Docstoc

Protein expression in eukaryotic hosts

Document Sample
Protein expression in eukaryotic hosts Powered By Docstoc
					    Protein Expression Systems
Cell-free             Bacterial




Yeast                       Mammalian




             Insect
   Protein Expression in Bacteria
1. Advantages/disadvantages
2. Genetic elements essential for the expression
3. Cloning strategies
4. Overview of the available expression   systems
   and expression strains
5. Design of cloning procedures using the VNTI
   program
              Advantages

• Fast growth
• Cheap medium and equipment for growing
• Good knowledge of the host
               Disadvantages
• Limitation for expression of eukaryotic proteins
  due to differences in the distribution of tRNAs
  and posttranslational modifications …
  Rear codons, SS bonds, glycosylation etc
• Accumulation of lipopolysaccharides
  (generally referred to as endotoxins) …
                             Goals
To obtain
as much as possible        /good expression+good cell growth
soluble folded protein             /reduced aggregation
in a form that is easy to purify     /use of secretion and tags



Common problem:
High expression=danger of aggregation, decreased cell growth
Genetic Elements Essential for Expression
          RBS, START, and STOP
Ribosome Bindind Site (RBS):

    RBS      RBS   5-9 n START
  GAAGGAATTCAGGAGCCCTTCACCATG ... ...

START codons:
E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8%
TTG (UUG) and a few others
STOP codons:
TAG (UAG), TGA (UGA), TAA (UAA)
Genetic Elements Essential for Expression
                      Promoters
Host’s promoters
2500 in the entire genome of E. coli K12 strain
Most frequently used: Plac / Ptac / Ptrc, PPBAD, rhaPBAD
- Regulation of expression

Promoters from phages
T7, T3, SP6, T5, PL
- Highly efficient and specific expression
Plac: Regulation
       Plac, Ptac, Ptrc: Characteristics
         Level of expression             Key features
             (inductor)

Plac     Low level up to       Weak, regulated. Suitable for
         middle (IPTG)         expression of gene products at
                               very low intracellular level.
                               Comparatively expensive
                               induction.
Ptac      Moderately high      High-level, but lower than T7
Ptrc      (IPTG)               system. Regulated expression still
(trp-lac)                      possible.Comparatively expensive
                               induction. High basal level.
PPBAD: Regulation
                 PPBAD and RhaPBAD

          Level of expression              Key features
              (inductor)

PPBAD     Variable from low to   Can fine-tune expression levels in
          high level             a dose-dependent manner. Tight
          (L-arabinose)          regulation possible. Low basal
                                 level. Inexpensive inducer.

rhaPBAD   Variable from low to   Tight regulation. Low basal
          high level             activity. Relatively expensive
          (L-rhamnose)           inducer.
                 Phage Promoters
      Level of expression               Key features
          (inductor)

T7   Very high              Utilizes T7 RNA polymerase.

T5   High                   Utilizes E. coli RNA polymerase.

PL   Moderately high        Temperature-sensitive host required.
     (temperature shift)    Less likelihood of "leaky" un-induced
                            expression. Basal level; high basal
                            level by temperatures below 30°C.
                            No inducer.
Combinations
Genetic Elements Essential for Expression
          Replication Origin

Plasmid        Replicon   Copy Number
pBR322          pMB1            15-20
 pUC             pUC           500-700
pACYC           p15A            18-22
pSC101         pSC101            5
 colE1          colE1           15-20
Co-expression from two plasmids
  Protein Expression in Bacteria
              Part2
1. Cloning strategies
2. Overview of the available expression
   systems and expression strains
3. Design of cloning procedures using the
   VNTI program
    Types of Expression Vectors

1




2




3
Insertion into Transcriptional Vectors
Insertion into Translational Vectors
Cloning Using Restriction Enzymes
                    NcoI

                             HindIII
Cloning Using A-overhangs
TA-Cloning with Topoisomerase
Directional Cloning
             CACC
Gateway Technology
    Expression of Fusion Proteins
We may fuse the target protein with
•   various tags to facilitate purification or protein
    detection
        HHHHHH-target, epitope-target
•   highly soluble proteins to improve solubility and to
    facilitate purification
        Thioredoxin-target, GST-target
•   signal peptides or other proteins to promote
    secretion
        SP-target
‘Short’ Fusion Protein Construction
                 ATG CAT CAC CAT CAC CAT CAC
‘Long’ Fusion Protein Construction
           NcoI               HindIII

                    HindIII             PstI
                        pUC18/19
                                    ApaLI (178)
                                           ALPHA
               P(BLA)                             HindIII (400)
    ApaLI (2367)                                  PstI (416)
                                                  XbaI (424)
                                                   BamHI (430)
                                                     AvaI (435)
    APr                                               XmaI (435)
                          pUC18
                                                      SmaI (437)
                          2686 bp
                                                      EcoRI (451)
                                                    P(LAC)
                                                   ORI




                                     ApaLI (1121)
Transcriptional vector
                       pTtrc99




Translational vector
                             pQE




Translational vector + CDR
pET
pCR&pEXP
pBAD
                       Expression strains
# Strain              Key features
1 BL21                Deficient in lon and ompT proteases
2 BL21* /STAR         #1 + deficient in RNaseE
                      Improves the stability of mRNA transcripts and increases
                      protein expression yield
3 BL21*(DE3)        #1 or 2 + carry T7 polymerase under Plac
                    Enables T7 expression
4 BL21*(DE3)pLysS/E #3 + plasmid pLysS or pLysE expressing T7 lysozyme
                      Reduces basal expression of recombinant genes
5 BL21-AI             #1 + carry T7 polymerase under PPBAD (araBAD)
                      Enables T7 expression with tight regulation
6 BL21 CodonPlus-     #1 + Enhances the expression of eukaryotic proteins that
  RIL                 contain codons rarely used in E. coli: AGG, AGA, AUA, CUA
7 BL21 trxB           #1 + deficient of trxB
                      Facilitates cytoplasmic disulfide bond formation
       Expression optimization

To optimase:
Level of inducer (e.g. arabinose)


Time of induction


Temperature of the induction step (popular - 18oC
overnight)

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:14
posted:8/8/2011
language:English
pages:38