Sec Cmm Templates

Document Sample
Sec Cmm Templates Powered By Docstoc
					030_JPP286SC_495   25-06-2009     12:54     Pagina 495




         Journal of Plant Pathology (2009), 91 (2), 495-497        Edizioni ETS Pisa, 2009                                        495


                                                         SHORT COMMUNICATION
                  DEVELOPMENT OF A MULTIPLEX PCR ASSAY FOR THE SIMULTANEOUS
                  DETECTION OF CLAVIBACTER MICHIGANENSIS subsp. MICHIGANENSIS,
                               PSEUDOMONAS SYRINGAE pv. TOMATO
                AND XANTHOMONAS AXONOPODIS pv. VESICATORIA USING PURE CULTURES

                                                                  Z. Özdemir

                      Adnan Menderes University, Faculty of Agriculture, Department of Plant Protection, 09100 Aydın, Turkey


         SUMMARY                                                           strains of P. syringae pv. tomato were identified with a
                                                                           650 bp PCR product, along with other coronatine- pro-
             A multiplex PCR assay for the simultaneous detection          ducing pathovars of Pseudomonas syringae (Bereswill et
         of three bacterial seed-borne pathogens of tomato was             al., 1994). Xanthomonas axonopodis pv. vesicatoria, the
         developed. Published primers: (i) CMM-5-CMM-6 for                 agent bacterial spot of tomato and pepper, was ampli-
         Clavibacter michiganensis pv. michiganensis; (ii) primer 1-       fied by three different PCR primer pairs targeted to the
         primer 2 for Pseudomonas syringae pv. tomato; (iii) RST2-         hrp gene cluster of the genus Xanthomonas. One of
         RST3 for Xanthomonas axonopodis pv. vesicatoria, were             these primer pairs, RST2-RST3 was designed on the
         used in the assay. Annealing temperatures were deter-             hrpB region of Xanthomonas axonopodis pv. vesicatoria
         mined by gradient PCR individually for each pathogen              strain 75-3 and amplified a 840 bp product (Leite et al.,
         and primer concentration ratios were investigated. Sensi-         1994). Specific detection of virulent strains of Clavibac-
         tivity assays were carried out and compared with single           ter michiganensis subsp. michiganensis that causes bac-
         PCR. Temperature of 59±1°C was optimal for annealing.             terial canker of tomato, was possible, using CMM-5 and
         Optimal primer concentrations were determined as 0.36             CMM-6 primers, from plasmid-borne pat-1 gene which
         µMol l-1 for C. m. michiganensis, 0.30 µMol l-1 for X. a.         generated a 614 bp product specific to virulent strains
         vesicatoria, and 0.12 µMol l-1 for P. s. tomato. Sensitivity      (Dreier et al., 1995). The detection limit in this assay,
         assays showed that 3 CFU in 50 µl sterile distilled water,        when testing infected plants was ca. 2x102 CFU ml-1.
         derived from pure cultures of C. m. michiganensis, P. s.              Multiplex PCR allows the amplification of more than
         tomato and X. a. vesicatoria could reliably be detected by        one target region in one PCR reaction mixture and can
         multiplex PCR when applied to pure cultures. The detec-           reduce the time and labor as compared with single PCR
         tion limit was determined to be ca. 10 times lower than           (Chamberlain and Chamberlain, 1994). However, the
         that of single PCR. Multiplex PCR provided less labor             use of multiple primers on multiple templates may re-
         and rapid results for the detection of bacterial pathogens        sult in inefficient or preferential binding of some
         of tomato, but the sensitivity of detection was reduced.          primers to their templates, while the degree of proximi-
         Thus, the sensitivity of this technique should be assayed         ty of annealing temperatures of different primers can
         prior to its use in place of single PCR.                          negatively affect the outcome of the assay (Elnifro et al.,
                                                                           2000). Nonetheless, multiplex PCR assays have already
           Key words: Clavibacter michiganensis subsp. michiga-            been employed for detection of a number of pathogens
         nensis, Pseudomonas syringae pv. tomato, Xanthomonas              (Glick et al., 2002; Menzel et al., 2002; Bertolini et al.,
         axonopodis pv. vesicatoria, tomato, detection, multiplex          2003; Hiroyuki and Tsuda, 2005; Özdemir, 2005a).
         PCR.                                                                  The aim of this study was the development of a mul-
                                                                           tiplex PCR assay to detect three seed-borne pathogens
                                                                           of tomato, C. michiganensis subsp. michiganensis, P. sy-
            Clavibacter michiganensis subsp. michiganensis,                ringae pv. tomato and X. axonopodis pv. vesicatoria si-
         Pseudomonas syringae pv. tomato and Xanthomonas ax-               multaneously in a single PCR tube. A preliminary report
         onopodis pv. vesicatoria are important bacterial                  of this work has been given previously (Özdemir,
         pathogens of tomato and cause economic losses world-              2005b), but this paper now extends the study to the
         wide. PCR methods and primers have been developed                 partial optimization of amplification conditions from
         for each pathogen (Bereswill et al., 1994; Dreier et al.,         pure cultures of the pathogens.
         1994; Leite et al., 1995). Coronatine toxin-producing                 For PCR assays, C. michiganensis subsp. michiganen-
                                                                           sis ICMP 2550 [Type strain (International Collection of
                                                                           Micro-organisms from Plants, Auckland, New
         Corresponding author: Z. Özdemir
         Fax: +90.256.7727233                                              Zealand)], P. syringae pv. tomato ICMP 2844 and X. ax-
         E-mail: zahide_ozdemir@yahoo.com                                  onopodis pv. vesicatoria ICMP 9592 [75-3, group A
030_JPP286SC_495    25-06-2009     12:54   Pagina 496




         496    Multiplex PCR of bacterial pathogens of tomato                       Journal of Plant Pathology (2009), 91 (2), 495-497

         strains, tomato race 1, also classified as X. euvesicatoria,       plex PCR, the three primer pairs were grouped in pairs
         Jones et al., (2004)] were routinely grown on King                 and several primer concentration ratios were tested.
         medium B (King et al., 1954), on yeast dextrose calcium            These primer groups and their concentration ratios were:
         carbonate agar [YDCA (Wilson et al., 1967)] and on                 (i) RST2-RST3/CMM-5-CMM-6; 4:1, 1:4, 2:4, 1:1.2; (ii)
         nutrient broth yeast extract agar [NBYA (Vidaver,                  primer 1-primer 2/CMM-5-CMM-6; 1:3, 3:3, 2:4, 1:4; (iii)
         1967)] at 24ºC. Cultures were maintained in 30% glyc-              primer 1-primer 2/RST2-RST3; 1:2.5, 3:3, 2:4, 1:4. Each
         erol at -80ºC for long term storage.                               concentration was run in duplicate. Except for primer
            PCR primers used in this study, shown in Table 1, had           concentrations and annealing temperature, reaction mix
         the following sequences: CMM-5: GCGAATAAGCC-                       and thermocycler conditions were the same as in gradient
         CATATCAA (19-mer), CMM-6: CGTCAGGAG-                               PCR conditions. Annealing temperature was set to
         GTCGCTAATA (19-mer) (Dreier et al., 1995); primer 1:               59.4°C. PCR products were run in gel electrophoresis in
         GGCGCTCCCTCGCACTT (17-mer), primer 2:                              3% high resolution agarose (Sigma-Aldrich, USA). Gels
         GGTATTGGCGGGGGTGC (17-mer) (Bereswill et al.,                      were run in 1x TBE (Tris-borate EDTA, pH 8.3) buffer
         1994), RST2: AGGCCCTGGAAGGTGCCCTGGA                                for 130 min at 4 V/cm, stained with ethidium bromide
         (22-mer), RST3: ATCGCACTGCGTACCGCGCGCG                             and visualized under UV by a Kodak imaging system.
         (22-mer) (Leite et al., 1994).                                         For sensitivity testing of multiplex PCR assays, 4-day-
            Annealing temperatures were determined by gradient              old pure cultures grown at 24°C were used. Templates
         PCR. Reaction mixture contained 200 µMol l-1 dNTPs,                were prepared by boiling for 10 min in an Eppendorf
         1x PCR buffer (100 mMol l-1 Tris-HCl pH 8.8, 500                   thermomixer. For each bacterial culture, three colonies
         mMol l-1 KCl, 0.8% Nonidet P40), 1.5 µMol l-1 magne-               were suspended in 50 µl sterile distilled water and 10 to
         sium chloride, 0.05 units µl-1 Taq polymerase (Fermen-             100 fold dilutions were made. An aliquot of 1.25 µl tem-
         tas, Lithuania) in 25 µl reaction volume. DNA templates            plate was used for each pathogen in a final PCR volume
         were prepared from 4-day-old cultures grown on their               of 25 µl. Cycling conditions were 35 cycles at 95°C for 30
         respective agar medium, suspending half loopful from               sec, 59.4°C for 30 sec and 72°C for 45 sec. Final exten-
         each culture in 200 µl sterile distilled water in eppen-           sion was at 72°C for 5 min. The same amount of primer
         dorf tubes. Tubes were boiled for 10 min in a ther-                concentration and reaction mixture was used as in the
         momixer (Eppendorf AG, Germany) and 1.25 µl of                     gradient PCR. The effect of Taq polymerase and Mg+2
         boiled suspension was used as DNA template. Primer                 (1.5, 2, 2.5 and 3 mMol l-1) concentration was also tested.
         concentrations for each pair were 0.12 µMol l-1 (primer            Under standard magnesium concentration (1.5 mMol l-1),
         1-primer 2), 0.3 µMol l-1 (RST2-RST3) and 0.36 µMol l-1            Taq polymerase concentration was increased by 1.6-fold.
         (CMM-5-CMM-6) (Genosys, Sigma-Aldrich, USA).                       All PCR experiments were repeated at least twice.
         Thermocycler conditions were determined as 30 cycles                   Multiplex PCR requires such an annealing tempera-
         at 95ºC for 30 sec, annealing at 57ºC (in a gradient) for          ture that all templates can be amplified efficiently by their
         30 sec, at 72ºC for 45 sec and final extension at 72ºC for         primers. A gradient PCR, with temperatures increasing
         5 min. The temperature gradient was 55.2, 56.3, 57.4,              from 55.2ºC to 61.4ºC was applied to each template of C.
         58.5, 59.5, 60.4, 61.0 and 61.4°C. PCR products were               m. michiganensis, P. s. tomato and X. a. vesicatoria. A
         run in 2% agarose (Sigma-Aldrich, USA) gel elec-                   common annealing temperature for all templates was de-
         trophoresis in 1x TBE (Tris-borate EDTA, pH 8.3)                   termined as 59±1ºC. In parallel to determination of the
         buffer, stained with ethidium bromide and visualized               annealing temperature, for homogenous amplification of
         under UV by a Kodak imaging system.                                templates, primer concentration ratios of three primer
            To determine primer concentration ratios for multi-             pairs were tested as paired group by PCR. Based on the

                   Table 1. Primers used for PCR assays.

                    Primers          Pathogen              Target gene   Fragment length   Tm                 References
                    CMM-5-           Clavibacter           pat-1         614 bp            55°C               Dreier et al.
                    CMM-6            michiganensis                                                            (1995)
                                     subsp.
                                     michiganensis

                    primer 1-        Pseudomonas           cfl           650 bp            67°C               Bereswill et al.
                    primer 2         syringae pv.                                                             (1994)
                                     tomato

                                                                         840 bp            62°C               Leite et al. (1994)
                    RST2-RST3        Xanthomonas           hrp
                                     campestris pv.
                                     vesicatoria
030_JPP286SC_495   25-06-2009         12:54   Pagina 497




         Journal of Plant Pathology (2009), 91 (2), 495-497                                                            Z. Özdemir     497

         results obtained, it was possible to choose the ratio of 1          (eds). The Polymerase Chain Reaction, pp. 38-46.
         (0.12 µMol l-1):2.5 (0.3 µMol l-1):3 (0.36 µMol l-1) for            Birkhäuser, Boston, MS, USA.
         primer 1-primer 2, RST2-RST3 and CMM-5-CMM-6, re-                Dreier J., Bermpohl A., Eichenlaub R., 1995. Southern hy-
         spectively. After optimization of annealing temperature             bridization and PCR for specific detection of phytopatho-
         and primer concentration ratios, the sensitivity threshold          genic Clavibacter michiganensis subsp. michiganensis. Phy-
                                                                             topathology 85: 462-468.
         of multiplex and single PCR was compared using pure
         cultures of the pathogens. In both single and multiplex          Elnifro E.M., Ashshi A.M., Cooper R.J., Klapper P.E., 2000.
                                                                             Multiplex PCR: optimization and application in diagnostic
         PCR, each template was detected reliably for all three              virology. Clinical Microbiology Reviews 13: 550-570.
         pathogenic bacteria at 3 CFU in 50 µl sterile distilled wa-
                                                                          Fessehaie A., Walcott R., 2005. Simultaneous detection of Aci-
         ter. However, lower yields by a 10 factor were obtained in          dovorax avenae subsp. citrulli and Didymella bryoniae us-
         multiplex than in single PCR.                                       ing multiplex real-time PCR. Phytopathology 95, S29.
             In multiplex PCR, increasing Taq polymerase enzyme           Glick D.L., Coffey C.M., Sulzinski M.A., (2002) Simultaneous
         concentration 1.6 fold did not have any effect on ampli-            PCR detection of the two major bacterial pathogens of
         fication sensitivity. In addition, increasing the amount of         geranium. Journal of Phytopathology 150: 54-59.
         Mg+2 concentration from 1.5 to 3 mMol l-1 did not in-            Hiroyuki U., Tsuda S., 2005. A one-step reverse transcription-
         crease amplification sensitivity. Previously, Özdemir               polymerase chain reaction system for the simultaneous de-
         (2005a) had studied simultaneous detection of C. m.                 tection and identification of multiple tospovirus infections.
         subsp. michiganensis and X. a. pv. vesicatoria by multi-            Phytopathology 95: 166-171.
         plex PCR without performing sensitivity assays. John-            Johnson K., Walcott R., 2005. A real-time PCR assay for the
         son and Walcott (2005) and Fessehaie and Walcott                    simultaneous detection of Pepino mosaic virus and Clav-
         (2005) have shown the detection of Pepino mosaic virus              ibacter michiganensis subsp. michiganensis. Phytopathology
                                                                             95: S50.
         and C. m. subsp. michiganensis by real-time PCR and
         Acidovorax avenea subsp. citrulli and Didymella bryoni-          Jones J.B., Lacy G.H., Bouzar H., Stall R.E., Schaad N.W.,
                                                                             2004. Reclassification of the xanthomonads associated with
         ae by multiplex real-time PCR.
                                                                             bacterial spot disease of tomato and pepper. Systematic and
             In this study, to prepare DNA templates, bacterial              Applied Microbiology. 27: 755-762.
         colonies were boiled as previously reported (Schaad et           King E.O., Ward M.K., Raney D.E., 1954. Two simple media
         al., 1995) and no PCR inhibition was obtained during                for the demonstration of pyocyanin and fluorescein. Jour-
         multiplex and single PCR assays. Further research                   nal of Laboratory and Clinical Medicine 44: 301-307.
         would be desirable to develop a reliable DNA extrac-             Leite R.P.Jr., Minsavage G.V., Bonas U., Stall R.E., 1994. Detec-
         tion method of bacterial template from seeds and a sen-             tion and identification of phytopathogenic Xanthomonas
         sitive detection method of the three pathogens in the               strains by amplification of DNA sequences related to the hrp
         seeds using real-time PCR.                                          genes of Xanthomonas campestris pv. vesicatoria. Applied and
                                                                             Environmental Microbiology 60: 1068-1077.
                                                                          Menzel W., Jelkman W., Maiss E., 2002. Detection of four ap-
         ACKNOWLEDGEMENTS                                                    ple viruses by multiplex RT-PCR assays with coamplifica-
                                                                             tion of plant mRNA as internal control. Journal of Virologi-
                                                                             cal Methods 99: 81-92.
            Work supported by Adnan Menderes University re-
         search fund (ZRF 04015) and The Scientific and Tech-             Özdemir Z., 2005a. Development of a multiplex PCR assay
                                                                             for concurrent detection of Clavibacter michiganensis ssp.
         nological Research Council of Turkey (TUBITAK)                      michiganensis and Xanthomonas axonopodis pv. vesicatoria.
         (TOGTAG 3505).                                                      Plant Pathology Journal 4 : 133-137.
                                                                          Özdemir Z., 2005b. A multiplex PCR assay for detection of
                                                                             Clavibacter      michiganensis     subsp.      michiganensis,
         REFERENCES                                                          Pseudomonas syringae pv. tomato and Xanthomonas ax-
                                                                             onopodis pv. vesicatoria. American Phytopathological Soci-
         Bereswill S., Bugert P., Volksch B., Ullrich M., Bender C.L.,       ety, Northeastern Division Meeting, Geneva 2005: 44.
            Geider K., 1994.Identification and relatedness of corona-     Schaad N.W., Cheong S.S., Tamaki S., Hatziloukas E.,
            tine-producing Pseudomonas syringae pathovars by PCR             Panapoulos N.J., 1995. A combined biological and enzy-
            analysis and sequence determination of the amplification         matic amplification (BIO-PCR) technique to detect
            products. Applied and Environmental Microbiology 60:             Pseudomonas syringae pv. phaseolicola in bean seed ex-
            2924-2930.                                                       tracts. Phytopathology 85: 243-248.
         Bertolini E., Olmos A., López M.M., Cambra M., 2003. Mul-        Vidaver A.K., 1967. Synthetic and complex media for rapid
            tiplex nested reverse transcription–polymerase chain reac-       detection of fluorescence of phytopathogenic pseudomon-
            tion in a single tube for sensitive and simultaneous detec-      ads: effect of the carbon source. Applied Microbiology 15:
            tion of four RNA viruses and Pseudomonas savastanoi pv.          1523-1524.
            savastanoi in olive trees. Phytopathology 93: 286-292.        Wilson E.E., Zeitoun F.M., Frederickson D.L., 1967. Bacterial
         Chamberlain J.S., Chamberlain J.R., 1994. Optimization of           phloem canker, a new disease of Persian walnut trees. Phy-
            multiplex PCRs. In: Mullis K.B., Ferré F., Gibbs R.A.            topathology 57: 618-621.
         Received June 11, 2008
         Accepted February 18, 2009
030_JPP286SC_495   25-06-2009   12:54   Pagina 498

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:62
posted:8/11/2011
language:Italian
pages:4
Description: Sec Cmm Templates document sample