RNAi ntro shRNA Transfection Kits sh marter RNAi from by paveldatsuk

VIEWS: 17 PAGES: 33

									RNAintroTM shRNA Transfection Kits
     for Transient, Stable and in vivo RNAi




           shmarterTM RNAi
       from Open Biosystems
Table of Contents                                                    Page


RNAintroTM Transfection Kit contents                                 3
       Shipping and Storage                                          4
Additional materials required by researcher                          5
Introduction to RNAi                                                 6
            TM
RNAintro         Transfection Kit description                        8
                            TM
       Expression Arrest         shRNA constructs                    8
       Arrest-InTM transfection reagent                              12
       Controls                                                      13
Transfection Kit Protocols (P1-P5)
       General schematic                                             15
       P1: Culturing and maintenance of shRNA plasmids               16
       P2: Culturing of shRNA for plasmid DNA                        18
       Restriction digests for pSM2                                  19
Transfection Protocols with Arrest-InTM
       P3: Co-transfection protocols                                 21
       P4: Transfection of adherent cells                            23
       P4: Transfection of suspension cells                          24
       P5: Determining Puromycin dose response                       25
       Transfection Optimization with Arrest-InTM                    25
Detection
       X-Gal staining of mammalian cells                             26
       Assaying For knockdown                                        27
Vector maps and sequence information
       pSM2                                                          28
       β-gal                                                         31
References                                                           31
Limited Use Licence                                                  33




Phone: 1-888-412-2225                 FAX: 1-256-704-4849       info@openbiosystems.com

                                        For Research Use Only

                                                    2
RNAintro™ Kit contents

RNAintro™ shRNA Transfection Kit-Luciferase              Catalog               Quantity
                                                         RHS3600
Kit Contents:
Expression ArrestTM shRNA constructs                     (RHS1764 or RMM1766)          2
Arrest-In™ Transfection Reagent                          (ATR1740)                     0.5ml
Luciferase shRNA plasmid DNA                             (RHS1701)             20ul at 0.5ug/ul
Non-Silencing control shRNA plasmid DNA                  (RHS1703)             20ul at 0.5ug/ul
Transfection Efficiency Control- β-Gal reporter          (RHS3708)             20ul at 0.5ug/ul
Protocols Manual                                                                       1




RNAintro™ shRNA Transfection Kit-eGFP                    Catalog               Quantity
                                                         RHS3601
Kit Contents:
Expression ArrestTM shRNA constructs                     (RHS1764 or RMM1766)          2
Arrest-In™ Transfection Reagent                          (ATR1740)                     0.5ml
eGFP shRNA plasmid DNA                                   (RHS1701)             20ul at 0.5ug/ul
Non-silencing control shRNA plasmid DNA                  (RHS1703)             20ul at 0.5ug/ul
Transfection efficiency control- β-Gal reporter          (RHS3708)             20ul at 0.5ug/ul
Protocols Manual                                                                       1




Phone: 1-888-412-2225              FAX: 1-256-704-4849             info@openbiosystems.com

                                     For Research Use Only

                                                  3
Shipping and Storage Conditions:
The following catalog items ship on ice packs and are to be stored long term at
–80°C upon arrival.
RHS1764
RHS 1701
RHS1702
RHS1703
RHS3708
Item ATR1740 is shipped on ice packs but separated from direct contact with the ice pack via
packing material in order to avoid freezing. This item is to be stored at 4°C upon arrival.


Each shRNA construct is shipped as a bacterial culture of E.coli in LB broth with 8% glycerol
and chloramphenicol (50µg/ml). Open Biosystems checks all cultures for growth prior to
shipment. Individual constructs are shipped on wet ice. All Expression ArrestTM shRNA
constructs should be stored at –80oC.




Phone: 1-888-412-2225               FAX: 1-256-704-4849             info@openbiosystems.com

                                        For Research Use Only

                                                 4
Additional materials required by researcher
Detection and Reporters:

        For RHS 3600

        Luciferase Reporter (Promega, pGL3-Control Vector (E1741)

        Luciferase Assay System (Promega Luciferase Assay System, E1500) or other
        established system/protocol and Luminometer

        X-Gal Staining Assay Kit (Gene Therapy Systems, #A10300K) or other established
        system/protocol

        For RHS 3601

        eGFP reporter (Invitrogen, cat#V355-20)

        Fluorescent microscope or fluorescence microplate reader

        X-Gal Staining Assay Kit (Gene Therapy Systems, #A10300K) or other established
        system/protocol

        Optional – β-gal detection kit using colorimetric substrate (Mammalian B-Galactosidase
        Assay Kit, Pierce 75707 or 75710). Spectrometer at 405nm.

        Cell lysis solution or commercially available solution (M-Per Solution, Pierce 78503)

Stable cell lines:

Puromycin (Cellgro catalog# 61-385-RA)

Plasmid DNA preparation:

Kit for plasmid DNA extraction (Qiagen, UltraPure)




Phone: 1-888-412-2225             FAX: 1-256-704-4849              info@openbiosystems.com

                                     For Research Use Only

                                               5
Introduction to RNAi
RNA interference (RNAi) is a conserved genetic surveillance mechanism in which dsRNA
induces degradation of the homologous mRNA, mimicking the effect of the reduction, or loss, of
gene activity (He and Hannon, 2004).
 The discovery of RNAi as a biological response to double-stranded RNA (dsRNA) came from
experiments in the nematode Caenorhabditis elegans. Injecting dsRNAs into the worm was
found to silence genes whose sequences were complementary to those of the introduced dsRNAs
(Fire et al 1998). It is now clear that an RNAi pathway is present in many, if not most, eukaryotes
(Hannon GJ, 2002). dsRNAs are processed into short interfering RNAs (siRNAs), ~22 nt in
length, by the RNAse enzyme, Dicer. These siRNAs are then incorporated into a silencing
complex called RISC (RNA-Induced Silencing Complex), which identifies and silences
complementary messenger RNAs by a process of cleavage and degradation. The RNAi pathway
is highly conserved, however introduction of long dsRNA (<30bp) into mammalian cells results
in a potent interferon response and non-specific inhibition of transcription and translation
(Williams BR 1997). The use of synthetic siRNAs to transiently knockdown the expression of
target genes has been an effective way to circumvent the cytotoxic dsRNA activated pathways in
mammals (Elbashir et al 2001). The silencing response to siRNAs, although effective, is transient
lasting from 3–7 days depending on the rate of cell division, making this approach unsuitable for
analysis of the long-term effects of gene silencing. The discovery of endogenous triggers of
RNAi in the form of microRNAs (miRNA) resulted in the development of another class of
synthetic RNAi triggers–short hairpin RNA (shRNA).
MiRNAs are a family of 21–25 nt small non-coding RNAs that regulate gene expression in a
sequence specific manner. miRNA precursors share a characteristic secondary structure forming
short hairpin RNAs of ~70nt. These precursors are processed to their mature form by RNAse III
enzymes, Drosha & Dicer, and function through RNAi mediated pathways to regulate the
expression of target genes (Figure1). Native miRNA’s do not perfectly match their target mRNA
(unlike siRNAs). Also miRNA’s typically act via translational repression of coding mRNAs,
however recently they may also have been indicated in mRNA degradation. (See He and Hannon
(2004) for review).




Figure1: Current model for microRNA processing and the RNAi pathway


Phone: 1-888-412-2225              FAX: 1-256-704-4849             info@openbiosystems.com

                                     For Research Use Only

                                                6
shRNA, RNAi and gene silencing

 Short hairpin RNAs (shRNAs) are modeled after miRNA hairpin precursors and cloned
into expression vectors. In this system instead of chemically synthesizing the siRNAs
before introducing it in the cell, the siRNAs are made directly by the cells. A vector
directing the transcription of the shRNAs by RNA polymerase III is introduced into cells
and these transcribed shRNAs are processed (by Drosha and Dicer) to give siRNAs that
turn off the target gene either by translational repression or mRNA degradation. The
mode of silencing depends at least in part on the level of complementarity between the
small RNA and its target (Zeng et al 2003, Saxena et al 2003). shRNAs transcribed
within cells from expression vectors make possible the creation of stable cell lines and
transgenic animals in which suppression of a target gene is stably maintained by RNAi.

The following schematic (Fig.2) shows the entry points of endogenous and synthetic RNAi
triggers. dsRNA, microRNA precursors and shRNA share a common mechanism that correlates
with the production of siRNAs. Synthetic siRNAs bypass the requirement for Dicer, enter the
RNAi pathway, assemble into RISC and block gene expression by mRNA cleavage and
degradation. MicroRNA exert their effect primarily via translational repression.




Figure 2: Different RNAi triggers share a common mechanism for gene silencing



Phone: 1-888-412-2225            FAX: 1-256-704-4849           info@openbiosystems.com

                                   For Research Use Only

                                             7
RNAintroTM shRNA Transfection Kit description
The use of vector-based RNAi for gene silencing is a powerful and versatile tool. Successful gene
silencing in vitro is dependent on several variables including 1) Health and transfectability of the
target cell line being studied 2) Transfection efficiency 3) Abundance of the mRNA or protein of
interest in the target cell line 4) Half life of the protein.
For all these reasons it is very important to run controlled experiments where the transfection
efficiencies are as high as possible and measurable.

RNAintro™ shRNA Transfection Kits provide optimized reagents and validated controls
necessary for a gene silencing experiment. Each kit includes:

    •   Two Expression ArrestTM shRNA constructs - Your choice from human or mouse whole
        genomes
    •   Arrest-In™ Transfection Reagent for shRNA delivery
    •   Positive controls: Luciferase or eGFP shRNA plasmid DNA
    •   Negative control: Non-silencing shRNA plasmid DNA
    •   Transfection efficiency control: β gal reporter plasmid DNA

Expression ArrestTM Human and Mouse shRNA

Expression ArrestTM human and mouse shRNA libraries from Open Biosystems are a whole
genome RNAi resource and the only choice for transient, stable and in vivo RNAi studies. This
collection was developed in collaboration with Drs Greg Hannon (CSHL) and Steve Elledge
(Harvard). The collection has several unique features that make it a very versatile and efficient
tool for RNAi studies including large-scale screens (Paddison et al 2004).

These include:

(1) Unique MicroRNA-30 based hairpin design

Expression ArrestTM short hairpin RNA constructs are expressed as human microRNA-30
(miR30) primary transcripts. This design adds a Drosha processing site to the hairpin construct
and has been shown to greatly increase knockdown efficiency (Boden et al 2004). The hairpin
stem consists of 22-nt of dsRNA and a 19-nt loop from human miR30. Adding the miR30 loop
and 125nt of miR30 flanking sequence on either side of the hairpin results in greater than 10-fold
increase in Drosha and Dicer processing of the expressed hairpins when compared with
conventional shRNA designs without microRNA. Increased Drosha and Dicer processing
translates into greater siRNA/miRNA production and greater potency for expressed hairpins.




Phone: 1-888-412-2225               FAX: 1-256-704-4849             info@openbiosystems.com

                                      For Research Use Only

                                                 8
Figure 3: Expression ArrestTM shRNA are expressed as mir30 primary transcripts

Use of the miR30 design also allowed the use of 'rules-based' designs for target sequence
selection. One such rule is the destabilizing of the 5' end of the antisense strand which results in
strand specific incorporation of miRNAs into RISC.

The proprietary design algorithm targets coding regions and the UTR with the additional
requirement that they contain greater than 3 mismatches to any other sequence in the human or
mouse genomes.

Due to the placement of the RNA Polymerase III transcription terminator (four or more
thymidines) downstream of the hairpin, each transcript is designed to precisely terminate. RNA
Polymerase III terminates on the second thymidine, two uridines remain to create a 2 base
overhang.

(2) Versatile vector design

 Expression ArrestTM shRNA are already cloned into the pSHAG-MAGIC2 (pSM2) retroviral
vector. This vector has a Murine Stem Cell Virus (MSCV) backbone. Features of the vector that
make it a versatile tool for RNAi studies include:

    •   Ability to perform transfections (transient and stable) or transductions using the
        replication incompetent retrovirus
    •   Amenable to in vitro and in vivo applications
    •   Puromycin drug resistance marker for selecting stable cell lines
    •   Molecular barcodes enable complex screening in pools




Phone: 1-888-412-2225               FAX: 1-256-704-4849              info@openbiosystems.com

                                       For Research Use Only

                                                  9
                                                                Utility
         Vector Element
U6 promoter                             RNA generated with 4 uridine overhangs at each 3’
                                        end
Retroviral Signaling Sequence           Combined with packaging extract for mammalian cell
                                        infection
PGK-Puro                                Selection for transfection stability in mammalian cells
Chloramphenicol/Kanamycin               Bacterial selection marker
Homologous recombination sites
                                        Transfer shRNA cassette into new vectors through
                                        the MAGIC homologous recombination system

RK6γ
                                        Conditional origin of replication. Requires the
                                        expression of pir1 gene within the bacterial host to
                                        propagate


Table 1: Features of the pSHAG-MAGIC2 Vector




Antibiotic Resistances

        Antibiotic                   Concentration                          Utility
Chloramphenicol                  50ug/ml                    Bacterial selection marker (shRNA
                                                            insert)
Kanamycin                        optional                   Bacterial selection marker (vector)
Puromycin                                                   Mammalian selectable marker


Table 2: Antibiotic resistances conveyed by pSHAG-MAGIC2




Phone: 1-888-412-2225             FAX: 1-256-704-4849             info@openbiosystems.com

                                    For Research Use Only

                                               10
Arrest-InTMTransfection reagent for delivery of shRNA

Gene silencing using RNAi is critically dependent on highly efficient delivery of shRNA or
siRNAs into cells. Arrest-In™ transfection reagent is a proprietary polymeric formulation,
developed and optimized for transfection of shRNA plasmid DNA into the nucleus of cultured
eukaryotic cells. It is well known that polymers, but not cationic lipids, protect DNA in the
cytoplasm and promote entry into the nucleus of transfected cells (Pollard et al 1998).

Arrest-In™ transfection reagent also provides an enhanced uptake efficiency of the shRNA
plasmid DNA into cells. Once in the cells, Arrest-In™ promotes the entry of the shRNA
containing plasmid into the nucleus where it is transcribed into a hairpin, enters the cytoplasm
and is processed by the endogenous RNAi machinery into functional siRNAs.

Arrest-In™ is easy to use, robust, and exhibits very low toxicity. One milliliter is sufficient for
approximately 100 transfections on 35-mm tissue culture dishes using 2µg of DNA. Simply mix
diluted shRNA plasmid with diluted Arrest-InTM in the recommended ratios (See Table 1), add to
cells and assay 48–96 hrs later.




Phone: 1-888-412-2225               FAX: 1-256-704-4849             info@openbiosystems.com

                                      For Research Use Only

                                                11
Controls included in the RNAintroTM kit

Controls are a critical part of a gene silencing experiment. They enable accurate representation of
knockdown data and provide confidence in the specificity of the response. Changes in the mRNA
or protein levels in cells treated with negative or non-silencing controls reflect non-specific
responses in cells and can be used as a baseline against which specific knockdown can be
measured. Positive controls are useful to demonstrate that your experimental system is functional
and your shRNA construct is successfully activating the RNAi pathway.

Exogenous reporter genes are a good choice as positive controls to control for common
experimental variables in RNAi experiments such as
    a) Level of expression of the target gene in any particular cell line
    b) Relative abundance and turnover rate of the mRNA/protein of interest
    c) Exact target gene sequence being targeted.
Knowledge of transfection efficiency in gene knockdown experiments is also critical in
understanding the results. Factors affecting transfection efficiency include purity of plasmid
DNA, health of transfected cells, inconsistencies in number of cells plated, sufficient mixing of
transfection complexes, different cell types or change in the cell passage number. Thus,
determining the transfection efficiency for every RNAi experiment is essential to enable valid
comparisons across sets of data.

Negative controls
Non-Silencing shRNA construct: The non-silencing shRNA construct is a negative control for
any transfection experiment performed using the Expression Arrest™ shRNA library or other
shRNA producing vectors. The non-silencing shRNA sequence is cloned into the pSM2 vector
and expressed under the control of the U6 promoter. This sequence has been verified to contain
no homology to known mammalian genes.

Positive controls
eGFP shRNA construct: The eGFP shRNA is a positive control designed against the enhanced
GFP reporter (GenBank Accession No: pEGFP U476561, Invitrogen catalog#V355-20). This
construct has been validated to produce > 75% decrease in GFP fluorescence. The eGFP shRNA
sequence has been cloned into the pSM2 vector and is expressed under the control of the U6
promoter.

Luciferase shRNA construct: The Firefly Luciferase shRNA is a positive control designed
against pGL3 Firefly Luciferase (Promega Cat. #E1741). This construct has been validated to
produce >75% decrease in luciferase activity. The luciferase shRNA sequence is cloned into the
pSM2 vector and is expressed under the control of the U6 promoter.

Transfection efficiency control
β -Gal reporter: The β-Gal control vector contains β-gal under the control of the
cytomegalovirus (CMV) immediate early promoter for high levels of protein expression in
mammalian cells. Selection in bacteria is made possible by the inclusion of the ampicillin
resistance marker bla. β-Gal, the protein product of the E.coli lacZ gene, is a commonly used
reporter since it is easy to use and can be assayed either histochemically or quantified using a


Phone: 1-888-412-2225               FAX: 1-256-704-4849             info@openbiosystems.com

                                      For Research Use Only

                                                 12
spectrophotometer. Through the hydrolysis of X-gal, a blue precipitate can be visualized which
allows the determination of transfection efficiency by calculating the ratio of blue (transfected) vs
non-transfected cells. Activity can also be quantified using a spectrophotometer following the
addition of a substrate (eg. ONPG) to produce a colored product.


Validation of components in RNAintro™ Transfection Kits

Cos-1 cells were plated in a 24-well plate at a density of 2.5 x 104 one day prior to transfection.
The following day shRNA constructs were transfected into the cells using Arrest-In™
transfection reagent. Co-transfections were performed using a 10:1 ratio of shRNA to the
reporter, and ß-Gal was used as a transfection control. At 48 hours post-transfection the activity
was measured and the results were normalized to the non-silencing shRNA (Figure 2)




Graph 1. The data is shown as percent suppression of eGFP activity normalized to the
non-silencing control. The eGFP shRNA decreased eGFP activity by over 80% relative to
the non-silencing control whereas the luciferase shRNA used as a negative control did
not suppress activity.




Phone: 1-888-412-2225               FAX: 1-256-704-4849             info@openbiosystems.com

                                      For Research Use Only

                                                 13
Simple steps for gene silencing with the RNAintroTM shRNA kit




   Figure 4 shows a gene silencing experiment using transient or stable transfection.
   RNAintro™ shRNA transfection kits make each step of the process simple by providing
   optimized and validated components along with easy to follow protocols. The protocols are
   numbered P1-P5.

Phone: 1-888-412-2225            FAX: 1-256-704-4849           info@openbiosystems.com

                                   For Research Use Only

                                             14
Protocols
P1: Culturing protocols and maintenance of pSM2

It is well known that viral vectors have a tendency to recombine, producing background
recombinants. Recombination occurs at the long terminal repeat regions (LTRs). It is therefore
critical to maintain careful growth conditions when culturing viral vectors in E. coli in order to
reduce the number and abundance of background recombinants.

pSM2 is a viral vector that produces very little recombinant background product under careful
growth and handling conditions. We have observed that greater than 24-hour incubation times
increases recombination only slightly.

In order to obtain a good yield of cells in a short period of incubation, rich, low-salt media should
be used to culture pSM2 constructs. An incubation period of 14–20 hours at 37°C with aeration is
sufficient. It is recommended that you maintain an 8% glycerol stock of the cultures frozen at
–80°C when not in use. Freeze/thaw cycles do not have any detrimental effect providing the
cultures are not incubated at room temperature or higher for long periods of time.

Gel images of plasmid isolated from cultures grown under the above conditions are shown below.

1 2 3 4   5 6   7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50




Figure 5. 1.5 ml cultures of 42 different shRNA constructs after 20 hours of incubation at 37°C
with shaking (~170 rpm). 2X LB media (low-salt) with 8% glycerol was used for culturing. This
vector is a stable retroviral vector and shows minimal recombinants. The pSM2 band usually runs
around 7kb although it is not uncommon to see a band around 10kb or even around 5 kb. The
presence of a faint recombinant band is seen around 1.8 kb in lanes 10 and 12. If the recombinant
product is not a significant proportion (over 50%) of your plasmid prep the DNA is still
acceptable for transfection since the LTR-LTR recombinant product does not contain the
puromycin resistance gene or the shRNA construct.




Phone: 1-888-412-2225                             FAX: 1-256-704-4849                            info@openbiosystems.com

                                                     For Research Use Only

                                                                     15
   Background recombination levels associated with pSM2
   Although careful growth conditions were maintained when culturing this set, some percentage
   (5%) of the whole set still shows a low level of recombination. The following gel image is an
   example of what to expect after plasmid DNA preparation.
     1    2    3 4 5           6 7 8 9 10




10kb
7kb
5kb
4kb


1.5kb




   Figure 6: A 1ul inoculum of 9 different shRNA constructs were cultured in 1ml of 2XLB
   medium (low-salt) in a bioblock with aeration by shaking at 200 RPM at 37° C for 16 hours.
   Plasmids were isolated and run uncut on a 0.9% agarose-TAE gel.
   Lane 1: 10kb marker (10kb, 7kb, 5kb, 4kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb), Lanes 2 to 10: 10ul of
   plasmid prep product of nine different shRNA constructs.The first three arrows from the top point
   to various forms of the correct plasmid pSM2, which when digested with restriction enzymes
   produces the correct band size. The last arrow from the top points to the recombinant product (~
   1.8kb). Samples on lanes 4, 5, 6 and 7 show varying levels of recombination. Samples 2, 3, 8, 9
   and 10 show minimal to no recombination. If the recombinant product is not a significant
   proportion (over 50%) of your plasmid prep the DNA is still acceptable for transfection since the
   LTR-LTR recombinant product does not contain the puromycin resistance gene or the shRNA
   construct.




   Phone: 1-888-412-2225             FAX: 1-256-704-4849            info@openbiosystems.com

                                        For Research Use Only

                                                  16
P2: Protocols for culturing pSM2 shRNA constructs for plasmid preps

2X-LB* broth (low-salt) media preparation for plasmid DNA
Peptone               20 g/L
Yeast Extract         10 g/L
NaCl                  5g/L
Chloramphenicol       50µg/ml
**Glycerol            8% for long term storage

*LB media can also be used

** Glycerol can be omitted from the media if you are culturing for plasmid preparation. If
making copies of the constructs for long term storage at –80° C, 8% glycerol is required.



Culture conditions for individual plasmid preparations
Most plasmid mini-prep kits recommend a culture volume of 1–10 ml for good yield.
For shRNA constructs, 5ml of culture can be used for one mini-prep generally producing from 5–
20 ug of plasmid DNA.

    1. Upon receiving your glycerol stock(s) containing the shRNA of interest store at –80°C
       until ready to begin.
    2. To prepare plasmid DNA first thaw your glycerol stock culture and pulse vortex to
       resuspend any E. coli that may have settled to the bottom of the tube.
    3. Using a sterile loop or a pipette tip, streak the shRNA culture onto a LB agar plate
       containing 50 µg /ml Chloramphenicol. Incubate the plate overnight at 37°C. Return the
       glycerol stock(s) to –80°C.
    4. The following day, pick 1 to 3 colonies from the agar plate and inoculate 6 ml of the
       2XLB Chlor50. Incubate at 37°C for 16-20 hrs with vigorous shaking (300 rpm).
    5. The following day remove 1 ml of the culture and place in a sterile 2-ml sterile
       microcentrifuge tube. Place this tube at 4°C until the plasmid DNA from the remaining
       culture has been analyzed. Pellet the remaining 5-ml culture and begin preparation of
       plasmid DNA. We recommend preparing Ultra-pure DNA to ensure both high-purity and
       low endotoxin levels (Qiagen Catalog #12123) as required for transfection into
       eukaryotic cells.

    If you wish to continue at a later time cell pellets can be kept frozen at –20°C overnight.

    6. Run 3-5ul of the plasmid DNA on a 1% agarose gel. The uncut pSM2 shRNA constructs
       run at about 7-10kb while the most common product of a recombination event will run at
       ~1.5-1.8kb. If recombination is present at a significant amount then return to the plate
       and pick another colony and repeat plasmid preparation. A small amount of
       recombination is acceptable during transfection since the LTR-LTR recombinant product
       does not contain the puromycin resistance gene or the shRNA.
    7. Prepare an 8% glycerol stock culture using the 1ml of culture you removed prior to

Phone: 1-888-412-2225              FAX: 1-256-704-4849             info@openbiosystems.com

                                     For Research Use Only

                                                17
       plasmid preparation. This culture can be used for future plasmid preparations but it is
       still recommended you streak isolate and work from a fresh colony. Store at –80°C.

   Note: Due to the tendency of all viral vectors to recombine we recommend keeping the
   incubation times as short as possible and avoid subculturing. Return to your original glycerol
   stock or the colony glycerol stock for each plasmid preparation.



Restriction Digests of pSM2

You may wish to restriction digest a sample of your plasmid DNA following plasmid DNA
preparation. The following is a protocol for dual restriction enzyme digestion using EcoRI and
XhoI for quality control of pSM2 vectors (shRNA library and controls). The protocol for
HindIII/XbaI digests is exactly the same except replace the EcoRI Buffer with the 10X Buffer 2
and exchange the enzymes used.

   1. Using filtered pipette tips and sterile conditions add the following components, in the
      order stated, to a sterile PCR thin-wall tube.

       Sterile, nuclease-free water                                      14.8µl
       Restriction enzyme EcoR1 10X buffer                                  2µl
       BSA (10X, 10mg/ml)                                                 0.2µl
       DNA sample 1µg, in water or TE buffer                                1µl
       Restriction enzyme EcoRI, 20U                                        1µl
       Restriction enzyme XhoI, 20U                                         1µl
       Final volume                                                        20µl

   2. Mix gently by pipetting.
   3. Incubate in a thermalcycler at 37°C for 2.5 hours to digest then at 70°C for 20 minutes to
      kill the enzyme.
   4. Add 4µl of 6X Loading Dye (or another appropriate DNA loading buffer), and proceed to
      gel analysis.
   5. Load the gel with 20µl of each of the digested samples (a EcoRI/XhoI and HindIII/XbaI)
      on a 1% agarose gel. Also run 1µl (1µg) of the uncut sample combined with 16µl of
      water and 3µl of 6x dye alongside the digested samples.
   6. The Ecor1/XhoI digest will release the 97-bp insert and leave an approximately 7-kb
      band. The XbaI/HindIII digests should have 3 bands: 3690bp, 2260bp and 1253bp.




Phone: 1-888-412-2225             FAX: 1-256-704-4849             info@openbiosystems.com

                                    For Research Use Only

                                               18
1     2     3      4     5      6       7     8    9      10




Figure 7. The 1% agarose gel above contains -10kb ladder followed by undigested sample and
restriction digests of the non-silencing shRNA control (lanes 2,3,4), the eGFP shRNA control
(lanes 5,6,7) and the FFLuc shRNA control (lanes 8,9,10). For each sample the lanes are as
follows: undigested sample, an EcoR1/Xho1 digest, then the XbaI/HindIII digest.




Phone: 1-888-412-2225               FAX: 1-256-704-4849         info@openbiosystems.com

                                     For Research Use Only

                                              19
Transfection Protocols with Arrest-InTM:
P3: Co-Transfection of Adherent Cells with Reporters and shRNA constructs

**Warm Arrest-In™ reagent to ambient temperature (approximately 10-15 minutes at room
temperature) prior to use. Always mix well by vortex or inversion prior to use. Do not add
antibiotics to cell media during transfection.

    1. The day before transfection, plate the cells so that they are approximately 70–80%
    confluent on the day of transfection.

    2. The protocol below is optimized for co-transfection of a reporter and an shRNA construct
    into Hek293T cells in a 24-well plate (6–8x 104 cells per well seeded the day before
    transfection). If a different culture dish is used adjust all amounts in proportion to the change
    in surface area. Form shRNA DNA/Arrest-In™ transfection complexes as follows:

        a. For each well in transfection, in a sterile microcentrifuge tube dilute into 40µl serum-
        free medium the following:

        i.      50ng of the reporter DNA to be targeted by the shRNA (eGFP or Luciferase)
        ii.     20ng of β-gal reporter, to be used as a transfection efficiency control
        iii.    500ng of the appropriate shRNA plasmid DNA
        iv.     Add serum free medium as required to bring the final volume to 50µl

        b. For each well in transfection, in a sterile microcentrifuge tube dilute 2.5 µl (2.5 µg)
        Arrest-In™ into 47.5µl serum free medium.

        c. Add the 50 µl of medium containing the diluted DNA (step a) to the diluted Arrest-
        In™ (step b), mix and incubate for 15 minutes to form the transfection complexes.

  3. Add the transfection complex mixture to the cells and incubate in a CO2 incubator at 37o C.

Method 1 – Add the transfection complex mixture directly to the cells in culture. Tap the
plate and shake carefully to mix. Return the cells to a CO2 incubator at 37o C. The following day
replace medium with fresh growth medium as required.

Method 2 – Serum free transfection for difficult to transfect lines, to increase efficiency, or
sensitive cell lines. First aspirate the growth medium from the cells. Add an additional 300µl of
serum free medium to the tube containing the transfection complexes, mix well, then overlay onto
the cells. Return the cells to the CO2 incubator at 37oC for 3-6 hrs. Following the incubation add
an equal volume of growth medium containing twice the amount of normal serum to the cells (i.e.
to bring the overall concentration of serum to what is typical for your cell line). Alternatively the
transfection medium can be aspirated and replaced with the standard culture medium (see Note).
Return the cells to the CO2 incubator at 37oC.



Phone: 1-888-412-2225               FAX: 1-256-704-4849              info@openbiosystems.com

                                      For Research Use Only

                                                 20
Note – Arrest-In™ has displayed low toxicity in the cell lines tested therefore removal of
transfection reagent is not required for many cell lines. In our hands higher transfection
efficiencies have been achieved if the transfection medium is not removed. However, if toxicity is
a problem, aspirate the transfection mixture after 3-6 hrs and replace with fresh growth medium.
Additionally, fresh growth medium should be replenished as required for continued cell growth

  4. After 48 hrs of incubation, assay cells for reduction in gene activity, compared to reporter
  alone, non-silencing shRNA, or other negative controls.

 5. Calculate decrease in reporter activity compared to % of control as follows:

        a. Calculate the mean of your replica samples (R1 + R2…) of shRNA/reporter
           transfections and the non-silencing/reporter or other negative controls.
        b. Subtract the mean of a ‘no plasmid DNA' control (background) from each sample
        c. Divide each of the background subtracted replica means by the mean of the Non-
           silencing/reporter transfections (or other negative control transfection). This results in
           your sample:control ratio.
        d. Assay for the non-targeted reporter activity (e.g. β-Gal, Renilla Luciferase) to
           determine if transfection efficiency varied across wells. If significant variation exists
           either repeat transfection under tightly controlled conditions or normalize transfection
           efficiency prior to comparing across wells.

        Note: Factors affecting transfection efficiency are not limited to but include purity of
        plasmid DNA, health of transfected cells, inconsistencies in number of cells plated,
        insufficient mixing of transfection complexes

Table 1 - Suggested amounts of DNA, medium and Arrest-In™ reagent for transfection of
shRNA constructs into adherent cells
                                           Total serum
                                                              shRNA
                         Surface area per   free media                          Arrest-In™
  Tissue Culture Dish                                      plasmid DNA
                            well (cm2)      volume per                            (µg)**
                                                               (µg)*
                                             well (ml)
         60 mm                     20                   2                 4                 21

         35 mm                     8                    1                 2                 10

         6-well                   9.4                   1                 2                 10

        12-well                   3.8                  0.5                1                  5

        24-well                   1.9                 0.25               0.5                2.5

        96-well                   0.3                  0.1             0.1–0.2             0.5–1
*Recommended starting amount of DNA. May need to be optimized for the highest efficiency
**Recommended starting amounts of Arrest-In™ reagent. See Transfection Optimization.



Phone: 1-888-412-2225               FAX: 1-256-704-4849             info@openbiosystems.com

                                        For Research Use Only

                                                 21
P4: Transient Transfection of Adherent Cells with Plasmid DNA containing Reporters or
shRNA constructs
    1. The day before transfection, plate the cells so that they are approximately 60–80%
         confluent on the day of transfection.
**Warm Arrest-In™ reagent to ambient temperature (approximately 10-15 minutes at room
temperature) prior to use. Always mix well by vortex or inversion prior to use. Do not add
antibiotics to cell media during transfection

   2. See Table 1 to determine the appropriate starting amounts of plasmid DNA, Arrest-In™
      reagent, and culture medium based on your culture vessel size. Form DNA/Arrest-In™
      transfection complexes as follows:

           a. For each well in transfection, dilute plasmid DNA in 50µl of serum-free medium
           b. Dilute the appropriate amount of Arrest-In™ in 50µl serum-free medium.
           c. Add the diluted DNA (step a) to the diluted Arrest-In™ reagent (step b), mix
              rapidly then incubate for 10 minutes at room temperature.
           d. Add the remaining volume of serum-free medium required for your culture
              vessel size (Table1).
           Optional: Skip 2d, 3 and 4. Add complexes directly to cells in culture with existing
           growth medium. Mix well.

   3. Aspirate the growth medium from cells in culture and add the DNA/Arrest-In™ complex
      mixture to the cells. Incubate for 3-6 hrs in a CO2 incubator at 37oC.

               Note– It is required that the DNA/Arrest-In™ complexes be made in the absence
               of serum. Following complex formation the DNA/Arrest-In™ mixture can be
               added directly to the cells in culture with serum if this is preferred and cells do
               not experience increased toxicity.

   4. Following the 3–6 hr incubation add an equal volume of growth medium containing
      twice the amount of normal serum to the cells (i.e. to bring the overall concentration of
      serum to what is typical for your cell line). Alternatively the transfection medium can be
      aspirated and replaced with the standard culture medium (see Note). Return the cells to
      the CO2 incubator at 37oC.

               Note – Arrest-In™ has displayed low toxicity in the cell lines tested therefore
               removal of transfection reagent is not required for many cell lines. In our hands
               higher transfection efficiencies have been achieved if the transfection medium is
               not removed. However, if toxicity is a problem, aspirate the transfection mixture
               after 3–6 hrs and replace with fresh growth medium. Additionally, fresh growth
               medium should be replenished as required for continued cell growth

   5. After 48–96 hrs of incubation, assay cells for reduction in gene activity, compared to
      untreated or non-specific/irrelevant shRNA controls, by qRT-PCR and Western blot or
      functional assay. Optimal length of incubation from the start of transfection is dependent
      on cell type and stability of the protein being analyzed.


Phone: 1-888-412-2225             FAX: 1-256-704-4849             info@openbiosystems.com

                                    For Research Use Only

                                              22
   6. If selecting for stably transfected cells, transfer the cells to medium containing
      Puromycin for selection. It is important to wait at least 48 hours before beginning
      selection.
      Note – The working concentration of puromycin varies between cell lines. We
      recommend you determine the optimal concentration of antibiotic required to kill your
      host cell line prior to selection for stable shRNA transfectants. Typically the working
      concentration ranges from 1–10 µg/ml.


P4: Transfection of Suspension Cells in Presence of Serum Containing Medium
**Warm Arrest-In™ reagent to ambient temperature (approximately 10-15 minutes at room
temperature) prior to use. Always mix well by vortex or inversion prior to use. Do not add
antibiotics to cell media during transfection

   1. Add 4-6 X 105 cells in 500 ul of growth medium with serum but without antibiotics.
   2. The protocol below is for Jurkat cells in a 12-well plate, if a different culture dish is used
      adjust all amounts in proportion to the change in surface area. Form DNA/Arrest-In™
      transfection complexes as follows:
           a. For each well in transfection, dilute 2ug DNA into 50ul serum free medium.
           b. For each well in transfection, dilute 10ug Arrest-In™ into 50ul serum free
               medium.
           c. Add the diluted DNA (step a) to the diluted Arrest-In™ (step b), mix rapidly and
               incubate for 10 minutes to form the transfection complexes.
   3. Add the DNA/Arrest-In™ complex mixture to the cells in culture and incubate for 48-96
      hrs in a CO2 incubator at 37oC.
               Note - Arrest-In™ has shown low toxicity in the cell lines tested. Therefore
               removal of transfection reagent is not required for many cell lines. If toxicity is a
               problem, remove the transfection mixture after 4-6 hrs and/or dilute with fresh
               growth medium. Additionally, fresh growth medium should be replenished as
               required for continued cell growth

   4. After 48–96 hrs of incubation, assay cells for reduction in gene activity, compared to
      untreated or non-specific/irrelevant shRNA controls, by qRT-PCR and Western blot or
      functional assay. Optimal length of incubation from the start of transfection is dependent
      on cell type and stability of the protein being analyzed.

   5. If selecting for stably transfected cells, transfer the cells to medium containing
      Puromycin for selection. It is important to wait at least 48 hours before beginning
      selection.
      Note – The working concentration of puromycin varies between cell lines. We
      recommend you determine the optimal concentration of antibiotic required to kill your
      host cell line prior to selection for stable shRNA transfectants (See below). Typically the
      working concentration ranges from 1–10 mg/ml.




Phone: 1-888-412-2225              FAX: 1-256-704-4849             info@openbiosystems.com

                                     For Research Use Only

                                               23
P5: Determining Puromycin Dose-Response
In order to generate stable cell lines expressing the shRNA of interest, it is important to determine
the minimum amount of puromycin required to kill non-transfected cells. A simple procedure to
quickly test this is as follows:

    1. Plate cells at a 25% confluency in 14 wells of a 24-well plate. Allow them to incubate
       overnight under proper conditions for your cells.
    2. Label the wells to reflect the concentration of antibiotic to be applied (in duplicate).
       Prepare medium containing 0, 1, 2, 4, 6, 8, 10 µg/ml puromycin.
    3. Aspirate the growth media from the cells.
    4. Apply the medium containing the dilutions of the antibiotic to the appropriate well.
    5. Return the plate to the proper conditions for your cells.
    6. Every 3 days aspirate the old medium and replace with freshly prepared selective
       medium.
    7. Monitor the cells daily and observe the percentage of surviving cells. Optimum
       effectiveness should be reached in 3–10 days with puromycin.
    8. The minimum antibiotic concentration to use is the lowest concentration that kills 100%
       of the cells in 5–10 days from the start of antibiotic selection.

Transfection Optimization using Arrest-In™
It is essential to optimize transfection conditions to achieve the highest transfection efficiencies
and lowest toxicity with your cells. The most important parameters for optimization are
transfection reagent to DNA ratio, DNA concentrations and cell confluency. We recommend that
you initially begin with 70-80% confluent cells, and with the Arrest-In™ and DNA amount
indicated in Table 1.

Additional Factors Influencing Successful Transfection:
   1. Concentration and purity of nucleic acids – Determine the concentration of your DNA
       using 260 nm absorbance. Avoid cytotoxic effects by using pure preparations of nucleic
       acids.
   2. Transfection in serum containing or serum-free media – Our studies indicate that
       Arrest-In™/DNA complexes should always be formed in the absence of serum. In the
       cell lines tested we found that the highest transfection efficiencies can be obtained if the
       cells are exposed to the transfection complexes in serum free conditions followed by the
       addition of medium containing twice the amount of normal serum to the complex
       medium 3–5 hrs post transfection (leaving the complexes on the cells). However, the
       transfection medium can be replaced with normal growth medium if high toxicity is
       observed.
   3. Presence of antibiotics in transfection medium – The presence of antibiotics can
       adversely affect the transfection efficiency and lead to increased toxicity levels in some
       cell types. It is recommended that these additives be initially excluded until optimized
       conditions are achieved, then these components can be added, and the cells can be
       monitored for any changes in the transfection results.
   4. High protein expression levels – Some proteins when expressed at high levels can by
       cytotoxic; this effect can also be cell line specific.
   5. Cell history, density, and passage number–It is very important to use

Phone: 1-888-412-2225               FAX: 1-256-704-4849             info@openbiosystems.com

                                      For Research Use Only

                                                 24
       healthy cells that are regularly passaged and in growth phase. The highest
       transfection efficiencies are achieved if cells are plated the day before. However,
       adequate time should be allowed to allow the cells to recover from the passaging
       (generally >12 hours). Plate cells at a consistent density to minimize experimental
       variation. If transfection efficiencies are low or reduction occurs over time, thawing a
       new batch of cells or using cells with a lower passage number may improve the results.


Detection
Checking transfection efficiency: X-Gal staining of mammalian cells

   1. Aspirate medium from the cell culture dishes or plates.
   2. Wash the cells 1 time with 1X PBS.
   3. Add enough fixing buffer to cover the cells and incubate for 10–15 minutes at room
      temperature.
   4. Remove the fixing buffer from the cells and gently wash the cells 2 times with 1X PBS.
   5. Add freshly prepared staining solution containing X-gal to the cells. Incubate for 1 hour
      to overnight at 37°C.
   6. Examine the dish under the microscope. To calculate the transfection efficiency count
      the number of stained vs. unstained cells in randomly selected fields.

We recommend the use of the X-Gal Staining Assay Kit from Gene Therapy Systems (Cat. No:
A10300K) which contains all reagents in a ready-to-use format.




Phone: 1-888-412-2225             FAX: 1-256-704-4849             info@openbiosystems.com

                                    For Research Use Only

                                              25
Assaying for knockdown

       Assays for mRNA and protein are specific to your experimental system and protein of
       interest. Commonly used assays include qRT-PCR/RT-PCR for detecting changes at the
       transcript level and western blotting/ immunocytochemistry for detecting changes at the
       protein level.
       The graphs below show an example of a loss of function study (Silva and Hannon
       unpublished data) using shRNA to various human proteasomal genes. They used a
       fluorescent reporter assay in which a fluorescent reporter (Zs Green) was fused to a well
       known degradation signal (ZsGreen Prosensor, Clontech). Individual proteasomal shRNA
       were co-transfected with the fluorescent reporter and accumulation of fluorescence was
       indicative of impaired proteasomal function and successful knockdown. The results from
       the functional assay were also correlated with the amount of transcript remaining in the
       cells relative to control.
       A




       B

Figure 9: (A) Accumulation of fluorescent protein increases as the proteasomal function
decreases with knockdown of various proteasomal genes. Genes that show impaired proteasomal
function also show decreased mRNA levels (qRT-PCR) relative to control (B).




Phone: 1-888-412-2225            FAX: 1-256-704-4849            info@openbiosystems.com

                                    For Research Use Only

                                              26
Detailed Vector Map of pSHAG-MAGIC 2




The sequence of pSHAG-MAGIC2
5’ MSCV LTR
Packaging signal
U6 promoter + 27nt leader sequence…2003-2515
5’ mir30 context…2515-2634
Cloning site [XhoI-EcoRI] 2634-2646
3’ mir30 context…2646-2760
U6 terminator…2760-2764
Barcode cloning site [MfeI-MluI]… 2765-2799
Chloramphenicol resistance gene…2809-3763
PGK-PURO
3’ MSCV-“SIN”-LTR
CTTCCCAACCTTACCAGAGGGCGCCCCAGCTGTCCGAAATATTATAAATTATCGCACACATAA
AAACCATGCTGTTGGTGTGTCTATTAAATCGGCAACTGTTGGGAAGGGCGATCGGTGCGGGCC
TCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACG
CCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCGCAAGGAATGGTGCATGCAAGGAG
ATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCT
CATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGC
AACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGCGATTAGTCC
AATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGC
TGAAGCCTATAGAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAG
GGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAA
GGCATGGAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTTAGGAACAGAGAGAC
AGCAGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAA


Phone: 1-888-412-2225          FAX: 1-256-704-4849       info@openbiosystems.com

                                 For Research Use Only

                                          27
GAACAGATGGTCCCCAGATGCGGTCCCGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTC
CAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTT
CTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCG
GCGCGCCAGTCCTCCGATAGACTGCGTCGCCCGGGTACCCGTATTCCCAATAAAGCCTCTTGC
TGTTTGCATCCGAATCGTGGACTCGCTGATCCTTGGGAGGGTCTCCTCAGATTGATTGACTGCC
CACCTCGGGGGTCTTTCATTTGGAGGTTCCACCGAGATTTGGAGACCCCTGCCCAGGGACCAC
CGACCCCCCCGCCGGGAGGTAAGCTGGCCAGCGGTCGTTTCGTGTCTGTCTCTGTCTTTGTGCG
TGTTTGTGCCGGCATCTAATGTTTGCGCCTGCGTCTGTACTAGTTAGCTAACTAGCTCTGTATC
TGGCGGACCCGTGGTGGAACTGACGAGTTCTGAACACCCGGCCGCAACCCTGGGAGACGTCC
CAGGGACTTTGGGGGCCGTTTTTGTGGCCCGACCTGAGGAAGGGAGTCGATGTGGAATCCGA
CCCCGTCAGGATATGTGGTTCTGGTAGGAGACGAGAACCTAAAACAGTTCCCGCCTCCGTCTG
AATTTTTGCTTTCGGTTTGGAACCGAAGCCGCGCGTCTTGTCTGCTGCAGCGCTGCAGCATCGT
TCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATTAGGGCCAGACTGTTACC
ACTCCCTTAAGTTTGACCTTAGGTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAGTCG
GTAGATGTCAAGAAGAGACGTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTC
GGATGGCCGCGAGACGGCACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTT
TCACCTGGCCCGCATGGACACCCAGACCAGGTCCCCTACATCGTGACCTGGGAAGCCTTGGCT
TTTGACCCCCCTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCGCCTCCTCTTCCTCCAT
CCGCCCCGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCAGC
CCTCACTCCTTCTCTAGGCGCCGGAATTAGATCTCTCGATAATAGGGGACCGGATCCCCCCGA
GTCCAACACCCGTGGGAATCCCATGGGCACCATGGCCCCTCGCTCCAAAAATGCTTTCGCGTC
TCGCAGACACTGCTCGGTAGTTTCGGGGATCAGCGTTTGAGTAAGAGCCCGCGTCTGAACCCT
CCGCGCCGCCCCGGCCCAGTGGAAAGACGCGCAGGCAAAACGCACCACGTGACGGAGCGTGA
CCGCGCGCCGAGCGCGCGCCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCAT
ATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAA
AGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTTA
AAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGG
CTTTATATATCTTGTGGAAAGGACGAAACACCGTGCTCGCTTCGGCAGCACATATACTAGTCG
ACTAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCA
CATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTCGAGCAACC
AGAATTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCT
CTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTTTTCAATTGGA
AGACTAATGCGTTTAAACACGCGGCGACGCGTTCGACCGAATAAAACCTGTGACGGAAGATC
ACTTCGCAGAATAAATAAATCCTGGTGTCCCTGTTGATACCGGGAAGCCCTGGGCCAACTTTT
GGCGAAAATGAGACGTTGATCGGCACGTAAGAGGTTCCAACTTTCACCATAATGAAATAAGA
TCACTACCGGGCGTATTTTTTGAGTTGTCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAG
AAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAG
GCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTT
TAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCC
TGATGAATGCTCATCCGGAATTACGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGAT
AGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTG
AATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTG
AAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTG
GGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTC
ACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCAT
CATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGAT
GAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTTGC
TACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGGATCTCGACCGCGTTTG
GGCGGTGGCTCCCTGCCACGCGGCTCCGAACAGAAGCTGATCTCCGAAGAGGATCTGATTACC
CTGTTATCCCTACCCTAAAATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAG
CATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACAC


Phone: 1-888-412-2225   FAX: 1-256-704-4849      info@openbiosystems.com

                         For Research Use Only

                                  28
ATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTC
TACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACA
AATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGC
GGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGC
TGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCG
AAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTC
CTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCCCAAGCTTACCATGACCGAGTACAAGCCC
ACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTC
GCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGA
GCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACG
ACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCC
GAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGA
AGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTC
GCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCG
AGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGC
GGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATG
ACCCGCAAGCCCGGTGCCTGACGCCCGCCCCACGACCCGCAGCGCCCGACCGAAAGGAGCGC
ACGACCCCATGCATCGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGA
AAGACCCCACCTGTAGGTTTGGCAAGCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAG
GACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGC
GCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCCTC
CGATAGACTGCGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACT
TGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCT
TTCATGGGTAACAGTTTCTTGAAGTTGGAGAACAACATTCTGAGGGTAGGAGTCGAATCGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACGTGGGCCCAATTCTGTCAGC
CGTTAAGTGTTCCTGTGTCACTGAAAATTGCTTTGAGAGGCTCTAAGGGCTTCTCAGTGCGTTA
CATCCCTGGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTT
TTTTTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATTGT
TCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTTAGCCATGAGAGCTTAGT
ACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACATGAGAGCTT
AGTACGTGAAACATGAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATCAACAGATC
CTCTACACTAGAAGGGACGCACCGCTAGCAGCGCCCCTAGCGGTATCCTATAAAAAAACACA
CCGCGCCGCTAGCAGCACCCCTAATATAAAATAATGTTTTTTATAAAAATAGTCAGTACCACC
CCTACAAAACGGTGTCGGCGCGTTGTTGTAGCCGCGCCGACACCGCTTTTTTAAATATCATAA
AGAGAGTAAGAGAAACTAATTTTTCATAACACTCTATTTATAAAGAAAAATCAGCAAAAACTT
GTTTTTGCGTGGGGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTTGAGCCTTTTTGTGG
AGTGGGTTAAATTATACTAGCGCGTTTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAG
AAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAG
CGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGA
TAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACC
ATGATATTCGGCAAGCAGGCATCGCCATGTGTCACGACGAGATCCTCGCCGTCGGGCATGCGC
GCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCC
TGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGG
TCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGA
TACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAG
CAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGT
GGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGGGCACCGGACAGGTCGGT
CTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGC
CGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTG
CGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTTGATCAGATCT



Phone: 1-888-412-2225   FAX: 1-256-704-4849      info@openbiosystems.com

                         For Research Use Only

                                  29
β-Gal vector map1:




1
 Vector map and sequence compiled from literature and known fragments used to construct
vector. Sequence information available at http://www.openbiosystems.com/product_inserts.php




Phone: 1-888-412-2225            FAX: 1-256-704-4849           info@openbiosystems.com

                                   For Research Use Only

                                             30
References
Boden et al (2004) “Enhanced Gene silencing of HIV-1 specific siRNA using microRNA
designed hairpins”. Nucleic Acids Research 32:3, 1154–58.
Elbashir SM et al (2001) “Duplexes of 21-nucleotide RNAs mediate RNA interference in
cultured mammalian cells”. Nature, 411: 494–498.
Fire A et al (1998) “Potent and specific genetic interference by double stranded RNA in
Caenorhabditis elegans”. Nature 391:806-811.
Hannon, GJ et al (2003). “Stable Suppression of Gene Expression by RNAi in Mammalian
Cells”.. PNAS 99 (3):1443–1448.
Hannon GJ (2002) “RNA interference” Nature 418, 244-251
Hannon GJ et al (2004) “Unlocking the potential of the human genome with RNA
interference”. Nature 431:371–378.
He, L and Hannon GJ (2004) “MicroRNAs: Small RNAs with a big role in Gene Regulation”
Nature Genetics Reviews 5, 522–531.
Hemann, MT et al (2003) “An epi-allelic series of p53 hypomorphs created by stable RNAi
produces distinct tumor phenotypes in vivo”. Nat Genetics 33, 396–400.
Li MZ and Elledge SJ (2005) “MAGIC, an in vivo genetic method for the rapid construction of
recombinant DNA molecules” Nature Genetics in press
Lee et al (2003) “The nuclear RNAseIII Drosha initiates microRNA processing” Nature
425:415–418.
Nakahara et al (2004) “Expanding roles for miRNAs and siRNAs in cell regulation”.Current
Opinion in Cell Biology 16:127–133.
Paddison PJ et al. (2004) “A resource for large-scale RNAi based screens in mammals”. Nature
428: 427–431.
Pollard et al (1998) “Polyethylenimine but Not Cationic Lipids Promotes Transgene Delivery to
the Nucleus in Mammalian Cells”. Journal of Biological Chemistry, 273: 13; 7507–7511.
Saxena S et al (2003) Small RNAs with imperfect match to endogenous mRNA repress
translation: Implication for off-target activity of siRNA in mammalian cells. JBC, 278: 44312–
44319
Williams BR (1997) “ Role of the double stranded RNA-activated protein kinase (PKR) in cell


Phone: 1-888-412-2225             FAX: 1-256-704-4849            info@openbiosystems.com

                                      For Research Use Only

                                               31
regulation. Biochem Soc. Trans. 25, 509–513.
Zeng Y et al (2003) “MicroRNAs and small interfering RNAs can inhibit mRNA expression by
similar mechanisms”. PNAS 100: 9779–9784.




Phone: 1-888-412-2225            FAX: 1-256-704-4849         info@openbiosystems.com

                                    For Research Use Only

                                               32
Limited label licence


This product is covered by a Limited Use License.
This product is covered by several patent applications owned by Cold Spring Harbor Laboratory.
The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable
right (without the right to resell, repackage, or further sublicense) under these patent rights to
perform the RNAi knockdown methods using the RNAi-inducing vectors claimed in those patent
applications for research purposes solely in conjunction with this product. No other license is
granted to the buyer whether expressly, by implication, by estoppel or otherwise. In particular,
the purchase of this product does not include nor carry any right or license to use, develop, or
otherwise exploit this product commercially, and no rights are conveyed to the buyer to use the
product or components of the product for any other purposes, including without limitation,
provision of services to a third party, generation of commercial databases, or clinical diagnostics
or therapeutics.

This product is sold pursuant to a license from CSHL, and CSHL reserves all other rights under
these patent rights. For information on purchasing a license to the patent rights for uses other
than in conjunction with this product or to use this product for purposes other than research,
please contact the CSHL Office of Technology Transfer at, 516-367-8312.




Phone: 1-888-412-2225              FAX: 1-256-704-4849             info@openbiosystems.com

                                     For Research Use Only

                                                33

								
To top