTCATTCAT
ATCCATGCAAAGGGCATATCTGAAAACTGCCATCTAGGGT[T/C]TAGTAAGAATTTAAGCCGGTGCCTAATCATTCATGACGGT
TGCGCCCCCGCCCTTCATGCATACACATATAGGCACATGC[A/G]CACACACAATAACAACACTCTTATCCCATCTGTGTGGAGG
CTGGTGCTTATTTTTAATATAATGAAATATGTACAAACTT[T/C]ACAATGCAGCTCGACATAAAAGGAAAAATTGATTTTATGC
AATGGTATCAAAATTACCATCTCAGGATTATCACAGCAAC[T/G]GATCTAGTTCTTTGGTTTCAGTGAAAATCTGAGTTTCATT
CTAAAAACTTTGAAACAGGTAATGTGGAGATAAAGATATT[G/A]GCTATAAGTGGTCTTTATGTTTCTTACAGCTAATACATCA
GTTTTCATTCTGGGTGCAATGCAAAGTTAACCTCTAAATA[T/C]TTGCAAACAGTTTCCACCTCCCAGTTCCCCAGGGGTAGAG
CTTTTGTACTTTGTCAAGAAGCACTCAAATGGTCATAGAT[G/A]TTTTGTATATGTTTACAACAAATAGATTGTAGATGTACAA
TGAGTGCATACATGCACATACGGAGCAGACATTAAGAGAA[T/C]AGACTGGAATGCTGGGCATGGGGCATCGAAGGTTGGCACG
GACCTTATATGTAAACAAGCACACATCTCCTAAAGGCTTG[G/A]TTTGAGCTAGCTCGAAGCATGCCTTGTCCCCCCTTCTGGT
GTTCTGCCTGTCTACCCAGTCATAGTTGAGTGTGGCATCT[A/G]TTGATGTAAGTCTGACTTGCTGGGAAGTTAAAATTCTAGG
GTATCTAGTAGGTGTAGGAGGCTGTGAAGAGTGACTGCGT[G/A]GAAGCAGCGCCTGACGAGCCCGTGTGAACATACTGTCCTT
AGTTTGATGTTCAATAGGAATTTATGATTAGGGCTTATGT[T/A]CAATTGTGAAAGCTAATTCCATGGCTATAGCAGACTGTAG
CAAAGTGTCGCGATGATGGCCTTGCACTTGGGAATCAGGT[C/T]CTGCTCACTTGGACATCCCTGCGTCATGGACTCTTGCTGC
CTGCCATGCCACCTTCACTATTCTCCCTACCAATCCCAGA[T/A]CTTCTGAACCAGCCAGCCTCTGTCATGCCGACCACCAAAC
TATTGACAGGCAGGTGAGAGATGCTTTCCAGATCTCTGCT[C/T]GAGACATAGGTCAGCCTAAGTGATGCTTCTTTAGAACAAA
TATACAACACAATGCCCACTGTGACTCATCTTGTCACAAA[A/G]GTTTCTTATTAGTCTCAGTTCTGTTCCTTGGCACACATAT
GGTAATCACAGCGGTAACTATCCCCAACGTGAGCTGCCGC[T/C]GAAGGCTCTACACAAGCGAGTTGCAAAGCCTCACGGAAAA
CTAAGACAACATGAAGACTAAAACCCTTACAGGACTAGAA[G/A]TGAATCACCAGACCTTAAATATTTTACAACTTCAAAATCC
GGCTCCACAGTACACAGTTGCAACCCCAGCACCTGGAAAA[C/T]GAAGGATCATTCAACCCTGACTCTCCTAGGAAACAGTAAT
GTCCAGCTTTCTCCCTCACTTGATTTAGGTCAATATAAAG[T/C]TTTTGACATTTTACTTTTCATTAGTTTCTATATGACCCCA
AGAAATCCTATTAAAGTGCTATCCATTAAACCATTAAACT[G/A]GTCATTAAAGCTGTTAGTGCAGACTGTGACTCGTGAGTTA
AGAAAGTCTAGGAATGGCCTGGATCTCAATACAAAGGAAC[G/A]AGCAAGACAATGACCAGTTGCTCTCAGGGAGTGCTTTTAT
TTCCTATCACACTTCCCTCATTGCAAGGGACTATACCAAT[A/T]TTTTCCAATAGCCATCCCTCCTCACATCAACAATGTCTCA
CTGACACAGGATTGCAAATCCAAGTTATTTCAGAGCCATT[T/C]AGCATTATATTAGAGAGATTACTTTCCCCAAAATATTCTA
TATGTCGTAATAATGACAATAATGGTAAGCCACGATACTT[C/T]AGTTTAAAACAACTGCTGCCTTAGGTGATTGGAAACCCTG
TCAACAATGAATGTTGTTTGCTAGTAGGAATATTGTACAC[T/C]GAATGAAATCCTTGAATAAAAGCAGAAGTCTGAGGTTCTC
AGCCTGCCGAAGTGTAAGGGAACAAAGTCCGAGAGCACAT[C/T]TGTCTCCGTTCCTCCCTATGAAACTGACAGCAAGGAAGAC
TCATATATGTAAAATAAAGTAAATGACTTTAAAAAGGAAA[T/C]GTTAATACAAAGCATTCACCTTCTAAAACATATAAAAGCA
TTTATACTTATACTTATACTTATTTATATTTATACTTATA[T/C]GTACTTAGAAAGTAGGACCACCTTATATGTACATTAACTG
TTCTGGGCTTGCAGAGACACCAAGTGACAGAATTTAGCTC[A/T]TTGGGTCTCAGCTGCTGAGTTTAGGGAGCTGAGGGTGGAG
AAGCTCTACTCTATCAAATCATCTAAAATGATGCTCCAGC[C/A]GACCACCTAAGGAAGCGTCAGCTGAACTGAGACAAATTAA
TGTAAGAGGTCCTTGCATAAGAGCGAGGGGAGACATTTTT[C/T]CCAGTATAAATATGGCAACCTTGGCGTGAGACAGTGTCTG
TCAAAAGGCTAATGACTTGGCTTCAGGAATCAGAGCCATA[T/C]GGTGCCGCAATGCAGCCAGCCATGACCCCCAACACCAGAG
TCAGAAATGTAATAGGCTGTTCACTTGACCTCAGGCTCAT[T/C]CAAAGCACTGCTAGCAGCAGCAGCAAAGGCGGGGCTTGTG
TTTCCCCTAAGTCCTACTCCCACCCCATACCCTCCCTCCT[A/G]ACAGTGTTAACAAAAGCTTAATCTTCCAGTTTTAAAGTGC
AGTAACAAATGGTCAAAATGTGTTGTAGATATGCAAGCAT[T/C]GACCTTCTTATATTATGAAATTGTAAGTTCAATGCCTAGT
TTCACAGTGCTGACTCAGTCCTGGATAGCCTGAAGCCCAC[C/T]CACGCCCTTGAATTCCAGAGCTCAGCATCTGCAGCAAGCA
AAGTGAAACTGGCAAGTTAGACATTTTGATTCCAGAAGGA[T/C]GGTAGCTCCGTGTTCCTGAAGTTCCAGGTCCTGGGGAAAC
AACTCCCATTGCACGTGAGAGGTTTAAGTGAGTCAACCTT[T/C]TCAAATAACAGCATTCAACATGTATTTAACTGATGTGAGC
AGATTAAGTAGTAAGGACTCAAATATCCCAGTCATTCAGC[G/A]GCTGTGAGCTGCAGCTACCCTGGGGTGGGTGTTGCAAAGG
ACGGCACTCAGCACAGTGTCAGCAGGATGCGTCCAGTAAA[T/C]ACACTGCAGTACTCCCCACCAGAGCTCACTACAATGGAAC
CCAAAGATTCTGAATGCAGTGAGGGGGCAAAGGGTAGAAA[G/A]ATCTCTTGACACCTTCATTTCAATTCAAAGAAACCATTGA
AGGCAGGAGTCTGCATGCCCTGGCCCACTTCTCTGAGCAG[G/A]GTTTGCAGTCCTCTCTGCCACACCCACTCCAGTGGAGTCT
GCCTGATCCAGAGGCAGGTGCAGATGTGCAAACGGAACCT[T/C]GAGGTGATGGACTCAGTGCGCCGTGGCGCCCAGCTGGCCA
TGGGCTGGACAAATGCTCTCTGGGTTAAGTATTATCCCCA[T/C]GTAGATGTATCCCTCTGGCTGTCCGGCAAGTGATGTCTTT
TGATCAGCTCTGTGTCCTTGGGTCTAGATCAGGTCTACAG[A/C]GCAGCTTCCCTAACATGTGGGTTCACAGGTGTGTGAACTC
TGTTTTTTCAAAAGTGTCCTTTTTTAATCTTTTAAAATTA[G/A]TCTGTCCGAATTAATCTTTTTTAAAAAGGCAAAACCATCA
CTCAGTGTTTGTGACATCGTGATTCACCATCACCTGGCAC[T/C]GCCTTGACCATTGCCAGAACTGTCGGGGTACTCTGTCTTC
GGAGCCCTTAGCTTGAGTCCTGGTTGCCTGTGGCCACATG[A/G]TCCTTCATGTTGTTTAGTCTCTTCAAGCTATTCCTTAAAT
TTGACTATATTTACTGGTTATTTCTAGTCTAGCTTTCCAC[C/T]TTTAAAATCTAAAATTAAGATTAAAACAATCAAAACAGGA
TTTAACACATTTAATGAGCACCTACTGGATACCAGTCTGT[A/G]CGTACATGCCTTCCCTGTTCTCAAAAGTCCCATGAAGTAA
CAACTCAAACATTGAAACAAGTCAAGTGCTTCAGGAAGAC[G/A]AAGACTGAGCCTCTGCCCGCCTCTAGGCCTACTCCCCAAA
TCAGCAGAATGCAGTGGTTTCTCACAGAGCCACTACTGTA[C/T]TTCTTTAACTTGTAGATGAGCCCTTAAACTATGACCAGCA
ATGGGGGGCTGGATCCAACCCTCCCGCTCCCACTCAGAAC[T/C]GAACCCTTAGGGTCTTCTTATTGTTCATATTTGATGTTTA
TTACAGAATACTTAGTAGAGTGTATTTTAACCACCACTAT[T/C]GGATCAGTTAATCAGTAAAGAATAGGAAAGCTCAGAGGAT
TGTTAAGGACTGACATTTTGTGCTTGACTTTCAACCCACC[T/C]ATAGTCTCCATTTCACTGACCATCAAGTATGCAGACAAGG
GAATCCTCACCTCAGGAACAAGGTCCAAGCGAAGATGTCT[A/G]TTCTCCATGGGCACTAGCTTCCATTCTCACCAAGGTTGCC
CATTTCTTCTCTCTAACAGGGTGGTTTTGTTCTTGGCTGC[T/C]CCCTTCCAGCCTTCCTTGTCAGTGTAAGTGGTTTAACCTG
AGCAGAGACCCAGTGAGGCGTGTACTGAAGCAAGGCCCGT[T/C]GTCAGGAGCCTGGGGTCACCCCCCCCCCTTTATTTTAAAT
ATGTTTCATTACAGTGATAGGAACCCTAACCAGGACACTC[A/T]CTATATGGTTAAGGATTAGAGTTCTAGCCCTCCTGCCTCT
AGCTGCCCTGTAGACATGTAAGGCCATGTTACTGTCACTT[T/C]GCAGAGCCTATCTACCTTATGACTCTCCACTCCCATATGC
AGTAGGCACGGTTTTGGATACGCCTGGGAAATGCCTCTAG[T/C]GTTATTTTATGAACCATTTAGTAAACTTCTTAAAGATCCT
CTAAGGAAAAGACAGGGATAAAGCAAGAGGTGAGCAGGAT[C/T]GGACTCAGTCCTGAAATGGCCATCAACTGTCTCTCCCTCA
GGGAGATATCTCAGTGCTCTGCTAGCTATGGGTTGGGGAT[G/A]AAAGGGGACTGAAGATGAAGGCAGGTGGCAGGCTTGCTAA
TAGTTTTTTCAAGGACCTACCTAAGTTCATTTTCAATTTC[A/T]TCAATGACCAGCTGGTTGGTGAATAATAATGTTTAAAGTC
TGAAAGCTGCCAAAGATACACTTTCCCTTCAGCTGAACAG[T/G]CCTCTTGGATTTGCCTCTGTGGATAAATAACTGAGAGGTT
TCATTTCAGGGGAATGGACAGTAGAAAGAGCTTTAGTCAA[C/T]TAATCACATTTCATTTTTAGTAAAAAGGTAGAGATAAGAA
TATTCCCCTTCACTACTAACCATCAGGTTATAAAATCAAA[C/T]CATGGGGAGTCCAGATCTTCTAGCAAGGTTTGTACCCAGT
TCTAGTGCAATTTAATTTAGCAAGTCTGCAATCAAAATTA[T/C]AGTCATTATTTCTTGTGATGCTCAAGCTAAAACATAGGTT
AAAAAAAGAATCACAAAACCCGTGAGTCTATGAAGAACAA[T/A]GCTGAGAAGAGTTACTTTTAGAAAGAGCAAAAAGGACAAG
TGTCCAGCAGGAGCCTCAAGACTTTCTCATGGCCCACCCC[C/T]TTCAATTCCTGTGTGTTCTCCATGTGAAACTTGAGCTTAA
AGAGATGGAGCCTCAGTCTCATGCCCTGTGTAGACACTAC[C/T]GTCCCAGTCGCATTGGAAAACAGCTCATTTGCTCTGTATT
GTGGATTACAGCCTGGGCTGTATAGAAGGATTTATAAGTT[A/G]AGAGTTGAGGAAACTTTAAAACACAGATTAAAAACCACTC
TAATTGACATGGAATAAAACTAGATATCAACACCGGAAAA[C/T]GATAGAAATCACTCAAGCACACACAAATAGAGTCTTATTA
AATGTTGGATAGCATGAGGGTGTCATTAGTGAATACATGT[A/G]TCCTGGGCGAAGCGGGATGGTGGCAAGCATATGGTATTAC
GCATCTCAATCTGAATAATACTACTTGTTTGAACTTGGTC[C/T]AAGAATGAAGTCATGCAAAAAGGATTTTGAGTACTTCAGA
AGGAACAAAAGGGTCCCAAAATTAGGCAAAAAAAGTCAAA[T/C]AGAAAAGTTCCCTATTCTGAGTGTTAGAATTCCCACAAGA
TCAAATGGCCCATAACTTTAGCTTGGCTTACCCTTAGAAG[T/C]TTCATTGACCCCTCTTCCCTCAATCTTCCCCTTTGATATC
TGTTCCCCCATTTTTCACTACATCAGAACAAAAATAGGCA[T/C]GTGGACAAACACAGACACATCCATCATTAGACATCCAGTC
CCCGCCTGTGACCTCTCAGACCTTGGCAGGCCACACTGTG[C/T]GGGAGAACCAAGAATGTCTGTCAGTGGAGATTCCTGCCCC
TATGGCAAAAGACCATAGCTGATGATAACCTTTTTGCTGG[G/T]GGTGAGGTCCCAAAACAGCATAGGGCATCACATGGAACGA
GCTCAGCTTCTAGGACACTGGACATAAGGGATCCTGAAAC[A/G]ACTGCGTATGCAGATTTTAAGTACAGAGAGAATCCCCTGG
CCTACTATTCCCGGTCTCCTTTTCCCTCCACCAGACATCC[A/T]GAGCTGTTCTCTCCCGCTGAATGCTTCCTGGCTTGCTAAG
ACAGCAGGTCCTCGTCCTTCTCTTCCGCCAGGAGGTTGGC[A/G]GGCTCCATCACCTCTCCAGCTGCTCTCCGCCGCTCCAAGT
TCTGAGAGCTCTGGTGTTGGGATCAGGCTGAGATCAACAT[C/T]ACACCATAATACAGTGCGGGGCTTAGCCACTGAACCAAGC
GTCATCAGTAGATTGGTTTGCAATGTGCTACTCAGTTAAC[G/A]ATGAGTGATCACAAAGAAGCCAGGCTCCGCCTACAACTTC
GTGGTGGCTGTGGCTGACCTCTGTAGTGTGTCTCATTTGT[A/G]ACGAATGAGGCAGGTGTCCCCTCACTGCCTACTTGGCATC
TTGTGACATCCAGTTTTTGACATTTATGCAATCCATCAAA[C/T]ATTTTTAAACACTTTATGCCTTGACAAACAATCTATTCTG
TCACGGTTTAATTAAGGCCAGGTGTGTTAAGTGGCCAGCG[C/G]AGACTCTGAAAAGGATACCAGAAGAGGAGGGAGAATGAAC
TAGAAAATTGAGACAGAATGACAGAGTTACTTGTTTTCAT[T/C]TCATGGTGATTTAGACTGTTGTTTACAGTAATATTTATTA
ACTGTCTTACCTTCTTCATTCAACTCTGAAGATCTATGCA[C/T]GTCTTGATTAGAGTGAAGTTGAGAGGAGTAAATCATTAAA
TAGAATGGATGAGTGATAAATTGATGAGATGTTTTGAAGA[C/T]AAGAGAAATAACCCATTTCAGTTTCGCCATCTCTCTCTGT
CCCCTGATGCTTTTGTAACTTCCTCTAAAAGGGAAATGAT[A/G]GACAGAGAAGAAAATGTGGTGGCTGGAGTGTTGTTTTTTT
CATCCAGTGCCTGTCACATGATACAAAAAAAGGAAGGCCC[T/C]GTCCTCACTGCCATCTTCTCTGTAGCTGTGCATTCTTTGT
AAAATAGTCCATGAAAAGAGATGAAGAAGCCAACGAAGCC[T/C]GCTCGGGGACATGGCAGGGAGAGCCACACAAGGAATGCTA
AGGGTGATGTCTCAGGAAGCTGCAGTTAGCATGATTATTT[C/T]AAAGTAACAAAATGAAAGCAAAACAAAAATTACTTTTACT
TGCGCGAGGGCTCAGCCTCCCAGCAGCTGCCCATGAGGGT[A/G]TGCACAGGGCCTGGGCAGCTGTCGGGGGGCTCCATGCGGT
CACAGCCCAAGGACACTCAGCCTTCAGCCTTCAAGATAAC[G/T]GGATCAGCCTGTGCCCTGATGTTTCAATGACTCCACTGGG
AGAAAACCTGTGGGTCTTGGAGAGAAAGGGTTTCTGTATT[C/T]CCAAGTTTAGATGAGAATGTTTAAAGGAAATCCCCATCCC
CTCCTCCAGGACAACAGAGGGCACTTTCCCAACAGCCTCT[G/A]CAGATTGAGGAGGTGCTGGAGTGCCGCCACCTGGTGGCCA
GGATCTGTACCTGTAGATAGACCTCCAGCCGCTTCTGAGT[A/G]AGGTTCATGGTTTGCAGCAGCTTTTCATCTTGACTGGTTG
AGAAAGTTCAGAGAGTGAGTCTTCCTTCAGTGACTAAGCT[G/A]TGAGAATCACAGAACGTGGAAGGGTGGATTTATGTTCTAG
TTACTCTAGTGGAATAAAACAGACACAGACAAAAGACCAA[A/G]TACACGCTTTTAAAAAAGAAAATGGCATGTTTTACCTGGT
AAGTTTACCTACAACCGTAATCAACAACGTCTTTCGTACT[G/A]GACGACCAGGCAGCCCTCCATTTCAGATTCGTAGTTACGG
AATTGAAATTTGTAGACTTTCATTGGTATATTCTGACCCT[G/A]AGGCCATTTCCTTGAATGAAATTAATAATATATTTCTTCA
AAAGACAACATAACCCTCAGGATAGAAGACAAGAAAGGTC[T/C]TTTGATTCCTTTTCTTGGTGACAAAGAAAATCTTTCTCCA
AGTCCACCTGCCTTGCCTCATTTTTACAGTTCCCTACTAA[C/T]GTTTTTATCCAGAAAGCGCAGGCCAAATTCGGGAGTGAGT
TATGAAAACCCCACAACTGAGAAGATAAAAGTATAAAATC[G/A]CCCTTTAAATTGCCCATTTTTCTGAGAGTTCTCTTTTGTA
CATCTCTCTCCTTCTCTCCTATCCTCTTTTATTATATTTT[C/T]CCTCAGTCACTCTTCATATTTTAAATATTAGGCATGTACA
CTATTTCTATCACAATTCAAACTGGGGGCCCTGTCAACTG[T/C]GTGCATTGGATCTTGAAAATATGGAGTATGAAGAGATCAT
ATTAAAAGGCTTCCATACTCTGAAAGTTGATCAGATAACC[A/G]AGACAATGATCTGACTAATGGGTGGCTAGCATCCATTGTC
AGGACAGCTCAGGAGACACATAACCACTACTTGAAGACAG[A/T]GACTAACTAGGCAATCTATTCTCTGTCTCTTTCTAATTCT
ACACCATGTCGGCCAGCTGCAGGCACTCCTGGTATTGCCC[G/A]GTGCTGTGCAGTATGGTGTGAAGCAGGAAGCACAGCATGG
GGGAACCCAACCTAAGCCACAAGCCTTGCTAGACAAGTGT[C/T]CTGGTGGAGCACTATACTCTCTCCTTAAGATTTTAAGTGA
GTGTCCAGCTAGAGATCGTAAGAGCAGATGTGTTTATGTG[A/G]GATAGGCAGACATAAATCAACTCAGTGTATACACTGTTTC
TTGATTTCTAAAATTTAGGTTGATACAAGGAAGAAGCAAA[A/G]GAGAAAGACCAAGTTTGCATAACAATCACTCAAATATAAA
GTTTTTATCTGTCAGAAATTCAAAGCATTTACCAATGACT[C/T]CCTCAAATTGGAAACCATTCAAAGAGTCCTCCCTAGCTGT
GGTGGCAGTTCAGAGAATGGAGGTGATCTGATATCACGAT[G/A]CCTCTCAGGCTGAATTTCTGCTAAGGCCTTTTCGAAATTG
GGCTACGTTGAAGACATGTGTGTTAAAATAATCAGTAGAT[A/G]CTATAGGAGATGTTAAATATTCTAGAAAATACACCAGAAA
CATGATGAAACAATAACAGACCAAAGCAAGAGGCATAAGC[C/T]GTAAGTGCTACATGCCTTGTAAGTAATGACATCAACAATG
ATCTGTGTGAGTCTAATGAAGGGATTGATTGGCATAGACC[G/A]ACTGTCAGTCTGTGGTAACGTAACCTTGCATGCTGCCTGA
AGTAGCACCACAAGGGAGGTACTGGAACCACCTCCCTTGC[A/G]TAAAAGTGAAGCAAACTGGAGTTCAATGAGCAACTTGCAA
ATGCAAACATCAGCGTTCTGTGCAGAGTTTCCGACACCCT[C/T]TTGATCAGTGTTTAAAGAATGACTTATAAAACTGAGTTAA
CACATATTATAGAATTTCTTGAATATTATGGCTACATTGT[G/A]GACCATTGGACGCGCGTGTGTGTGCATGTATCCCTGTTTT
CGGAATGCAATACATTTCGCAAGTATCAAACAGAGCACCT[T/C]TCCTTGGCATTTTCAAAGAAATCTATTAATGAGACTTTGA
AACATCATTGGAAATGCGTTCAGACCAATCAGGAGGATGA[T/C]AAGATGTGGGCAGGAGAAAGCAAAGTTTAAATGGGCAATG
TTTATCACAGCAAGTGAAGGCAAACGAGGACACTTGTCAC[T/A]GATCACTCCCTCATCTCTCTCCTCCCCTTTCTCTTGTCCC
ATCTACTTACTGACTGAGGCTGTTCCCAAAGAAGGTGGCA[T/C]GCAAGAAACAAGGACCACCAGTGTTCATTTATCAATCTGG
CTCTCAAAGTGGGGATGAGAAATAAGATTTGAGCAACACC[G/T]TATCCTTTATTCCACACCTTGGCAGAGATAGTCAAAGACA
AAGAAGGGAAAATAAAGCCTTGGTTTTCTCTCAAAGCATC[T/C]GTAGAAGGCAGACTTGAAGCTATAGAGAGTGGGTGGTGCA
CAGGGTCCATTACAGTGGGAAACATGTCGTGAGCTGGCCT[A/G]AGGAAGAGTCAGGGAGGGGACAAGAGTTTCAGAGGCCTAG
CAGCCAGGTAGCTCAGCTTTCAGCAAGCAAACCCAGAAGC[T/C]TGCACTCCTCGTGGCAAAGGGTAGGCCGCCGCCACCACCA
ACTCAGCCGGGAGAGCATGCTCTTGTGTGTCTTTTCCCTC[C/A]CGCTGCCCTATCCTGCCTGTGTGACCTCACTGTCCCCACA
CCTGTGCTCAGAAGCACGTCAGTCCCCTCCAGCCAGGGCC[A/G]GGCTCCACTCTAGCAAGAATCATTCCTTTCAAAAAGCTGG
ATTTGCTGTTCTCATCCTCGCTCAGAGGATGCTCTTCATC[A/G]TGGGATGACTGTAATTCCTTCTAATCCCTGCGGCTCCATC
ATTAGTAACCCAAAGAGTTTATTTATCATGCTTACATGAG[T/A]ATGGGTGTGGGGTCACTTCAAGGACTTACCAGTGAACACC
AACACATTCAGGTCTCCTTATTTCTCCTTCCATCCCATGT[T/C]GCAAGCTAGAGCGAGCATGAAGTCTTATGAAATGCTTGAT
AGTAAAGAAGGGCTTTGCCTTCCTATCTGTTTGCTTGCCA[T/C]AGTGCATGCTTGAAGAAGGAAATGCAGGAGCCACCCCACC
CGCTCTGCAGCTTCGCTTTCTTCCACACTTACTGAATATG[A/G]CGGGATGTGACCTGTTTTGTCGCTGGCTCCCGTGCTTTCG
ACTGAGTTCCTTGTCTCAGGAAATCTGCAAGTATCAAATT[A/G]TGTTCTGAACAGATTGAACATCTAAATTTGTGCTAGCTGA
GGAGATCATCAATAAGAACAACTCATAGCAGATACTTGAA[C/T]TAACATTTCAAATGCAGACTGACTGCATGCTATGCATAGA
CACATGAACTCTTCTGGGTAACCCGAGAGCTATAGACCCA[G/A]AACCTACTTCTCGTTATTAGTTATAGGGCAACTGCTGACT
TATCTTCTAATCAAGAAACACAATGGAAAGGAAGAAATTT[C/T]AATAAGTGCCCTATTGCAATTTGTTATTGACACATTTTAC
CTCAGGTGGGAGAAGCAAATGCAGCAGGCCCTCACAATTG[A/G]ATCCTGAGATCTTTGCAAACCATTCGTTCTAGAGCTTTCC
AGGTTAAAATCATGAACTTCTGAGTTTCTACAATTGATCA[C/A]ATTTTCTTGTTGTGATGATAATCACTAACATTGTAGAAAT
GTGTCAACCGCCATGTGCTTTGCTTCAAGAGGGACTAACT[T/A]GTCTTTTGTGACTTTTTTGTACATAATTATTTGTTACAAA
ACTTAGAATGCCCCAAAGTCGGTGCAGCTCTGCTAAATGA[C/T]GAACCTGTATGGAGAGCCTTCTTGTAGCCCCCACATAAAT
TCTTCCTTCTCTCTACCAAGCTCACCAGACTCTTCCTCCC[T/C]ACCTGACTGCCAATTGCCAAAAGTTAGGCAGGTTTACAAC
CAGTGAGTGAAGACAAGGAGGAATGGGCATCACCTACCAC[A/G]ACCAACAGTTTTCTATTAAGTCATTCTGTACAAGTGTGTA
GCCTGTTATCCCAGCTACTTGGGAGGTGGTGACAAGAATC[T/A]GGAGTTCAAGGCTGTTCTGATGATAGCTCTCTTTGTTGTT
ACAAAGTGAATGCCACAAATTAAAGTCCTCAAAAACAAAC[T/C]ACACCTACACTGAAGATCGGATGCCATGATTGTGAAAACG
CACCCCATCTGGCAGTCTGACAGCAAGTTACAGGGGTCAC[C/T]GTGGTGCAGTCCAGGAGCTTCTACCAAGATAGGAAAAGTA
TGGTCCCTGGGTAATTTAGACTTTATTGGTTATGGTTTAA[A/G]TTTCCTGACTTCATTATTAGGACAAGGAAGCAAGACCAGA
TTCTAAACCCACTGAAGGCCTGAGCTCCTTCTCTGGTTAG[T/C]ACTTACTCTTGTCCTCAAGGTCACTAGCCACTGGTCATTG
CTTGCGCACAGCGCCAGGCAAAGTACAGTTATAGATCCAA[A/T]TATAGACGGTCAGACAACCCAACTGCAACCAAACTGTGTT
CTGTGTGACTCACAGCTGTGCTGGGTCAGAGGAGCGCAGA[T/C]GAGACAGAGATCTTGCCTGTCTTCCTATGGATTAGTCACC
CTTCCCCCTCAACCAGTATCATTTTATCTACTGGAGTAGA[A/G]TGGCTAAAATAACACCAAGGCTTTGGAGGCCCCTGCAAGG
AAATCCACAATCAGTGAGATGGTCCCAGGTCCACTCTACA[G/A]CTTGGGGCAGCAAAGGTGGCAGCCCAGGATTTCAAGCATG
TCTCCAGTCTCTGCCTACCCCGTCTCACTGAAGGGATGCT[A/G]GAATTACGGGTGGGTGCCACATTAGCTTCCTGCACGGAGC
GCCTCTGCAAGCGTGTGGGGGCTCGGGGTCCACTGAGGGA[T/C]GGCAGGTCCCGCACGGGTCCCGCAGACCAGCAGCCGACGG
TTATGATGCAGAGTAACAACAAGCCGCTGGTTTATGTCTA[T/C]ACACATCCCCCAACTTGCTGTCTGCCATCAGACCCATCCA
TTTATCTTTTTCACCTAAAATCCATAGATTATAAACCAAA[A/G]AGGTTCCATCTGTGAAAAGTGAGACTCAGGACAGGCAAAC
CTATTCGTTTGCCCTTTTTGCCTAAACCTGGAGCCAACAG[C/T]ACTACTGAAGCTCCGCAGACAAAACTAAGCCAAAGCAGGC
CCTGTGTCAGTCCCATCTATTCCTGGACTCATGACAAACC[T/C]CTGTTTGCAAGTCTGGAAGATGCAGTAGATTTCATCCTAA
GTGGGGTGCTATCTACTGCTCTTCCTGCTTGCCAACCCTG[G/A]TCCCTGAGAGCAGCACACACCCCCTTCTTAGTGGAGTCTT
TGTCTTGTGAACTCTTGCACACCTGAATACTATGGAAGAA[T/A]CAATAAACTGCACCATGAGGAAAACTAAAGGTCTCTCTCA
ACCCCATCCAGCATCTGATCAAGTATGTTTCCCATGGCAT[A/G]GAGGTGGTCCCTGCCTTCCAGGACCAGGGAGAGGATGCAC
ACAATCAAACCAGCACATTACTGATTAAAATGCCAAACAC[C/T]GCTTTAAAATGACCACACCCGTGCTCCCATCTTGCTGCTC
GAAGGCTGCTCCCATGCTGGAAGTGTGCATATCTGAACTA[T/C]GTGACGGATTATATTTTCTCTCTTGCACAGCTTGCTCCGA
TAGATGAATTAACATATAATTTCATTAGTGTATTGTATAT[G/A]AAATGGTTTTATTATTTTTCCCTAGATGTAGTAACAAAAT
TTGTATCCACCGTTGCTCATGCTGTCAGTATTAACCAACA[A/G]GGGGACTTTGGAATTGATATCAACTTAACTATATTTGAGA
GGACCAGGAAGCACAGAAAATGAGTCATCACAGCTTGTGT[A/G]ACAGTGCACTGCACCTTAATGTGTGTTTTTTACTAACCCA
ACAATTTCTTATTAAATCAGCACGTGCTTGAAGTAGGGAA[A/T]TTTTTTATCTCTGTAAGACTAAAGTAACTATAATTTATAA
GCTTTTCACCTCATCTCAGGCTCTGTCATCCTGGTTTTTG[T/C]CCTGTTCCCCTGTACGCAGCAAGGATATTAATTTTGCAGT
TCATCCTTCCCTTTGAAAATGTCATTCCTGATGAAGGAAA[T/C]GATGTACTCCATTTTTTAACAAATGTTTCAAGCAACTCAG
CAGTCACAGGTAAGCATTTACAGCATTGCAAAATAAATAC[G/A]AATTTTAATTAACTCGCTAGCTCACAATTAGAATTTAGCA
GGTTTGCCTTAAACCAGGCACCTACCTCTGCCTCTGGAGT[A/G]CTGGTACTAACGCTGTCCATGTACTCAGTCTACTGTGTCT
TTCCAGGACAGAGACAGTGTGACGCATCCTCCTGTGGCTA[T/C]ACTGGGTCATGTTACAAGTGCACGCCATGTTCCTAACAAG
AAAACGGCTCACGTTTATCTAGGCTTTGCCCTAAAGATTC[G/A]ACCCATGGGTTTATACACTACCAATGAAGGCATTCTGCTT
GGGCTGGAGAGTTTGCTCAGTTCCTTAGCAAATGCACCAC[C/T]GGAGGGTTGAGGGCTTATCATTACTCCTCACCCCTCTCGG
GGGTAGAGGGCAAAGTCAAGAGAAAGATGGAGAAGGGTGC[G/A]GCAACTGGCCCCTTGGTACCTATTTCTGCAGACATAATTC
ACAGCCTTGGTTCTTCAGTGTCCGTTGCTCTGGTGACCAC[T/C]AGGAAAAGTGCTCCTCCTACAGCCTAGGTGGGAACGGTTG
TTTCTTGAGTCTTTGGCAAGGACCCTTCTGTGAGAATGGC[T/C]ACGGCAGGGCCAGGGTCTAGTGAGTTCCCATGGACATTGT
CCATCATCACTACCCCAGGCCCTGCACCTAATGGACTCCT[C/T]CTATTCTTGCAATGGTTTTAATTGTCAACTTGACCAGAAT
ATTACCTTCCGCACAGAGATCTGAGAGCAGTGAGGAAGAG[G/A]GAAGCCCTAGATTTCCTGACTATATGCTTTAGCTATTTGA
GAATGACATTCTGTAATGTACAGAAAACACTAATCACTGC[C/T]ATTAGAGTTAACAAAGAAGCTAGAATGGGGCAAATATCTC
GGATGAGGAGAAGGAACTGGGGAGCAGCACCAAGCAGAGC[T/C]GAAACATCCCCTGTAAGCCCACCAGGCCTCCAAGGGAGGA
CTTGCGTGTTCTGTGTTACAAACTTGGACTCCAGGATAAT[G/A]AGGGTTTAAATTATCCAGATGCTCATTCTTTGCCAGTGTC
ATTTTTTATTTTAAACCTCAAGCTACATGGCAGCAGGAAT[G/A]ATGTCTCCTTCCTATCTTCCTCTACCCATCTCCAGAGTGC
TAAATATCTAGTACAGTCCCTGCACACATGGTTCGATATT[G/C]TATTTCAACTATTCTAGCATTTAAAGCATCAACAAATGAT
TTGTCCTCTGGAGTCTTTTCGCTGTCACCTCAATCAGTTC[T/C]GATCCTTCGCCTGTCCCCTGGGTGGGCACATAGCTGTGGC
TCCAAGTCCTACCACAATTTTAAGAATAAATATATAAATA[C/A]ATATCAAGAGATGACAGAGTGGTAAGAACACTGGTTGCTC
ACCCCACCCCAACATTCTCCTTTAAAAACACTCCGAATCC[C/T]GCCTATGACTGTCATTTTCTATCCTGCTCATTTAGAAGTT
CCCAGACTCTTTGGAATCCAGAGAACTGTGCAAAGTTGAA[G/A]GTAAAGTAAACACTTTACTCACTCAGCCACCTAAGGTGTA
GCCATCTGGTTTTGGATAACCAGTTGGTGGGCTCGTCTCC[A/G]GAGAAGACGATGTCTCCTAAGTTCAGCATTCCTTAGTTGC
CAGCATCAGAATAAGTTAAAATTTCATGTGTTGGTGCCAG[G/A]CAGTTGAATCTATCTGGTTTTGTAAAGATATACACAGTAT
TAGCCCCTTATCTTACAGTCTCCCTAATTCCTGGCCTATG[A/G]TCTCTTTTTCTATACTAAATACACTAAAGAGTTGTGGTTC
CTTTCAACCTTAGTGATACTTAGGCACTAACAGATGACAT[C/T]AAACGGCATTAGAGCAGCCTAATATTTAAAGTGTTCTAAT
GAGCAATCAGAGCAGATTACAACTTCTGAGTCCTTTTTAC[A/G]TGACACCTTCACACTACGACTATGTGAGTTTTCAAAGAAA
CCCCTGATGTTCCCCGATATCCTGGGCCTGCCTGTCCTAT[A/G]AACCCTACCTCTGCCACCCTTGAGGAGCTTACATACCCTG
GAGAATACTTAAGTCTTATATTCAAAAGGTCTACATTAAA[G/A]CATATGCATAATTAAATGTTAGCGATCGCAAATGTTAATG
GCGGCTGTCATTTTCTGAGGCAAACTCCTCATTTGTAACC[A/G]AGCCTGCTATGGAGTCGCTTCAGTGGAAAAACCAGAGAGC
ACATGAAGTAATGTAGCATGGGCTAACAATGTTCTCCACA[T/G]AAGTCATATACTATATAACAAAAATTCCAGTCCCAGGCAT
AATTCTTAAATTATTTTAACTTATGTGGTAACTGCCCCCA[C/T]GTATCATGTTTAGAGTCACCTATCATATAAGTACCAATAT
GACTTTGCTAGCCATGGACAACACTATTTTGGAGATTCAC[A/G]GAGAGGACCATCATATTCTGAGACACCATTCTTCCATATG
TGCCAAGGGCTTTTGGATCAGAAATGGGCAACATGGGAAA[A/G]AAAAATCGAGGCAACTGGGTAACTTCAGGGCTGAGGATTG
AGATCACATAGTTTCTTCTTGGGAGCCCGAGGACTACTCA[C/T]TCTAGGACAAATGAGGCACTATGATGGAAGATGACCAAAA
GGAACTAACTTGCCAAGGGGTGGGCAAGGAAAATTTGGCC[C/T]CTTGCCTGCTGTTTGACCCCTAACTTCATAACTACTTATT
TTATCTCTTGGATTGTGTAATATTTTTTCATACAGACCCT[G/A]AGTGTTTCTTGTCTGGGTCTCTGCTGATGACTTTTATGTT
AGACTTGACCACCATGAAGGCCTGTCACAAGGCCTCTGAC[G/T]GGCAGCTACTTAAAACAAAAGCATTCCAGGGTGAGCAGGA
CTATAATTTTCTGAATCAGTTTTTAATGTTATCCCTCTGA[G/A]GCAGTATTAGAGAAAGATAAGAATTTCAGAACGAAGTGAG
ACGTGTGACGTATCAGTGTGTGATCTTCCACTATCATCGT[C/T]TAATTGAAGTCCTGGCCCAGGCTGATGACAATACCTCCTG
TTTTCAGTCATGTAGAAGCGTATTTGCAGGAGCTCCTCCT[T/C]CTTCCCTACTTCCATTGCTTGGGAAGTCTGACTCAGCAGG
AGGCCTGTCACATCTGTTTTCACAGGCGTTCAGTGGACCA[T/C]GATTGTCTCACTACCCTCTCCCCACTTCCTGAAATTTTAA
CGTGAAACACTAGGATTAAGTCCTGTCCAGAACATGAATG[C/A]TCACTAGGAAGGCCCAGGATAGCCAGAATCAAGGACCTAT
CCCCTGGATGTGTCTGCTCCTGTAACAGAAAGTCACAAAC[C/T]GGCCTTCTCTGCATGTTTGTCCTGCCCAAAGCCAAGGTAA
AAGAAGCAATCTGGGTGTGGTGTCACTTGTTAAAAACCTG[A/T]GCAAGATTGGGACCTTATAAGATGGAGAAGAAAGACACAA
CTCCTGGAAGCTCAGCATACAATGCTGTTGCTGATTTTTT[C/T]CCCACAGCCTGGGGCATGATCAGTGGTAGAGGGCTGCCTT
TAAGTGGAAGCCTGCTCCCTATGGGAACCACCATCTCCGC[A/G]TCCAGCGGCTTTGATGGCATTGTGTCTGCCCTGAAAATCA
TTCTCAGGCTGGGCATGGTGGTTTGTGTCTGTACATTCAG[T/C]GCCCATGAAGCTGAAGCAGGGTTTTTGTTGCTGTGAAGAG
AAGACTCCTTCCTGAAGGGTTACATGTCCAGAGAGAGAGT[G/C]TCCAGAAAGCTGGCCTGAGGGATATTTTCCAAGGGGATGT
GGACCTGAACCGACAGCTTCTGGATAAGTACGCTGCCTGC[T/C]GTGGCCCAGAGGAGGTGCTAGAGGCTGAACAGGGGTACTT
CCGACCAGGAGCAGAGGGTCTGAGAAACCCAAATGTCACT[C/T]AAGAACGTTGGAACCCCAAAGCCTTTTATTATGAATCATG
ACATCCACCTCAAAATACAGTACTTTATACAGTAGAGAAA[C/T]AATGTGGGACAAGCTGGAAAAGGACTGAAATGGATGGTTC
TCCTCAAAAGGCTGCTTCCATGGGCACTTTTAGTTTGCAT[G/A]ATTTGTCTGCCAGAAGTGCGGCGGAAGTCAAACCAACCCA
TGTTCAGCCAAGTTCCTGTCACACGGTGATACAGGAGATG[G/C]TGACCTAATACGAGTCCCCCAAGGATCTTTGATCACCAGA
CTGCTCTTATCAAAGTCTTATAACTTGGGTAAGTGATTCC[C/T]CAAAGACTGATGTGCTGAAGGTTTGATCATAATCATACAG
GAGGCTTTTGGCTGAGGACTCTGGCTTCCTAGGAGGACAG[A/G]TGGGCTGGGACTTTAAAGCTGCTTCTTGCCTACAGCGATT
CTGAAAAATTTGCTATCAAAGACTTAATGACTATTTAAAA[T/C]CTCTTTCTATTCTTTGAGAGTTCGTATATGAGTATAATGT
GGATCCTGGCCAGGAGTCAGGGTGAGTCCTTGTTCACCTT[A/G]AGCAGAGGGAGGTAAAAACCAGTGTGAGTCCTGGGGTGTC
AAGGTCAGGTGGGGAACCTCAGACCTCAAACTATCCCAAC[T/C]TGGAACTTTGCCAGCCCCTCAGGGTTTCTGAGTGAGATTC
GGAGTTCTTCTAGGTTCCACTGGTTTTGTTTCAATTCTAG[A/G]GGAGTCAAACATTTAGCTGCTACAAAATAAAAGTCCCAAG
GCATCAGCTACCGTGGTGCCATTAGTGATACCATAGTGGA[T/C]GTGGACCGGAAGGTGATGGAAATAAACTATTTTGGCCCTG
CTCGTCTCACCACCTAATCACCAGATCCTATTGTTACGTT[C/T]AACTCTCTAATTCGTTCATTTCTCTGTTTCCACCATGCTC
CTTTTCCTCTGTGTCTTCCTTCATCAGTCACTTAATTAAC[A/G]GCAACAGCCATTCCAGTTTGAACTGGAAGTTTGTGTTGCT
ATAAGCCCCAGTTAGGAAAGGACAAACTTTAGAGTGAATT[A/G]GCACACACCCTTCCCAGTGCAATGAGGTATGTGCTTTCAT
CTGGGATACATTGTAGCTCCTTTAAGGTTCACATTACCCC[T/C]AAGCATCTAGGAAGTTGAGGAGATGCAAGTAGGAAGTAAG
CAGAGGGTTGGGGCAAGAGGGTGGCAAGTGTGAGGTCAGC[A/C]TAGGATACGAAGCAAATCATGTTATAAACTGTAAGAATGA
ATCCTGAAAGTGTGCCACGCCTCTTCAGACTGGCTGCTTC[C/T]ATTACATTTCCAGGTCTGACTTACTCCCAAAGGGAGCAGC
CTTCATGGTGTTTAACTTAATGCCTTAAGTGCAACTGCAG[T/C]CCTCCCTCTATCTGTTAGAACCCTTAGCACAAAGCACTCC
CTCTGTGCTGTGAGCAGAGTCGGAACAGGCACCCAGGGGC[C/T]GGCCTCTCCCTGTCATTCACTCTCCCTTCCCCTCGTTCCT
TAGTTCTAGCTTGAGAATATATACAATCATCGACAGGTTT[T/C]AAGGTACCCAAGAGTCCTTGCTTCCCATTTCTGCAGTCAC
CTTGTAGTTAGGTTAGCATAGCTGAAAATATAGCTTTAAC[G/A]GTTGATTTTTAGTGGCTGGAGAGATGGCTCAATAATTAAA
CTAAAGGGCAAACAGCTGAAAACACAAAAGACTCCTGGTA[C/T]AGAACTTGACTGGAACAGAATAACCAGGTGATCTCCTATC
TGTAATTCTGTTATCTGCTTCCCCTTATTGTTAAAGGCTC[A/G]GTTTCAAAGAGTCTCTATTTACCACTTGGCTAGATGGTGG
GAATATTCTTCCCAATATTGTGTTCTTTACCAAAGAAAGC[T/C]CTCTCCATTATCATTATCCAAAATAAAAAGTGCTCCAGGA
CTGAGGACTGAGGAAAGCTCAGCCTAGAAGGGAAGAGGTC[T/C]GGAGGGAACATCCTGGGAACAGGACAAGCCACTAGGACTG
CCCACGCTCACTCAGTTCTCTATTTTAAAAAGTACCCAGA[T/C]TGCCCAAAGATAGCAGAAGTAGGAGATTAAAGAAAAAATC
TTGATGTTTTTCAGTCTCTCTGTGTAGCGAGCACACTCCT[C/T]CTTCAACTCCTGAATCTCTGTCTGCATCTCAGGAGTGGTC
GAAGGACGCTAACCAGCGGTGTGCGGTCACTGTTTTTAGT[T/C]TGCTGGACCAGCAGCTCTCCGTCGTCGAGGACTCGGGTCA
TTCCTGCCTCTTGAAAGAGCCACCTGTGGAGGCCTCCGAC[T/C]AGCTGTGATTGATGAAGACGGGACATTCCCAGTATTATGA
ATGGACACCTCTACATCTACAATTTGGACCCTCAGGATGG[A/C]GGAGAATGCGTCTTAATCAAAACCCACAGGTGAAGATTCT
AGAAAGGGTGATTTGCAGCAACAGAACGACACACGGAGAC[G/C]TAAGGATAGAAATATACACACGTGCCAATCACCAAACCAG
ACAGGAAGTAGTAGTAATGTGATATAATATGATGTCACCC[T/G]GGAAAGCGCTTTGCTGCCTTTCAGTCCCTTACGGGACTCA
TGTGTCGACAGGAGTGGAAGTTCAAAGAGTGAAGCCTGCC[A/G]TGCCCACTCCCTTCTCCCAGCGCTGTGCCAGGCTCAGCCC
TTTGTAATTGTGTTTAGAAATGCTATATTAAATATGTGGC[T/G]TTAATATGAAAATAAGAATCTCATAAAAGAGAATATAAAT
CTCCCATGCATCTAAATGGCTCACCTATTACTGCTCTCCC[G/A]ACTGAAGAATACTAAGGAAAGGAAGCATGCTTCCGTTACT
ACCATGACCACATGGTGTGCAGGAGAAAGATTCTTACATA[T/C]GCTGGTGAAAAATACTGTGAAAAGGAGAGGGTTGATGTTC
ACTCTTTAAATCAGTTATTCCCCTGTTTACTCACTTATTA[G/A]CCACTAATGCCACCATTCGTCTTTTCTTATCCACTCTTAA
TGACATAAGCATTGTATATACATTGTCAGCATTCACAGCA[T/C]CTTAAAATAATATATACAAAACAGAATCAATTTGAAAATA
ATGAGAGTTTCTGGTTATGGGCTAGTGTGCATTCTCTGCT[G/A]AGCACTGGCTTGAGATACAAAAAGACTCAATTCCGTGTTT
AACATACAGGGGGGAAATTGAGCCAAAATTATCCTTTTAT[T/C]ATGCACTGCCCAAAGAGCAGAGGAGGAAGACCAGCAGGGA
TATCCAAGCACACACATGCTGATGTGCGCGCACACGCTAA[T/C]ATATTAACTGACAGGTATATATGATTCATGTACACACCCA
TATGCCTTGGCCTGTGACCAATGCCGAGGGGTCTGCTGTG[G/A]CCCCTGTGTGCTATTTGCTACTCAGGGGTTAGACATAGAT
CTGAATCTAACAGGAATCCTATTTCTGATTCTCCTTGTCT[T/C]CTAGAGCCTCTTCAGCAAGGCGAAGTTTTCTCCGAGGCTG
CAGACTTTCTGCTTTAGCTCAAACATATCTGCATCATCCC[C/T]GTCTTTTTCCATAGTGACACATGAGCAATTTGCAGCTTTC
TTTTTTCTCACGAAAACATTGTGGAATGGGTTTACTGGAG[T/G]TTCTGTAAAGCCCAGTAAAAATGAAGCATCAGTATCAGCA
ATACCTTCCCGGGTCTATATAATGTGTGGGGCTCATTGAA[G/A]TCTGCCAAAATGTGTGTGGGCCCCTGGGTGGGCTTTCTCT
ATAAAATAAACATCCAGCTGTGTTTTAGTGGTATGAACAC[T/C]CTTTCCTCAGAGTAAAAGTGCCTGTTTGTAACATTACAGG
TTCCTAGCCATTGCTCTTCAGGTCTGGATTCAGGTGCTTC[G/A]CCTTCTCTTCCCACCACCTTAGCCCCTGTTCCCAGAAGGT
TGGAGTACAGGCCGGCCTGCCGGACATAGGGCAGAGCTGC[A/G]TATATTGTGAGTAACTCTCCCGTCACTCCCATTGGGTACA
CTTCTATAGACAGAATTGTGTTCTGGGAAGCAGCAAGATG[T/C]AAGGCAGGAGGAAGGAATTCACAGGCTAAGCTAGACAGAG
GAGCCAGCTGTCTTAGAAAGGGGGTTATCTCTTGCCAAGC[G/A]AGAGTTTTGTGGTCTGGCTTGACTGTGTGCTTGATTGCTG
TAGAAACAAAGGTGTTAACGGCGTCAGAACCAACGTACTG[T/A]GCATCACCACAAAGATGGACGCCTTCTCTTAGGATCTCTC
GGGCACAGCAGGCTTATACGGGGTAAAGGAGGAAGATTTC[T/C]CACCTTCCAGCATAGTCAAGTGCAGAGAGAACCAGAGAAG
CACAGCCCAGCCACGCGCTTTCCAGTGGTTCTCATACATC[G/A]CAGCCATGTTTTCCTGTTGTCCCCACACAGCCCTGTGAGG
CTGCAGCCAGGGTCTCTAGTGTCAGCCATTTTTCAAAGAT[T/C]GTAGTTGGGGTTCTTTCGAAGAATGACAAAGCCTTCCAGA
TCACCTCTAGTCCTAATTGTTCTTGGCTGACAGGTTAGCA[G/A]TGATAACGAGACTGTACTGACGGGTGCTGGCGTGGGGAGT
ATGCCTGGTTTCTGCATCTTCTAAACCTCACTCAAACCCT[A/C]TGTCTCCTCCAGCCATACCTTTTCCATGTCCAGAACTTTG
TCAATGGGCAAAACACAGTTTTGAGCATCAAGCCCAACCT[T/C]GACCACATACTTTGATTTCATGAAGTGCTGGCCCTGGAGG
GCTACACCCCAAAAGCATGCCCCAAACAACACACTCCCCA[C/T]CAGCCAGGCCTCGGGGCTGTGCCACCAGCCAGGGACCAGG
CACAAGGTCAGGTTCAGGTCGGGCGAACGCTGGACCGATC[T/C]GCAGAGAACACGCCTCATCCTACCGCAGCCTGGGGGCCAC
CCGCCCTTCTCCCCTGAGGCCCCGCCCCTTGAGATACCAC[T/G]TGTCGGCGTTGGGAAACTAGCCCCGCCCCTTCACAGAGGC
TCTTCTACTGTGCTTGTTGGAGCTGGGCTTGTGCTTACCA[T/C]CTCCTTCCTGACCCCCACCTGAGGCACAAAGGCTTGGCAA
GTCTTGCTGTGCTGTCAGCTTGTTTGCATGTTTGTCCTCT[T/C]GGCAGAACTTCACCGTCCAGAGGCCAGGACCAGCCAGGTG
GACTCCAGGCTGAAGCTGAGTCCTTATGGGAGATGGAGGA[T/C]GGCAGGGTCTGAGGCGCTGAGAGCCCCAGACACACTAGCC
AGTTAAGTCAATTTGTTCTGGAATCAATAGCTGTGATCTT[C/A]GTTTACAGAGGACCCGAGGTTTCCTTTTTGTTTAATTTAG
AAGTTGGTAATGGCGTCTTCTATACGATTTCAAAAGCTAC[A/G]CTTCTTATAGGAGGTCCTCAGGGTTCAGCTAATACTTTCC
GGTAGAAAGGCTTCAGGATAGAAACCATCTGCTGTACCCC[A/G]TTCTTGGCTTTAAAGGGAGGTAGTTCTGCAGAGGTTTGCT
AAAAAGGGGAGCATGTGACAGTTTAGTTGGGAGATCTTGC[A/G]ATAAAGCTCTGAGCATCTTATTGGTTTGAAGAGACTAATG
GAAACAGTATCTTCCTGACGGCAGCCCTTGGGTTTCCTGA[A/G]GCTTTGATTCCTGTCCAGTTACTCTGGGTCAATCTGGTGA
CCAGAGGTTAACCTCTGACCACTACACACATGCACATGTA[C/T]ATGCTTAAAACATGTAAAGGATGCTGTAACTCCTAAACAG
ATATGGGATTTATCCACATAAAACACAGTCTGGATTTTTC[A/G]CAGCATGACCCCATGGCTCTCAAACCATCACCACCAAGGA
ATGTAATGGGCCCACATTTCAGTCCAGCTTTCATAACTTC[T/C]TGTCTGAGGTCATCTGGATTCAAGAGTTTCAGTCGAGCCA
GATAGAACAACCAGTAGCTGACTGCAAATCTATTTTTCCC[T/G]GTAAATTCAACATTCAATGAAAGAGCTTTTTTATTATTTT
TCTATTATTTTTTAATTATGTATGTAATTTTGTGTGTGTG[C/T]GCATAATCACATGCAATGACACAGATGTAGAATTATGTAG
GGCAACCCTGACTTCTCATAGCATAGTTACTGAGTCATTT[C/T]CATATTCACATTATAGTTTAGAGTATTGTCTAGCATCACG
AGCTGAGGGGCCACTTTCCCCTTTGTACCCACTCTGGACG[C/A]AGCTCAAAGGCAACTTCGAATACTTAGGAAGGTCTTCTGG
TATCTTCACTGAAAATCATTTTACCACAATCAAAGCAGAG[T/C]TAGATGACAAATAAGCATGCATCATTTTGGATTGTTAAGC
TGTCAATCACTGGTTGCTACATTAACACATATTAGTCAGA[T/C]ACAAGTGCATGGACACATGCTAACACCCACACTCACAAAC
ATGTTCCACCTGAGAAGTTTTCTCATTTCTTTGCGGCTCT[C/T]TGTTCTTTTTCATAGATGGTTAAAGATGAAAATAAATGTA
CAACAAAGTATCCCCTGATTACATTTATGCCCCAAAAAGT[G/A]AAGACTGCACACAAATATAACTTTAGAAGTTGGCCAATAT
TTTCTGGTTGTGTCTATTCTTACAGAAAACTATCACGCTT[T/C]CATAAGAGTAAATTTTTGAGCATGGACTTAGTTCAATAGT
TGACCTCACGAAATATTTGCAGGTATTCATTCTTACTTCT[A/G]GTCCCACAAAAATAAGCAAGTGGATCCTTAAAAAGAAAAA
GCCCACCCTGACACATACATGCTGCCATCTGTCCCCAAGC[C/T]CCAGATTCCCTCAGGCCAACCTTCTGCACCGCCTGCTATA
GCCGCTCAGCTTCCCTTACTGTGAGCTATCCCTTGGATGT[C/T]CAGACTGACATCTTGAAGCTGTGTGTTCTCACAGAACATG
ACTAAAAAGAAGATATGTTCAGATTTTGTGAGCCTTTACT[G/A]ATTTTTTTTCATTTAGGTTGTATGTTCCACCTTTGATCTT
ATCAAAATTACCCCACGAATAAGTTTCATGATGATTCTGT[G/A]TTTCATGTAGGAAATCCAGCTATACATGTGCTGACTTAGG
GACTGTGGACTCCACAGACAGGCTTCAGGCTTCCTCACAG[T/C]GGAGGTGGGGAGAGCAGAAGGCATACAGAACCAGACCTCT
ACCTGGAGAAATGGCTCTCCTTCGTTCGATAGCCCTACTC[T/C]GTCTCCCACGTGAAGGTCTTTCCTCCCCCCACCAAGAGCC
ACCCCAGAGATTGGATACCTATTAAGTATTCCTATACTAC[C/T]GTGTGCAGATCACTACTTATGTACATACTAGCAAGTACAT
CTCTTAAAGCTCCTCCTGGCTGCCCATTTCCTTAGACTAT[T/C]ACCCGGATCCCGCCTTGACTCTAACCCTATTGTAGCACTA
GGTTGCAATTACTACTTCACTAGTGATGAGCTCCCATATG[A/C]TCTTCCTCCCTTCATAGTTGGAACAGAAACTGGCCTGAGC
ATAGTTTTAGAAAATACCTATCATCAAACAATTTGGGGAA[G/C]GTTGTTTTTAGGTTCATATAGTGTGAGAGGATATACACCA
GCCACAGAAAACCTTCAAGAAATATGAAATATATAACATT[C/T]CTAAGATCCTCTACTTGGAATTAACAAGATGATTTTTACC
AACGGAATTCCCCGTGTTCCTTTTCAATCTTGAGTGGACA[G/A]ACTTCAGAACCCCTGACTATGCAACTTCCTTGGACCTCCA
GGGGTGGAGGCAGGGCAGGAACGCAGAGAAATGTGTCCAA[T/C]TCAGAGCAATTTTCAACTTTGCCCTAACTCAAGTACCCTC
CCCCCAAGGAGCAGCTAGCCCTTCCTTGTGTCCAGAGACT[G/A]TGTGTATGTATATGTCTGTTCACGAAGGACCCTGAAAACA
CAAACAGTCAGCAAAACCACACAGAGCTGTCAAGGAAAAC[T/A]TCTATGTCCAATCATTGCCACCTGGGTGGCTCTGGCTTTA
ATTGACCTGATCTGAAATCCTGGGGAGCTGAGTTTCTAAA[G/A]GCCACACTCATTCCAATTCTATCTGGGGACTGCCAGTTTT
ACAAGGTATGGGCGATGGCTCCGTCCAGCTCTCATGTGAC[A/G]AAGACGATCCTTTTAGTAAGACTGAACAAGGCTTGTTAAC
TCTAACCACTGTAGTCAGTGGAGGAAATGAACCTGTATAG[G/A]ACAGGCTCCTGCATCAGCTGTTTGAATAGCAGTGGCCACA
GATAAGTCGTTAACAAGGTAAACATATTGGAAAAATTAGA[C/T]GTTTTAATGGTCTTTACCATCAGTATATAAAATCTGGAAA
AGAAGCAGCGCGCCACGGGAAAGCCCCAGAGCCTGGTCTG[T/C]AGGGTGAGTGGTGGATTAGCCCAGCGACAACTCAGACAGC
GCCACCCGCTCACCTGCTTCTGCCAAAACTGCATACAAGT[A/G]CATCAGATAGCCATTTGTGATCTCAGTGTGGATGATCATG
TAACACAGTTGAAGCATTGCTCAGATCAGATAAAACCCGC[T/C]GACTGGATTTGAAGCCCCGGAAGTCCTGAAGTTCCCGAGT
TGTACAGAATTCTGCTATGTGCAACACATGGAAAGGACTC[A/G]GGGATGGTGCTTGCACTGCACATAAATAATCTGGAAAAAA
GATGCTCAATAGGTAACATGCCTGCCCAATGAGGATGAAG[G/A]TTTGAATTCAGATCCCTAGCTCTGTGTAAACACAGGGCGG
CTGTGAGCCTTTGCGTTCCCGCCCCTTCCTGCTCTTTCTC[G/A]GTTGTGTGAAGTGTTCTCGAAGTTTCACGCTTTGCCTTGA
AACCGAGAACAGAGTGTGTGTCTATTCCTCTCCTGTCCTC[G/A]GAGAATAGAGCAGACATTTAGTGAGGCATGGGACACAGGC
GCCTCAGCATCTCACACCCCAATCCCTCAGGCTCTGCTTC[T/C]TGGATGCCCAACTCTCAACAGGGCTGCCAACCACTAAGAC
TAGTGCTAGCTTTATGAATTTATGAATTTATGAATTTGTA[G/T]GATGCACAGATTAGGGAAGGATGAAATTTTGCTCCTTGTT
GTGGGAAAGGCTGTACTATCTTATGTAGTGAATGTAAAAC[G/A]CAAAAGGATATTGACTGCATTGAAATAAACAATATATTAG
TATCTTAATCAAGAGTTTTCACCTGAATCTATCAATTCTA[C/T]GATAGCAACAAGTATAGTGTTTCTCTGTTAATAGATCAAA
TAATCAGAATTGATTATCAGTACATTACTCAGTCTTCCAT[C/T]ACTATAGCAAATATGGATAATTAATTTGTCCATTGAAAAA
CCAAGGAATTGGCTTCAACGCTCAGGCCTGTTCGGCCCAC[A/G]AAAAACTTTACTGTTGTTGATTTTTTTTAATGTTAAGACA
CTTTTCAAGTATAAGTGATTGATGGCCTGAGGTGTTCGGA[C/A]ACATACAGCCATATACTTGACTGTGAGTTACAAAGGTTAA
TTCTTGCAATTTTGTACAGTATTTGAGTATAGTGCAAATC[A/G]GGTCTGTTCACAAAATCAATAAAAGGGGCATCTTCTGGAA
ATTAGATATGCATGGACATACGCAATGGAGGAAAACCCTT[T/C]CCCTGTATTACATAAAAGTCACCAAACACAGATAAGGTCA
TTGCTGTCATTGTGGAGAGGGAAATTCCAACTCCACACTA[A/G]TTTTGTAAAGCAATACCTATTTAAAAAACAGTCCCCTCAG
AAGCAGAAATACTGTAATATTCAGGGATTATGCTAGTTTA[A/G]AAAAGTAGCATCATGATCTATGATTTCACAAGCCCTGCGT
CAGGAGGAATGAGACAGGAGGCAAACAAGAAAGCAGAATT[A/G]GGAGAGGGGCATCTTGTGAAAGAGGTATCTTTGGGTGACA
TAGAATTGAAGATGGGAGTTAGGGCTGCAGACCCACAGTG[T/C]GGGAAAGCTCTAGAACTAACCAAGACATAGAAATAATTTC
TTGTATTAATGCATACAATATAACTTTATCAAATTCATTC[T/C]ACTTCCTTCTTTTCAGCCCATTAATGGAAAGACACAGTCT
GTATGAAAAAATAAAATTTACCATTTATTTCTTTGATACA[T/C]AGACAATTCAGTGTGACCCACACCATCTTAGTCCACCCAC
TGAGATCCCCAAGGCTTTGTCCTCATTCATTTTAGCAAGA[C/T]ATTTCTAAACATTTAATTTGAGGCAGGCACTCTGCAGATG
AGTGGGTTGAGTAAAAATTAGAAAAGTTGGAATTCTAGGG[G/A]TGGTGTGAGGACATTTTTCTGGCCTGAATCTTACTCTTCT
GGTGTATATATGGTTCTGTTGGCTTGCTGCTTTCATTTTA[C/T]ACCGTTCTGAGTCTCTTTCCAAGATATTCATTAACTGTAC
AGGAGCAAGTCACCAAGGCCGAAGCCGAACTGGGGACCTT[C/T]CCCCGAGCCTTTCGGAGGCTGCTGCATACCATCAGCGTTC
TGTTGGGGGAGCTTGGGACTCAGTTACTTGGGGTTCACCA[T/C]CATCTATGCAGTTGAAGATGCACAGCTGGCTTTCCTGAAA
GGAGTTAGGGGGACAATAAGGGAAGGTCACTACAGGAAAG[C/T]GCAGGAGGCTACACCATAGTTAGAGCAGTTCCAAATGATG
ACAATAAACCTCAAGTAAATTAAATGTAGCAATGTATAGT[A/G]ATGTACGGTTGACCTTATAGAAAGAGTTTAAATTTTAAAG
ACTACTCTCCATAAGTGATATCGTTCTCTTCAGCCAAACC[T/C]TCTCTTCTAAAGGTCTTATCTCCCCAAATCAATGAGGCAC
TTTAAGCTCATTACTTTAAACCTACATTGGTTTTAAACAC[C/T]TTTTCAACTTTAAAAAATACACTTACACACTCCCCTGCTT
AATTTGAAAATTTGATTATGCTAAACCAATACAAGCTTAT[T/A]TAAGTGTTTCAGTTATTTTCTAATTTCAAGCACAAACAAG
CTATTAACAAACAGATGAAGTAAAGGAAAATATCTACTTC[A/G]GTAACTGTTGGTTCAAGAGTTAACAGAATGCTATATATCC
CTCTGCAGTTACTATGCAGAGAGTTAAGATGAGTATGAAT[G/A]CCCTAGTTTCAGGCCTCAGGAAAGAGTTTGCTGTGCTCTT
GTATCCTAACTGCCACACGATTCTCATCAATCCTATTTAA[T/A]TGTTTGCATGGATGTATGGATCAGCAGATAGGTAATAAGT
GGAACAGAAACCTTGAATGCGAATGTACCTTGTTTCAAGG[C/A]CCTGGCTCTCCATTACTTGGCTTCACCTTGGACTCACCTG
TTAATTGTGTGTATATGTGAGGTGGGATGCACAAGAGTTT[T/C]AGAGAGGCCAGGGGTAGGCACTAGATCTCCCAGAGCTGGC
GCTCTGTCAGTCTGAACGATGTGCTTAGAATTTCTGAGAA[A/G]ACTCGGAGCCTGGTTATTTGTACAACATAAAGAAAATTAT
TCGCTCAAGAACCTTCATCAACTCTATGTTCCCTGGCCAT[A/G]GAAAAGAAAATGACGGTTATAATGTTGTCCTATCAGACAG
AACATGAACCTCTACTCTGTGGGAAGCACTAGAAACACAA[A/C]ACCAAAGAGAGAAGTCTGTATTCTGCCTTTCGGCCTCTGC
ATCCGTGACGCGGCCTTGGAGAGGGTCTGCTGATAGTGAT[A/G]ACTGAGCCAAAAAGAAAGAGTAGTGTAGAGTGGACAAGGT
CTCTCCCTTGCCTTCTTGCCCCATTCTTTCCCTGATTAGT[T/C]TGTATGAGGACAGTCCCGAGGTCTCATTACCAAAGCCTCT
TCCAGTTGTTTCCAACCAGTAGCAGAAGAGGGAGCCTAAT[T/C]ACATAGCTCAGGCTAGAAGGTGGCTGTGTCCATAATCGGG
CCCTAGAGTGCTGGCAAAGGTTCCTGCTGCGCCTTTACTC[C/T]TCACCCTTCCACCTGAAGCCACGGTGGCCTGGAAATAGCT
CTGTCCCGCTAGAGAGTGCACAAGGAGTTGGTGTGCTGAC[T/C]TGTAGGAGAGAGGTCAGAGAAGGTCCATTCAGAGTCAATG
CCGAAAGGGAGTATCTACTAACCTCATTGGGTTTTGCCTT[T/C]AGGGTGTCCAGTACAAACTTGTAGATCTGAGGCTCAGGCT
AGGTTGTAAAAATCAATGGTAATATATATAAATTGCTACT[G/A]GTTATCACTAGAGGAGCCTTTACATTTGCTTGACATAAAC
GAGCAGATGAAGGTGACACAGTCACCACCAGAGGCAAGCA[T/C]AGGCCTGGGCTCACCCGGGGGAGAGAAAGCAGCACTCCCA
TTATGTTGACAAAGGTCACTGTCCTGTATGCTCTTAATTA[T/C]GACATGTCTGATTTATGATATGTAAACCAGATTTGTTAGT
ACTTATTTTCCAACTTGAAAAGAATCAAGGACTGATATAT[A/G]TTCCTCAGGCACATAAGAAATGACTTATTAAAAAGTGAAA
AGACAATGAATGTGACCTTCACTAATCTCATGTATGTACA[C/T]AGGAATGTTCTACTTCCCTTTCAAGAGTCTATCCCATAAC
TATTGTAGGAGAGCAAAAAATTGAATAGTGTATGAAACTA[T/C]GTGAATATATTCTGAAAAATGTAAATTCCATCTAAATATG
AACAGCTACAGTTATAATAACATAATCTTCCATTTTATAC[G/A]GAAACCCAAAAGCCCATAAAGAGCTAAAATTAGTCAAGAA
GGGAGGAAGCAATGAAGGGAGGATATATCTTGTTAGGTGT[T/A]TTAGTGGCATTTATGTGTGCAGTCATAACTATCTAACAGC
GTAAGTGTTAATGCATTCTTATAGTCACCAGAATAACTGT[T/C]CACATCTTAGGCAAGCTTACTATTTTGACCTGCACATATG
ACAGAAAGCTATAGTTTTTCAAGTCATTCCCAAACCCACC[C/T]AAATTTAATAAAACCTTCCTCCTGTTTTCACTCTTTCGTG
TACAGCTTCCCAAAAGCCTTTGAGAATCTACTATGCACTA[G/A]CCATTAGGTTAAATCCTGAAAACTAAACAAACAAACAAAA
AATGCTACGTAATTTCAATCTGATAAATACTAGACATCCT[C/T]TTGTCAATGATTAACAATCAGTTTTATGCTGAAACGAATT
AAAGTGATCTGAAAAGCAGGATTTGGAGCCTAGAATGCAG[G/C]TCAGTTTGTAGAGTGTTTGTCTGAACTCATGAGGCACTGG
AGACAAAGTAAACCAAAACAAAACAAAAACCCTTTCCCTT[C/T]GGAAGATTACAATCTGAATCAGGAAGACAAAAGATACAAA
TTGATTTTTCCCTATACCTTATTCAAAAGACTAGGGTTGA[T/C]AAGAAGGCTTAATGGCAGATGCCAGCTGGTCACTACAGCA
GGACACAGACAAAGAGCTTTGGTGAATATTTGCATATTAA[A/G]AAGCTCAGGGTGTGCCTGGCCTTGAAGAGACTTGAGTCAT
TAACTGTCTCCTCAGCCAATCAGATGTTAAAGACCATGGG[A/G]GTCCTCTTGTTTAATTTGTCCTCGTGTATCTATTAAACCT
ACTTGTTTATATGGGTCACCCATAATATAGCAGCGTCTGC[T/C]GATTCTGTAGGGAACTGAATATTGTGGGTGAGATGCTTTG
TCCCATAGCCCAGCTGACTTTAAGAAATAGCACTGTCCTC[A/G]GTGGACCTGGCCAACGAATGCAAGTCCTGAAAAGTAACCA
TGATGGGGAGCAAGCGGCTTCAGTGGAAGATCCACATGCC[A/G]GCTGCCCTTGTGGCCAACTTGTGCGACGACAAATACAACT
GCTGAGCCAGATGGCTGATGGGAAAATTGACAGGTGGCTG[T/G]ATCCTGAGGGGTGCGGCCTAATTAATCAATGTATCAATCC
ATTCAATGGGATTTGAAAACATTAAACAAAACTTGTATTG[G/A]TATGAAGCTCTAGAGTCCTGCCTACTGGACATATACGCAT
CGTTTTGGTGATATTTCTAAGGGATTCTCCCACCTCTGTA[A/G]GAAGCAGTGAATTATCAAAGAATCAGAGAGAGCCTGAAAT
ACCAGCAGTTACTTCTGAGCCCACCAGAGACTGTTCCCAT[T/G]TGGATCAGCCACCAGCAAGGGCTGTCCCGGTTTTCTACTG
AGATGGGGATTTTCTGTCCCCTCGCAATACTGTTCATGCC[A/G]TCGATGGCAGAAATGCCCGTCTGAATCATCTCTTCTGGGT
ATACAAGTTTGATTGGATTCTCACACAGAGATGTAGGTGA[C/T]GTCTGGGACATTTTCAAAAGCTAATATACGTTTAGCTGGG
AATGAATAAAAGGAACAAGAAAAACCTTTAAAAAGAAAGA[C/T]ATTGTTTTAGATGGATGGTACTGCAGAGATTTTAAAAATA
TCCCACTTGTGTTTTGGGGGTTGAAGATAATGGAAGCCTA[C/T]GTGCTGAGCTCATCAGGCTGTAGGCTCCGGCAGGAAGTAG
ATGTTGGTAATACCTAGAGATTTTTAGCTGTCAAATTTTA[C/T]ATGTGTAAACATCTCTATTTAAGGATAAATTTGGCTCTCA
CTCAATAAATTTTATTGGGAATGCACTTACACTGAAGGAG[G/A]ATTTCACAATGGTCAAATCAGTGCACAATACTACCTAGGT
CAGAAAAACTAAGCAAAATAGCATGGTATTTAACTTCTAT[T/G]TTATATCTAAATCTTAATCAGTATGGTTTCACACATAGCA
CATCAATGGTCTCAAAGTCTTCAACGGTAATGACACTCTG[G/C]GAGATTCTTGTGGTGTGTCCCAGTCCTCTGTGAATCAGTC
CAGGATGTTGTGGACCATTAGCACCCCGTGCTGTCAGCCA[T/A]GTTCGCAAAAGTCATGGAATACAAGATGGACAGATGCTAT
GGCATCCTGAAGGCTCAGGCTGACCTCACTTGTGGTTCAA[C/T]GCAGTGGGCATAGACTGAAGGACAATACGCATGTCAGCGG
GCAGGAACCATTTAAGTATACTAAGTAAGCCTTCCATGCC[A/G]GCTGAATCCAGTCTTCCCAGGTGTTACCCTCCACAGTTGC
CCCTCACCCCAAGCCACGCTCCCTCCCCAGTCCACCCCAG[C/T]GTCACTTAAAAACAGACTGGAAGGTGGGACACTCGTGGTT
AAGAAGACATCTGTAGACCCACTGAACTTCCATACTGAAT[T/C]TGTCTGTGGACCAAAAATTGATCAAAAATTTTAACATTCT
CACTTGGACCTAGGTGATGGTGCTTTTGGGGGAACTTGGG[G/A]AATGTTTCGGAGATGGGTCCCAAGCATGGGTGCTCATGAG
TGGGTTTCAAAACAAAAAGTCCTGAAATTGGGTGGAAAGA[T/A]AGTTGCTGATGGAGGTGATAGGAAGCTTGGGTTCATTTGG
ATGTGATTTCTGATAGCCAAGATATGAGAAATAAATGTTG[A/T]CACAGTTATAAAATAGTTTGGGAGGTGGGGTGGGGTGAAA
TTAGCCTTTAAAGCAGGAACATGAATCCATTCTGCAAAAG[C/T]GACTTCCAAATGCTAGAAAATATAGCTCTCCCTAGACTAG
GCTGGGGACTCAACACTTGGTTGGTAATTTGCAGATGCCA[T/C]GAATCCGCCTGGCTTCCCTCACTCCACTGCGTCATGGAAT
CAAGCCATGACTTCATCTCCCTGAAGGAAGGTCGACGAAA[C/T]GCTTCCATGCCGGGAGTGGGTTCAGTCCAAGATGCTGTGT
GGGTTTGAGTGAGATGATCAGGCTGGGATTCCTAGACAAA[A/G]GGTGGGGGTGGGGCTGGGGTTGTAATCTGGCCTGATCATG
GAAGAGAGGAGACTAAGGTGAGGCTCCTGGGTAGGACATG[C/T]ATTTAGGGAAATCTCAGGACTGTAGTCTTCCAGCTGGTAG
AGACATTCTTTATGGATAATGTGTTACCATTGGACTTTGG[T/C]CATCCTGATGGGGGTGAAAGGTATCAATTTGACAGGAGAG
TCCTGGCTCCATTATATAATTTAAACTGATCCAACAGCAA[C/T]ACTCTGCCACCTTAAGTCCCCAGCCCAAACCCAGGCAGCA
GGCACTCCCATTTCTTTGCATCCCAGACACAGATGAGCCC[A/G]TCTTCTGCTCCACTGATTAAGTGCCGGCTGCCATAGAATT
GTAAGTATTCTATGCGGCTATTCTGCGTCCACATTCAAAT[T/C]GCCATCAGGGCCCTGTAAGGATGTGCAGGATTGCACGCAC
AGCACCATAAACCACATGCAGATATGCAAATGAGGTGCTC[T/A]GGCTACCCACAGGATTTGGTCAACTGAAAACCTCAGATGT
AATAATATGGTAGAGCCTAAATCATCATGGAGTTTATCTC[T/C]CACACTTTGTCATATATGAGTCTGACCAGAGCTCCCCAGT
TACCTCCACAACTGCCATGACTACATGCACCTAAGGCAGG[G/A]CTCTACACAGCTAGGGGGGAGCAGAAGGCAGGGAATGGCT
ACTATTGAGACAGAAGCCCAGGTAAGGTCATATATTTTAG[T/C]GCCTAGTCATATTCAACAATTTCCTAAAGTGACACCTCCA
GAGAGTGACTGGTGACAGTGGATTGCAGAGAGCAGGCTTG[T/G]GAAGATAAAAAGTATGGATGTCAAACAAGGTGTGGGTAGA
ACCAGCCCCATAGTCTAGGTTTTTTGAAGAATGGGTCTCA[C/T]CCTGAGTGGTGCTTCATTCCCAACCAGCATGGTTGCCTTC
CCTCATCTATGTGGCTAAAATACTAGTCTCTTGAAAATAA[C/G]AAAGGGATTGAGCTCACTAGAAAGAGAGTGTTTGTTTTGT
CTTGAGGGTCATAGAATTTCAAGGAAGTTTAAAACAACAA[T/C]GAAAACAAACCACGAACATCTCAAATCTGGAACCTAAAAG
AATTTAATTTTGACTAAGGTTTCGAGAACACAGGACAGTG[A/G]AAGGCTTTCATTTCAATACAGTGCAGTGACAGCTAGAGAT
CAGAGTGGGCAAAGGCATGCTTGATATGCAAATAAAACTT[T/C]ATTTACAAGCCAGGTGTGGTACCCTCACCGTTAATCTCAG
AGAATGCAAATGTTGTGGTGAGGTTGCTCATCCGGAGACC[A/G]GAGTGCTTTGGCCCTGCCTTGAGAGGAGAAGGTGGTAATG
TCTCATAAAAACAATCATGATATGGGTCATCAAGGGGTTT[T/C]GTTGGTGTTCCCGTGAGGGTCTCATCTCTTGATAAGGAAT
TAAGAGCTCACCTGGTTGCAGGTGGGTTTGTATTTCAACC[T/C]TGGTTTGTTCAGAATCAGTTCCAGCTGTTTGTGGTTGAAA
TAATATTCTAGCTATCTCCTGTTTGAGGTCCAAGGGTGGT[T/C]ATTCAAGAGAAGAGCAGCTATGAGCTATTTGTGGATCCTC
AACAGAGTCTCCTGGAAGGGTAGCAACTCCAGTCCCTCAC[A/G]GGCACCTGCTCTGCTGCCCACCCTAGAGCCAGCGTCCTGT
AGCATTTGATCTCCCCACATTTACACAACCGAGATGCCCC[T/C]GCAATGGGCATCCCCTGGGATCCTCGATTCACTGACGTTA
CTTTTTATAACTGTTATTTGCTGCAAGAGAGGAAGCCATT[G/A]TGCAGATGCCCGTGGTCTTTGCTAAACTGCCCATGGTTAA
AAAAAAAAACATCAAGTGAACTTGCAAAATAAATAAGGAG[T/C]AAAAAGAAAGCTGCAAATTAAAAACATAAGTGATATGAGA
ACAAGCCAGTGCTCTAACAATCCAAGACAATGAGGATGTG[T/C]ACAGGCTAAGAAATGTTGTTAAGAAAAACAATTCGTAAAC
GGTTCTAGGTTAGAAAAGATGTCTGGGCAAGGATTTTAAT[C/T]TTGAAACCATTGAAGCAGTAAGAAGACTGCCTTCTCTGTG
GTTGGAATAAATTTAAGTCTTGTTTATGGATAAAGTTTCT[G/A]TATGGAAAAATAATTCTTGCTTATTAGCTTTTGTTTAAGA
GCTAGGCTCCTGAGTGGGCTTCTGAGGATTTAAATCCAGA[G/A]CTCCAAATCCCAGTCCCATGCCTCTGAATCCTTCCTACTG
GACACAGCAACTTACCTTCGGGCCAGAGATTTTCAAAGTC[T/C]GCTTAAACAGATGTGCTTAGAAATCTCTCAGTGCACATCT
AGATCCTCTTGTCATTTTTCCTCTCAAAGTGTTACTCTTA[C/T]ATTCACTGATAGATGCAGTTGACCAAAGCACTAAGAAGCA
CCAAAAACACTTGTAGTAAATTTTAGGGGGAGGGGCTGAT[A/G]TTAAAATCTGGTTCCTAGTTCTTTCTCTGATTCCTTCAAC
TAAATCTGTGGGGAACATTTCAGTTTCAAGAATGGTTGTA[A/G]TTAGCTTTTTTACAAACTGACAAACATAGGTTAAGAATAT
TGCAACTACATCACACTGAGGTTCCTCACAGCCCTCACCT[A/G]GCTGCTGAGTCCTCGGTTATTGCTAGCTGCCTTCTGGGAG
CCACTAAAGTGACAGTGACAATTATCAGTGAATGTAAATT[C/T]ATAGTGTGTAAATTCTAAATTTACATTATCGTGCACTCAT
CCGTGTAGCCCTCCCATGGCACAAACACTACAATGTGTAC[A/G]TATGTGATGGACAGGTGGAAGCAAGAGAGAAGCAGCACAT
GACAGGAGAGCAGTGGGCGTGAATTCATGCAGACTCACTC[T/C]TGTTTGTGTGTTGTCTTATGTTTCACTCTGAAGTCATGTA
AAAGTCTAAGGCTTGGATGAGGGTTCTGAGGCAGTATAAA[T/C]GGTCAATGTTCAGTGAGTTTGGCACTCTTGTCTGATACTC
TGTGCTTTTGAGATTAGAGGAAGCAGTTGCACTTCTAGAC[C/T]CAAAGCTAACTTTTCTGAAACAATCTCACTAGCAAGGAAA
TGTCATCTTCTTTCCCATTAATAACAATTTTCCCTCTCAT[C/T]TTATACTAGCAATTTCTCTAAGTAAATTGTATTAGTTTCA
GAGGAGCCAAAGGGACTTCCAAGATGTAGTCAAGGTGATT[A/G]ATCAGATACATTAATACAGACAATTTTTCTTGTATGACCT
AGAGGGCAGGGTATATTTGTCTTCTCTGGGGACTCAGCAA[T/A]CCCAGTATCCTCCAAGCAGTCCCAGAATACCTCTGCACAT
ATATGAAAGAGCTGCGAAGGCTTATTCACTGCTCCGTGCC[G/A]GCTCGAACATGGCAGACGTGATGGATTGCTTAAAAGTGCA
TTATAAGAGCATAATAATTGCTGAAGACGTTCAATATCTT[T/C]ATTTTAACAACTCGAATCACCTAGAGACATGTAGAGGGAA
CATCTTTTTTTTGAGATGGGATCTTTCACTGAACCTCAGC[C/T]AGAATGACTCACCCACAGGCCCTTCTGTCTCTGCTTTTCC
TTATGTACACACATTATGCTAACCTGTCACAGACAGTAAA[C/T]GTCAGATTTATACACTGGACTCTGTGGAGCACCCTACACA
TGAGACAAATGGTATCTCTTAATGCTTCTTTGATGAACTC[A/G]GAGCCCAGCTGGGAGCTGTCCAGTGTCACAGGTAAAGGAC
TTACATTGTGATATATCGTTTTTGTTTGTTTGTTTGCAAG[A/G]AAAGAACGCTATCTCTTTGATGTATAGTATGTTGCTAAGA
AACAGTTGCTTACTGCCCTTTCTCTAAATCACGGGTTGTC[A/G]GTTTCCTGGAAATAATTAAAATGCTAAGAGATTCCATCCT
TCTCCAGGAACAAAACTCGAATGGGATACAGGGTTGACCA[T/C]GTTCTCAGCTTCAGTCTCTCCATCAAGGCCTTCGATGAAA
AAAGACGGGAAGATTGGGGCTGTCGTTGGTTGGTTGGTTC[A/G]GTCAGGCACCAAAACAAGAAACTCAATGAGAAATATTTGG
CGTTACCAGTAGCTAATCTGAAAACGCACAATCCACAGAC[C/T]GCGTATAGAAACACCGTTTTTGGTAATTGTTTCCTTAGAT
TGGTTGGAGAAGAAATGTGTGATCCTTCCACGAGCCGAGC[A/G]GGTATGCTTTCGCCTCAGAGTTAAGTTGATTTAAGCAAAT
TGGTTTTTCTCTTTCTTTTGAAAATACTTCATCCTTTCTG[T/G]TTGTCCTAGTTCCATTTCTGATGCTGTGATATAATAGCTT
AAAGTAGCCGTTGGCCAAAATTATCTTGGTTTCCCTTTCA[T/G]TCTGATGATTGGTGTTTATTGCTAAGGAAAAAGCCAAGGG
AATGGCTTACGCCAGGCACCTCCTAGGCATCTCATACATA[T/C]GAAATGATCATTAAGTCCTGAATAAATGAACAAACGGAGG
GCTGTGTTCAACCTTTGAGTAATCACTGTCTTAGCAACAA[C/T]AAAAGAGTATCTGCTCTCAAAGCTATTGTCCTGAAGCTTC
TCTCTGTAAAGAAGGTTCCTTCTGTTAGCACATACATAAA[A/G]TCGACAAAGATACAGTGTCATCACCCAGACTGGTCAGAAT
TACATATCATTTTGTAAGGAAAAGAACAGGAACAAAAATT[T/C]TTGACCAGTTATGTCTATCTGAATGATGCGTTTTAGGATA
CCAACCATACCCCTAGCAGCCCGGCAGCAACCAGATAGAT[A/G]TCCATCTACCCAAACTGGCTACACTGGGGCCCCCACCCCC
GAACAGGACTTGCTATCAGAATAGAATAAAGCCAAGTGCA[C/T]TGTTATTCTGTAGACATTTCTTGTTTTAGACTTAAAGATA
AAGAAAAACACTTTGAAATTTTAGCAACATTTATAAAAAT[A/T]ATAATGATCCAGGCACTACTAGACTCAAAGATAAAAATGT
CAGCAATACCATGTGTCCTTTCCTGCTGTAAAATTGACAC[A/C]TGTGACTTCTCAATTAAGGATTTTGGTGGTTTGGTTTGGT
TCTGCTTCCAAAACACAGATTTGGGTTTCTAGTACAGCTC[A/C]GTAGTAGAGCAAAAAACTTAACCAGGTTGAGGTCCTGGCA
ATTTTTCTCAGCACCACCTTGGAAGTTCTGTTCTCTCCCC[G/C]ACAGTGTGTAAAGCCGGAGGCCTGGAGAAGGAGCAGGATT
ATCGGGGGTTTCCCAGACAGTCCTTTTTCTTTTAATTCAG[G/A]GTGCATAAGATTTGTATCACACATGCTGAAAGACTGGGTG
GTGATGGCACTGCGGTGTCTGTGGAGCTATGCTGTCTCAC[G/A]GCACTAAAAGAACAGCGGCTCACGCATCCCAGCGCTGCGG
TTCATTTGTGTGGCTCACTGGAGTATGACAGAGAGATGGA[A/T]GGGTTTTTGAAGGGTATCCCCTCCTCCTCCTCCTGCCTGT
GTGATGATCATCTCAGAGCACTACACTGTATGTAGGAAAG[A/G]ACACACAGTAGTTCACATAATCTTTTAAACTAACATCCCC
CTGTCCCTCCTGTCTTCTGCCTCTGAGTGTTCTTGCTCCC[A/G]GGTACATAAATCCTGGAACGCAGAGACAAAAGCTAGGAAT
GTGGCAAGGTCCACAGTCCAGGTCTCTGTTTGGATGTCAC[C/A]CTGTCTGCTAAAGTTTGACTATGACAGCTTCTCTCTGAAA
GCCGCACAAACCATGAACTTCAATGATCAAGTGCTGCGTG[T/C]GTGCGTGAGTGCGTGCATGCGTGGGTGGGTGGGGCAACTA
GCGAGGCCCCGAAGGACACCTCCGTGCTTCATTCACAGGA[A/G]GAACTTCAGAGGATACTCTCTGTCTAGATATCTCTTGTCC
ATGTCAGACAAGGTAGCCCTGGATGCACCATACCAAGAGC[C/T]CTATGTTCAGAAATGTGTATTTTTGCAGCAAAACATGTTG
GCTTCCACATGCATGCAGATGTTCACCCATGCCCACATGT[G/A]CAACTCCACACATGCAAACACATGTACCGCACACACATAT
GGGAAGACCTGAGGATGGATCAAGATGCTTCCTGTACGCC[A/G]AGTGTGGAAGTTCGCACTTGTAATCCCAGCATGCAACGGG
GAAAGTCCACTTACAAAACAGGATCGGTCATCGGGGGGCC[A/G]ACGTTGGATTCCTCTGCTATTAGGTCGAACCGTGGTCCTT
AGATACAAGAAACAGACCTAGTTGGAAGCAGTGGGTTCCT[A/G]GGGACAAGTCCTATGGGTAATGACTTTCCCCGAGCCCCTT
GTTCGGCTTCGTAGCATGTAATGTAGACCTAGCCCATCCA[T/A]TCATGTGCTCGGGAGAGTGTTCTTTATCCAATAAAGTTTT
TTATTTTTAAAGTGCTGTTGACACTTATTAAGGAAAAGAC[A/G]GTGTGCTGCCAGAGAAATGGAGCCAGTTGTAGATGTTAAG
CGGGGCCGACGTAGAGGAAGGAGCAGTTCTTCATGCCCTG[T/G]CTCTACTTGTAACTTTTATAATAAACGCTTTAAAAGCAAA
GAGAGGCTAATGACTGACCTCACAGAACCTGTTTGCTGTC[C/T]GGAGAGGACAGCAGAATGCGCCCAAATGGTAAGGAGGAGT
CTCAGAACAAGTGAGGAGCTGGCCTCACTGTTACTGCTAC[T/C]GTTGACAAAGGTGTTAGGAAAGAAGTCATCGATCGTGCTC
ATAGAATATGCTTTAAGGTATCTGTCGCCTGAAAGAAGAC[T/C]TCGCCCCGGTGAGATTACAAACGATCTAAAGGCGCCAGTG
TGGTAGCACATCAGCACTTATCCAAAGCTGAAAAGAGTCT[A/G]TGAATCTAGGTTTATGGCTGCCTTTTGTAACATTGTACAT
ATGTTCTTGGGGCTTACTACTGTGATTAAACACCTGAACT[C/T]CTTGGAGACCATTGTGAACTCAACTTTGCAGACTGTGTGA
TAAAAACAGTGGTTTTCTTTCCAGATTTCTTTCAAGGGGC[G/A]GGGGAGTGATTTATTGAGAAACAATGATGCACTAGTTCAT
TCTTGAAAAATATGTAGATAGATTATAGAAATAGAAAAAG[A/G]AGAGAGAATGACAGGGAAAAAGTCTATTTCTATTGTAATT
GGCCATGAGAAATTGTTCAGGCGGTAAGAGTCTTGCCATA[C/T]AAATATGAAGACTTGAATTAGAATCCAAATAGCTATGTCA
AAATGATGTAGCTAAATATGCTGGCATAAAAGTTGGAAAT[A/C]TGTTATATAGATAGCACTGTATGTTACATTCTACCAACAT
CTGTGGAAATTCGCACAGCTTTGAACTCTTCAGTCGTTGG[G/A]AGAGGAACATAGTCTTGAACCACAGCATTTTCTGGCAGAA
TAATTTGGATGTACAATGCTCCTTACAAACTCAAGTGTTC[A/G]AATATATGGCCCTCAGCAAGTGGCACTGTAGGAAAGCTGT
GTCGCTAGGGATGAGAGGAGAGAAGAAAGTGGGGGATGGG[A/G]CAAGGAATAATTCTAATATATCACATGCATTCATGAAACT
GGAAATAAAAATACTTTATATTCATGCTTCAAGATATCCC[T/C]CCACAGATTTGATTTTATATATCTAATTACAAGCATTTAT
ATCATCATTCCAACGCCCTAACACCTAGCTTGGGAGTTCC[A/C]CCTTCTAAATGAACATGCCCAATCATTTTAATGATGATCT
TTGGGGAGGGCATGCCGCACTTGCAGTAAATCCCAGACCA[T/C]GCTGCCTGTTTACCTTCTGAGGCCCCACACAGAGCAGCTT
TGGGTATGGGGGCATGGGAGACACAGAAGGACAGAAAAAC[A/G]GAACAGCAGCCTAAGGTTCCTGTGTAATGTCAGTTCTTAA
ATAAAATGTTTTTGACTTAGTTTTGCTGTGAAATTATACT[A/C]TTTTGAGTTTCCCATTTTAAATCAAGAAGTGATTCTGTAT
TCCACAATGGAACATACACACTGTGGGTCTCAGCATAAGA[T/C]GTGGGTGGGGCCTGGCCAGATAGCTGGAAGAAACAATACT
GGGCTCTTCTTACTGATTTATTCAATTAAAAGAGTATTTT[T/C]ATCTCAGGTTCTCTAATAAATGAAACATAACAATGTTTCT
ATAAAAATAAGTAAATAAGTAAAAAAAAGTGTAACAAAAA[G/A]GGTCAAAGATGAACTAAATAAAAGAAGAAACTTCCATTGC
CAGGCAGTTAGACATCTTTTTGTTGTTGTTTTTGTTGTTG[G/T]TGGTGGCCTTATGTAATTCCTATGAGAACATAGGGTCCCT
TACAAAGCTGTTTCTCGTCAACTCTTACCTGGAATGTGCT[G/C]TTGTGTTATCACACACGAAGTAAGGAGACACATGAATCAT
ACCTAGTGAATCCACACTTCTCAGGTCTTAACTTGAAACC[G/A]AACCAAAGTCTGCTTTGCATAATTATCCTATGAGACTATC
AGAGGGCGTTTCCAACAACCCACTCCCTGCTCATAAATCA[T/C]AGAACAATTGTTGTTAAGGATTTGCTCAGAAATTCCATTT
ACTGCATGTTCCAGGTAAAATGTGTTTCTAGGTCTTGGTA[A/G]ATAACACAGAAGAATGAGAATTGACTAGAAGGAAGGGCTG
ACACATTTTTAAAGGGTGTATGGATTTGAAAGAGAGCAAA[G/A]GGGGTTGAATGGGAGGGTCTAGAAGGAGGAAAGGAAATGG
AACCACATTGAGGTGTGATTTTGCAAATTCTCCATATCAC[A/G]ACCTTCACCCTTTGTCACCCAGTTCTCTAATCCAAGTTAC
CCTCAGGCTACATAGTACAAGGATATATTAGTGACATAAA[C/T]ATATGTAGTGTGCATAGCAGTAAAGGCATGGTATCTTTGT
CATATAGCTCAAATCTTATTGGCAACAAAGAAGAGTAGGC[T/G]GTATAAATATAAAAGAGTGACTAAGCTTGCTTTACAAAAA
AGTTTGTGCATTAGTGTTAATCTTATGATCTTGTTTCTTC[T/C]GTAACAATATCATGGGTTTCAAAATTAAGAAACTAATAAT
CTCAACCTCTGAATTGAACTTCTACCAGGACTGTCCTACA[C/T]TCTGGAAACATATGTATCTTTTTTAGTAAGAAGAATGTGA
AGTGTATAATATGAGAACGTTCTCATTAGTAGTTATTATT[C/T]CATGACTATCAATGATAGAAAACCACTGACTTAAATTCTT
GAAAAGTCCAGAAGTTGCTGCATATTTTCTAAGCAATTAG[T/G]TGGTTCTGGCTGTGCCCTCTCTGGCTCTACTGTAAAATTA
TTATGAACATCTTTTATAATCAACATGGTAACTACTTAAT[G/A]ATGAAAAATATTTATGTTGAAAAATAATAAAATTAATATT
AACACAAAGAGCACCAGGAATATCCACAGCAATCCTCCAT[G/A]CATTTCCAGAGGTTTCTGGTTTCATTTCAGTGAGAGGAAA
TTCCCCAGTTAAATTTTTCAAATTTGTTTTCCTCAATGGG[C/T]GAGCTTATTTAAGGACAAGGTCAATACCCAGCATCATTGT
TCCTTATACATCTTTGTGGACTGTAATAGCCTTTCTTAGG[G/A]AGAGATTATTGTAAATGAAGCGCTAATTGCAGTCTACTTC
TGTAACATTATAACACAGAAGAGACAATCTAATACAGCTG[T/C]AAAGTCAAGGGAAGTGATTCCTAGAAGAAAGGACACTTAA

								
To top