Interim Report California Tree by dfgh4bnmu

VIEWS: 90 PAGES: 174

									California Tree Fruit Agreement
    2007 ANNUAL
  RESEARCH REPORT
      An investment on behalf of the growers of   :

            California
 Peaches · Plums · Nectarines
This page left intentionally blank.
California Tree Fruit Agreement
2007 Annual Research Report



                 CALIFORNIA TREE FRUIT AGREEMENT
                   2007 ANNUAL RESEARCH REPORT
ABSTRACTS......................................................................................................................................ii

FULL REPORTS................................................................................................................................iv

EPIDEMIOLOGY AND MANAGEMENT OF PRE- AND POSTHARVEST DISEASES
OF FRESH MARKET STONE FRUITS
ADASKAVEG, J. E............................................................................................................................17

BIOLOGICAL CONTROL OF ORIENTAL FRUIT MOTH
BENTLEY, W.....................................................................................................................................37

INVESTIGATION OF THE EFFECTS OF TREE FRUIT SUPPLEMENTATION
ON THE REPAIR OF OXIDATIVE DNA BASE DAMAGE IN MOUSE EXTRACTS
BOHR, V.............................................................................................................................................41

HEALTH BENEFITS OF PEACHES AND PLUMS
BYRNE, D...........................................................................................................................................50

DEVELOPMENT OF PREDICTIVE TOOLS FOR BROWN AND SOUR ROT
RESISTANCE IN PEACH AND NECTARINE
CRISOSTO, C......................................................................................................................................70

TESTING LOW HYDROSTATIC PRESSURE (LHP) TECHNOLOGY FOR
APPLICATIONS OF INTEREST TO THE CALIFORNIA TREE FRUIT INDUSTRY
CRISOSTO, C......................................................................................................................................79

PEACH AND NECTARINE CORKING
DAY, K................................................................................................................................................88

DEVELOPING PEDESTRIAN ORCHARD SYSTEMS
DAY, K................................................................................................................................................92

EVALUATION OF SIZE CONTROLLING ROOTSTOCKS FOR CALIFORNIA
PEACH PRODUCTION
DEJONG, T.........................................................................................................................................95



                                                California
                                                                           ii
This page left intentionally blank.
California Tree Fruit Agreement
2007 Annual Research Report




IMPROVED ROOTSTOCK FOR PEACH AND NECTARINE
DEJONG, T.......................................................................................................................................104

REFINING CHEMICAL CONTROLS AND APPLICATION METHODS FOR
TENLINED JUNE BEETLE GRUBS
JOHNSON, M...................................................................................................................................123

A GREATER NUMBER OF ROOTSTOCK CHOICES CAN PROVIDE A PARTIAL
ALTERNATIVE TO METHYL BROMIDE FUMIGATION
MCKENRY, M..................................................................................................................................129

SOURCES OF INOCULUM, BIOLOGY, EPIDEMIOLOGY,
AND TRANSMISSION OF SOUR ROT OF STONE FRUIT AND
MANAGEMENT OF THE DISEASE IN THE ORCHARD
MICHAILIDES, T.............................................................................................................................138

CONTROLLED ATMOSPHERE/HIGH EMPERATURE FORCED AIR:
A NONCHEMICAL QUARANTINE TREATMENT FOR STONE FRUIT
OBENLAND, D AND NEVEN, L....................................................................................................155

MICROBIAL FOOD SAFETY AND POSTHARVEST FRUIT DISINFECTION
SUSLOW, T................................. ....................................................................................................166




                                              California

                                                                        ii
This page left intentionally blank.
ABSTRACTS




    iii
California Tree Fruit Agreement
2007 Annual Research Report




EPIDEMIOLOGY AND MANAGEMENT OF
PRE- AND POSTHARVEST DISEASES OF
FRESH MARKET STONE FRUITS
PROJECT LEADER:                   Dr. James E. Adaskaveg

COOPERATORS:                      H. Förster, G. Driever, D. Thompson, K. Day,
                                  H. Andris, B. Beede, and B. Holtz

ABSTRACT

In 2007 we continued to evaluate new pre- and postharvest fungicides for their efficacy in managing
brown rot, gray mold, sour rot, powdery mildew, and Rhizopus rot. The main goals for the
preharvest research are to develop alternative chemistries to the highly effective SBI fungicides for
brown rot and powdery mildew management so that preharvest rotation programs can be designed
that prevent the overuse of any one class of fungicide, as resistance has developed in other stone
fruit growing areas. Due to the cool spring in 2007, disease incidence for powdery mildew was very
low in our research plot and no data could be obtained. There was also low blossom blight levels in
spring of 2007, and only limited information was obtained.

For preharvest fruit treatments two applications with any of the fungicides evaluated significantly
reduced the incidence of brown rot of harvested fruit. Applications within 8 days of harvest
generally were similarly effective to applications 16 and 8 days PHI for fungicides such as, Elite®,
Orbit®, Enable®, V-10116, Pristine®, and Adament®. The efficacy of the later treatments for other
fungicides (i.e., Scala®, Vangard®, Distinguish®) was generally reduced on spray-inoculated fruit.
The efficacy of the SBI fungicides Elite®, Enable®, and V-10116 was also stable for the two
timings on wound-inoculated fruit. Simulated rain that was applied after preharvest treatments with
Vangard®, Scala®, Elite®, V-10116, Polyoxin D, Adament®, or Distinguish® generally did not
significantly reduce fungicide efficacy.

Postharvest studies were part of an ongoing effort to develop and register new “reduced-risk”
postharvest treatments and to integrate the new materials in resistance management strategies. The
main goals in our 2007 postharvest research were to evaluate treatments with Mentor®, Pristine®,
and with the GRAS materials sodium bicarbonate and potassium sorbate for management of brown
rot, gray mold, and sour rot. Mentor® was very effective in reducing sour rot and brown rot decay
of inoculated fruit and was effective against gray mold when used at the 4-oz rate. Because BASF is
still tentatively pursuing registration of Pristine® for postharvest use on stone fruit we continued to
evaluate this fungicide using new postharvest formulations. These formulations significantly
reduced the incidence of brown rot, gray mold, and Rhizopus rot. Still, the performance using the



                                                 1
California Tree Fruit Agreement
2007 Annual Research Report




suggested rates generally was not equivalent to that of Scholar®. A new formulation of the
experimental material DPX LEM 17-072 was not shown to be very effective in reducing brown rot
and gray mold.

Postharvest treatments with sodium bicarbonate and potassium sorbate showed little or no efficacy
on the incidence of brown rot, gray mold, and sour rot. Only gray mold was sometimes reduced by
treatments with 0.2% sorbate. The addition of sodium bicarbonate or potassium sorbate to Mentor®
in some cases significantly decreased the efficacy of Mentor®.

Postharvest in-line drench treatments of plums with Scholar® had consistently the highest efficacy
in reducing both brown rot and gray mold when compared to treatments with Pristine®, Mentor®,
and Penbotec™. Still, these latter three treatments also significantly reduced the incidence of both
decays.

Currently, fludioxonil (Scholar®) and fenhexamid (Judge®) are fully registered for postharvest use
on stone fruit in California. Pyrimethanil (Penbotec™) is being registered through the IR-4 program
and registration is expected for 2008. A Section 18 emergency registration was granted for
propiconazole (Mentor®) in 2007 for management of sour rot. A Section 3 full registration is being
pursued through the IR-4 program. Although some reports of possible resistance have been made
we are investigating this finding in cooperation with other researchers.




                                                2
California Tree Fruit Agreement
2007 Annual Research Report




BIOLOGICAL CONTROL OF
ORIENTAL FRUIT MOTH
PROJECT LEADER:                   Walt Bentley

COOPERATORS:                      Dr. Marshall Johnson and Dr. James Hagler

RESULTS

Having been established on sunflower moth since 2003, Macrocentrus ancylivorus has
maintained a presence at Kearney Agricultural Center in an orchard of Crimson Lady peaches.
This orchard is adjacent to a field of sunflowers, planted annually to provide an alternate
overwintering host for Macrocentrus ancylivorus. The parasitoid was established in 2003 and
2004 using augmentative releases but is now parasitizing both Oriental fruit moth (OFM) and the
sunflower moth in the absence of controlled releases. In 2007 distance movement studies were
conducted. It was established that Macrocentrus ancylivorus sprayed with whole milk and soy
milk successfully picked up the milk protein marker.

Macrocentrus ancylivorus are reared at KAC. It requires just over one month per generation,
using the potato tuber moth (Gnorimoschema operculella) as a host.

Prior to release Macrocentrus ancylivorus were sprayed in each of two Bugdorms. One group of
approximately 200 was sprayed with soy milk, the other with whole milk. Before release, 25
unsprayed Macrocentrus ancylivoruss, 25 soy-sprayed Macrocentrus ancylivoruss, and 25 whole
milk-sprayed were aspirated, placed in micro-capsules, and placed in a freezer to be sent for
ELISA, along with any recaptured Macrocentrus ancylivoruss.

In August, 2007, a young mixed peach and cherry orchard infested with OFM, Sprayed
Macrocentrus ancylivorus were released from two points at the south side of the orchard. The
Macrocentrus ancylivoruss sprayed with whole milk were released at the edge of the orchard
adjacent to the first row of trees, the soy treated Macrocentrus ancylivoruss were released 100 ft.
directly south of the first point, in the midst of an adjacent vacant field. Sticky cardboard
sleeves were placed over branches to trap Macrocentrus ancylivoruss. Altogether 96 tubes were
placed, 4 each on 24 trees. No Macrocentrus ancylivoruss were found in traps after 24 hours. At
one week, traps were checked again but no Macrocentrus ancylivoruss were recovered.

An unseasonal rain and windstorm moved through the area about 24 hours after the experiment
was set up and compromised many of the traps. However, after three days, seven Macrocentrus
ancylivorus were recovered from traps and placed in micro-capsules, then in the freezer.
Damaged traps were reset and checked again in 24 hours.

It was encouraging to discover that the recapture method does have potential, but due to the
small number of Macrocentrus ancylivoruss that were recaptured, it seems that a larger sample
population will be required to draw any definitive conclusions regarding movement and flight
distance.




                                                 3
California Tree Fruit Agreement
2007 Annual Research Report




INVESTIGATION OF THE EFFECTS OF TREE
FRUIT SUPPLEMENTATION ON THE REPAIR
OF OXIDATIVE DNA BASE DAMAGE IN
MOUSE EXTRACTS
PROJECT LEADER:                   Dr. Vilhelm A. Bohr

COOPERATORS:                      Dr. Nadja C. de Souza-Pinto, Dr. William
                                  Ramos, Ms. Charlotte Harboe


ABSTRACT

The DNA is a relatively unstable molecule that can be easily modified (Lindahl, 1993).
Modifications of DNA bases, particularly those caused by oxidative stress, can lead to mutations and
have been directly linked with some diseases such as cancer. DNA lesions introduced by oxidative
stress also accumulate during the normal aging process. To counteract their deleterious effects, living
organisms have developed DNA repair systems that remove the damaged base and replace it with a
new, unmodified nucleotide. DNA repair is a set of enzymatic processes that work jointly to correct
DNA damage.

Since fruits and vegetables are good sources of anti-oxidants, it has been long speculated that dietary
modulation would decrease the levels of oxidative DNA damage. Very few studies have directly
addressed this question and the results are heterogeneous (Moller et al., 2003;Zhu et al., 2000). On
the other hand, the possibility that dietary components also modulate DNA repair activities has been
poorly investigated. Recently, Collins and colleagues (Collins et al., 2003) demonstrated that
consumption of kiwi fruit for 3-week periods decreased endogenous levels of oxidized DNA bases
and increased DNA repair efficiency. This DNA repair stimulation was not due to an increase in the
repair enzyme protein levels, suggesting that kiwi fruits may directly affect the activity of the
proteins.

Previous results from our laboratory suggested that peach extracts could modulate the repair of
oxidative lesions in vitro. This study was designed to address the question of whether a peach or
nectarine-enriched diet modulates DNA repair and damage levels in vivo, using mice as our animal
models. Our interest concentrates on one particular class of DNA lesions, formamidopyrimidine
(Fapy) modifications. The results obtained from these studies will further our understanding of how
diet modulates human health at the molecular level and may stimulate the consumption of peaches
and nectarines, if it appears that these fruits may contribute to lower oxidative DNA damage levels,
and thus decrease risk for certain diseases such as cancers and age-associated degenerative diseases.




                                                   4
California Tree Fruit Agreement
2007 Annual Research Report




HEALTH BENEFITS OF
PEACHES AND PLUMS

PROJECT LEADER:                   Dr. David Byrne

COOPERATORS:                      Dr. Luis Cisneros, Dr. Weston and Dr. David
                                  Ramming

ABSTRACT

Antiproliferation activity in cancer cell cultures
Extracts from the yellow fleshed peach Rich Lady (RL) and of red fleshed plum Black Splendor
(BS) were evaluated on the estrogen-dependent MCF-7, the estrogen-independent MDA-MB-
435 breast cancer cells and one non-cancerous breast cell line MCF-10A. The results showed
that RL extract effectively inhibited the proliferation of the estrogen-independent MDA-MB-435
breast cancer cell line as compared to either the non cancerous breast line MCF-10A or the
estrogen dependent breast cancer line MCF-7 respectively. In general BS extracts were less
effective although they still affected the MDA-MB-435 to a greater degree than the other breast
cancer cell line or the normal breast cell line. Thus subsequent screening was done with only the
MDA-MB-435 estrogen-independent cell line.

Twenty-six commercial varieties were tested. The IC50 values found in peach extracts ranged
from 110 mg/L to > 1200 mg/L. Spring Snow and Rich Lady showed high activity in
suppressing the proliferation of MDA-MB-435 cells, with IC50 values of about 110 and 150 mg/L
respectively. Among the nectarines varieties, IC50 values ranged from about 230 to > 1200.
Summer Fire and Honey Blaze were the most potent in suppressing the cell growth (IC50
between 230-250 mg/L). Finally, the IC50 values found for the plum varieties ranged from about
200 to 975 mg/L. Black Amber, Crimson Glo, Angeleno and Friar exerted the highest anti-tumor
activity (IC50 ~ 200 mg/L). These tests are currently being repeated and then the screening with
the colon and prostate cancer lines will begin.

The effect of maturity stage on phytochemical content
Fruit from Black Splendor plum and Rich Lady peach were collected in California at a range of
harvest maturities and shipped to Texas A&M University. Upon arrival these were separated into
3 firmness delimited groups and the flesh samples were frozen at -80C until later for analysis.




                                                5
California Tree Fruit Agreement
2007 Annual Research Report




DEVELOPMENT OF PREDICTIVE TOOLS
FOR BROWN AND SOUR ROT
RESISTANCE IN PEACH AND NECTARINES
PROJECT LEADER:                   Dr. Carlos Crisosto

COOPERATORS:                      Ebenezer Ogundiwin, Richard Bostock,
                                  David Slaughter, Tom Gradziel, Dr. Themis
                                  Michailides

ABSTRACT

The long-term goal of our program is to conduct research that will lead to the development of
brown and sour rot resistant peach and nectarine cultivars thereby reducing postharvest chemical
fungicide usage. The specific objectives of this project were to determine the genetic control of
resistance to brown and sour rot in peach using the ‘Loadel’ x ‘UCD96,4-55’ and ‘Dr. Davis’ x
F8, 1-42’ progeny populations, and cultivars contrasting for resistance/susceptibility to sour rot,
develop linkage maps with these populations and localize genomic regions controlling
resistance. During the summer of 2007, several peach and nectarine cultivars were challenged
with virulent isolates of brown and sour rot. Progenies of the two mapping populations were also
challenged with the same brown rot isolate used on the cultivars. Two inoculation methods were
used for brown rot – without wounding and with wounding. Inoculation with wounding was the
only method used for sour rot study. About 80 cultivars were surveyed for reactions to brown rot
inoculation. All cultivars were obtained from sources without post-harvest fungicide application,
and some cultivars were obtained from multiple sources. A total of 204 progeny were also
inoculated with brown rot for the two segregating populations ‘Loadel’ x ‘UCD96,4-55’ (82
individuals), and ‘Dr. Davis’ x F8, 1-42’ (122 individuals). For sour rot resistance survey, 34
peach and nectarine cultivars were challenged. Data were also obtained for each sour- and brown
rot-inoculated fruit on two ripening-related traits – firmness and flesh color. Levels of reaction
seemed to vary among cultivars, among progenies of the two populations, and between the two
methods of inoculation used. Analysis of data is underway, the result of which will determine the
course of molecular marker analyses.




                                                 6
California Tree Fruit Agreement
2007 Annual Research Report




TESTING LOW HYDROSTATIC PRESSURE
(LHP) TECHNOLOGY FOR APPLICATIONS
OF INTEREST TO THE CALIFORNIA TREE
FRUIT INDUSTRY
PROJECT LEADER:                   Dr. Carlos Crisosto

COOPERATORS:                      Gayle Crisosto and Antonio Torres

ABSTRACT

The objective of this project is to examine the effect of LHP treatments on the quality of fresh
peaches, nectarines, and plums. The proposed low hydrostatic pressure (LHP) technology
effectiveness reflects independence from fruit size and geometry because pressure transmission
into fruits is essentially instantaneous. Egg and larvae inactivation has been reported for short-
time LHP applications.

Fresh fruit, a yellow flesh, clingstone nectarine, a white flesh, freestone peach and a dark plum
were tested. LHP treatments tested were 20,000 and 30,000 psi (138MPa and 207Mpa) for 0, 1,
3, and 10 min. and controls (KAC and to OSU and back to KAC). The treatments were carried
out using a 22 liter high hydrostatic pressure vessel capable of reaching 85,000 psi (590 MPa or
5,800 atmospheres) located at the Oregon State University Food Processing Pilot Plant. The
treatments were applied to both naked and bagged fruit. Fresh fruit visually evaluated after
treatment showed various types of damage from all LHP treatment pressure-time combination.
Cracking of the skin on the peach and nectarine and pitting and tiny bumps on the plum were
visible on naked and bagged fruit. For the peaches, after 3 days of ripening, nearly all of the fruit
from all of the LHP treatments were visually unacceptable showing external damage of cracked
skin, discoloration, and water soaked areas. Internal damage included water soaked flesh and
brown pit cavity. For the nectarines, after 3 days of ripening, nearly all of the fruit from all of
the LHP treatments were visually unacceptable showing external damage of cracked skin,
discoloration, pitting, and water soaked areas. Internal damage included water soaked flesh,
brown flesh and brown pit cavity. For the plums, after 3 days of ripening, nearly all of the fruit
from all of the LHP treatments were visually unacceptable showing external damage of leaking
juice, hairline cracks, staining and pitting. Internal damage included translucent flesh, brown
flesh and brown pit cavity. From this test, we concluded that LHP treatment of fresh peaches,
nectarines, and plums is not a viable option as a fruit disinfestation alternative due to the
extensive damage to the fruit both immediately after treatment and after ripening.

In addition, we have applied for a USDA, APHIS permit to move insect pests across state lines
in order to test the effectiveness of the LHP treatments on the kill of major fresh fruit pests in the
egg and larval stages.



                                                  7
California Tree Fruit Agreement
2007 Annual Research Report




PEACH AND NECTARINE
CORKING
PROJECT LEADER:                   Kevin R. Day

COOPERATORS:                      Dr. R. Scott Johnson and Dr. Carlos Crisosto

ABSTRACT

Three trials were carried out in 2007. In the first, “Summer Fire” nectarines at Kearney were
subjected to the same treatments as in 2006. These included high and low nitrogen regimes; low
and heavy crop loads; and no summer pruning or severe summer pruning 45-60 days prior to
harvest. Fruit were harvested and kept in cold storage for about 15 before being peeled and
evaluated for corking incidence. The data are still being analyzed, but the incidence of corking
in this block was low.

In the second trial, fruit from additional “Summer Fire” trees were dipped in calcium solutions 5
times at approximately weekly intervals beginning at bloom to determine if fruit calcium
concentrations can be effectively raised. The leaves and fruits from these treatments are being
analyzed at the UC Davis analytical laboratory.

In the third trial, a block of “August Fire” nectarines with a history of severe corking was heavily
summer pruned at 12, 8, and 4-week intervals before harvest. A 50-fruit sample was collected
from each treatment just prior to harvest and there was no corking in any of the treatments so no
formal harvest data was collected.

The relative lack of corking can likely be explained by the warm spring temperatures
experienced in March/April of 2007. As such, we see no reason to extend these efforts into 2008
unless the spring is abnormally cold.




                                                 8
California Tree Fruit Agreement
2007 Annual Research Report




DEVELOPING PEDESTRIAN
ORCHARD SYSTEMS
PROJECT LEADER:                   Kevin R. Day

COOPERATORS:                      DR. Ted M. DeJong and Dr. R. Scott Johnson

ABSTRACT

Developing a Pedestrian Orchard

I. Peach/nectarine portion - Potted trees of an early-season peach and a late-season nectarine are
growing in the nursery in preparation for October 2007 planting at the Kearney Ag Center.
Rootstocks will be UC Controller 5, UC Controller 9, and Nemaguard. Trees will be planted at
appropriate spacings and conformations to achieve both pedestrian (7-9 feet tall) and standard
(12-14 feet tall) orchard height configurations.

II. Plum Portion – In March 2007 a block of “Owen T” plums growing on the semi-dwarfing
rootstock Citation (about 75-80% of the vigor of Nemaguard) were planted at Kearney. Two
row spacings/tree height configurations are used: standard 18 foot wide rows in which the trees
will be grown to standard height (12-14 feet tall); and 15 foot wide rows in which the tree will be
kept at a pedestrian height (7-9 feet tall). Tree conformation within each includes three training
systems: 1) 6-leader Hex-V trees, 2) 4-leader Quad-V trees, and 3) 2-leader Kearney V trees
planted at 12, 8, and 4 feet apart respectively. Trees are growing well and are anticipated to
produce some crop in 2008.




                                                 9
California Tree Fruit Agreement
2007 Annual Research Report




IMPROVED ROOTSTOCKS
FOR PEACH AND NECTARINE
PROJECT LEADER:                   Dr. Ted DeJong

COOPERATORS:                      Ali Almehdi, Dr. Scott Johnson, Kevin Day

ABSTRACT

The objective of this project is to develop genetically improved rootstocks for peach and
nectarine that combine tree size control and resistance to important diseases and pests including
nematodes. Thirty-nine rootstocks were planted, in replicated trials, at the Kearney Agricultural
Center (KAC) in 2003, through 2005. Three more rootstock selections with O’Henry scions were
planted in the KAC trials in winter 2007. Ten new selections are currently at a commercial
nursery for propagation and planting in replicated trials at KAC in the winter of 2008 and the
final three new selections identified in 2007 will be propagated next year and planted in the KAC
plot in winter 2009. All of these rootstocks are root-knot nematode resistant and have the
potential for tree size control.

The two new rootstock selections previously identified as having size-controlling characteristics
(HBOK 10 and 32) continued to perform well in 2007 with tree size being approximately 60 – 70
% of trees on Nemaguard and acceptable crop loads and fruit size. Several new selections have
been identified in the replicated plots at KAC as having promising size-controlling
characteristics including HBOK 9, 18, 27, 28 and 29. We have been paying special attention to
HBOK 28 because, in addition to size-controlling, trees on it appear to produce larger fruit than
trees on some of the other size-controlling rootstocks. We have not had time to process all of the
data collected in this plot this year but subjectively, the results continue to appear promising and
we anticipate the eventual release of several new rootstocks that will be completely compatible
with peach, have root-knot nematode resistance and have tree size-controlling characteristics.




                                                 10
California Tree Fruit Agreement
2007 Annual Research Report




EVALUATION OF SIZE CONTROLLING
ROOTSTOCKS FOR CALIFORNIA PEACH
PRODUCTION
PROJECT LEADER:                   Dr. Ted DeJong

COOPERATORS:                      Dr. R.S. Johnson and Dr. D. Ramming

Over half of the annual production costs for California peaches involve hand labor for pruning,
thinning and harvesting which is done on ladders. It is widely recognized that production costs
could be substantially reduced if the size of the trees could be reduced enough to eliminate the
need for ladders in the orchard.

Eight rootstocks were selected for further testing from the 80+ genotypes that were originally
evaluated. In 1994 the current project to further evaluate these eight selected rootstocks in
replicated field production trials was started.

In September 2003 and 2004 the trees were topped at 11 ft. To further test the response of the
trees on the different rootstocks one-half of the replications of each scion/rootstock/training
system replication was topped to 8 ft. in September 2005. This treatment was continued in the
fall of 2006.

In 2007 researchers attempted to adjust crop loads on all the trees of a particular system to
similar levels regardless of rootstock and tree height. Crop loads/tree in the KAC-V were much
lower that the open vase system. Although there was substantial variation among treatments, in
many cases crop loads and yields were similar across rootstocks and tree heights for a given
system but fruit size on the more size-controlling rootstocks was generally smaller than on the
vigorous rootstocks. In most cases there was no problem in keeping crop loads in the shorter
trees as high as in the taller trees. Fruit size on the trees topped at 8 feet tended to be larger than
fruit on trees topped at 11 feet when crop loads were similar for a given rootstock/scion/training
system combination.

This project clearly shows the potential of size-controlling rootstocks to be used in conjunction
with tree topping to maintain the height of trees so that virtually all horticultural operations can
be conducted from the ground or on very short ladders. Tree planting densities would have to be
greater than used in this trial to maintain crop yields comparable to standard, tall orchards. Also,
since there is the tendency for trees on the most size-controlling rootstocks to produce smaller
fruit compared to trees on more vigorous rootstocks it is recommended that growers use the new
size-controlling rootstocks (like Controller 5 aka K146-43) only in conjunction with scion
cultivars that have a propensity to produce large fruit.



                                                  11
California Tree Fruit Agreement
2007 Annual Research Report




REFINING CHEMICAL CONTROLS AND
APPLICATION METHODS FOR TENLINED
JUNE BEETLE GRUBS
PROJECT LEADER:                   Dr. Marshall W. Johnson

COOPERATORS:                      Kevin Day, Xingeng Wang, Walter Bentley,
                                  Michael Klein, Walter Leal, Dr. Michael McKenry,
                                  John D. Stark, Frank Zalom, Cyrille Verdun

ABSTRACT

Work continues on identifying insecticides that can effectively kill grubs of the tenlined June
beetle, (TLJB), Polyphylla decimlineata, and its cousin Polyphylla sabrina (Coleoptera:
Scarabaeidae). To date, two of four insecticides tested have shown promise. These are Diazinon
50 W and Admire® 2 (imidacloprid). In laboratory tests, 3rd instar grubs stopped eating and later
died when exposed to sand that had been treated with various rates of Diazinon and Admire. Of
interest is the observation that grubs exposed to the insecticides did not die immediately, but they
did stop feeding fairly quickly (within a few days). The shortest times to 100% mortality were
20 and 28 days for Diazinon and Admire, respectively. These products were also tested in a
sand-filled soil column to evaluate how far solutions could penetrate the sand and still kill 100%
of the test grubs. Diazinon and Admire could penetrate as far as 4 and 6 inches, respectively,
below the soil surface and kill 100% of the test individuals. Above 50% mortality could be
achieved for both compounds as far as 10 inches below the soil surface at the rates used. Given
environmental concerns, further work will concentrate on increasing the effectiveness of delivery
methods for Admire.

Although some potential was shown for the use of entomopathogenic nematodes for grub
control, work on this tactic will be postponed at this time due to the low levels of mortality
achieved and the difficulty in obtaining nematodes on a regular basis. For the near future, efforts
will be focused on the use of Admire for grub control.




                                                 12
California Tree Fruit Agreement
2007 Annual Research Report




A GREATER NUMBER OF
ROOTSTOCK CHOICES CAN PROVIDE
A PARTIAL ALTERNATIVE TO
METHYL BROMIDE FUMIGATION
PROJECT LEADER:                   Dr. Michael McKenry


ABSTRACT

In 2007 we have had four major nematode research activities underway. In a commercial
nectarine planting near Parlier we have been applying two nematicide treatments for the last four
years. Treatments include an untreated, Enzone alone and Enzone plus NatureCur, a walnut tea
derivative, applied by drip along existing irrigation furrows. We have done a very good job of
reducing ring and root lesion nematodes with the combination treatment but neither of the
treatments has adequately improved tree growth. At KAC we screened 18 Prunus rootstocks in
2004-05 against ring nematode and another 18 rootstocks are being examined in 2006-07.
Evaluation of Viking rootstock has now been conducted twice. These two-year studies indicate
that ring resistance in Viking is generally absent in 2-year tests. However, in farm advisor field
trials of 3 or more years in duration Viking is always of lower ring nematode populations than
Lovell. The poor correlation of data from these two different studies is not yet resolved. In the
longer term field trials we also identified a Prunus fergusobia and a new HBOK rootstock from
Ted DeJong’s program that appear to be useful against ring nematode when compared to Lovell.
We are very interested in HBOK selections because the Okinawa in its parentage may provide a
source of tolerance to the rejection component of the replant problem when replanting after
Nemaguard. Also at KAC we will soon complete the final evaluations of a dozen rootstocks for
their second-year tolerance to root-lesion and root-knot nematodes. Also at Kearney we have
first-year evaluations of various scions planted onto Krymsk 1, Flordaguard and ten other
rootstocks of interest. All the projects listed above were designed for completion in fall 2007.
We are on schedule to finish them except we will need one more year to inexpensively evaluate
the scions we have on Krymsk 1 and Flordaguard and to carry our Viking/ring evaluations into a
third year. I will propose in 2008 a new study, the initiation of a field trial to compare Krymsk 1,
HBOK, Viking and Nemaguard when replanting with or without soil fumigation. Our last four
years of study have provided a few specific answers for our overall strategy of “Starve the soil
ecosystem and replant with different rootstock parentage”. We see this general approach as an
alternative to soil fumigation for stone fruit growers.




                                                 13
   California Tree Fruit Agreement
   2007 Annual Research Report




SOURCES OF INOCULUM, BIOLOGY,
EPIDEMIOLOGY, AND TRANSMISSION OF SOUR
ROT OF STONE FRUIT AND MANAGEMENT OF
THE DISEASE IN THE ORCHARD

PROJECT LEADER:                      Dr. Themis J. Michailides

COOPERATORS:                         M. Yaghmour, D. P. Morgan, H. Reyes,
                                     Dr. C. Crisosto, and Dr. J.E. Adaskaveg

ABSTRACT

Sour rot of stone fruit is mainly caused by the yeast-like fungus Geotrichum candidum. Sometimes two
other yeasts Issatchenkia scutulata and Kloeckera apiculata are also isolated from fruit rotten by sour rot
and have been shown to induce sour rot on their own (Michailides et al., Plant Disease 88: 222, 2004).
Because G. candidum was shown to be more aggressive than the other yeasts and more frequently isolated,
our research emphasis was on G. candidum. In 2007, Geotrichum citri-aurantii was tested for its
pathogenicity and found to be pathogenic on nectarines, causing sour rot lesions of 18.7 mm in diameter.
There were differences in the production of polygalactoronase among 18 isolates of G. candidum and one
isolate of G. citri-aurantii and there was a trend between lesion size and enzyme production. Testing 36
white and yellow varieties of peaches and nectarines revealed significant differences in their susceptibility
to sour rot. In general, yellow varieties showed higher susceptibility to sour rot than white varieties. This
susceptibility might be in part due to differences in fruit acidity and content of phenolics between yellow
and white peach varieties. Based on 2006 and 2007 results, G. candidum propagules can contaminate the
packing line particularly at the fruit dump area and the area at the brushes and after the brushes and
“inoculate” fruit that originated from orchards whose fruit were free of any sour rot decay. The results also
show that whenever good sanitation practices are taken, the frequency and numbers of G. candidum are
reduced. Propagules of G. candidum were recovered from soil in about 44% of the 43 orchards sampled,
from leaves in 7.1% of the orchards, and from the surface of fruit from 3.6% of the orchards. In five
orchards, sour rot developed only in fruit of one field (0.2% of the fruit and 10% of boxes) collected
directly from the field without running them through the packing line. On the other hand, after running
fruits from the same lots through the packing line, sound cull fruit developed sour rot for all sampled fields.
The percentage of fruit decayed with sour rot ranged between 1 and 19.7%, and 40 to 100% of the boxes.
The results suggest that a major contamination of the fruit occurs is in the packing house. There is no report
or any evidence that G. candidum growing on treated fruit are resistant to Mentor®, or if the infection by
G. candidum has already started before the fruit were treated in the packinghouse. No definite conclusions
can be made regarding the reproduction of G. candidum in the packinghouse, although G. candidum could
be detected in wash water in 2006, but not in 2007. G. candidum was recovered from soils as deep as 4
inches. The highest population was in the top 1 inch and decreased significantly as the soil depth increased.
The results suggests that G. candidum population decreases as soil depth increases due to non-tillage
practices that allow the accumulation of fruit and plant residues on the surface, resulting in higher
population of G. candidum on the surface.




                                                      14
California Tree Fruit Agreement
2007 Annual Research Report




CONTROLLED ATMOSPHERE/HIGH
TEMPERATURE FORCED AIR: A NON-
CHEMICAL QUARANTINE TREATMENT
FOR STONE FRUIT

PROJECT LEADERS:                  Dr. David Obenland and Dr. Lisa Neven

ABSTRACT

Large-scale CATTS chamber installation and initial testing (Obenland, Parlier, CA)
The new large-scale CATTS chamber arrived on July 9 and was installed by the manufacturer
during the next 11 days. Control of chamber temperature and the concentrations of carbon
dioxide and oxygen were all found to be very accurate and superior to the laboratory CATTS
chamber. A total of five treatment runs, using two pallets of fruit per run, were completed to do
an initial evaluation of the ability of the chamber to heat boxed/palletized fruit. Total run times
(excluding time needed to establish the controlled atmosphere) were between six and seven
hours with size 56 fruit and two-layer boxes. This compares to three to three and one half hours
for the laboratory chamber. Fruit in boxes in the outer portion of the stack, particularly at the
corners, tended to heat more rapidly than fruit in inner boxes. Due to the very long treatment
times, experiments were conducted during the later runs to test the effects of enlarging the box
vents, using trays less restrictive to airflow and using plastic RPCs in place of some of the
normal boxes in the stack. Fruit in the modified boxes heated more rapidly than that in standard
boxes, but treatment times were still in excess of five hours, not including the time to establish
the controlled atmosphere. Further work needs to be done to reduce treatment times and to
improve heating uniformity throughout the stacks.

Entomological research (Neven, Wapato, WA)
Work on development of a controlled atmosphere water bath system for rapidly determining the
most tolerant infestive stage and most tolerant species has been completed using codling moth
(CM) and oriental fruit moth (OFM) as test organisms. This system will cut down on the time
needed for CATTS treatment development. It was also determined with this system that the
oblique banded leaf roller is less tolerant to CATTS than OFM or CM. Work is continuing on
developing a controlled atmosphere heating block system. This apparatus offers the ability to
test the tolerance of larger numbers of insects than can the water bath system, but more work
needs to be done to make this system useable. CATTS treatment was tested on two-spotted
spider mites this summer and it was found that the standard CATTS tests developed for peaches
and nectarines will not kill the deutronymph life stage. Previous work has shown that water dips
with food grade organosilicones will kill this life stage. Currently, we are arranging to obtain
apples infested with diapausing eggs of European red mite to test the CATTS tolerance of this
insect.




                                                15
California Tree Fruit Agreement
2007 Annual Research Report




MICROBIAL FOOD SAFETY AND
POSTHARVEST FRUIT DISINFECTION
PROJECT LEADER: Dr. Trevor Suslow


No report is available at this time.




                                       16
FULL REPORTS




     iv
California Tree Fruit Agreement
2007 Annual Research Report




EPIDEMIOLOGY AND MANAGEMENT OF
PRE- AND POSTHARVEST DISEASES OF
FRESH MARKET STONE FRUITS
PROJECT LEADER:                   Dr. James E. Adaskaveg

COOPERATORS:                      H. Förster, G. Driever, D. Thompson, K. Day,
                                  H. Andris, B. Beede, and B. Holtz

OBJECTIVES

1. Evaluate bloom and preharvest applications of new fungicides and biocontrols or natural
    products as compared to registered fungicides for control of brown rot blossom blight and pre-
    and postharvest brown rot fruit decay, as well as for gray mold and powdery mildew.
              a. Natural incidence of blossom blight and fruit decay (e.g., V-10116, V-10135,
                 Adamant)
              b. Bloom spray treatments under defined wetness periods using high-angle sprinkler
                 irrigation.
              c. Resistance management programs – mixtures of different fungicide classes.
              d. Efficacy of new fungicides against powdery mildew (e.g., V-10118, Quintec)
2. Evaluate nectarine and peach cultivars for natural resistance against brown rot blossom blight
and fruit rot.
3.     Determine the efficacy of new fungicides and biological/natural products as postharvest
treatments.
              a. Continued evaluation of new fungicides (Penbotec and Pristine) and
                 biocontrols/natural products (e.g., V-80005, DPX-LEM17) in laboratory and
                 experimental packingline studies, as well as evaluations of the newly registered
                 fungicide Judge in commercial packlines. Evaluation of compatibility of Mentor
                 with postharvest fruit coatings will also be done.
4. Evaluate new postharvest application methods, including in-line drenching systems, and roller-
bed applications.
5. Management of sour rot of stone fruits caused by Geotrichum candidum.
              a. Collection and characterization of fungal isolates from soil and decayed fruit with
                 sour rot-like symptoms.
              b. Evaluate postharvest sanitation treatments, including peroxyacetic acid (PAA) and
                 compare to standard sodium hypochlorite treatments.
              c. Baseline sensitivities of G. candidum to propiconazole (WP formulation).
              d. Evaluation of management strategies for sour rot, including sanitation treatments
                 with chlorine and ozone, PAA, and pre-and postharvest propiconazole treatments.
              e. Support emergency registration petition for Mentor.


                                               17
California Tree Fruit Agreement
2007 Annual Research Report




6.      Establish baseline sensitivities of fungicides (EC50 values) using spiral gradient dilution
     technology and monitor for resistance in target pathogen populations for new fungicides
     (pyrimethanil and pyraclostrobin/boscalid, propiconazole for postharvest pathogens –see
     above).

SUMMARY OUTLINE

     1) Three trials were conducted on the evaluation of fungicides for brown rot blossom blight
        management. Although very low disease levels occurred in the spring of 2007 (less than
        1% in the untreated controls), limited information on treatment efficacy was obtained from
        these trials.
     2) In preharvest fungicide applications, all fungicides evaluated including the registered
        products Pristine, Vangard, Scala, Elite, Orbit, and a new liquid formulation of Indar (i.e.,
        Enable), as well as the new materials V-10116 (metconazole or Quash, an SBI fungicide)
        and Polyoxin D, and new pre-mixtures (e.g., Adament and Distinguish) significantly
        reduced the incidence of brown rot fruit decay as compared to the control. The new SBI V-
        10116 was similarly highly effective as Elite. Among the new pre-mixtures, Adamant
        (Elite + Gem) performed very well on spray- and wound-inoculated fruit, and was similar
        to mixtures of Orbit and Vangard, Orbit and Abound, or Scala and Elite, especially when
        applied closer to harvest (i.e., 7+1 days PHI).
     3) Simulated rain that was applied after preharvest treatments with SBI fungicides (Elite, V-
        10116), pre-mixtures (Adament, Distinguish = pyrimethanil + trifloxystrobin) or Polyoxin
        D generally did not significantly reduce fungicide efficacy.
     4) In postharvest studies on sour rot, Mentor continued to be very effective in reducing decay
        of inoculated fruit. This fungicide was also very effective against brown rot and sometimes
        effective against gray mold when used at the 4-oz rate.
     5) A new formulation of the experimental material DPX LEM 17-072 was not shown to be
        very effective in reducing postharvest brown rot and gray mold.
     6) BASF is still tentatively pursuing registration of Pristine for postharvest use on stone fruit.
        Concerns with postharvest usage in the United States and the impact on worldwide
        maximum residue limits (MRLs) have been discussed. Postharvest formulations of Pristine
        significantly reduced the incidence of brown rot, gray mold, and Rhizopus rot. The
        performance using the suggested lower rates generally was not equivalent to that of
        Scholar. Still, due to its spectrum of activity, this pre-mixture compound would still be a
        good candidate to be developed as a postharvest fungicide.
     7) Postharvest treatments with sodium bicarbonate (rates between 0.5 and 4%) had little effect
        on the incidence of brown rot, and gray mold, and did not reduce the incidence of sour rot.
        The addition of 1 to 4% sodium bicarbonate to Mentor in some cases significantly
        decreased the efficacy of Mentor.
     8) Postharvest treatments with potassium sorbate at 0.2% in some cases significantly reduced
        the incidence of gray mold, but not of brown rot or sour rot. When mixed with Mentor,
        potassium sorbate either had no effect or decreased Mentor’s efficacy against gray mold
        and sour rot.
     9) In-line postharvest drench treatments of plums with Scholar were the most effective in
        reducing brown rot and gray mold. The efficacy of Mentor, Pristine, and Penbotec was not
        as consistent as that of Scholar.



                                                   18
California Tree Fruit Agreement
2007 Annual Research Report




     10) Construction of a sensory evaluation lab at KAC is moving forward and construction has
         begun in 2007.

INTRODUCTION

Blossom blight and preharvest brown rot control
Currently, fungicides are the most effective means for control of brown rot of blossoms and fruit.
Some fungicides have pre-infection (protective) and post-infection (suppressive) activity. Thus, our
research has shown that a single, properly timed fungicide application can reduce blossom blight to
zero or near zero levels. Broad-spectrum fungicides such as Rovral and Topsin-M, and more
narrow-spectrum fungicides such as the SBIs Orbit, Elite, Indar (Enable), and Rally (Laredo); the
anilinopyrimidines Vangard and Scala; the pre-mixture of two single-site materials Pristine; and the
hydroxyanilide Elevate are available in California that are very effective for control of brown rot.
The newer fungicides were registered based on research in our laboratory and currently, we are
developing new products with new modes of action to ensure that highly effective materials will
always be available to the stone fruit industry and that mixture and rotation programs can be
designed to help to prevent the selection of resistant populations to any given class of fungicide.
Thus, in 2007 we continued to conduct comparative blossom and preharvest efficacy studies with
registered and new fungicide treatments. Fungicides evaluated represented several different
chemical classes: sterol biosynthesis inhibitors Orbit (propiconazole), Elite (tebuconazole), Enable
(fenbuconazole), and V-10016 (metconazole; Quash); anilinopyrimidines Vangard (cyprodinil) and
Scala (pyrimethanil); the biofungicide Polyoxin D; mixtures of selected fungicides; and the
premixes Pristine (strobilurin pyraclostrobin plus carboxamide boscalid), Adament (SBI
tebuconazole plus strobilurin trifloxystrobin), and Distinguish (anilinopyrimidine pyrimethanil plus
strobilurin trifloxystrobin). Fungicides were evaluated on nectarine and peach fruit that were either
wound- or non-wound inoculated to characterize the compounds’ wound-protection and locally
systemic activities. Selected fungicides were also evaluated under highly favorable environmental
conditions for fungal infection, where rain that was simulated by micro-sprinkler irrigation was
applied to blossoms in the orchard after fungicide application.

Postharvest decay control
Due to the dry spring weather in 2007, and subsequent low inoculum levels in most orchards, the
incidence of postharvest brown rot was relatively low. Sour rot caused by Geotrichum candidum,
however, continued to cause postharvest losses to many packers especially on pre-conditioned or
tree-ripened fruit. We continued to evaluate different fungicides, as well as GRAS rated materials
(i.e., sodium bicarbonate and potassium sorbate) against the major postharvest decays with the
goal of finding suitable postharvest treatments for all of the industry’s needs for marketing high
quality fruit. New biological controls or natural compounds were not made available to us for
evaluation in 2007. Over the years, we identified several highly active ‘reduced-risk’ fungicides
and facilitated their registration by conducting IR-4 residue studies. Fludioxonil (Scholar) was
fully registered for postharvest use in December 2002. In August 2005, fenhexamid (Judge) was
registered in California for postharvest use and was fully registered on stone fruit in 2006.
Penbotec is being registered through the IR-4 program. Although IR-4 residue studies have been
conducted with Pristine, BASF, the registrant of Pristine delayed the postharvest registration of
the fungicide after European concerns about potential high MRL values on stone fruit after pre-
and postharvest applications. Therefore, we re-assessed the efficacy of this premix fungicide



                                                19
California Tree Fruit Agreement
2007 Annual Research Report




against the common postharvest decays using reduced rates. A Section 18 Emergency
Registration was approved in 2007 for Mentor (propiconazole) for the management of sour rot.
This fungicide in our previous years’ studies had demonstrated the best efficacy against sour rot
among a range of compounds that were evaluated. IR-4 residue studies have been conducted for
Mentor, and a full registration is expected for 2009-2010. Scholar is highly effective against
brown rot, gray mold, and Rhizopus decays, whereas Elevate, Penbotec, and Pristine (at reduced
rates that are considered for postharvest use) are mainly effective against gray mold and brown
rot. The efficacy of Mentor against decays other than sour rot was further evaluated in 2007. In
future studies we plan to assess the efficacy of new natural compounds and biological controls.
With this, we are trying to identify products that could be used for fruit that are destined for
markets that do not accept the use of fungicides.

With several highly effective and environmentally safe postharvest fungicides available in the
future and with an expanding arsenal of preharvest fungicides, it is important to apply proper
fungicide stewardship. Thus, our research is also focussing on strategies to prevent fungicide
resistance in pathogen populations. Determining fungicide sensitivity levels in fungal isolates is
critical to detect any changes in sensitivity in pathogen populations. For this, we established
baseline sensitivities of M. fructicola, B. cinerea, and G. candidum against some of the newer
fungicides. In addition to evaluating new postharvest fungicides and integrating them into a
management program, we have also been evaluating different postharvest application methods
and the compatibility of fruit coatings with these fungicides. This is done to ensure efficacious
fungicide usage, to make treatments cost-effective to packers, especially with expensive
materials such as Scholar, and to improve the appearance of treated fruit. Furthermore, we are
evaluating fruit and equipment sanitation treatments that are important to prevent the spread of
pathogen inoculum during postharvest handling in packinghouses.

Management of powdery mildew and peach leaf curl
In 2007, trials were also conducted on the management of powdery mildew and peach leaf curl.
Disease incidence for powdery mildew, however, was very low in our research plot and no data
could be obtained. Dormant spray treatments were conducted for management of peach leaf curl.
Due to serious outbreaks of this disease in recent years, we continued our timing and efficacy
studies on this disease. Several broad-spectrum, multi-site mode of action materials were used in
single-fungicide and mixture programs.

MATERIALS AND METHODS

I. Blossom blight and preharvest studies for brown rot control

Evaluation of fungicides for management of brown rot blossom blight and preharvest fruit decay.
Three trials were established at the Kearney Agricultural Center (KAC) in Parlier, CA, to evaluate
fungicides for control of brown rot blossom blight on Red Diamond, Summer Flare, and Summer
Fire nectarine as well as on Elegant Lady, July Flame, and Ryan Sun peach. The first trial was in
the established orchard with Red Diamond, Elegant Lady, and Ryan Sun, whereas the other two
trials were in a newly established orchard with Red Diamond, Summer Fire, and Summer Flare.
Fungicides that were applied to trees using an air-blast sprayer calibrated for 100 gal/A and
application dates are indicated in Fig. 1 of the Results section of this report. Randomized sub-plots



                                                 20
California Tree Fruit Agreement
2007 Annual Research Report




of four single-tree replications for each treatment were used. Incidence of brown rot blossom blight
caused by M. fructicola was recorded on April 14. For this, 200 blossoms were evaluated for blight
for each single-tree replication and treatment.

These orchards at KAC were also used for the evaluation of preharvest treatments. Applications
were made in the field using an air-blast sprayer (100 gal/A) at 8+1 day and 16+9 days PHI to Red
Diamond nectarine, at 7+1 day and 14+8 day PHI to Elegant Lady peach, and at 7+1 day PHI to
Ryan Sun peach. Fungicides evaluated are indicated in Figs. 2-4. Preharvest treatments were also
evaluated under highly conducive conditions for decay development where simulated rain was
applied by overhead microsprinker irrigation for 6-7 h after selected fungicide timings (see legends
of Figs. 5-8). In these simulated-rain studies, preharvest application intervals were 6+1 day for
Summer Flare nectarines, 7+2 days for July Flame peaches, 7+1 day for Summer Fire nectarines,
and 7+2 days for Ryan Sun peaches. Four boxes of 48 fruit each were harvested for each treatment
(one per single-tree replication). Fruit were packed in commercial boxes and stored for
approximately 7 days at 1 C. Fruit were then inoculated with M. fructicola either by spray-
inoculation of non-wounded fruit (15,000 conidia/ml) or by drop-inoculation of wounded fruit
(30,000 conidia/ml). Fruit were then incubated at 20C for 7 days and evaluated for incidence and
severity (lesion diameter) of decay.

Evaluation of fungicides for management of powdery mildew and peach leaf curl. A trial on the
management of powdery mildew was established in a commercial orchard, several new powdery
mildew fungicides (e.g., Quintec, V-10118, Procure, Yucca/Ag-Aide) were compared to registered
fungicides (e.g., Rally, Abound, Pristine). In a trial on the management of peach leaf curl at UC
Davis, fungicides (Bravo, Kocide 2000, Ziram, and mixtures of Kocide and Ziram) were applied in
an experimental Fay Elberta orchard at UC Davis as dormant treatments on 12-7-06 and/or 1-18-07
using an air-blast sprayer at 100 gal/A. Trees were evaluated for disease in April, 2007. For this,
100 leaves of each tree were rated for the presence of leaf curl.

II. Postharvest management studies for brown rot, gray mold, Rhizopus rot, and sour rot.

Experimental packingline studies on postharvest fungicide treatments for control of brown rot,
gray mold, Rhizopus rot, and sour rot. Fungicides evaluated include two formulations of Pristine
(i.e., BAS 516 09F – a liquid formulation, and BAS 516 04F – the WG formulation), Scholar
50WP, Mentor 45WP, Elite 45WP, Judge 50WG, BAS 510 (boscalid), Penbotec 500SC, and
selected mixtures of these fungicides. In addition sodium bicarbonate (SBC) and potassium sorbate
(K-sorbate) were evaluated at selected concentrations either by themselves or in mixtures with
Mentor. A range of nectarine and peach cultivars, as well as Casselman plums, were used in these
studies as indicated in the Results section. Fruit were wound-inoculated (wounds 1 x 1 x 0.5 mm)
with either G. candidum (3x105 spores/ml), M. fructicola, B. cinerea, or R. stolonifer (3x104
spores/ml each) and treated 13-18 h after inoculation. Treatments were applied by low-volume
spray (CDA) applications on a brush or roller bed at 25 gal/200,000 lb fruit or were treated using
an in-line drench application on a roller bed. Treatment rates for CDA applications expressed in
ppm are the equivalent amount of active ingredient applied in 100 gal/200,000 lb fruit and
fungicides were applied in a dilute fruit coating (25-50% D251 or 20% Primafresh 200) to
peaches and nectarines or in an undiluted fruit coating (Primafresh 45) to plums. In-line drench
applications were done with fungicide rates/100 gal and were followed by CDA applications with



                                                 21
California Tree Fruit Agreement
2007 Annual Research Report




the fruit coating. For each treatment there were 12-24 fruit for each of four replications. After
treatment, fruit were then incubated for 6 days at 20C and >95% RH. For evaluation of fruit, the
incidence of decay was calculated based on the number of decayed fruit per total number of fruit
treated.

Statistical analysis of data. Data for disease incidence (percentage data) were arcsin transformed
before analysis. Data were analyzed using analysis of variance and least significant difference
(LSD) mean separation procedures of SAS 9.1.

RESULTS AND DISCUSSION

I. Management of Blossom Blight, Preharvest Brown Rot, Powdery Mildew, and Peach Leaf
Curl

Efficacy of fungicides for management of blossom blight. The performance of fungicides was
evaluated after single applications at delayed pink bud or at full bloom. Due to low precipitation
in the spring of 2007 (59.4 mm between Feb. 1 and April 1, 2007, as compared to 133.6 mm
between Feb. 1 and April 1, 2006) at our trial site at Kearney Ag Center, there was a very low
incidence of blossom blight. There was less than 1% blight in the untreated controls of three stone
fruit cultivars in one of the plots. In the other two plots in a new orchard with low disease pressure,
no disease was detected. Thus, only limited information could be obtained from these trials in
2007. As in most years, the SBI fungicides performed best against blossom blight (Fig. 1).
Currently, registered fungicides that belong to five different classes, the SBI fungicides Orbit,
Elite, Indar (Enable), and Rally (Laredo), the anilinopyrimidines Vangard and Scala, the
dicarboximide Rovral/Oil, and the carboxamide-strobilurin pre-mixture Pristine are highly
effective treatments for immediate use in managing brown rot blossom blight. Future
registrations include two additional SBI fungicides (difenoconazole - Inspire and metconazole –
Quash or V-10116), as well as new premixtures (pyrimethanil + trifloxystrobin - Distinguish,
and tebuconazole + trifloxystrobin – Adament).

Efficacy of preharvest fungicides for management of fruit decays. The efficacy of selected
preharvest fungicides for control of fruit brown rot decay was evaluated under ambient (3 trials)
and simulated rain (4 trials) conditions. Applications under ambient conditions were done 8+1 or
7+1 days PHI and 16+9 or 14+8 days PHI. Due to a very low natural incidence of decay, fruit
were inoculated with M. fructicola after harvest, and either a spray-inoculation of non-wounded
fruit or a drop-inoculation of wounded fruit was done. Two applications with any of the
fungicides evaluated significantly reduced the incidence of brown rot of harvested peach and
nectarine fruit (Figs. 2-4). Applications within 8 days of harvest were more effective as earlier
applications for some fungicides such as Vangard, Scala, Orbit-Abound, and Distinguish (Figs.
2,3). This confirmed again that the AP fungicides Vangard and Scala are not very stable during
hot temperatures in the summer. With other materials, such as Elite, Orbit, Enable, V-10116
(Quash), and Adament, both timings resulted in excellent decay control. A reduced efficacy on
wound-inoculated fruit as compared to non-wound inoculated fruit was generally observed for
Distinguish, Pristine, and Orbit-Abound (Figs. 2-4). Again, the SBI fungicides, and mixtures of
SBIs with other classes (e.g., Elite + Scala, Adament) were similarly effective using both
inoculation methods, indicating that they are locally systemic and can stop early infections (up to



                                                  22
California Tree Fruit Agreement
2007 Annual Research Report




ca. 18 h after inoculation).

One or two simulated rain applications were done after preharvest treatments with Vangard, Scala,
Elevate Elite, V-10116, Polyoxin D, Adament, or Distinguish and fruit were again either wound- or
non-wound inoculated. These simulated rain treatments generally did not significantly reduce the
efficacy of Elite, V-10116, or Adament (Figs. 5-8). Thus, these fungicides are quite rain-stable and
do not get washed off easily should a rain occur in the summertime. Most effective in both the non-
wound and wound inoculations were the SBIs Elite, V-10116, and Adament and least effective were
Polyoxin-D, Distinguish, and Scala (Figs. 5-8).

In summary, selected fungicides have been consistent in their performance over the years and on
different stone fruit cultivars, and therefore are reliable preharvest treatments for the stone fruit
industry for managing preharvest diseases and reducing postharvest decays. Highly effective
preharvest rotational products for the SBIs are still needed other than the anilinopyrimidines
(e.g., Scala and Vangard) that break down under high temperature and humidity. Pre-mixtures
may partially fill this void, but new classes of fungicides have to be identified.

Evaluation of fungicides for management of peach leaf curl. The incidence of powdery mildew in
our trial was very low and no data could be obtained. - In a trial on Fay Elberta peaches on the
management of peach leaf curl, the efficacy of selected fungicides and mixtures applied during tree
dormancy was compared in one- and two-spray application programs. Due to relatively low
rainfall in the winter of 2007 (164 mm between Dec. 1 2006 and April 30, 2007 vs. 552 mm rain
between Dec. 1, 2005 and April 30, 2006), disease pressure was low. All treatments significantly
reduced the incidence of leaf curl from that of the control to very low levels and there was no
significant difference between treatments and whether one or two applications were done (Fig. 9).

II. Postharvest decay control

Postharvest studies were part of an ongoing effort to develop and register new postharvest
treatments and to integrate the new materials in resistance management strategies that include the
use of proper rates and application methods. The main goals in our 2007 postharvest research were
to evaluate treatments with Mentor, Pristine, and the GRAS materials sodium bicarbonate (SBC)
and potassium sorbate (K-sorbate) for management of brown rot, gray mold, and sour rot.

Because BASF is still tentatively pursuing registration of Pristine for postharvest use on stone fruit,
we continued to evaluate this fungicide using a new postharvest formulation in low-volume spray
and in-line drench applications. Both, the new liquid formulation and the WG formulation, in most
cases significantly reduced the incidence of brown rot, gray mold, and Rhizopus rot (Figs. 10,11).
No phytotoxicity was observed in any of the experiments using rates between 250 and 500 ppm, in
contrast to some trials conducted in previous years when higher rates (1000 ppm) were used. The
performance of Pristine using the suggested rates generally was not equivalent and not as consistent
to that of Scholar. When very mature fruit were used in one of the studies, only Scholar provided
excellent control of brown rot (Fig. 11C). Still, overall Pristine had good efficacy against the three
major decays of stone fruit and because of its broad spectrum, it is only second to Scholar in
efficacy among all postharvest treatments evaluated in recent years.




                                                 23
California Tree Fruit Agreement
2007 Annual Research Report




A range of additional postharvest experiments were conducted on several nectarine and peach
cultivars, as well as on plums. Most of these experiments had several objectives, such as the
evaluation of the efficacy of specific fungicides, fungicide mixtures, GRAS compounds, mixtures
between fungicides and GRAS compounds, and application methods. Because there is some overlap
between experiments and our research objectives, Figs. 12-21 are discussed here together and not
necessarily in numerical order.

Efficacy of new and registered fungicides against sour rot. After low-volume spray treatments of
inoculated Summer Fire nectarines, Mentor at the 4-oz rate was more effective in reducing the
incidence of sour rot than Elite at the 8-oz rate (Fig. 12). This confirms previous studies that Mentor
is among the most effective SBI fungicides to control this decay. Control of sour rot was equivalent
when using Mentor alone or when this fungicide was mixed with Scholar. Thus, no incompatibility
between these two fungicides was observed and possibly, they can be formulated as a pre-mixture
once Mentor receives a full registration. This pre-mixture would have the widest spectrum of
activity (i.e., brown rot, gray mold, Rhizopus rot, sour rot) of any postharvest fungicide ever
registered. When Mentor was mixed with Judge, a decrease in efficacy against sour rot was
observed as compared to using Mentor alone (Fig. 12). A trend for this apparent incompatibility
between the two fungicides was also found in another study with Summer Fire nectarines where the
Mentor-Judge mixture resulted in more decay than when using Mentor alone (Fig. 21A). A Section
18 emergency registration was granted for propiconazole in 2007 and a Section 3 registration is
being pursued through the IR-4 program.

As we established previously, sour rot management has to be done as an integrated approach that
includes proper handling of fruit, sanitation treatments of equipment and fruit, and preharvest
applications with Orbit. All these practices are especially important for those stone fruit cultivars
that are known to be highly susceptible to this decay and when pre-conditioned or tree-ripened fruit
are marketed. In addition, Orbit and Mentor are not effective against other sour rot-like decays that
are also observed every year in some fruit lots. These sour rot-like decays that are caused by other
species of yeast fungi are not controlled by any of the registered fungicides on stone fruit. Sanitation
and proper handling practices are the only methods currently available to reduce these kinds of
decays.

Efficacy of new and registered fungicides against brown rot and gray mold. Because Mentor will
receive a full registration for postharvest use on stone fruit due to its superior efficacy against sour
rot, we evaluated this fungicide’s activity also against other decays of stone fruit. In several studies
on nectarine and peach, Mentor was very effective against brown rot, but efficacy against gray mold
was inconsistent and rate-dependent and efficacy against Rhizopus rot was relatively low as
compared to Scholar (Figs. 15,14,19,20,21). In in-line drench applications to Casselman plums, all
fungicides evaluated (Judge, Penbotec, Mentor, Scholar) were highly effective against brown rot,
but Mentor was the only material that was ineffective against gray mold (Fig. 14). Thus, the
strengths of Mentor are control of sour rot and brown rot and it will need a mixture partner such as
Scholar to cover gray mold and Rhizopus rot as well.

The efficacy of a new formulation of the new carboxamide fungicide DPX LEM17-072 against
brown rot and gray mold was compared using low-volume spray applications in trials on Elegant
Lady and Ryan Sun peaches. When used at a rate of 780 ppm, this fungicide had no effect against



                                                 24
California Tree Fruit Agreement
2007 Annual Research Report




brown rot, whereas the incidence of gray mold was reduced by ca. 50% from the untreated control
in one trial (Fig. 13), but not in another trial (Fig. 21B). Boscalid, another carboxamide fungicide (a
component of Pristine) that was included in one experiment (Fig. 13), also had no effect against
brown rot, and was similarly effective against gray mold as DPX LEM17-072. In contrast, both
Pristine and Scholar were much more effective against both decays than the two carboxamide
fungicides. These results on the use of DPX LEM17 are similar to previous year’s data and indicate
that this compound should not be developed as a postharvest fungicide for stone fruit.

Comparison of postharvest application methods on plum. In this year’s comparative trial, low-
volume spray treatments to plums on a roller bed with Mentor, Pristine, Penbotec, and Scholar
were similarly effective in reducing brown rot and gray mold than in-line drench treatments (Fig.
15). Scholar had consistently the highest efficacy in reducing both decays when compared to
treatments with the other three fungicides. Still, these latter three fungicides also significantly
reduced the incidence of both decays. In previous years’ trials, postharvest in-line drenches were
always found to be superior to low-volume spray applications and thus, more consistently provide
better decay control than spray treatments.

Evaluation of SBC or K-sorbate alone and in mixtures with Mentor. The GRAS materials SBC and
K-sorbate were evaluated to potentially be used for postharvest decay control in organic fruit
production. SBC has been used for many years in citrus postharvest decay control because it has
some activity against sour rot and Penicillium decays of citrus fruit due to raising the pH at the
infection site. In addition, when mixed with Scholar or other postharvest fungicides, a superior
decay control can be obtained in citrus compared to when using the fungicides alone. We conducted
several studies using low-volume spray and in-line drench applications to inoculated fruit of several
stone fruit cultivars. SBC at concentrations between 0.5 and 4% had no effect against sour rot (Figs.
16-19). There was some degree of incompatibility when SBC was mixed with Mentor and
consequently, the efficacy of a Mentor-SBC mixture against sour rot was sometimes reduced than
when Mentor was used alone (Figs. 16-18). No phytotoxicity was observed on fruit after SBC
treatment. These trials indicate that the use of SBC does not have any benefits in the management of
postharvest decays of stone fruit.

Similar trials as for SBC were conducted with K-sorbate using rates of 0.1 and 0.2%. K-sorbate had
no effect against sour rot and brown rot, whereas gray mold was sometimes reduced using the
0.2%-rate (Figs. 20,21). The addition of K-sorbate to Mentor in one experiment significantly
decreased the efficacy of Mentor against sour rot (Fig. 21A). Thus, as with SBC, K-sorbate is
ineffective in the management of postharvest decays of stone fruit

Perspective on postharvest decay control. Currently, fludioxonil (Scholar) and fenhexamid (Judge)
are fully registered for postharvest use on stone fruit in California. Pyrimethanil (Penbotec) is being
registered through the IR-4 program and registration is expected for 2008. A Section 18 emergency
registration was granted for propiconazole (Mentor) in 2007 for management of sour rot and a
Section 3 full registration is being pursued through the IR-4 program. With this spectrum of
fungicides, all major decays of stone fruit can be managed with high efficacy and, if properly
applied, long-distance shipping of high-quality California stone fruit can be done.




                                                 25
         California Tree Fruit Agreement
         2007 Annual Research Report


           Fig. 1. Efficacy of fungicide treatments for management of brown rot blossom blight of
                       nectarine and peach cultivars at the Kearney Agricultural Center
                                             Red Diamond Nectarine                             Elegant Lady Peach                  Ryan Sun Peach
                                       Control                 a                                         a                               a
Single fungicides      Orbit 3.6EC 4 fl oz   b                                         b                                       a
          Elite 45WP 6 oz + Induce 0.06%   b                                           b                                       a
                    V-10116 50WDG 2.5 oz b                                                     ab                                  a
                       Scala 600SC 18 fl oz b                                                           ab                     a
                       Vangard 75WG 5 oz b                                                            ab                       a
                   Polyoxin D 11.3DF 32 oz b                                               b                                   a
Mixtures        Orbit 4 fl oz + Vangard 5 oz b                                                          ab                         a
            Orbit 4 fl oz+ Abound 2F 10 fl oz                 b                            b                                   a
                    Elite 6 oz + Scala 9 fl oz b                                               ab                              a
Pre-mixtures            Adament 50WG 6 oz               b                                      ab                              a
                  Distinguish 480SC 12 fl oz        b                                                          a               a
                      Pristine 38WG 0.92 lb                   b                            b                                   a
                                                0       0.2   0.4   0.6        0.8   1 0        0.2   0.4    0.6   0.8   1 0       0.2   0.4   0.6   0.8   1
                                                                                Incidence of blossom blight (%)
One application of each treatment was made in the field on 3-3-07 to Elegant Lady (40% bloom) and Ryan Sun peach (20% Bloom)
and on 3-5-07 to Red Diamond nectarines (20-30% bloom) using an air-blast sprayer (100 gal/A) . Blossoms were evaluated for
blossom blight on 4-14-07. There were four single-tree replications for each treatment.




                                                                          26
          California Tree Fruit Agreement
          2007 Annual Research Report



  Fig. 2. Efficacy of preharvest fungicide treatments for management of fruit brown rot
               of Red Diamond nectarines at the Kearney Agricultural Center
A. Spray inoculation of non-wounded fruit                                       8+1 day PHI                          16+9 day PHI
                                                   Control                        a                                                            a
        Single                      Vangard 75WG 10 oz            b                                                 bc
        fungicides                   Scala 600SC 18 fl oz         b                                                  b
                      Elite 45WP 8 oz + Induce 0.06% c                                                  f
                                   Orbit 3.6EC 4 fl oz bc                                               ef
                                     Enable 2F 6 fl oz c                                                ef
                              V-10116 50WDG 2.5 oz c                                                    ef
        Mixtures      Orbit 4 fl oz+ Abound 2F 10 fl oz c                                                   def
                            Orbit 4 fl oz + Vangard 5 oz c                                              f
                               Elite 6 oz + Scala 9 fl oz bc                                            f
        Pre-                        Adament 50WG 6 oz bc                                                    bcde
        mixtures
                              Distinguish 480SC 12 fl oz bc                                                  bcd
                                   Pristine 38WG 0.92 lb c                                                  cdef
                                                              0        20        40   60   80   100 0               20     40        60   80   100
B. Drop inoculation of wounded fruit                                            8+1 day PHI                              16+9 day PHI
                                                   Control                           a                                                             a
         Single                     Vangard 75WG 10 oz                 cd                                                            bc
         fungicides                  Scala 600SC 18 fl oz                   b                                                             b
                      Elite 45WP 8 oz + Induce 0.06%              e                                         f
                                        Orbit 3.6EC 4 fl oz        de                                                      de
                                       Enable 2F 6 fl oz e                                              f
                                 V-10116 50WDG 2.5 oz e                                                 f
         Mixtures Orbit 4 fl oz+ Abound 2F 10 fl oz e                                                                           cd
                       Orbit 4 fl oz + Vangard 5 oz e                                                                     de
                            Elite 6 oz + Scala 9 fl oz e                                                        f
         Pre-                   Adament 50WG 6 oz de                                                                 e
         mixtures                                                                                                                                  a
                        Distinguish 480SC 12 fl oz                              b
                                    Pristine 38WG 0.92 lb                   bc                                                                 a
                                                              0        20        40   60   80   100 0               20     40        60   80       100
                                                                                       Incidence of decay (%)
Applications were made in the field on 6-19 and 6-26-07 using an air blast sprayer at 100 gal/A. Fruit were harvested and
stored at 1C for 7 days. Spray-inoculations with M. fructicola (15,000 conidia/ml) were done on non-wounded fruit,
whereas drop-inoculations (30,000 conidia/ml) were done on wounded fruit. Fruit were then incubated at 20C for 7 days.




                                                                  27
        California Tree Fruit Agreement
        2007 Annual Research Report


   Fig. 3. Efficacy of preharvest fungicide treatments for management of fruit brown rot
                 of Elegant Lady peaches at the Kearney Agricultural Center
A. Spray inoculation of non-wounded fruit                                     7+1 day PHI                             14+8 day PHI
                                                     Control                                 a                                                   a
         Single                     Vangard 75WG 10 oz                  bcd                                      cd
         fungicides                  Scala 600SC 18 fl oz               bc                                             bc
                      Elite 45WP 8 oz + Induce 0.06%                    bc                               d
                                          Orbit 3.6EC 4 fl oz d                                              d
                                           Enable 2F 6 fl oz bcd                                                 cd
                                 V-10116 50WDG 2.5 oz d                                                      cd
         Mixtures      Orbit 4 fl oz+ Abound 2F 10 fl oz    bc                                                        bc
                             Orbit 4 fl oz + Vangard 5 oz cd                                                 d
                                Elite 6 oz + Scala 9 fl oz cd                                            d
         Pre-                        Adament 50WG 6 oz bc                                                d
         mixtures
                              Distinguish 480SC 12 fl oz                 b                                              bc
                                    Pristine 38WG 0.92 lb               bcd                                  cd
                                                                0        20    40      60   80   100 0            20        40    60        80       100
B. Drop inoculation of wounded fruit                                          7+1 day PHI                              14+8 day PHI
                                                     Control                                     a                                               a
          Single                    Vangard 75WG 10 oz                       bcd                                      cde         bc
          fungicides                 Scala 600SC 18 fl oz                     bc                                            bcd
                       Elite 45WP 8 oz + Induce 0.06%               f                                        f
                                          Orbit 3.6EC 4 fl oz            cde                                     ef
                                           Enable 2F 6 fl oz        ef                                       ef
                                 V-10116 50WDG 2.5 oz               ef                                       ef
         Mixtures Orbit 4 fl oz+ Abound 2F 10 fl oz                     def                                                 bc
                       Orbit 4 fl oz + Vangard 5 oz                     def                                      ef
                                 Elite 6 oz + Scala 9 fl oz f                                                    ef
          Pre-                       Adament 50WG 6 oz              ef                                            def
          mixtures                                                                 b                                                   ab
                              Distinguish 480SC 12 fl oz
                                    Pristine 38WG 0.92 lb                                   a                                                a
                                                                0        20    40      60   80       100 0        20        40    60        80       100
                                                                                        Incidence of decay (%)
Applications were made in the field on 7-3 and 7-9-07 using an air blast sprayer at 100 gal/A. Fruit were harvested and
stored at 1C for 7 days. Spray-inoculations with M. fructicola (15,000 conidia/ml) were done on non-wounded fruit,
whereas drop-inoculations (30,000 conidia/ml) were done on wounded fruit. Fruit were then incubated at 20C for 7 days.




                                                                28
        California Tree Fruit Agreement
        2007 Annual Research Report


   Fig. 4. Efficacy of preharvest fungicide treatments for management of fruit brown rot
                  of Ryan Sun peaches at the Kearney Agricultural Center
     A. Spray inoculation of non-wounded fruit                                                7+1 day PHI
                                                       Control                                                         a
              Single                        Vangard 75WG 10 oz                                    bcd
              fungicides                     Scala 600SC 18 fl oz                                       bc
                           Elite 45WP 8 oz + Induce 0.06%                            de
                                        Orbit 3.6EC 4 fl oz                          de
                                        Enable 2F 6 fl oz                                               b
                                 V-10116 50WDG 2.5 oz                           e
              Mixtures Orbit 4 fl oz+ Abound 2F 10 fl oz                                 bcde
                            Orbit 4 fl oz + Vangard 5 oz                                 cde
                                          Elite 6 oz + Scala 9 fl oz                     de
              Pre-                       Adament 50WG 6 oz                          de
              mixtures             Distinguish 480SC 12 fl oz                                          bc
                                            Pristine 38WG 0.92 lb                             bcd
                                                                       0            20            40         60   80       100
     B. Drop inoculation of wounded fruit                                                      7+1 day PHI
                                                            Control                                                    a
              Single                        Vangard 75WG 10 oz                  d
              fungicides                     Scala 600SC 18 fl oz               d
                           Elite 45WP 8 oz + Induce 0.06%                  ef
                                                Orbit 3.6EC 4 fl oz f
                                                 Enable 2F 6 fl oz              d
                                 V-10116 50WDG 2.5 oz                       de
              Mixtures Orbit 4 fl oz+ Abound 2F 10 fl oz                    de
                            Orbit 4 fl oz + Vangard 5 oz                   ef
                                      Elite 6 oz + Scala 9 fl oz                d
              Pre-                           Adament 50WG 6 oz              d
              mixtures             Distinguish 480SC 12 fl oz                                           b
                                            Pristine 38WG 0.92 lb                             c
                                                                       0            20            40         60   80   100
                                                                                     Incidence of decay (%)
Applications were made in the field on 8-8 and 8-13-07 using an air blast sprayer at 100 gal/A. Fruit were harvested and
stored at 1C for 7 days. Spray-inoculations with M. fructicola (15,000 conidia/ml) were done on non-wounded fruit,
whereas drop-inoculations (30,000 conidia/ml) were done on wounded fruit. Fruit were then incubated at 20C for 7 days.




                                                               29
 California Tree Fruit Agreement
 2007 Annual Research Report

       Fig. 5. Efficacy of selected 6+1 day preharvest fungicide applications under ambient
         conditions or with simulated rain for management of brown rot of Summer Flare
                            nectarines at the Kearney Agricultural Center
 A. Spray inoculation                                                 Ambient conditions                               Simuated rain
 of non-wounded                               Control                  a                                              a
 fruit                           Vangard 75WG 10 oz              b                                                  ab
                                  Scala 600SC 18 fl oz            b                                                  a
                     Elite 45WP 6 oz + Induce 0.06%             b                                           b
                              V-10116 50WDG 2.5 oz              b                                           b
                           Polyoxin D 11.2WDG 32 oz             b                                             ab
                                  Adament 50WG 6 oz             b                                           b
                            Distinguish 480SC 18 fl oz          b                                               ab
                                                            0         20    40          60    80    100 0            20       40    60       80    100
  B. Drop inoculation                         Control                           a                                                        a
  of wounded fruit               Vangard 75WG 10 oz                    b                                                       b
                                  Scala 600SC 18 fl oz                           a                                             b
                     Elite 45WP 6 oz + Induce 0.06% c                                                       c
                              V-10116 50WDG 2.5 oz c                                                         c
                           Polyoxin D 11.2WDG 32 oz                             a                                                  ab
                                  Adament 50WG 6 oz c                                                           c
                            Distinguish 480SC 18 fl oz                           a                                                       a
                                                            0         20    40          60    80    100 0            20       40    60       80    100
                                                                                     Incidence of decay (%)
  Applications were made in the field on 6-20 and 6-26-07 using an air blast sprayer at 100 gal/A. Simulated rain was
  applied by overhead microsprinkler irrigation for 6-7 h on 6-25-07. Fruit were harvested and stored at 1C for 7 days.
  Spray-inoculations with M. fructicola (15,000 conidia/ml) were done on non-wounded fruit, whereas drop-in oculations
  (30,000 conidia/ml) were done on wounded fruit. Fruit were then incubated at 20C for 7 days.


     Fig. 6. Efficacy of selected 7+2 day preharvest fungicide applications under ambient
   conditions or with simulated rain for management of brown rot of July Flame peaches at
                                 the Kearney Agricultural Center
A. Spray inoculation                                 Ambient conditions                                              Simuated rain
                                            Control       a                                                           a
of non-wounded
                               Vangard 75WG 10 oz cd                                                            b
fruit
                                Scala 600SC 18 fl oz   b                                                    c
                   Elite 45WP 6 oz + Induce 0.06% d                                                        c
                            V-10116 50WDG 2.5 oz d                                                         c
                         Polyoxin D 11.2WDG 32 oz    bc                                                      bc
                                Adament 50WG 6 oz d                                                        c
                          Distinguish 480SC 18 fl oz bc                                                     c
                                                        0        20        40       60       80    100 0        20        40       60    80       100
B. Drop inoculation                         Control                                 a                                              a
of wounded fruit               Vangard 75WG 10 oz           c                                                       bc
                                Scala 600SC 18 fl oz                   b                                                  b
                   Elite 45WP 6 oz + Induce 0.06%           c                                              c
                            V-10116 50WDG 2.5 oz             c                                             c
                         Polyoxin D 11.2WDG 32 oz                      b                                                  b
                                Adament 50WG 6 oz           c                                               c
                          Distinguish 480SC 18 fl oz                   b                                                  b
                                                        0         20       40       60       80    100 0            20    40       60    80       100
                                                                                 Incidence of decay (%)
Applications were made in the field on 6-20 and 6-25-07 using an air blast sprayer at 100 gal/A. Simulated rain was
applied by overhead microsprinkler irrigation for 6-7 h on 6-25-07. Fruit were harvested and stored at 1C for 7 days.
Spray-inoculations with M. fructicola (15,000 conidia/ml) were done on non-wounded fruit, whereas drop-in oculations
(30,000 conidia/ml) were done on wounded fruit. Fruit were then incubated at 20C for 7 days.

                                                                 30
    California Tree Fruit Agreement
    2007 Annual Research Report
       Fig. 7. Efficacy of selected 7+1 day preharvest fungicide applications under ambient
          conditions or with simulated rain for management of brown rot of Summer Fire
                             nectarines at the Kearney Agricultural Center
 A. Spray inoculation                                                   Ambient conditions                                     Simuated rain
 of non-wounded                                 Control                                                      a                                         a
                                  Vangard 75WG 10 oz                      cd                                                  cd
 fruit
                                   Scala 600SC 18 fl oz                                        b                                        bc
                      Elite 45WP 6 oz + Induce 0.06%               e                                                     cd
                               V-10116 50WDG 2.5 oz                 de                                               d
                                   Elevate 50WG 1.5 lb                        c                                                         b
                            Polyoxin D 11.2WDG 32 oz                                  bc                                                          ab
                             Distinguish 480SC 18 fl oz                      c                                                cd
                                                               0     20          40       60        80       100 0        20            40    60       80        100
  B. Drop inoculation                           Control                                                      a                                               ab
  of wounded fruit                Vangard 75WG 10 oz                                                cd                                             d
                                   Scala 600SC 18 fl oz                                               bcd                                               cd
                      Elite 45WP 6 oz + Induce 0.06%                e                                                    e
                               V-10116 50WDG 2.5 oz                  e                                                   e
                                   Elevate 50WG 1.5 lb                                                       bc                                              ab
                            Polyoxin D 11.2WDG 32 oz                                       d                                                                  a
                             Distinguish 480SC 18 fl oz                                                  ab                                                  bc
                                                               0     20          40       60        80       100 0        20            40    60        80       100
                                                                                          Incidence of decay (%)
  Applications were made in the field on 7-18 and 7-24-07 using an air blast sprayer at 100 gal/A. Simulated rain was
  applied by overhead microsprinkler irrigation for 6-7 h on 7-18 and 7-24-07. Fruit were harvested and stored at 1C for 7
  days. Spray-inoculations with M. fructicola (15,000 conidia/ml) were done on non-wounded fruit, whereas drop-in
  oculations (30,000 conidia/ml) were done on wounded fruit. Fruit were then incubated at 20C for 7 days.


     Fig. 8. Efficacy of selected 7+2 day preharvest fungicide applications under ambient
     conditions or with simulated rain for management of brown rot of Ryan Sun peaches
                                 at the Kearney Agricultural Center
A. Spray inoculation                                                Ambient conditions                                    Simuated rain
                                              Control                                                    a                                                  a
of non-wounded
                                Vangard 75WG 10 oz                                              bcd                                                     abc
fruit
                                 Scala 600SC 18 fl oz                                            bc                                                     abc
                    Elite 45WP 6 oz + Induce 0.06%                               e                                                      d
                             V-10116 50WDG 2.5 oz                                         de                                                  cd
                                 Elevate 50WG 1.5 lb                                            bcd                                                     ab
                          Polyoxin D 11.2WDG 32 oz                                                  ab                                                   ab
                           Distinguish 480SC 18 fl oz                                      cde                                                    bcd
                                                           0       20        40       60       80        100 0           20        40        60    80        100
B. Drop inoculation                            Control                                                   a                                                   a
of wounded fruit                 Vangard 75WG 10 oz                                       bc                                                      de
                                  Scala 600SC 18 fl oz                                c                                                      e
                     Elite 45WP 6 oz + Induce 0.06%                     d                                                     f
                              V-10116 50WDG 2.5 oz                       d                                                     f
                                  Elevate 50WG 1.5 lb                                          b                                   b                         b
                           Polyoxin D 11.2WDG 32 oz                                            b                     c                                  c
                            Distinguish 480SC 18 fl oz                                          b                                                  cd
                                                           0       20        40       60       80        100 0           20            40    60    80        100
                                                                                      Incidence of decay (%)
Applications were made in the field on 8-10 and 8-17-07 using an air blast sprayer at 100 gal/A. Simulated rain was
applied by overhead microsprinkler irrigation for 6-7 h on 8-10 and 8-17-07. Fruit were harvested and stored at 1C for 7
days. Spray-inoculations with M. fructicola (15,000 conidia/ml) were done on non-wounded fruit, whereas drop-in
oculations (30,000 conidia/ml) were done on wounded fruit. Fruit were then incubated at 20C for 7 days.


                                                                   31
      California Tree Fruit Agreement
      2007 Annual Research Report
            Fig. 9. Efficacy of fungicide treatments applied during dormancy against
                peach leaf curl of Fay Elberta peaches in a field trial at UC Davis
                                   Treatment                             7-Dec     18-Jan              Incidence (%)*
                                        Control                              ---     ---                                    a
                              Ziram 76 DF - 8 lbs                            @       @           b
                              Ziram 76 DF - 8 lbs                            @       ---         b
                              Ziram 76 DF - 8 lbs                            ---     @           b
                              Ziram 76 DF - 6 lbs                            @       @           b
                                Bravo 720 4 pts                              @       @             b
                             Bravo 720 4 pts                                 @       ---           b
                         Kocide 2000 54DF 8 lb                               @       @           b
                        Kocide 2000 54DF 8 lb                                @       ---         b
                Ziram 76DF 6 lb+ Kocide 2000 54DF 4 lb                       ---     @           b
                Ziram 76DF 6 lb+ Kocide 2000 54DF 4 lb                       @       @           b
                                                                                      0       5     10     15    20          25
           * - Incidence is the average percentage of 100 leaves (4 reps per treatment) with leaf curl when evaluated
                in April 2007. No oil was included in the applications.


     Fig. 10. Efficacy of postharvest low-volume spray treatments with two formulations of
        Pristine for management of postharvest decays of selected stone fruit cultivars
                             - Fruit inoculated, treated, and incubated -
A. Elegant Lady                                                          R. stolonifer
                                     M. fructicola
peaches                                                                                                Fruit were wound-inoculated with M.
                Control                      a                                 a                       fructicola or R. stolonifer (30,000
  BAS516 09F 250 ppm                         ab                 Not done                               spores/ml), washed with 100 ppm
  BAS516 09F 375 ppm                    bcd                     Not done                               chlorine in the wash section of the
  BAS516 09F 500 ppm                  cd                             c                                 experimental packingline, and treated
                                                                                                       after 13-15 h with a new liquid
  BAS516 04F 250 ppm                       ab                   Not done                               formulation (BAS516 09F) or a WG
  BAS516 04F 375 ppm                     abc                    Not done                               formulation (BAS516 04F) of Pristine by
  BAS516 04F 500 ppm                d                                        b                         low-volume spray applications (CDA 25
                                                                                                       gal/200,000 lb) on a brush bed.
 Scholar 50WP 300 ppm               d                                        bc                        Applications were done in 25% D251.
                           0       20      40     60 80 100 0 20 40                60      80 100      Fruit were then incubated for 6 days at
B. Elegant Lady                                     Incidence of decay (%)                             20C.
peaches                                 B. cinerea                        R. stolonifer                Fruit were wound-inoculated with B.
                Control                       a                          a                             cinerea or R. stolonifer (30,000
  BAS516 09F 250 ppm      b                                     Not done                               spores/ml), washed with 100 ppm
                                                                Not done                               chlorine in the wash section of the
  BAS516 09F 375 ppm b                                                                                 experimental packingline, and treated
  BAS516 09F 500 ppm b                                           b                                     after 13-15 h with a new liquid
  BAS516 04F 250 ppm bc                                         Not done                               formulation (BAS516 09F) or a WG
                                                                Not done                               formulation (BAS516 04F) of Pristine by
  BAS516 04F 375 ppm     bc                                                                            low-volume spray applications (CDA 25
  BAS516 04F 500 ppm c                                          c                                      gal/200,000 lb) on a brush bed.
 Scholar 50WP 300 ppm    bc                                     c                                      Applications were done in 25% D251.
                                                                                                       Fruit were then incubated for 6 days at
                        0 20               40     60 80 100 0 20 40                60      80 100
                                                                                                       20C.
C. Summer Fire                                     Incidence of decay (%)
nectarines                         M. fructicola                          R. stolonifer
               Control                   a                                                   a          Fruit were wound-inoculated with M.
 BAS516 09F 250 ppm                c                             Not done                               fructicola or R. stolonifer (30,000
                                                                                                        spores/ml) and treated after 18 h with a
 BAS516 09F 375 ppm                 bc                                                                  new liquid formulation (BAS516 09F) or
 BAS516 09F 500 ppm                c                                    bc                              a WG formulation (BAS516 04F) of
 BAS516 04F 250 ppm                    ab                        Not done                               Pristine by low-volume spray
                                                                                                        applications (CDA 25 gal/200,000 lb) on
 BAS516 04F 375 ppm                 bc                                                                  a roller bed. Applications were done in
 BAS516 04F 500 ppm                 bc                                    b                             25% D251. Fruit were then incubated for
Scholar 50WP 300 ppm           d                                    c                                   6 days at 20C.
                          0        20     40      60 80 100 0 20 40                 60      80 100
                                                   Incidence of decay (%)



                                                                        32
  California Tree Fruit Agreement
  2007 Annual Research Report


     Fig. 11. Efficacy of postharvest in-line drench treatments with two formulations of
      Pristine for management of postharvest decays of selected stone fruit cultivars
                           - Fruit inoculated, treated, and incubated -
A. Summer Flare nectarines
                                        M. fructicola                                R. stolonifer
                                                                                                                Fruit were wound-inoculated with
                  Control                   a                                               a                   M. fructicola or R. stolonifer
                                                                                                                (30,000 spores/ml) and treated
 BAS516 09F 250 ppm                 b                                    Not done                               after 13-15 h with a new liquid
                                                                                                                formulation (BAS516 09F) or a
 BAS516 09F 500 ppm              b                                           b                                  WG formulation (BAS516 04F) of
 BAS516 04F 250 ppm                                                      Not done                               Pristine by in-line drench
                                 b
                                                                                                                applications. Drenches over a
 BAS516 04F 500 ppm             b                                            b                                  roller bed were followed by a CDA
                                                                                                                application with 25% D251. Fruit
                            0     20      40    60     80 100 0 20 40                           60   80 100     were then incubated for 6 days at
                                                     Incidence of decay (%)                                     20C.

B. Red Diamond nectarines
                                     B. cinerea                              R. stolonifer                      Fruit were wound-inoculated with B.
                  Control                               a                        a                              cinerea or R. stolonifer (30,000
                                                                                                                spores/ml) and treated after 13-15 h
 BAS516 09F 250 ppm  b                                                   b                                      with a new liquid formulation
 BAS516 09F 500 ppm  b                                                   b                                      (BAS516 09F) or a WG formulation
                                                                                                                (BAS516 04F) of Pristine or with
 BAS516 04F 250 ppm b                                                    b                                      Scholar by in-line drench
 BAS516 04F 500 ppm b                                                    b                                      applications. Drenches over a roller
                                                                                                                bed were followed by a CDA
Scholar 50WP 300 ppm b                                                   b                                      application with 25% D251. Fruit
                            0    20      40     60 80 100 0 20 40                               60   80 100     were then incubated for 6 days at
                                                 Incidence of decay (%)                                         20C.


 C. Elegant Lady peaches
                                     M. fructicola                                   B. cinerea
                                                                                                                Fruit were wound-inoculated with
               Control                                      ab                                         a        M. fructicola or B. cinerea (30,000
 BAS516 09F 250 ppm                                  bc                  Not done                               spores/ml) and treated after 18 h
 BAS516 09F 375 ppm                                 bc                               bc                         with a new liquid formulation
                                                                                                                (BAS516 09F) or a WG formulation
 BAS516 09F 500 ppm                             c                                c                              (BAS516 04F) of Pristine or with
 BAS516 04F 250 ppm                                         ab           Not done                               Scholar by in-line drench
 BAS516 04F 375 ppm                                          a                        bc                        applications. Drenches over a roller
                                                                                                                bed were followed by a CDA
 BAS516 04F 500 ppm                                          a                          b                       application with 25% D251. Fruit
Scholar 50WP 300 ppm             d                                                   bc                         were then incubated for 6 days at
                            0    20      40     60 80 100 0 20 40                               60   80 100     20C.
                                                 Incidence of decay (%)

   Fig. 12. Efficacy of postharvest low-volume spray treatments for management of sour
                                   rot of Summer Fire nectarines
                           - Fruit inoculated, treated, and incubated -

                                              Control                                            a         Fruit were wound-inoculated
                         Mentor 45WP 1 oz                                    b                             with G. candidum (10 6
                                                                                                           spores/ml) and treated by
                         Mentor 45WP 4 oz                       d                                          low-volume spray (CDA at
                                                                                                           25 gal/200,000 lb)
 Mentor 45WP 4 oz + Scholar 50WP 8 oz                       e                                              applications over a roller bed
                                                                                                           after 13-15 h. All fungicides
 Mentor 45WP 4 oz + Judge 50WG 1.5 lb                               c                                      were applied in 25% D251.
                                Elite 45WP 8 oz                                  b                         Fruit were then incubated for
                                                                                                           6 days at 20C.
                                                        0     20 40 60 80 100
                                                            Incidence of decay (%)




                                                                        33
       California Tree Fruit Agreement
       2007 Annual Research Report


       Fig. 13. Efficacy of postharvest low-volume spray treatments with registered and new
         fungicides for management of brown rot and gray mold of Elegant Lady peaches
                              - Fruit inoculated, treated, and incubated -
                                                  M. fructicola                    B.cinerea
                                                                                                         Fruit were wound-inoculated with
                             Control                  b                                  a               M. fructicola or B. cinerea (3x103
                                                                                                         conidia/ml) and treated by
       DPX LEM17-072 390 ppm                          b                                     ab           low-volume spray (CDA at 25
                                                      b                                                  gal/200,000 lb) applications after
       DPX LEM17-072 780 ppm                                                        bc                   13 h. CDA fungicide applications
                                                                                                         were done on a roller bed with
                 Boscalid 390 ppm                             a                         b                fungicides prepared in 25% D251.
         Pristine 38WG 500 ppm                c                                d                         Fruit were then incubated for 6
                                                                                                         days at 20C. Phytotoxicity was
                  Scholar 300 ppm             c                                    cd                    observed on fruit after treatment
                                                                                                         with the higher rate of DPX
                                         0        20 40 60 80 100 0 20 40 60 80 100                      LEM17-072
                                                        Incidence of decay (%)


Fig. 14. Efficacy of postharvest in-line drench treatments with registered and new fungicides for
                  management of brown rot and gray mold of Casselman plums
                            - Fruit inoculated, treated, and incubated -
                                              M. fructicola                    B.cinerea
                         Control                                  a                                  a    Fruit were wound-inoculated with
                                                                                                          M. fructicola or B. cinerea (3x103
           Judge 50WG 900 ppm              b                                b                             conidia/ml) and treated by in-line
        Penbotec 600SC 500 ppm            b                                b                              drench applications after 13 h.
          Mentor 45WP 128 ppm             b                                                          a    Drenches were followed by a
                                                                                                          CDA application with Primafresh
                Scholar 300 ppm           b                                b                              45. Fruit were then incubated for
Scholar 150 ppm + Mentor 64 ppm           b                                    b                          6 days at 20C.
                                         0 20 40 60 80 100 0              20 40 60 80 100
                                                          Incidence of decay (%)


Fig. 15. Efficacy of postharvest low-volume spray and in-line drench treatments with registered
     and new fungicides for management of brown rot and gray mold of Casselman plums
                            - Fruit inoculated, treated, and incubated -
A. Low-volume sprays                          M. fructicola                    B.cinerea
                            Control                    a                                         a
        Mentor 45WP 128 ppm d                                                      b                     Fruit were wound-inoculated with
        Pristine 38WG 300 ppm                 bc                           c                             M. fructicola or B. cinerea (3x103
                                                                                                         conidia/ml) and treated by
                Scholar 300 ppm           c                            c                                 low-volume spray (CDA at 25
                                                                                                         gal/200,000 lb) or by in-line
      Penbotec 600SC 500 ppm                      b                     c                                drench applications after 13 h.
                                    0        20 40 60 80 100 0 20 40 60 80 100                           CDA fungicide applications were
B. In-line drenches                                                                                      done on a roller bed with
                            Control                               a                          a           fungicides prepared in Primafresh
                                                                                                         45. Drenches over a roller bed
         Mentor 45WP 128 ppm c                                                      b                    were followed by a CDA
        Pristine 38WG 300 ppm                     b                                                      application with fruit coating. Fruit
                                                                           c
                                                                                                         were then incubated for 6 days at
                 Scholar 300 ppm c                                         c                             20C.
      Penbotec 600SC 500 ppm                      b                    d
                                      0       20 40 60 80 100 0 20 40 60 80 100
                                                    Incidence of decay (%)

                                                                      34
    California Tree Fruit Agreement
    2007 Annual Research Report


         Fig. 16. Efficacy of postharvest in-line drench and low-volume spray treatments with Mentor and
                                  sodium bicarbonate for management of sour rot
                                     - Fruit inoculated, treated, and incubated -
                                       July Flame peach                 Red Diamond nectarine
                               Control               ab                                   a       Fruit were wound-inoculated
                      SBC 0.5% drench                  a                                  a       with G. candidum (106
                                                                                                  spores/ml) and treated by
                       SBC 1% drench                   a                                  b       in-line drenching or
                       SBC 2% drench                   a                                  b       low-volume spray (CDA at 25
                                        c                                 d                       gal/200,000 lb) applications
              Mentor 45WP 2 oz drench
                                                                                                  after 18 h. Drenches on a
   Mentor 45WP 2 oz + SBC 0.5% drench d                                   d                       roller bed were followed by a
    Mentor 45WP 2 oz + SBC 1% drench d                                    d                       CDA application with 25%
                                                                                                  D251. CDA fungicide
    Mentor 45WP 2 oz + SBC 2% drench d                                     d                      applications were done over a
                         SBC 1% CDA                  b                                b           brush bed with fungicides in
                                                                                 c                50% D251. Fruit were then
      Mentor 45WP 2 oz + SBC 1% CDA      c
                                                                                                  incubated for 6 days at 20C.
                                               0 20 40 60 80 100 0 20 40 60 80 100
                                                       Incidence of decay (%)
        Fig. 17. Efficacy of postharvest in-line drench treatments with Mentor and sodium bicarbonate for
                                               management of sour rot
                                     - Fruit inoculated, treated, and incubated -
                                      Elegant Lady peach            Summer Flare nectarine
                       Control                                                           b         Fruit were
                                                    c                                              wound-inoculated with
                      SBC 1%                               a                          ab           spores of G. candidum (106
                     SBC 2%                              b                             ab          spores/ml) and treated by
                     SBC 4%                               ab                             a         in-line drench applications
  Mentor 45WP 2 oz + SBC 4%                                                         c              after 18 h. Drenches were
                                     d                                                             followed by a CDA
  Mentor 45WP 4 oz + SBC 4%     e                                                 c                application with 25% D251.
           Mentor 45WP 4 oz f                                        d                             Fruit were then incubated
                              0   20 40            60    80 100 0     20 40 60            80   100 for 6 days at 20C.
                                                        Incidence of decay (%)
        Fig. 18. Efficacy of postharvest in-line drench and low-volume spray treatments with Mentor and
                                 sodium bicarbonate for management of sour rot
                                    - Fruit inoculated, treated, and incubated -
                                  July Flame peach       Summer Flare nectarine                 Fruit were wound-inoculated with
                          Control                  a                        a                   G. candidum (106 spores/ml) and
         Mentor 45WP 2 oz drench c                         d                                    treated by in-line drench or
                   SBC 1% drench                    a                      a                    low-volume spray (CDA at 25
                                                                                                gal/200,000 lb) applications after
Mentor 45WP 2 oz + SBC 1% drench       b                     c
                                                                                                13-15 h. Drenches on a roller bed
           Mentor 45WP 2 oz CDA      b                            b                             were followed by a CDA
                     SBC 1% CDA                     a                       a                   application with 25% D251. CDA
 Mentor 45WP 2 oz + SBC 1% CDA       b                          b                               fungicide applications were done
                                                                                                over a brush bed with fungicides
                                 0 20 40 60 80 100 0 20 40 60 80 100                            in 50% D251. Fruit were then
                                             Incidence of decay (%)                             incubated for 6 days at 20C.

        Fig. 19. Efficacy of postharvest in-line drench treatments with Mentor and sodium bicarbonate for
                         management of postharvest decays of Summer Flare nectarines
                                     - Fruit inoculated, treated, and incubated -
                                  B. cinerea            R. stolonifer          G. candidum
                                                                                     Fruit were wound-inoculated
                    Control               a                          a                     a
                                                                                     with spores of B. cinerea, R.
        Mentor 45WP 2 oz                                 c          c                stolonifer (3x104 spores/ml),
                                b
                                                                                     or G. candidum (106
        Mentor 45WP 4 oz        b                        c           c               spores/ml) and treated by
                                                                                     in-line drenching after 13-15
                   SBC 1%              a                      b              b       h. Drenches were followed by
   Mentor 2 oz + SBC 0.5%       b                        c           c               a CDA application with D251.
                                                                                     Fruit were then incubated for
                            0    20 40 60 80 100 0 20 40 60 80 100 0 20 40 60 80 100 5 days at 20C.
                                                  Incidence of decay (%)


                                                               35
       California Tree Fruit Agreement
       2007 Annual Research Report




      Fig. 20. Efficacy of postharvest low-volume spray treatments with Mentor and potassium
            sorbate for management of gray mold and sour rot of Summer Fire nectarines
                               - Fruit inoculated, treated, and incubated -
                                                        B.cinerea                   G. candidum
                                                                                                                        Fruit were wound-inoculated
                                     Control              a                                 a                           with B. cinerea (3x103
                                                                                                                        conidia/ml) or G. candidum
                           K-sorbate 0.1%              ab                                            a
                                                                                                                        (106 spores/ml) and treated
                           K-sorbate 0.2%          b                                                     a              by low-volume spray (CDA at
                                                                                                                        25 gal/200,000 lb)
                       Mentor 45WP 2 oz                        a                    bc                                  applications after 13 h. CDA
                       Mentor 45WP 4 oz            b                               c                                    fungicide applications were
                                                                                                                        done on a roller bed with
    Mentor 45WP 2 oz + K-sorbate 0.1%               b                              c                                    fungicides prepared in 25%
                                                                                                                        D251. Fruit were then
    Mentor 45WP 2 oz + K-sorbate 0.2%              b                                   b
                                                                                                                        incubated for 6 days at 20C.
                                               0       20 40 60 80 100 0 20 40 60 80 100
                                                              Incidence of decay (%)

    Fig. 21. Efficacy of postharvest low-volume spray treatments with selected fungicides and
                     potassium sorbate for management of postharvest decays
                             - Fruit inoculated, treated, and incubated -
 A. Summer Fire nectarines                                         B.cinerea               G. candidum
                                  Control                                ab                                         a    Fruit were wound-inoculated
                         K-sorbate 0.1%                                        a                                   a     with B. cinerea (3x103
                         K-sorbate 0.2%                              b                                             a     conidia/ml) or G. candidum
                                                                                                                         (106 spores/ml) and treated
                      Mentor 45WP 2 oz                 Not done                                 d
                                                                                                                         by low-volume spray (CDA at
                      Mentor 45WP 4 oz                              b                          d                         25 gal/200,000 lb)
      Mentor 45WP 2 oz + K-sorbate 0.1%                              b                                  bc               applications after 13 h. CDA
      Mentor 45WP 2 oz + K-sorbate 0.2%                                  ab                            cd                fungicide applications were
                                                                                                                         done on a roller bed with
   Mentor 45WP 4 oz + Scholar 50WP 8 oz                    c                                         cd                  fungicides prepared in 25%
   Mentor 45WP 4 oz + Judge 50WG 1.5 lb                Not done                                     cd                   D251. Fruit were then
                         Elite 45WP 8 oz               Not done                                                   b      incubated for 6 days at 20C.
                                                       0       20 40 60 80 100 0 20 40 60 80 100
                                                                     Incidence of decay (%)

   B. Ryan Sun peaches                                     M. fructicola               B.cinerea                            G. candidum
                                     Control                           ab                                     b                   a
                            K-sorbate 0.1%                                ab                             ab             Not done
                            K-sorbate 0.2%                                 a                               a                       a
                DPX LEM17-072 390 ppm                                        a                                b         Not done

                DPX LEM17-072 780 ppm                                         a                          bc             Not done
Mentor 45WP 4 oz + Judge 50WG 1.5 lb Not done                                      Not done                             c
                        Mentor 45WP 4 oz           b                                                          ab        c
                       Scholar 50WP 8 oz           b                                       d                                  b
                                               0       20 40 60 80 100 0 20 40 60 80 100 0                                  20 40 60 80 100
                                                                      Incidence of decay (%)
Fruit were wound-inoculated with M. fructicola, B. cinerea (3x103 conidia/ml) or G. candidum (106 spores/ml) and treated by
low-volume spray (CDA at 50 gal/200,000 lb) applications after 16-18 h. CDA fungicide applications were done on a roller bed
with fungicides prepared in 20% Primafresh 200. Fruit were then incubated for 6 days at 20C.




                                                                          36
California Tree Fruit Agreement
2007 Annual Research Report




BIOLOGICAL CONTROL OF
ORIENTAL FRUIT MOTH
PROJECT LEADER:                   Walt Bentley

COOPERATORS:                      Dr. Marshall Johnson and Dr. James Hagler

OBJECTIVES

     1. Develop a small scale-rearing program for Macrocentrus ancylivorus, the parasite of
        Oriental fruit moth
     2. Determine movement distance of parasite from release site into peach orchard

RESULTS

Having been established on sunflower moth since 2003, Macrocentrus ancylivorus has
maintained a presence at Kearney Agricultural Center in an orchard of Crimson Lady peaches.
This orchard is adjacent to a field of sunflowers, planted annually to provide an alternate
overwintering host for Macrocentrus ancylivorus. The parasitoid was established in 2003 and
2004 using augmentative releases but is now parasitizing both Oriental fruit moth (OFM) and the
sunflower moth in the absence of controlled releases. In 2006 preliminary work was done on
selection of a reliable marking technique for Macrocentrus ancylivorus, enabling us to proceed
in 2007 with distance movement studies. It was established that Macrocentrus ancylivorus
sprayed with whole milk and soy milk successfully picked up the milk protein marker.
Dr. James Hagler of the Arizona Cotton Lab (USDA) performed the analysis (ELISA), with
excellent results showing the protein detected on all treated Macrocentrus ancylivorus. The
Colorado State Department of Agriculture generously provided us with additional Macrocentrus
ancylivorus pupae, allowing us to maintain and augment our own production.

Macrocentrus ancylivorus are reared at KAC using a procedure adapted from that perfected by
Glenn L. Finney et al. (Hilgardia, 1947). It requires just over one month per generation of
Macrocentrus ancylivorus, using the potato tuber moth (Gnorimoschema operculella) as a host.
The ideal temperature appears to be 78-80° F with a humidity of 60% though we have found the
humidity difficult to maintain. The entire process is entirely dependent on synchronization of the
two insect life cycles and requires a great deal of attention. Tuber moth pupae are placed in a
shallow box modified with a window screen mesh over the top. Following emergence of the
majority of the moths a damp cloth is placed over the mesh screen to collect eggs. This remains
in place for approximately three days while eggs are being laid. The cloth is then removed and
placed over 20-25 Russet potatoes in an insect cage or Bugdorm (BioQuip, Inc.), Inc uniformly
punctured with holes 3 mm. deep and 1 cm. apart in an enclosed space. As larvae emerge they




                                                37
California Tree Fruit Agreement
2007 Annual Research Report




migrate to the holes in the potatoes. This process requires approximately five days at which time
the cloth can be removed. Adult Macrocentrus ancylivorus are then introduced into the cage.

While the above tuber moth activity is occurring Macrocentrus ancylivorus pupae are allowed to
emerge in a separate cage. A wicked vial containing a honey and water dilution is provided as a
food source. Following emergence and allowing for mating to occur, approximately 75 adult
female Macrocentrus ancylivorus are introduced into the potato cage and left for 10 days.
Potatoes are then removed from the cage and placed in an egg carton suspended above a shallow
tray lined with waxed paper and filled with sand to allow the larvae to migrate from the potato
and pupate in the sand. It may take about 5 days to allow pupation to take place in 75% of the
population.

Pupae are then removed from the sand (a strainer may be used to sift as much sand as possible
from the pupae) and placed in a 50/50 bleach and water solution for a few minutes only. Stirring
gently will remove most of the remaining sand and the pupae of the Macrocentrus ancylivorus
and the tuber moth can be clearly differentiated. After removing the pupae from the bleach
solution they are placed in a solution of 3 parts alcohol/2 parts water. The Macrocentrus
ancylivoruss will float and can be gently skimmed off the top.

Macrocentrus ancylivorus pupae are then placed in an insect cage to await emergence. Tuber
moth pupae are once again placed in the shallow box and the process is repeated. This process is
capable of producing approximately 500-600 Macrocentrus ancylivorus per 10 lbs. of potatoes.

Russet potatoes are used as a food source and ovipositing site in our Macrocentrus ancylivorus
rearing. They are infested with potato tuber moth using an established protocol (see Rearing
above). Using infested and non-infested potatoes a greenhouse trial was set up to determine
whether infested potatoes attracted more Macrocentrus ancylivorus than non-infested. Three
russet potatoes were exposed to potato tuber moths for egg-laying. All potatoes were punctured
with approximately the same number of holes. In a greenhouse corridor 144 ft. long, three
potatoes infested with tuber moth larvae were placed at one end and three non-infested potatoes
at the opposite end. Potatoes were placed approximately 10 ft. high on a ledge. A slit was made
in each potato and a sticky trap inserted, much like wings on either side of the potato.
Macrocentrus ancylivorus, 40 females and 10 males, were released in the center of the corridor
and left for a period of 72 hours. Ambient temperature was monitored with a HOBO (Onset
Corp.) data logger and remained within the parameters for Macrocentrus ancylivorus activity.
The same experiment was performed similarly in a smaller enclosed room (19 x 21 feet) in the
greenhouse. Again, 50 Macrocentrus ancylivoruss, approximately half male and half female,
were released. Potatoes were placed on opposite sides of the room, prepared as above. There
were three replications. Temperature was monitored as above. Traps were checked at 24 hour
intervals for three days.

No Macrocentrus ancylivoruss were recovered from traps in the greenhouse corridor.
Macrocentrus ancylivorus were recovered from sticky traps in the smaller room, but results were
inconclusive though more Macrocentrus ancylivoruss were recovered from the non-infested
potatoes. A total of 7 Macrocentrus ancylivoruss, all male, were recovered from the infested, 11




                                               38
California Tree Fruit Agreement
2007 Annual Research Report




Macrocentrus ancylivoruss, 8 females and 3 males, were recovered from the non-infested
potatoes.

FIELD TRIAL

In August, 2007, in a young mixed peach and cherry orchard infested with OFM, sticky
cardboard sleeves were placed over branches to trap Macrocentrus ancylivoruss. Twelve inch
cardboard tubes, 2 in. diameter were covered with a sticky yellow tape called Rollertrap
(Western Farm Service). These were placed over the ends of branches with the shoot end
protruding as an attractant for Macrocentrus ancylivoruss. Altogether 96 tubes were placed, 4
each on 24 trees. Trees were located across 12 rows, within which the first and third trees were
used.

Macrocentrus ancylivorus were sprayed in each of two Bugdorms. One group of approximately
200 was sprayed with soy milk, the other with whole milk. These markers were tested in 2006
and found to be effective. Before release, 25 unsprayed Macrocentrus ancylivoruss, 25 soy-
sprayed Macrocentrus ancylivoruss, and 25 whole milk-sprayed were aspirated, placed in micro-
capsules, and placed in a freezer to be sent for ELISA, along with any recaptured Macrocentrus
ancylivoruss.

Sprayed Macrocentrus ancylivorus were released from two points at the south side of the
orchard. The Macrocentrus ancylivoruss sprayed with whole milk were released at the edge of
the orchard adjacent to the first row of trees, the soy treated Macrocentrus ancylivoruss were
released 100 ft. directly south of the first point, in the midst of an adjacent vacant field.

Following conclusion of the first experiment, large barrier traps, approximately 6 ft x 6 ft, were
constructed of sheets of corrugated cardboard, covered with Rollertrap. These were attached at
each end to PVC poles which were then planted in 5 gallon buckets filled with stones and placed
in front of the first trees in each of eight rows. Traps faced south, the direction of the release.
Releases were done as before but in the evening rather than the morning.

No Macrocentrus ancylivoruss were found in traps after 24 hours. At one week, traps were
checked again but no Macrocentrus ancylivoruss were recovered.

An unseasonal rain and windstorm moved through the area about 24 hours after the experiment
was set up and compromised many of the traps. However, after three days, seven Macrocentrus
ancylivorus were recovered from traps and placed in micro-capsules, then in the freezer.
Damaged traps were reset and checked again in 24 hours.

The ELISA results indicated that 4 of the 7 recaptured Macrocentrus ancylivoruss tested positive
for the whole milk protein (edge of orchard) while only one tested positive for the soy milk
(vacant field). Two Macrocentrus ancylivoruss tested negative for both. As all of the pre-release
sprayed samples, 25 of each, tested positive for their respective milk proteins and the unsprayed
controls tested negative for both, it is possible that some Macrocentrus ancylivorus were already
present in the orchard and would account for the negative readings.




                                                39
California Tree Fruit Agreement
2007 Annual Research Report




DISCUSSION

It was our intention to release at least 1000 Macrocentrus ancylivoruss with each protein marker
but, despite receiving an excess of 3500 Macrocentrus ancylivorus pupae, our emergence
percentages were unusually low. This occurred in two consecutive emergence samples and we
have not established a cause. This has not been a problem in the four years that we have been
performing the Macrocentrus ancylivorus studies. It was encouraging to discover that the
recapture method does have potential, but due to the small number of Macrocentrus ancylivoruss
that were recaptured, it seems that a larger sample population will be required to draw any
definitive conclusions regarding movement and flight distance.




                                               40
California Tree Fruit Agreement
2007 Annual Research Report




INVESTIGATION OF THE EFFECTS OF TREE
FRUIT SUPPLEMENTATION ON THE REPAIR
OF OXIDATIVE DNA BASE DAMAGE IN
MOUSE EXTRACTS
PROJECT LEADER:                   Dr. Vilhelm A. Bohr

COOPERATORS:                      Dr. Nadja C. de Souza-Pinto, Dr. William
                                  Ramos, Ms. Charlotte Harboe

INTRODUCTION

The DNA is a relatively unstable molecule that can be easily modified (Lindahl, 1993).
Modifications of DNA bases, particularly those caused by oxidative stress, can lead to mutations
and have been directly linked with some diseases such as cancer. DNA lesions introduced by
oxidative stress also accumulate during the normal aging process. To counteract their deleterious
effects, living organisms have developed DNA repair systems that remove the damaged base and
replace it with a new, unmodified nucleotide. DNA repair is a set of enzymatic processes that
work jointly to correct DNA damage. These modifications are recognized by specific proteins
and then cascades of enzymatic reactions take place. The particular process and set of enzymes
utilized is then dependent upon the kind of lesion that is being dealt with. Small, non-helix
distorting lesions, such as oxidative modifications, are repaired by the base excision repair
pathway (BER). BER is active both in the nucleus as well as in mitochondria, and thus functions
to prevent accumulation of oxidative DNA damage in both genomes (Bohr et al., 2002).

Since fruits and vegetables are good sources of anti-oxidants, it has been long speculated that
dietary modulation would decrease the levels of oxidative DNA damage. Very few studies have
directly addressed this question and the results are heterogeneous (Moller et al., 2003;Zhu et al.,
2000). On the other hand, the possibility that dietary components also modulate DNA repair
activities has been poorly investigated. Recently, Collins and colleagues (Collins et al., 2003)
demonstrated that consumption of kiwifruit for 3-week periods decreased endogenous levels of
oxidized DNA bases and increased DNA repair efficiency. This DNA repair stimulation was not
due to an increase in the repair enzyme protein levels, suggesting that kiwifruits may directly
affect the activity of the proteins.

Previous results from our laboratory suggested that peach extracts could modulate the repair of
oxidative lesions in vitro. This study was designed to address the question of whether a peach or
nectarine-enriched diet modulates DNA repair and damage levels in vivo, using mice as our



                                                41
California Tree Fruit Agreement
2007 Annual Research Report




animal models. Our interest concentrates on one particular class of DNA lesions,
formamidopyrimidine (Fapy) modifications. In a previous experiment we observed that the
levels of fapyadenine in liver DNA from mice that ate the fruit diet were significantly lower than
in mice eating the control diet. The results obtained from these studies will further our
understanding of how diet modulates human health at the molecular level and may stimulate the
consumption of peaches and nectarines, if it appears that these fruits may contribute to lower
oxidative DNA damage levels, and thus decrease risk for certain diseases such as cancers and
age-associated degenerative diseases.

PROPOSED SPECIFIC AIMS

1. In the previous mouse-feeding experiment we observed that mice fed a diet containing 8%
fruit extract (wt/wt) showed significantly lower levels of an oxidized base lesion, fapyadenine
(Fig. 1), which can cause mutations and cytotoxicity. In this study we propose to investigate
whether P/N extracts enhance DNA repair efficiency towards fapyadenine and the closely related
fapyguanine lesion. We measure the effect of adding P/N extracts to mitochondrial and nuclear
extracts on their ability to incise fapy-containing oligonucleotide substrates. We will also
investigate whether fapy incision is elevated in liver extracts from mice fed a diet containing 8%
P/N extract.

2. We propose to extend the mouse-feeding study to older mice. In the previous study we
utilized 3 months old mice and we would like to use 18 months old mice in this follow-up
study. Several of these oxidatively induced lesions accumulate with age and we postulate that
older mice will be more sensitive to small variations in DNA repair capacity, as casued by
the high fruit diet. Two groups of mice (24 animals each) will be fed a control diet or a diet
containing 8% elegant lady peach extract (wt/wt) for 3 months. At the end of the study the
animals will be sacrificed and livers and brains processed for mitochondria/nuclei isolation,
DNA isolation and RNA isolation for micro-array studies.

PROGRESS REPORT:

Aim 1- One critical element of the experiments proposed under this aim is the fapy-containing
oligonucleotide substrates. These substrates are proprietary, not commercially available and
obtained trough collaboration with an investigator in another institution. The substrates are
synthesized as short oligos, 16 bases long, which are too small for use in the in vitro incision
experiments. Thus, we have to further prepare the substrates by ligating the lesion-containing
oligo to another oligonucleotide in order to obtain substrates that are 30-36 bases long. We are
now preparing the substrates and performing the ligation reactions. Once the final substrates are
prepared we will continue with the in vitro experiments testing the direct effect of peach extracts
on the incision kinetics of these lesions.

Aim 2- To address aim 2 we devised the following experimental design:

     1. Experimental design: 3 feed groups (control, peach-enriched and nectarine-enriched), 18
        mice/group, 3 months feeding




                                                42
California Tree Fruit Agreement
2007 Annual Research Report




     2.   Assays to perform:
     a.   DNA repair activities in mitochondria and nuclear fractions
     b.   Levels of DNA damage by HPLC-EC or LC-MS
     c.   Expression of DNA repair/damage response genes

     3. Organs to collect:
        Brain, Liver, Heart, Kidney and Testis

     4. Sample preparation:
     a. Brains:
     - Dissect 9 brains into regions; combine 3 regions for each sample, for a total of 3 samples.
        Quick freeze in liquid N2 for isolation of mito/nuc
     - Combine 3 whole brains per sample, for a total of 3 samples, for DNA isolation. Quick
        freeze
     b. Livers:
     - Freeze livers of 12 mice individually, to be used for mito/nuc isolation and DNA
        isolation
     - Freeze 6 livers in RNALater for gene expression analysis
     c. Heart, Kidney and Testis:
     - Freeze organs from 6 mice individually for mito/nuc isolation
     - Combine 3 each, for a total of 3 samples, for DNA isolation. Quick freeze.
     - Freeze 3 organs individually in RNALater for gene expression analysis

     5. Progress:
     - The 3 groups were fed for 3 months and all animals sacrificed. The tissues were collected
        as described above and when appropriate processed into mitochondrial and nuclear
        extracts.
     - The mitochondrial extracts were tested for nuclear contamination by Western Blot
        against a highly abundant nuclear protein, Lamin B2, and the respiratory chain
        component, Cytochrome oxidase subunit IV (COX IV), as a marker for mitochondrial
        content. The absence of Lamim B signal in the lanes with mitochondrial proteins shows
        that all mitochondrial extracts are virtually free of nuclear contamination (Figure 1). The
        enrichment for mitochondria was confirmed by the several fold enrichment for the
        mitochondrial marker COX IV. These results allowed us to proceed with the
        measurements of DNA repair activities in these two compartments.
     - We have initiated the in vitro repair measurements using two prototypical DNA lesions,
        the common cytosine deamination product uracil, and the common oxidative lesion 8-
        hydroxyguanine. Incision reaction conditions were optimized for these two lesions
        (Figure 2 for uracil and Figure 4 for 8-hydroxyguanine) using increasing concentrations
        of nuclear and mitochondrial extracts from a control mouse.
     - We found that uracil incision activity is similar in nuclear and mitochondrial extracts, in a
        protein concentration range from 0.5 – 40 µg of extract. Because the reaction reaches a
        saturating plateau at the higher protein concentrations, we chose 2.5 µg of extracts for the
        experiments comparing the different groups. We have thus far analyzed one set of
        animals, i.e., one mouse of each feeding group, for the uracil incision activity (Figure 3).
        Our preliminary results suggest that the fruit-enriched diet may modulate DNA repair



                                                 43
California Tree Fruit Agreement
2007 Annual Research Report




          activities differently in nucleus and mitochondria. In the one set of animals analyzed we
          observed increased incision activity in mitochondria from the fruit-fed mice and
          decreased activity in the nuclear extracts from the same animals. However, since these
          results represent only one animal for each group, it is at this point too preliminary to draw
          conclusions. We are now analyzing the remaining samples in order to have statistically
          relevant results.
     -    For the 8-hydroxyguanine incision experiments we observed a slightly lower incision
          activity in the mitochondrial extracts when compared with nuclear extracts (Figure 4,
          compare panels B and D). For that reason, the amounts of extract chosen for the
          comparison of the feeding groups differs for the two types of extracts. We will use 20 µg
          of nuclear extracts and 40 µg of mitochondrial extracts. The experiments comparing the
          extracts from all the treated animals are now under way.




                                                   44
California Tree Fruit Agreement
2007 Annual Research Report




REFERENCES/LITERATURE REVIEW



  1. Bohr, V.A., T.Stevnsner, and N.C.Souza-Pinto. 2002. Mitochondrial DNA repair of

        oxidative damage in mammalian cells. Gene 286:127-134.



  2. Collins, A.R., V.Harrington, J.Drew, and R.Melvin. 2003. Nutritional modulation of DNA

        repair in a human intervention study. Carcinogenesis 24:511-515.



  3. Lindahl, T. 1993. Instability and decay of the primary structure of DNA. Nature 362:709-

        715.



  4. Moller, P., U.Vogel, A.Pedersen, L.O.Dragsted, B.Sandstrom, and S.Loft. 2003. No effect

        of 600 grams fruit and vegetables per day on oxidative DNA damage and repair in healthy

        nonsmokers. Cancer Epidemiol. Biomarkers Prev. 12:1016-1022.



  5. Zhu, C., H.E.Poulsen, and S.Loft. 2000. Inhibition of oxidative DNA damage in vitro by

        extracts of brussels sprouts [In Process Citation]. Free Radic. Res. 33:187-196.




                                                  45
      California Tree Fruit Agreement
      2007 Annual Research Report




    A                                                         B
                                                 Lamin B
                                                  COX IV




                                                 Lamin B

                                                 COX IV


                Mitochondria            Nuclei




Figure 1. Western blot detection of nuclear and mitochondrial protein markers in mouse liver: Fifty micrograms
of mitochondrial or nuclear extracts from each mouse liver were separated using a 12% denaturing polyacrylamide
gel, transfer to a PVDF membrane and probed with monoclonal antibodies against Lamin B and COX IV. Panel A
shows the immunoblot, as detected by ECL. Panel B shows the amido-black staining of the membranes to confirm
equal loading in all lanes.




                                                       46
A                                                                                    B
       California Tree Fruit Agreement
        protein: -c Report
    µg 2007 Annual Research +c 0.5 1 2.5 5 10 20 40
        protein                                                                           µg protein: -c +c 0.5 1 2.5 5 10 20 40
                                                                                             protein                               M




C                           Optimizing, uracil incision assay with mouse
                                                 liver                               D
                       80                                                                 ATATACCGCGGUCGGCCGATCAAGCTTATT
                       70                                                                 TATATGGCGCCGGCCGGCTAGTTCGAATAA
                       60
       incision (% )




                                                                  nuclear fraction
                       50
                       40
                                                                  mitochondrial
                       30
                                                                  fraction
                       20
                       10
                        0
                             0.5   1   2.5   5    10   20    40
                              protein concentration (microgram)




Figure 2. Optimization of reaction conditions for UDG incision activity with nuclear and mitochondrial extracts:
Increasing concentrations of nuclear (panel A) or mitochondrial (panel B) extracts were incubated with 100 fmoles
of uracil-containing duplex oligonucleotide (D) for 30 min, at 37 °C. The reactions were resolved in a 20%
polyacrylamide/7 M urea gel and exposed to Storm screens. The percent of incision was quantified using a
ImageQuant software and a graph representation is presented in panel C.



                                                                                     47
        California Tree Fruit Agreement
        2007 Annual Research Report
    A
                                    Nuclear extract                                  Mitochondrial extract

                                   C1 P N                                           C1 P N




B                                                                           Uracil incision

                                                             50

                                                             40
                                              incision (%)




                                                                                                 Nuclear extract
                                                             30

                                                             20                                  Mitochondrial
                                                                                                 extract
                                                             10

                                                             0
                                                                  control   Peach    nectarine




Figure 3. UDG activity in control and fruit fed mouse liver extracts: 2.5 µg of nuclear or mitochondrial extracts
from a control (C1), a peach-fed (P) or a nectarine-fed (N) mouse were incubated with 100 fmoles of uracil-
containing substrate and resolved as described earlier (A). The percentage of incision for each sample was
quantified and is presented in panel B. The results presented are the average of duplicate reaction for one mouse
per group.

                                                                                     48
A                                                           C
          California Tree Fruit Agreement
          2007 Annual Research Report

    µg protein M -C +C 1 10 20 40 60 80 100                                             70
                                                                                        60




                                                                      Incision (%)
                                                                                        50
                                                                                        40
                                                                                        30
                                                                                        20
                                                                                        10
                                                                                         0
                                                                                              1   10    20        40    60    80

                                                                                                       Protein [ug]



B       µg protein 10 20 40 60 80 100                       D                          50
                                                                                       40




                                                                  in c is io n ( % )
                                                                                       30
                                                                                       20
                                                                                       10

                                                                                       0
                                                                                             10   20    40         60    80        100
                                                                                                         protein (ug]


    Figure 4. Optimization of reaction conditions for OGG1 incision activity with nuclear and mitochondrial extracts:
    Increasing concentrations of nuclear (panels A and C) or mitochondrial (panels B and D) extracts were incubated
    with 100 fmoles of 8-hudroxyguanine-containing duplex oligonucleotide (same sequence as U-substrate, but with 8-
    oxoG in the position 11) for 4 hr, at 32 °C. The reactions were resolved and quantified as described before



                                                             49
California Tree Fruit Agreement
2007 Annual Research Report




HEALTH BENEFITS OF
PEACHES AND PLUMS
PROJECT LEADER:                   Dr. David Byrne

COOPERATORS:                      Dr. Luis Cisneros, Dr. Weston and Dr. David
                                  Ramming

INTRODUCTION


Fruits have long been promoted for their health benefits in preventing various cancers and age-
related diseases (Prior and Cao, 2000; Wargovich, 2000). The phytochemicals reported in Prunus
include carotenoids, anthocyanins, and phenolics (Weinert et al., 1990; Senter and Callahan,
1991; Tourjee et al., 1998; Gil et al., 2002; Cevallos et al., 2005). Orange-fleshed peaches have
the carotenoids β-carotene and β- cryptoxanthin both which have vitamin A activity (Tourjee et
al., 1998). Several hydroxycinnamates, flavan 3-ols and flavonols, predominantly chlorogenic
acid, neochlorogenic acid, catechin, epicatechin, and quercetin 3-rutinoside, have been identified
in peaches and plums (Tomás-Barberán et al., 2001; Kim et al., 2003a; Vizzotto et al., 2006).
Plums contain large amounts of phytochemicals such as flavonoids and phenolic acids that may
act as natural antioxidants in our diet (Wang et al., 1996), which in turn may provide health-
promoting effects to consumers (Kim et al., 2003b).


The antioxidant activity in both peaches and plums depends on the genotype tested. Some papers
have reported that blueberry has the highest antioxidant activity among fruits; however, the
levels found in red-fleshed plums overlap the levels found in blueberry (Wang et al., 1996; Prior
et al., 1998; Cevallos et al., 2005). There is a good correlation between total phenolic compounds
and antioxidant activity among peaches and plums (Cevallos et al., 2005; Gil et al., 2002;
Vizzotto, 2007). Furthermore the contribution of phenolic compounds and anthocyanins to this
antioxidant activity is much more important than the contribution of Vitamin C or carotenoids
(Gil et al., 2002; Kim et al., 2003b; Chun et al., 2003; Vizzotto, 2007). Although there is a direct
relationship between total phenolic and antioxidant activity there is no obvious linear
relationship between either total phenolic content or total antioxidant activity and inhibition of
cell proliferation, suggesting that there is a specific phenolic compound or a class of phenolics
that is responsible for the antiproliferative activity (Sun et al., 2002).


The total content of phytochemicals and the antioxidant activity of fruits (cherries, blackberries,
strawberries, and raspberries) also varies with the stage of maturity, post harvest handling, and
growing/cultural conditions under which the fruit was produced (Gonçalves et al., 2004a; 2004b;



                                                 50
California Tree Fruit Agreement
2007 Annual Research Report




Wang and Lin, 2000; Serrano et al., 2005). The current work indicates this may also be true for
peaches, nectarines, and plums. The only report with peaches, nectarines, and plums looked at
the changes of ripening fruit picked at the firm ripe stage but not the effect of picking fruit at
different maturity stages and its changes through to senescence (Tomas-Berberan et al., 2001).
These aspects of phytochemical development in stone fruit needs to be further studied to best
manage these fruit to maximize their health benefits.

Phytochemical extracts of peach showed a weak antiproliferative activity in vitro (Sun et al.,
2002); however, peach homogenates, in in-vivo tests, reduced induction of micronuclei in bone
marrow cells by 43-50% confirming the protective effect of this extract. This effect may be due
to a multitude of compounds present in the plant material (Edenharder et al., 2003). Initial work
using the (3H) thymidine incorporation technique showed that methanolic extracts from red
fleshed peach and plum inhibited the proliferation of T47D human breast cancer cells, Caco-2
human colon cancer cells, HTC rat hepatoma cancer cells, PC-3 prostate cancer cells and DS-19
mouse erythroleukemia cancer cells. More recent work in our laboratory has shown that
methanolic extracts from a few peach and plum genotypes showed excellent antiproliferative
activity on MDA-MB-435 estrogen-negative receptor breast cancer cell lines (Vizzotto, 2005).
Current work is attempting to elucidate the mechanism and identify the specific phytochemicals
responsible for this effect.


Little has been done to promote the health benefits of peaches, nectarines or plums as has been
done with grapes, prunes, cranberries, cherries and many other crops. In part, this is due to the
lack of specific information about the health benefits of the phytochemicals in these fruit. The
ongoing project in the Department of Horticultural Sciences at Texas A&M University has been
developing this information and has already screened about a hundred peach, nectarine, and
plum genotypes with flesh colors ranging from white to yellow to orange to red for their anti-
oxidant activity, total phenolics, and total anthocyanins (Cevallos et al., 2005; Vizzotto et al.,
2007). These studies found that the antioxidant activity of some plums overlapped that of
blueberry, a small fruit touted for its high level of antioxidant activity. In addition, the group of
phytochemicals best correlated with antioxidant activity were the phenolic acids. More recent
work in our group also indicates the importance of the phenolic acids in the inhibition of breast
cancer cell proliferation and on DNA methylation which is one of the mechanisms that control
the cell cycle, an essential component of cancer development.

OBJECTIVES

The long term objective of this research program is to document the health benefits of stone fruit
consumption and to understand the management and other conditions to maximize these health
benefits in the stone fruit produced for consumption.

The short term objectives for this research are the following:

     1. Determine the anti proliferation activity the methanolic extract of the phenolics of the
        specific varieties have on breast cancer cell lines (needs repetition).




                                                 51
California Tree Fruit Agreement
2007 Annual Research Report




     2. Screen commercial stone fruit varieties for their antiproliferative activity in two cancer
        cell culture systems: colon cancer and prostate cancer (ongoing).
     3. Determine the LDL oxidation inhibition that these extracts elicit (completed).
     4. Determine the effect of fruit maturity on the total phenolic concentration, anthocyanin
        concentration, and antioxidant activity of ‘Rich Lady” peach and “Black Splendor” plum
        (completed).




                                                52
California Tree Fruit Agreement
2007 Annual Research Report




MATERIALS AND METHODS

Cancer cell proliferation and LDL oxidation surveys. Methanolic extracts of the frozen samples
of the 26 stone fruit varieties collected in the summer of 2006 will be used in cancer cell line
proliferation studies as well as the LDL oxidation studies.

Fruit maturity studies. Peach and plum fruit were harvested in California and were shipped in
boxes via overnight mail to the Department of Horticultural Sciences at Texas A&M University
and stored at 5° C until further use. The fruit were moved to room temperature (~18°C) and
separated into the two groups of maturity stages according to their external firmness by hand
assessment. Afterwards, the internal (flesh) firmness value (lbf) was determined for an objective
characterization of the maturity stage in both types of fruits. The ripening and over-ripening
processes at room temperature of each group of peaches and plums was evaluated every other
day by measuring the internal firmness of 5 fruits from each group. Then every fruit was cut,
packaged and labeled in plastic bags, and stored at -20°C for further analysis.

Antiproliferation activity in cancer cell cultures (Objectives 1 and 2)

Cancer cell lines. Three breast cancer lines are used: MCF-7 (the estrogen-positive human breast
cancer), MDA-MB-453 (estrogen-negative human breast cancer), and MCF-10A (non-
cancerous breast cell line). These are cultured in Petri dishes using Dulbecco’s modified Eagle’s
medium (DMEM) at 37˚C in a 5% CO2 atmosphere and supplemented differently depending on
the cell line (see Vizzotto, 2005 for details).


Two human colon, colorectal adenocarcinoma cancer cell lines (HT-29 and Caco-2) and one
human prostate carcinoma cell line (PC-3) will be used. The HT-29 is cultured in ATCC
McCoy’s medium with 1.5 mM L-glutamine-fetal bovine serum and Caco-2 is cultured in ATCC
minimum essential medium (Eagle) with 2 mM L-glutamine and an adjusted Earle’s BSS (Yi et
al., 2005). The PC-3 line is grown in a RPMI medium 1640 (GIBCO) and supplemented with
10% FBS/1% penicillin/streptomycin. These cell lines are grown in an incubator at 37˚C with
5% CO2. The medium will be changed 2-3 times per week.


Cell viability assay. Antiproliferation will be measured in the presence and absence of treatments
by using MTT [3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide] or methyl thiazol
tetrazolium assay (Mosmann, 1983) based on its conversion to MTT-formazan. Cells are seeded
in 96-well microtitre plates at a density of 5,000 to 10,000 cells per well depending on the cell
line. After 12-24 h period of incubation to allow cell attachment, cells will be exposed to varying
concentrations of peach and plum extracts for 24 h. The concentrations used for all the genotypes
and fractions is based on total phenolic content and expressed as µg of chlorogenic acid/mL.
After the appropriate incubation period, 100 µL of MTT (5 mg/ml) is added per well and
incubated for 1 h at 37˚C. After incubation, MTT is aspirated and 100 µL of DMSO added to
lyse the cells and dissolve the blue formazan crystals. Calculate cell viability according to the
following equation.




                                                53
California Tree Fruit Agreement
2007 Annual Research Report




                             ⎡ OD of cell culture with sample − OD of the medium ⎤
        Cell viability (%) = ⎢                                                          ⎥ x100
                             ⎣ OD of the cell culture without sample − OD of the medium ⎦
Where OD is the optical density measured by spectrophotometer at 555 excitation and 520
emission filters.


The natural log of the remaining concentration (Ln C/Co) was calculated and plotted against the
concentration (µg/ml of total phenolics). The first-order rate constant (k) was used to calculate
the IC50 (concentration needed to reduce proliferation in 50%). IC50= Ln2 / k , where C is the cell
culture with sample, Co is the cell culture without sample and k is the first-order rate constant.


Antiproliferation assay. Cell growth determination will be performed using an electronic counter
(Z1 Coulter). Five to ten thousand cells per well are seeded in 6-well plate and incubated for 24 h
to allow cell attachment before exposure to varying concentrations of extracts. After the
appropriate incubation period, the medium is aspirated and the cells rinsed with 1 ml of PBS
(phosphate saline buffer). After incubation period of 5 min with 200 μL of trypsin, 800 µL of
medium is added and the mix transferred to a vial previously filled with 19 mL of isotone II
solution. Two readings were taken from each replication. The results were expressed as number
of cells.

Inhibition of LDL oxidation (Objective 3)

Total Phenolics Content- Total soluble phenolic content analysis was adapted from Swain and
Hillis (23). The sample was homogenized with methanol. Tubes were capped and stored for 20-
72 h at 4 °C. Extracts were centrifuged at 29 000g for 15 min. A 0.5 mL sample (0.5 mL water
for the blank) was taken from the clear supernatant and diluted with 8 mL of nanopure water. A
0.5 mL aliquot of 0.25 N Folin-Ciocalteu reagent was added and allowed to react for 3 min; then,
1mL of 1 N Na2CO3 was added and allowed to react for 2 h. Spectrophotometric readings at 725
nm were taken. Total phenolics were expressed as mg chlorogenic acid equivalent/100 g based
on a standard curve.

Anthocyanin Content- Total anthocyanin content was adapted from Fuleki and Francis (1968)
using the pH 1 method. A sample of 5 g was homogenized with 20 g of solvent (85:15, 95%
ethanol:1.5N HCl). Tubes were stored for 24 h at 4°C. After centrifugation and filtration samples
were added half its volume of hexane and shaken vigorously to remove carotenoids.
Spectrophotometric readings at 535 and 700 ηm were taken. Anthocyanins were expressed as mg
cyanidin 3-O-β-glucopyranoside (cyanidin 3-glucoside) equivalent per 100 g of fresh weight
using a molar extinction coefficient of 20,941 and a molecular weight of 484.84 (calculated as
the chloride salt) obtained from a standard curve

Antioxidant activity- The DPPH assay was done according to the method of Brand-Williams et
al. (1995) with some modifications. The stock solution was prepared by dissolving 24 mg DPPH
with 100mL methanol and then stored at -20 °C until needed. The working solution was obtained
by mixing 10mL stock solution with 45μL methanol to obtain an absorbance of 1.1 units at 515



                                                  54
California Tree Fruit Agreement
2007 Annual Research Report




nm using the spectrophotometer. Fruit extracts (150 μL) were allowed to react with 2850 μL of
the DPPH solution for 24 h in the dark. Then the absorbance was taken at 515 nm. Results are
expressed in μg TE/g fresh weight.

The ORAC procedure used an automated plate reader (KC4, Bio Tek, USA) with 96-well plates
(Prior et al., 2003). Analyses were conducted in phosphate buffer pH 7.4 at 37 °C. Peroxyl
radical was generated using 2, 2’-azobis (2-amidino-propane) dihydrochloride which was
prepared fresh for each run. Fluorescein was used as the substrate. Fluorescence conditions were
as follows: excitation at 485nm and emission at 520nm. The standard curve was linear between 0
and 50 mM Trolox. Results are expressed as μm TE/g fresh mass.

Antioxidant Activity Upon LDL Oxidation Evaluated By TBARS Assay-Isolation of LDL. Plasma
were obtained from Fisher Scientific Int. (Winnipeg, MB., Canada) in presence of 0.01%EDTA.
LDL (1.019-1.063 g/L) was isolated by sequential density ultracentrifugation according to
Schonfeld (1983). Briefly 2 mL of plasma was added to a centrifugation tube containing 4 mL
NaCl (1.0063 g/L) and 30 μL of 1.5% (w/v) dithionitrobenzoic acid (Sigma Chemical, St. Louis,
MO) and centrifuged at 40,000 rpm for 18 h at 4 °C, then 2 mL were discarded and corrected
with 2 mL NaBr of 1.1416 g/L for 18 h at 4 °C. After isolation, LDL was dialyzed in 0.01 M
phosphate-buffered saline (PBS, pH 7.4) to removed EDTA and other interfering compounds.
The protein content was measured using the Bradford reagent (Sigma Chemical, St. Louis, MO).

LDL Oxidation. LDL (75 μg/mL) was diluted in 0.01 M PBS pH 7.4 and incubated at 37 °C in
presence of 5 mM AAPH for oxidation. The AAPH which is an inducer of the oxidation reaction
was dissolved in PBS. A non-oxidized LDL sample, incubated in absence of AAPH constituted
the blank control.

Protein Content. Protein content in purified fraction of LDL was quantified according to the
Bradford method (Bradford 1976). A sample (50 μL) was taken and mixed with Bradford
reagent (1500 μL) and finally read the absorbance at 595 nm in a spectrophotometer. The total
protein concentration (mg/L) was expressed on the basis of standard of BSA.

Thiobarbituric Acid Reactive Substances (TBARS). Assay was performed according to the
procedures of Camejo et al. (1992). To each tube containing 0.55 mL of the incubated LDL
(75 μg/mL, 37°C by 6 h) in the presence of 2,2’-Azobis(2-amidino-propane)-dihydrochloride
solution AAPH (5 mM) was added 0.5 mL of 25% (w/v) trichloroacetic acid (TCA) to denature
protein. After the samples had been centrifuged (10,000 rpm) at 10 °C for 30 min to remove
pellets, 0.5 mL of 1% thiobarbituric acid (TBA) in 0.3% NaOH was added to the supernatant,
and the mixed reagents reacted at 90- 95 °C in a water bath for 40 min. After completion of the
reactions, samples were detected with excitation at 532 nm and emission at 600 nm in a Synergy
HT 96-well fluorescence plate reader and the KC4 software (Bio-Tek® Instruments).
Percent inhibition (%Inhibition) of the formation of malonaldehyde was used as a parameter to
compare antioxidant capacity. It is calculated according to the equation:

(%Inhibition)= [(C - S)/C] x100



                                               55
California Tree Fruit Agreement
2007 Annual Research Report




where C is the amount of malonaldehyde formed in the control (no antioxidant added) and S is
the amount of malonaldehyde formed when antioxidant was present. The sample concentration
that led to 50% inhibition, IC50, is used to compare the capacities of different antioxidants.

The effect of maturity stage on phytochemical content (Objective 4)

Internal firmness was determined using a texture analyzer (TA-XT2, Texture Technologies
Corp.), fitted with an 8-mm concave tip and the probe was driven with a crosshead speed of 10
mm sec-1. A set of 10 and 5 fruits from each group (very firm and firm) was used to measure
fruit firmness initially and during the ripening and over-ripening (senescence) processes. The
fruit was peeled, and an average internal firmness was determined as the force recorded at 10.0
mm compression deformation force applied on two different and opposite equatorial spots of
each fruit.

Total phenolic content, total anthocyanin content, and antioxidant activity were analyzed as
previously described.

The total carotenoids content protocol was adapted from Talcott and Howard (1999). Under
indirect light conditions, 2 g of frozen tissue was homogenized with 20 mL of acetone/ethanol
(1:1) solution containing 200 mg/L BHT in a falcon tube until obtaining uniform consistency.
After centrifugation for 20 min at 29,000 x g at 2°C, the supernatant was transferred to a 50-mL
graduated cylinder and solvent added to a final volume of 50 mL. The solution was transferred to
a plastic container with a screw cap. Twenty-five milliliters of hexane were added to the peach
and plum samples and the container was shaken vigorously. The solution was left for 30 min to
allow separation of the phases before 12.5 mL of nanopure water was added and the solution was
shaken vigorously. Again, the phases were allowed to separate and the hexane phase was
measured in a Spectrophotometer. The machine was zeroed using hexane as a blank solution and
the measurements were taken in a quartz cuvette at 470 nm. Every time the measurements were
above 0.7 AU, the samples were diluted with hexane and reanalyzed. The concentration of total
carotenoids was estimated from a β-carotene (Sigma Chemical Co.) standard curve in terms of
milligrams of β-carotene equivalent per 100 g of fresh tissue.

RESULTS AND DISCUSSION

Antiproliferation activity in cancer cell cultures (Objectives 1 and 2)
Extracts from the yellow fleshed peach ‘Rich Lady’ (RL) and of red fleshed plum ‘Black
Splendor’ (BS) were evaluated on the estrogen-dependent MCF-7, the estrogen-independent
MDA-MB-435 breast cancer cells and one non-cancerous breast cell line MCF-10A. The results
showed that RL extract effectively inhibited the proliferation of the estrogen-independent MDA-
MB-435 breast cancer cell line as compared to either the non cancerous breast line MCF-10A or
the estrogen dependent breast cancer line MCF-7 respectively. In general BS extracts were less
effective although they still affected the MDA-MB-435 to a greater degree than the other breast
cancer cell line or the normal breast cell line. Thus subsequent screening was done with only the
MDA-MB-435 estrogen-independent cell line.




                                               56
California Tree Fruit Agreement
2007 Annual Research Report




Twenty-six commercial varieties were tested. The IC50 values found in peach extracts ranged
from 110 mg/L to > 1200 mg/L. ‘Spring Snow’ and ‘Rich Lady’ showed high activity in
suppressing the proliferation of MDA-MB-435 cells, with IC50 values of about 110 and 150 mg/L
respectively. Among the nectarines varieties, IC50 values ranged from about 230 to > 1200 mg/L.
‘Summer Fire’ and ‘Honey Blaze’ were the most potent in suppressing the cell growth (IC50
between 230-250 mg/L). Finally, the IC50 values found for the plum varieties ranged from about
200 to 975 mg/L. ‘Black Amber’, ‘Crimson Glo’, ‘Angeleno’ and ‘Friar’ exerted the highest
anti-tumor activity (IC50 ~ 200 mg/L). These tests are currently being repeated and then the
screening with the colon and prostate cancer lines will begin once the new facility in Dr.
Cisneros’s laboratory obtains all the University approvals.

Inhibition of LDL oxidation (Objective 3)
Total phenolic content for different varieties of peach, nectarine and plums ranged from ~ 40-
170, 50-120 and 350-650 mg chlorogenic acid/100g fw, respectively while the total anthocyanin
content ranged from ~ 1- 4.5, 0.5- 10 and 10 – 90 mg cyanindin 3-gly/100g fw, respectively .
Peach varieties that showed higher phenolic content included ‘Galaxy’, ‘O’Henry’ and ‘Spring
Snow’, while for nectarines, varieties high in phenolic content included ‘Fire Pearl’, ‘June Pearl’
and ‘Spring Bright’. For plums, ‘Angeleno’ and ‘Black Splendor’ varieties had the higher
phenolic content (Figure 1).

The varieties with the highest anthocyanin content included ‘Rich Lady’, ‘Red Jim’ and ‘Black
Splendor’ for peach, nectarine and plum fruit, respectively. ‘Black Splendor’ plum was the only
variety among the fruits studied that showed both high phenolic and anthocyanin content (~ 0.2
anthocyanin/total phenolic ratio).

The antioxidant activity based on the DPPH assay for peach, nectarine and plums ranged from ~
450- 2300, 300 – 1200 and 2000 – 8000 ug Trolox/g fw, respectively (Figure 2). The values
obtained for plums are higher or similar to those reported previously for blueberries (Vizzotto et
al., 2007; Cevallos et al., 2006).

The specific antioxidant activity using the DPPH assay was calculated for all varieties and types
of fruits studied. The specific antioxidant activity expressed on phenolic basis, determines the
antioxidant activity of the specific profile of phenolic compounds present in each variety tested.
For peaches, nectarines and plums it ranged from ~ 700 -1400, 400 – 1200 and 625 – 1100 ug
Trolox/mg chlorogenic acid, respectively. ‘Sweet Dream’, ‘Arctic Star’ and ‘Black Kat’ varieties
were the fruits that showed higher specific antioxidant activity among peach, nectarine and
plums, respectively.

The antioxidant activity based on the ORAC assay for peach, nectarine and plums ranged from ~
4 - 17, 4.5 – 11.5 and 15 – 62.5 uM Trolox/g fw, respectively. In general, the varieties in each
type of fruit with higher antioxidant activity using the ORAC assay followed similar trend to
those observed using the DPPH assay and in total phenolic content.

The specific antioxidant activity using the ORAC assay was calculated for all varieties and types
of fruits studied. For peaches, nectarines and plums it ranged from ~ 5.5 - 12, 6.5 – 9.5 and 4 -9
uM Trolox/mg chlorogenic acid, respectively. Once again ‘Sweet Dream’ and ‘Black Kat’



                                                57
California Tree Fruit Agreement
2007 Annual Research Report




varieties were the fruits that showed higher specific antioxidant activity among peach and plums,
respectively. For nectarines ‘Arctic Star’ as well as other 6 varieties (including ‘Spring Bright’)
showed higher and similar specific antioxidant activity.

Linear correlation analysis indicated high correlations (r2 > 0.78) between total phenolic content
and antioxidant activity using the ORAC assay or the DPPH assay (r2 > 0.72) for varieties within
each type of fruit. This is consistent with previous work with stone fruit (Vizzotto et al., 2007).




                                                58
   California Tree Fruit Agreement
   2007 Annual Research Report




   Figure 1. Total phenolic content in selected California commercial varieties of peaches,
   nectarines and plums.


                                            700
           mg chlorogenic acid/ 100 g fwt




                                            600
                                                                       Rich Lady
                                            500                        O Henry
                                                                       Galaxy
                                            400                        Honey Blaze
                                                                       Summerfire
                                            300                        Firepearl
                                                                       Black Amber
                                            200                        Black Splendor
                                                                       Angeleno
                                            100

                                              0


   Figure 2. Antioxidant activity of selected California varieties of peach, nectarine and plum.




                                            9000
                                            8000
DPPH (ug Trolox/g fwt)




                                                                         Rich Lady
                                            7000                         O Henry
                                            6000                         Galaxy
                                                                         Honey Blaze
                                            5000
                                                                         Summerfire
                                            4000
                                                                         Firepearl
                                            3000                         Black Amber
                                            2000                         Black Splendor
                                            1000                         Angeleno
                                               0




                                                   59
California Tree Fruit Agreement
2007 Annual Research Report




Next, we characterized the effects of stone fruit phenolic compounds on the inhibition of Human
LDL oxidation. ‘Galaxy’ peach, ‘Fire Pearl’ nectarine and ‘Angeleno’ plum were initially
selected due to their high phenolic and antioxidant content. The IC50 values were obtained from
curves of LDL oxidation inhibition and concentration of phenolic compounds (Figure 3). The
IC50 values represent the concentration of phenolic compound that induces a 50% inhibition of
LDL oxidation. The IC50 values for the selected peach, nectarine and plum varieties were ~ 9.3,
11.7 and 13.7 uM chlorogenic acid, respectively. These IC50 values or phenolic concentrations
were used to screen the inhibition of LDL oxidation for different varieties in each type of fruit
studied.

The inhibition of Human LDL oxidation in different peach varieties ranged from ~ 30 – 55%, in
nectarines it ranged from ~ 0 – 50% and in different plum varieties the inhibition of Human LDL
oxidation ranged from ~ 20 – 50%. This large variation in LDL oxidation inhibition is related to
the type of phenolic compounds present in each type of fruit variety studied. It is likely that the
specific profiles influence the response. We observed that in peaches, ‘Spring Snow’ and
‘Galaxy’ varieties showed the highest inhibition, while the ‘White Lady’ variety the lowest. In
nectarines, ‘Fire Pearl’ and ‘Red Jim’ varieties showed the highest inhibition, while ‘Spring
Bright’ and ‘Artic Pride’ the lowest. Finally, in plums, ‘Angeleno’ and ‘Black Splendor’ showed
higher inhibition while ‘Crimson Glo’ the lowest.

There is not consistent relationship between our results of the antiproliferative activity for breast
cancer cells, or LDL oxidation inhibition with those obtained for total phenolics, antioxidant
activity or specific antioxidant activity. Since there is no apparent correlation, it is likely that
antioxidant properties of phenolic compounds from stone fruits would not be the only
mechanism by which phenolics inhibit Human LDL oxidation. The possible mechanisms would
have to be explored and studied in future work.

Our results confirm that selecting or screening varieties based solely on antioxidant activity is
misleading and does not represent the fruit’s ability for specific bioactivity (in this case Human
LDL oxidation inhibition and antiproliferative activity towards breast cancer cells). Thus it is
important to screen varieties using the appropriate bioassays targeting the specific bioactivity
searched for. One big challenge is to find bioassays that could be cost effective and efficient in
yield and time output.




                                                 60
California Tree Fruit Agreement
2007 Annual Research Report




Figure 3. Obtained curves of % inhibition of Human LDL oxidation for different peach, nectarine and
plum varieties. Selection of varieties was based on highest total phenolic content and antioxidant capacity
in order to obtain IC50 values in the LDL oxidation assay.


                                                   Galaxy (peach)
                                                                                                                                                                                     Fire Pearl (nectarine)
                                100
                                                                                                                                                                    100


                                80
% Inhibition of LDL oxidation




                                                                                                                                                                    80




                                                                                                                                    % Inhibition of LDL oxidation
                                60

                                                                                                                                                                    60

                                40

                                                                                                                                                                    40

                                20

                                                                                                                                                                    20

                                 0
                                      0   5   10         15                                     20      25       30
                                                                                                                                                                     0
                                              Phenolic content (uM CGA)
                                                                                                                                                                          0    5     10        15         20    25   30

                                                                                                                                                                                    Phenolic content (uM CGA)




                                                                                                                       Angeleno plum


                                                                                              100




                                                                                              80
                                                              % Inhibition of LDL oxidation




                                                                                              60




                                                                                              40




                                                                                              20




                                                                                                0
                                                                                                    0        5    10           15                                         20   25    30

                                                                                                                 Phenolic content (uM CGA)




                                                                                                                          61
California Tree Fruit Agreement
2007 Annual Research Report




The effect of maturity stage on phytochemical content (Objective 4)

‘Rich Lady’ Peach- The carotenoid content in ‘Rich Lady’ peaches increased substantially
(~200%) during the first four days at 18 C corresponding to the ripening process, while the
internal (flesh) firmness decreased rapidly during this period from an initial pre-ripe stage (FRP)
(~13 lbf) until the fruit reached the fully-ripe stage at a firmness value of ~ 1 lbf. The minimum
firmness value for “ready to eat” peach fruit is ~ 2 lbf (Crisosto et al. 2007). A slight increase in
the carotenoid content (~60% compared to day 0) was observed between days 4 and 12 of
storage corresponding to the over-ripening process. Fruit firmness during this period did not
change and remained at ~ 1 lbf (Figure 1). Carotenoid development occurs as the chloroplast is
transformed into chromoplast during ripening, resulting in new synthesis of various carotenoids
that are not present in green fruit (Abbie et al., 2005). ß-Carotene synthesis in peach fruit
(Katayama et al., 1971) during the ripening process has been reported previously. However, no
previous work has been reported for the over-ripening process or senescence period.

                                                             Phytochemical Content During Ripening Process of Peaches
                                                        16                                                                         600                                                        4.0                                                      12000
                                                                                             Internal Firmness (lbf)
                                                                                             mg Chlorogenic / 100 g fresh tissue
                                                        14                                   mg B-Carotene / 100 g fresh tissue                                                               3.5




                                                                                                                                         m g C h lo ro g e n ic / 1 0 0 g fre s h tis s u e


                                                                                                                                                                                                    m g B -C a ro te n e / 1 0 0 g fre s h tis s u e
                                                                                             μg Trolox Eq / g fresh tissue         500                                                                                                                 10000




                                                                                                                                                                                                                                                               μ g T ro lo x E q / g fre s h tis s u e
                                                        12
                                                                                                                                                                                              3.0
                    In te rn a l F irm n e s s (lb f)




                                                                                                                                   400                                                                                                                 8000
                                                        10
                                                                                                                                                                                              2.5
                                                        8                                                                          300                                                                                                                 6000
                                                                                                                                                                                              2.0
                                                        6
                                                                                                                                   200                                                                                                                 4000
                                                                                                                                                                                              1.5
                                                        4

                                                                                                                                   100                                                                                                                 2000
                                                        2                                                                                                                                     1.0


                                                        0                                                                          0                                                          0.5                                                      0
                                                                         0            4                  8                  12

                                                                                   Days at 18°C
Figure 4. Phytochemical antioxidant changes in ‘Rich Lady’ peach fruit during the ripening and
over-ripening processes.

In contrast, no differences in phenolic content and antioxidant capacity were observed during the
ripening and over-ripening processes (Figure 4). The phenolic content change in peach fruit
agrees with previous peach work (Tomas-Barberan et al., 2000) for firm ripe versus ripened fruit.

Soluble solid content increased slightly during the over-ripening process (after day 4), while the
pH remained constant during both the ripening and over-ripening periods (Figure 5).




                                                                                                    62
California Tree Fruit Agreement
2007 Annual Research Report




                                                                                    Chemical Changes During Ripening of Peaches
                                                                         16                                                                             25                    10
                                                                                                  Internal Firmness (lbf)
                                                                                                  Soluble Solid
                                                                         14
                                                                                                  pH
                                                                                                                                                        20                    8
                                                                         12

                                               Internal Firmness (lbf)




                                                                                                                                                             Soluble Solids
                                                                         10
                                                                                                                                                        15                    6




                                                                                                                                                                                                  pH
                                                                             8

                                                                                                                                                        10                    4
                                                                             6


                                                                             4
                                                                                                                                                        5                     2
                                                                             2


                                                                             0                                                                          0                     0
                                                                                         0              4                      8                 12

                                                                                                   Days at 18 °C
Figure 5. Soluble solids and pH changes in ‘Rich Lady’ peach fruit during the ripening and
over-ripening processes.

The carotenoid content during the ripening process in ‘Rich Lady’ peach fruits increased in
samples harvested at both very firm (~13 lbf) pre-ripe fruit (FRP) and the firm (~ 3 lbf ) “ready to
eat” fruit (RTE) maturity stages. Although more significant differences were observed in FRP
compared to RTE fruit, both groups showed a similar trend and rates in the change of flesh
firmness and carotenoid content during the ripening process. The flesh firmness decreased
rapidly while the carotenoid content increased during the ripening period (Figure 6).

                                                                             Phytochemical Content During Ripening Process of Peaches
                                                              16                                                                                                        4.0
                                                                                                                     FRP - Firmness
                                                                                                                     RTE - Firmness
                                                              14                                                     FRP- mg B-Carotene/100 g fresh tissue
                                                                                                                                                                        3.5
                                                                                                                     RTE- mg B-Carotene/100 g fresh tissue
                                                                                                                                                                              mg B-Carotene/100g fresh tissue




                                                              12
                     Internal Firmness (lbf)




                                                                                                                                                                        3.0

                                                              10
                                                                                                                                                                        2.5
                                                                         8
                                                                                                                                                                        2.0
                                                                         6

                                                                                                                                                                        1.5
                                                                         4


                                                                         2                                                                                              1.0


                                                                         0                                                                                              0.5
                                                                                         0                  4                      8                  12

                                                                                                    Days at 18°C
 Figure 6. Carotenoid changes in ‘Rich Lady’ peach fruit during the ripening process at two initial
                                         maturity stages




                                                                                                                63
California Tree Fruit Agreement
2007 Annual Research Report




‘Black Splendor’ Plum- Total anthocyanin content increased substantially (~100%) during the
first 4 days of ripening at room temperature of this red-fleshed plum, when the fruit firmness
decreased from an initial pre-ripe stage of ~ 8 lbf to a fully ripe stage of ~1 lbf. Ready to eat plum
fruit is considered in the range of 2 - 3 lbf of flesh firmness (Crisosto et al. 2007). During the
over-ripening period. between days 4 and 15, the anthocyanin accumulated up to ~ 230% in
relation to day 0 (Figure 4).

This result indicated this red-fleshed plum fruit continued synthesizing anthocyanins during
senescence and beyond the ripening period. These results confirm previous studies that observed
increasing anthocyanin content during the ripening of plum fruits at 20°C (Manganaris et al.
2007). However, previous studies did not characterize anthocyanin synthesis during the over-
ripening process or senescence period.


                                              Phytochemical Content During Ripening Process of Plums
                              12                                                                                     2500                                                        200                                                                       1e+5
                                                            Internal Firmness (lbf)
                                                            mg Chlorogenic / 100 g fresh tissue




                                                                                                                                                                                       m g C y a n id in -3 -g lu c o s id e / 1 0 0 g fre s h tis s u e
                                                            mg Cyanidin-3-glucoside / 100 g fresh tissue
                              10                            Trolox Eq / g fresh tissue




                                                                                                                            m g C h lo ro g e n ic / 1 0 0 g fre s h tis s u e
                                                                                                                     2000                                                                                                                                  8e+4
                                                                                                                                                                                 150




                                                                                                                                                                                                                                                                  T ro lo x E q /g fre s h tis s u e
          In te rn a l F irm n e s s (lb f)




                                          8
                                                                                                                     1500                                                                                                                                  6e+4

                                          6
                                                                                                                                                                                 100

                                                                                                                     1000                                                                                                                                  4e+4
                                          4


                                                                                                                     500                                                         50                                                                        2e+4
                                          2



                                          0                                                                          0                                                                                                                                     0
                                                        0                   5                   10              15

                                                                           Days at 18°C
Figure 7. Phytochemical antioxidant changes in ‘Black Splendor’ plum fruit during the ripening
and over-ripening processes.

In the present study phenolic content did not significantly change during the ripening and over-
ripening periods for the ‘Black Splendor” plum (Figure 7). In a previous study by Senter et al
(1992), phenolic compounds evaluated only during the ripening process showed no significant
changes. This group observed that the degree of polymerization of proanthocyanidins, as
indicated by vanillin/proanthocyanidin ratios, did not change. In the present study, the
antioxidant activity mimicked the phenolic content and did not show major changes during the
ripening and over-ripening processes in plum fruit. The overall antioxidant capacity was strongly



                                                                                                           64
California Tree Fruit Agreement
2007 Annual Research Report




correlated with the phenolics content, but not with the anthocyanin content. The reason is that
anthocyanin only represents a small fraction of the total phenolic content in plum fruit (~0.2) and
thus has little contribution to the total antioxidant activity of the fruit. Similar observations were
reported previously for stone fruit (Tomas-Barberan et al., 2000; Vizzotto et al., 2007) and
strawberry fruit (Ferreyra et al., 2007).

No significant changes in pH and soluble solids in plums were observed during the ripening and
over-ripening processes (Figure 8). Similar results have been reported previously for plum fruits
during a ripening period of 7 days at 20°C (Manganaris et al. 2007).

                                           Chemical Changes During Ripening Process of Plums
                                      12                                                        30                           10
                                                 Internal Firmness (lbf)
                                                 Soluble Solid
                                                 pH
                                      10                                                        25
                                                                                                                             8
            Internal Firmness (lbf)




                                                                                                     Soluble Solid (°Brix)
                                      8                                                         20
                                                                                                                             6




                                                                                                                                  pH
                                      6                                                         15

                                                                                                                             4
                                      4                                                         10


                                                                                                                             2
                                      2                                                         5



                                      0                                                         0                            0
                                                     0                     5          10   15

                                                                       Days at 18°C
Figure 8. Soluble solid and pH changes in ‘Black Splendor’ plum fruit during the ripening and
over-ripening processes.

Finally, we compared the anthocyanin changes in plum fruits harvested at two maturity stages
(Figure 9). The flesh firmness for both the very firm (~ 8 lbf) FRP fruit and firm (~2.lbf ) RTE
fruit decreased rapidly while the anthocyanin content increased during the ripening period.




                                                                                65
California Tree Fruit Agreement
2007 Annual Research Report




                                                 Phytochemical Content During Ripening Process of Plums

                                            12                                                                          200
                                                         FRP- Firmness




                                                                                                                              mg Cyanidin-3-glucoside/ 100 g fresh tissue
                                                         RTE - Firmness
                                                         FRP - mg Cyanidin-3-glucoside / 100 g fresh tissue             180
                                            10           RTE - mg Cyanidin-3-glucoside/ 100 g fresh tissue

                                                                                                                        160
                  Internal Firmness (lbf)


                                            8                                                                           140

                                                                                                                        120
                                            6
                                                                                                                        100

                                            4                                                                           80

                                                                                                                        60
                                            2
                                                                                                                        40

                                            0                                                                           20
                                                              0                       5                       10   15

                                                                                 Days at 18°C


Figure 9. Anthocyanin changes in ‘Black Splendor’ plum fruit during the ripening and over-
ripening processes at two initial maturity stages




                                                                                          66
California Tree Fruit Agreement
2007 Annual Research Report




LITERATURE REVIEW

Abbie, J. F., Del Pozo-Insfran, D., Lee, J. H., Sargent, S. A., and Talcott, S. 2005. Ripening-
induced chemical and antioxidant changes in bell peppers as affected by harvest maturity and
postharvest ethylene exposure. HortScience. 40: 732-736.

Brand-Williams, W.; Cuvelier, M. E.; Berset, C. 1995. Use of a free-radical method to evaluate
antioxidant activity. Food Sci Technol-Leb. 28, 25-30.

Cevallos-Casals, B., D. Byrne, W. R. Okie, and L. Cisneros-Zevallos. 2006. Selecting new peach
and plum genotypes rich in phenolic compounds and enhanced functional properties. Food
Chem. 96: 273-280.

Chun, O.K., D. Kim, H.Y. Moon, H.G. Kang, and C.Y. Lee. 2003. Contribution of individual
polyphenolics to total oxidant capacity of plums. J. Agr. Food Chem. 51:7240-7245.

Crisosto, C. H., Mitcham, E. J., and Kader, A. A. 2007. Product Facts. Available in:
http://postharvest.ucdavis.edu/Produce/Producefacts/index.shtml (last review: 11/30/2007)

Ferreyra, R. M., Viña, S. Z., Mugridge, A., and Chaves A. R. 2007. Growth and ripening season
effects on antioxidant capacity of strawberry cultivar Selva. Science Horticulturae. 112 : 27-32.

Fuleki, T. and F.J. Francis. 1968. Quantitative methods for anthocyanins 1. Extraction and
determination of total anthocyanin in cranberries. Food Sci. 33:72–77.

Gil, M., F. Tomas-Barberan, B. Hess-Pierce, and A. kader. 2002. Antioxidant capacities,
phenolic compounds, carotenoids, and vitamin A contents of nectarine, peach, and plum cultivars
from California. J. Agric. Food Chem. 50:4976-4982.

Gonçalves, B., A. Landbo, D. Knudsen, A. Silva, J. Moutinho-Pereira, E. Rosa, and A. Meyer.
2004a. Effect of ripeness and postharvest storage on the phenolic profiles of cherries (Prunus
avium L). J. Agric. Food Chem. 52:523-530.

Gonçalves, B., A. Landbo, M. Let, A. Silva, E. Rosa, and A. Meyer. 2004b. Storage effects the
phenolic profiles and antioxidant activities of cherries (Prunus avium L.) on human low-density
lipoproteins. J. Sci. Food Agric. 84:1013-1020.

Katayama, T. Nakayama, T. H. Lee, T. H. Chichester, C. O. 1971. Carotenoid transformations in
ripening apricots and peaches. Journal of food science. 36 : 804-806.

Kim, D.O, S.W. Jeong, and C.Y. Lee. 2003b. Antioxidant capacity of phenolic phytochemicals
from various cultivars of plums. Food Chem. 81:321-326.

Manganaris, G. A., Vicente, A. R., Crisosto, C. H., and Labavitch, J. A. 2007. Effect of dips in a
1-methylcyclopropene-generating solution on ‘Harrow Sun’ plums stored under different
temperature regimes. J. Agric. Food Chem. 2007, 55, 7015-7020




                                                67
California Tree Fruit Agreement
2007 Annual Research Report




Marin, A., Ferreres, F., Tomas-Barberan, F. A., and Gil M. 2004. Characterization and
quantitation of antioxidant constituents of sweet pepper (capsicum annuum l.). J. Agric. Food
Chem. 2004. 52: 3861-3869

Prior, R.L., and G. Cao. 2000. Antioxidant phytochemicals in fruits and vegetables: diet and
health implications. HortScience 35:588-592.

Senter, S.D., and A. Callahan. 1991. Variability in the quantities of condensed tannins and other
major phenols in peach fruit during maturation. J. Food Sci. 56:1585-1587.

Senter, S. D., and Fobes, W. R. 1992. Variations in Proanthocyanidins of Japanese-Type Plums
During Maturation and Storage J Sci Food Agric. 1992. 60: 11-14

Serrano, M., F. Giullén, D. Martínez-Romero, S. Castillo, and D. Valero. 2005. Chemical
constituents and antioxidant activity of sweet cherry at different ripening stages. J. Agric. Food
Chem. 53:2741-2745.

Sun, J., Y-F. Chu, X. Wu, and R.H. Liu. 2002. Antioxidant and proliferative activities of
common fruits. J. Agric. Food Chem. 50:7449-7454.

Swain, T. and Hillis W. E. 1959. The phenolic constituents of Prunus domestica. J. Sci. Food.
Agr. 10, 63-58.

Talcott, T. S. and Howard, R. L. 1999. Phenolic autoxidation is responsible for color degradation
in processed carrot puree. J. Agr. Food Chem. 47:2109–2115.

Tomás-Barberán FA, Gil MI, Cremin P, Waterhouse AL, Hess-Pierce B, Kader AA. 2001.
HPLC-DAD-ESIMS analysis of phenolic compounds in nectarines, peaches, and plums. J Agric
Food Chem 49:4748-60.

Tourjee, K.R., D.M. Barrett, M.V. Romero, and T.M. Gradziel. 1998. Measuring flesh color
variability among processing clingstone peach genotypes differing in carotenoid composition. J.
Amer. Soc. Hort. Sci. 123:433-437.

Vizzotto, M., L. Cisneros, W. R. Okie, D. W. Ramming, and D. H. Byrne. 2007. Large variation
found in the phytochemical content and antioxidant activity of peach and plum germplasm. J.
Amer. Soc. Hort. Sci., 132: 334-340

Wang, H., G. Cao, and R.L. Prior. 1996. Total antioxidant capacity of fruits. J. Agric. Food
Chem. 44(3):701-705.

Wang, S. Y., and H-S. Lin. 2000. Antioxidant activity in fruits and leaves of blackberry,
raspberry, and strawberry varies with cultivar and developmental stage. J. Agric. Food Chem.
48:140-146.

Wargovich, M.J. 2000. Anticancer properties of fruits and vegetables. HortScience 35:573-575.




                                                 68
California Tree Fruit Agreement
2007 Annual Research Report




Weinert, I., J. Solms, and F. Escher. 1990. Diffusion of anthocyanins during processing and
storage of canned plums. Lebensm. Wiss. Technol. 23:396-9.




                                               69
California Tree Fruit Agreement
2007 Annual Research Report




DEVELOPMENT OF PREDICTIVE TOOLS
FOR BROWN AND SOUR ROT
RESISTANCE IN PEACH AND NECTARINES
PROJECT LEADER:                   Dr. Carlos Crisosto

COOPERATORS:                      Ebenezer Ogundiwin, Richard Bostock,
                                  David Slaughter, Tom Gradziel, Dr. Themis
                                  Michailides

SUMMARY

Postharvest brown rot (BR) caused by Monilinia fructicola and sour rot (SR) caused by Geotrichum
candidum are serious diseases of peach and nectarine in California. Current disease management is
primarily by pre- and postharvest application of fungicides. Resistance to both fungi was surveyed
among 81 (for BR) and 34 (for SR) commercial peach and nectarine cultivars as well as a few old
cultivars, landraces, and closely related accessions. Of these, 22 cultivars were tested with both
fungi. A total of 204 individuals of two peach segregating populations (‘Loadel’ × ‘UCD96,4-55’
and ‘Dr. Davis’ × ‘F8,1-42’) were evaluated for genetic analysis of resistance to BR. Two methods
– wounded vs. nonwounded fruit - were used for inoculations with M. fructicola. All SR
inoculations involved wounded fruit. BR lesion size varied among cultivars and among the
progeny of both populations. SR lesion size also varied among cultivars tested. Yellow fleshed
cultivars were significantly less susceptible than white cultivars to BR nonwounded inoculation
(P < 0.05) but no significant difference was observed between both colors for wound inoculation.
Nectarines were significantly less susceptible to BR wound inoculation than peaches (P < 0.01)
but no significant difference was observed between the two fruit types for nonwounded
inoculation. Lesion size was determined to be under genetic control from analysis of cultivar
differences. A weak but significant linear relationship was observed between wounded and
nonwounded BR inoculation methods (R2 = 6-27%; P <0.01). However, several cultivars and
progeny that displayed resistance to nonwounded inoculation were susceptible to wound
inoculation. This indicated that similar as well as different resistance mechanisms may be present
for wounded vs. nonwounded fruit. Host resistance also varied between SR and BR as t-test
analysis showed significant differences between the reactions of the cultivars to both fungi. A
number of wild peach accessions and old cultivars showed a high level of resistance to BR
suggesting that these may be untapped sources of resistance to the fungus. DNA has been
isolated from parents and progeny of the two mapping populations. A set of Prunus candidate
genes in the cutin, lignin, chlorogenate, and caffeic acid biosynthesis pathways as well as
resistance gene analogs has been assembled. Linkage mapping and QTL analyses for BR
resistance is underway.



                                                70
California Tree Fruit Agreement
2007 Annual Research Report




INTRODUCTION

Two major postharvest diseases of stone fruits are brown and sour rot caused by Monilinia
fructicola (G. Wint.) Honey, and Geotrichum candidum Link (Adaskaveg et al., 2005; Biggs and
Northover, 1985; Byrde and Willetts, 1977; Michailides et al., 2004). Effective control of these
pathogens and other postharvest diseases is by routine application of chemical fungicides
(Adaskaveg et al., 2005; Margosan et al., 1997) particularly if fruit is to be stored and/or shipped
long distances. However, there is increasing concern about the environmental effects and safety
of chemical fungicides, and the development of fungicide-resistant postharvest fungal pathogens
has been reported (Hong et al., 1998). Regulatory agencies have reacted to public pressure and
introduced comprehensive legislation to reduce pesticide use (Irtwange, 2006; Karabulut and
Baykal, 2003).

Host resistance to plant pathogens is perhaps the most cost effective and environmentally safe
strategy for disease management. Although commercial cultivars are generally susceptible to
brown rot (Ogawa et al, 1985; Cantoni et al., 1996), improved levels of resistance have been
identified in some cultivars such as ‘Bolinha’, (Feliciano et al., 1987; Bostock et al., 1994;
Gradziel et al, 2003), and two breeding lines in the breeding program of Dr. S. P. Gonzalez,
Universidad Autonoma de Queretaro, Mexico. Research efforts are ongoing to breed peach
cultivars resistant to brown rot. The cling-peach breeding program of Dr. Tom Gradziel (UC
Davis) has incorporated sources of resistance from almond into several breeding lines (Gradziel,
2002, Gradziel et al., 2003). Bostock et al. (1999) reported that chlorogenic and caffeic acids are
major phenolic acids in the epidermis and subtending cell layers of peach fruit and that their
concentrations are especially high in immature fruit with a high level of resistance to brown rot
and decline as fruit mature with a corresponding increase in disease susceptibility (also see Lee
and Bostock, 2006). The processing canning peach breeding program of UC Davis is
incorporating the epidermis-based resistance to brown rot into improved cultivars through a
recurrent selection program (Gradziel et al., 2003). Augmenting traditional breeding practices
with more modern molecular mapping technologies will better equip the breeder to meet the
challenge of breeding sustainable resistance.

The detection of sour rot caused by G. candidum in peach and nectarine is relatively new
(Michailides et al., 2004). In the program of Drs. Michailides and Bostock, several peach and
nectarine cultivars have been observed to possess high levels of resistance to this pathogen.

The main goal of our group is to develop predictive molecular tools that peach and nectarine
breeders can use to quickly develop disease resistant superior cultivars such that there will be
less reliance on chemical fungicide usage. The specific objectives of this research are: 1.
Determine the genetic control of resistance to brown and sour rot in peach cultivars and two
cling peach progeny populations, and 2. Develop scaffold linkage maps with these populations
and localize genomic regions controlling resistance with tightly linked molecular markers.




                                                 71
California Tree Fruit Agreement
2007 Annual Research Report




MATERIALS AND METHODS

Plant Material
Fruit were collected at commercial maturity from fields at the Kearney Agricultural Center
(KAC), Parlier, UC Davis/USDA Germplasm Repository, and from organic growers. Fruit were
either transported from KAC to Davis for brown rot inoculations or from Davis to KAC for sour
rot inoculations. Materials sampled include canning peach and fresh market cultivars, peach and
nectarine cultivars, canning peach breeding lines, segregating progeny of two mapping
populations, old peach cultivars and related wild accessions. Many cultivars were obtained from
multiple sources.

Inoculations and lesion size measurements
All brown rot inoculations were conducted at the Plant Pathology Department, UC Davis and all
sour rot inoculations were conducted at KAC, Parlier. Prior to inoculation, fruit flesh color was
measured with the nondestructive impact firmness sensor as an indicator of maturity (Slaughter
et al., 2006). Fruit were surface sterilized by allowing them to sit for 30 seconds in a 10% bleach
solution. They were rinsed twice by dipping them in separate buckets of clean water, and then
allowed to dry on paper towels. Crispers were prepared by washing with hot soapy water and
rinsing with 95% ethanol, and air drying. The bottom of the crisper was covered with 1/8 to 1/4
of an inch of water, and lined with a crisper liner. Fruit were placed in crispers with the smooth,
flat side up. Inoculum of Monilinia fructicola (brown rot) and Geotrichum candidum (sour rot)
spore was prepared with 25,000 spores/ml concentration. Inoculation was done by pipetting a 10
µl drop of spores onto the fruit. Controls are prepared in the same way, except sterile water was
used instead of spores. Wounded inoculation was achieved by wounding the peach fruit surface
with a flamed metal tool with a sharp point, and inoculating with the spores. Only wounded
inoculation was carried out for sour rot. After inoculation closed crispers were covered with 2
layers of damp cheesecloth and allowed sit for 15 hours. The inoculum drops were then
removed by wicking away with a Kimwipe, and the crisper lids were replaced. Three days after
inoculation the lesion diameters were measured with a ruler.

Molecular analysis (ongoing)
Leaf samples were collected from all the progeny and available parents of the two mapping
populations at UC Davis and transported on ice to the Molecular Lab at KAC. DNA isolation
from the leaf samples was achieved through the standard CTAB method. Candidate gene
sequences in the cutin, lignin, chlorogenate, and caffeic acid biosynthesis pathways were
obtained from public databases such as the NCBI (http://www.ncbi.nlm.nih.gov/) and GDR
(http://www.bioinfo.wsu.edu/gdr/)    as    well  as    from    our   ChillPeach   database
(http://bioinfo.ibmcp.upv.es/genomics/ChillPeachDB/login.php). Primers were designed for
these candidate genes using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi).
Survey of polymorphism among these candidate genes as well as other available molecular
markers (SSRs, SRAPs & RAFs) is underway. Linkage mapping and QTL analyses will follow.

Statistical Analysis
Analysis of variance (ANOVA) was conducted on the lesion size data using the GLM procedure
of SAS. Relationships between resistances to brown rot wounded and nonwounded inoculations




                                                72
California Tree Fruit Agreement
2007 Annual Research Report




and between resistances to sour rot and brown rot were assessed by linear correlations and t-test,
respectively.

RESULTS

A total of 81 and 34 cultivars were surveyed for resistance to brown rot and sour rot,
respectively. Out of these, 24 cultivars were challenged with both fungi. Fruit collection was
made from fungicide-free sources and many cultivars inoculated with brown rot were obtained
from two or more sources, making a total of 123 entries. Also for brown rot, a total of 204
progeny of ‘Loadel’ × ‘UCD96,4-55’ (82 progeny) and ‘Dr. Davis’ × ‘F8,1-42’ (122 progeny)
cling peach populations were inoculated with brown rot to assess segregation for resistance to the
fungus. In addition 12 old cultivars and wild accessions were inoculated with brown rot for
discovery of new resistance sources.

The reactions of peach and nectarine cultivars to wounded and unwounded brown rot and
wounded sour rot inoculations are presented in Figure 1. Based on the distributions, five groups
were identified for each fungus/inoculation method as follows: HR = highly resistant, MR =
medium resistance, MS = medium susceptible, HS = highly susceptible, VHS = very highly
susceptible. Lesion size was generally larger for wounded inoculations compared to non-
wounded.

Relationships between resistances to brown rot wounded and nonwounded inoculations and
between resistances to sour rot and brown rot are indicated in Table 1. There were small but
significant correlations between wounded and nonwounded inoculations among the cultivars as
well as among progeny of the two mapping populations. Significant differences were observed
between brown rot and sour rot resistance reactions among the 24 cultivars inoculated (wounded
inoculation) with both fungi.

Figure 2 shows the frequency distributions of the reactions of the two cling peach progeny
populations to both wounded and nonwounded inoculations. These distributions indicated that
both populations are segregating for resistance to the fungus.

Table 2 is the summary of ANOVA of the different reaction groupings and fruit types. Yellow
fleshed cultivars were significantly more resistant to nonwounded inoculation compared to their
white fleshed counterparts (P <0.01), however, no significant differences were observed between
the two groups for wounded inoculation. Nectarines were significantly more resistant to brown
rot wounded inoculation compared to peaches (P <0.05), but both fruit types reacted similarly to
nonwounded inoculation. Fresh market and canning peach cultivars reacted similarly to both
wounded and nonwounded inoculations, although only about 7% of all cultivars tested were
canning peaches.

DISCUSSION
The reactions of various genotypes of peach and nectarine to brown rot and sour rot inoculations
indicated that there is genetic resistance to these postharvest fungi. Some established cultivars
showed very good resistance to the fungi under the experimental conditions used in this study.
This showed that perhaps postharvest fungicide applications can be reduced or cancelled for



                                                73
California Tree Fruit Agreement
2007 Annual Research Report




these cultivars. Because lesion size were larger for wounded inoculations across the board
compared to nonwounded inoculations, care should be taken during harvest to minimize physical
injury to the fruit to avoid cracks on the skin through which the fungi can gain entrance. Organic
growers may find the information generated in this study helpful in selecting cultivars for their
production. A weak but significant linear relationship was observed between wounded and
nonwounded BR inoculation methods. However, several cultivars and progeny that displayed
resistance to nonwounded inoculation were susceptible to wound inoculation. This indicated that
similar as well as different resistance mechanisms may be present for wounded vs. nonwounded
fruit. Host resistance also varied between sour rot and brown rot as t-test analysis showed
significant differences between the reactions of the cultivars to both fungi. A number of wild
peach accessions and old cultivars showed a high level of resistance to brown rot (results not
shown) suggesting that these may be untapped sources of resistance to the fungus.

FUTURE PLANS

We will continue with the molecular marker analysis of resistance to both fungi. The scaffold
linkage maps will be constructed for both populations and QTL analysis of resistance will be
conducted. Markers closely linked to the resistance QTLs will be identified for use in breeding
programs. With availability of funds, we will conduct a second year round of inoculation
experiments on the progeny populations. This is very important for the reliability of QTL
analysis because it will allow us account for non-genetic variation due to experimental errors and
environmental factors. In addition, we will select representatives of each reaction groups for both
wounded and nonwounded inoculations and challenge them with the fungi. A detailed quality
assessment (soluble solids, TA, firmness, etc) will be carried out on this subset and related to
resistance reaction.

PUBLICATION FROM THIS STUDY


Ebenezer Ogundiwin, Richard Bostock, Tom Gradziel, Themis Michailides, Mohammad
    Yaghmour, Dan Parfitt, and Carlos Crisosto (2007). Towards molecular genetic analysis of
    resistance to brown rot and sour rot in Prunus persica. Plant & Animal Genome
    Conference XVI, San Diego, 12-16 January 2007.




                                                74
California Tree Fruit Agreement
2007 Annual Research Report




REFERENCES

Adaskaveg, J., Forster, H., Gubler, W.D., Teviotdale, B.L. and Thompson, D.F. 2005. Reduced-
    risk fungicides help manage brown rot and other fungal diseases of stone fruit. California
    Agriculture 59, 109-114.
Biggs, A.R., and Northover, J. 1985. Inoculum sources for Monilinia fructicola in Ontario peach
    orchards. Can. J. Plant Pathol. 7, 302-307.
Bostock, R.M., Adaskaveg,J. E., and Madden S. 1994. Role of cutinase in pathogenicity of the
    brown rot fungus, Monilinia fructicola. Central Valley Postharvest News 3, 16-17.
Bostock, R.M., Wilcox, S.M., Wang, G., and Adaskaveg, J. E. 1999. Suppression of Monilinia
    fructicola cutinase production by peach fruit surface phenolic acids. Physiological and
    Molecular Plant Pathology 54, 37-50.
Byrde, R.J.W., and Willetts, H.J. 1977. The brown rot fungi of fruit. Their biology and control.
    Pergamon Press, New York.
Cantoni, L., Bassi, D., and Tacconi, N. 1996. Brown rot in stone fruits, aspects of biology and
    techniques of selection for resistance. Riv. Frutticoltura Ortofloricoltura 58, 59-65.
Feliciano, A., Feliciano, A.J., and Ogawa, J.M. 1987. Monolinia fructicola resistance in peach
    cultivar Bolinha. Phytopathology 77, 776-780.
Gradziel, T.M. 2002. Almond species as sources of new genes for peach improvement. Acta
    Hort. 592, 81-88
Gradziel, T.M. 2003. Interspecific hybridizations and subsequent gene introgression within
    Prunus subgenus Amygdalus. Acta Hort. 622, 249-255.
Hong, C., Michailides, T.J., and Holz, B.A. 1998. Effects of wounding, inoculum density, and
    biological control agents on postharvest brown rot of stone fruits. Plant Disease 82, 1210-
    1216.
Horvat, R.J., Chapman, G.W., Jr., Robertson, J.A., Meredith, F.I., Scorza, R., Callahan, A.M.,
    and Morgens, P. 1990. Comparison of the volatile compounds from several commercial
    peach cultivars. J. Agric. Food Chem. 38, 234-237.
Irtwange, S.V. 2006. Application of biological control agents in pre- and postharvest operations.
    Agricultural Engineering International: the CIGR Ejournal. Invited Overview No. 3. Vol.
    VIII, 12 p.
Karabulut, O.A., and Baykal, N. 2003. Biological control of postharvest diseases of peaches and
    nectarines by yeasts. J. Phytopathology 151, 130-134.
Margosan, D.A., Smilanick, J.L., and Henson, D.J. 1997. Combination of hot water and ethanol
    to control postharvest decay of peach and nectarines. Plant Disease 81, 1405-1409.
Michailides, T.J., Morgan, D.P., and ,Day, K.R. 2004. First Report of Sour Rot of California
    Peaches and Nectarines Caused by Yeasts. Plant Dis. 88:222.
Ogawa, J.M., Manji, B.T., and Sonoda, R.M. 1985. Management of the brown rot disease on
    stone fruits and almonds in California. In: T.J. Burr (ed.), Proc. Brown rot of stone fruit
    workshop. New York Agricultural Experiment Station, Geneva, New York. p. 8-15.




                                               75
California Tree Fruit Agreement
2007 Annual Research Report




Figure 1: Reactions of peach and nectarine cultivars to brown rot and sour rot inoculations. A = Nonwounded brown
rot, B = wounded brown rot inoculation, and C = sour rot wounded inoculation




                                                       76
California Tree Fruit Agreement
2007 Annual Research Report




Table 1: Comparison between brown rot (BR) and sour rot (SR) and between wounded and nonwounded
inoculations




Figure 2: Frequency distributions of two cling peach progeny populations showing segregation of resistance to
brown rot wounded and nonwounded inoculations




                                                        77
California Tree Fruit Agreement
2007 Annual Research Report




Table 2: ANOVA of the mean lesion size of reaction classes and fruit types among peach and
nectarine cultivars inoculated with brown rot
Inoculation            Group*          No. of cultivars Mean Lesion Size       P
Nonwounded             Yellow          56               3.29
                       White           25               5.32                   0.01

                                  Peaches        49        4.35
                                  Nectarines     32        3.26               NS

                                  Fresh Market   75        3.95
                                  Processing     6         3.53               NS

                                  HR             12        0.04
                                  MR             18        1.16
                                  MS             30        3.65
                                  HS             15        7.68
                                  VHS            6         11.91              0.001

Wounded                           Yellow         55        12.40
                                  White          25        12.61              NS

                                  Peaches        48        13.48
                                  Nectarines     32        10.94              0.03

                                  Fresh Market   75        12.32
                                  Processing     5         14.72              NS

                     HR              12                6.99
                     MR              18                11.82
                     MS              30                12.62
                     HS              14                15.13
                     VHS             6                 18.39                0.001
* HR = highly resistant, MR = medium resistance, MS = medium susceptible, HS = highly
susceptible, VHS = very highly susceptible




                                                      78
California Tree Fruit Agreement
2007 Annual Research Report




TESTING LOW HYDROSTATIC PRESSURE
(LHP) TECHNOLOGY FOR APPLICATIONS OF
INTEREST TO THE CALIFORNIA TREE FRUIT
INDUSTRY
PROJECT LEADER:                   Dr. Carlos Crisosto

COOPERATORS:                      Gayle Crisosto and Antonio Torres


FINAL COMMENTS

From this test, we concluded that low hydrostatic pressure (LHP) treatment of fresh peaches,
nectarines, and plums is not a viable option as a fruit disinfestation alternative to methyl bromide
due to the extensive damage to the fruit both immediately after treatment and after ripening.

ABSTRACT

The main goal of this project was to provide the tree fruit industry in California with a fruit
disinfestation alternative that is acceptable to consumers, industry and regulatory agencies, equal
to or more effective than current treatments (chemical, irradiation and hydrothermal
technologies), meets consumer expectations and has minimum impact on fresh and dried fruit
quality. The objective of this project was to examine the effect of LHP treatments on the quality
of fresh peaches, nectarines, and plums. The proposed low hydrostatic pressure (LHP)
technology effectiveness reflects independence from fruit size and geometry because pressure
transmission into fruits is essentially instantaneous. Egg and larvae inactivation has been
reported for short-time LHP applications.

Fresh fruit, a yellow flesh, clingstone nectarine, a white flesh, freestone peach and a dark plum
were tested. LHP treatments tested were 20,000 and 30,000 psi (138 MPa and 207 Mpa) for 0, 1,
3, and 10 min. and controls (KAC, and to OSU and back to KAC). The treatments were carried
out using a 22 liter high hydrostatic pressure vessel capable of reaching 85,000 psi (590 MPa or
5,800 atmospheres) located at the Oregon State University (OSU) Food Processing Pilot Plant.
The treatments were applied to both naked and bagged fruit.

Fresh fruit visually evaluated after treatment showed various types of damage from all LHP
treatment pressure-time combinations. Cracking of the skin on the peaches and nectarines, and
pitting and tiny bumps on the plums were visible on naked and bagged fruit.




                                                 79
California Tree Fruit Agreement
2007 Annual Research Report




For the peaches, after 3 days of ripening, nearly all of the fruit from all of the LHP treatments
were visually unacceptable showing external damage of cracked skin, discoloration and water
soaked areas. Internal damage included water soaked flesh and brown pit cavity. For the
nectarines, after 3 days of ripening, nearly all of the fruit from all of the LHP treatments were
visually unacceptable showing external damage of cracked skin, discoloration, pitting and water
soaked areas. Internal damage included water soaked flesh, brown flesh and brown pit cavity.
For the plums, after 3 days of ripening, nearly all of the fruit from all of the LHP treatments were
visually unacceptable showing external damage of leaking juice, hairline cracks, staining and
pitting. Internal damage included translucent flesh, brown flesh and brown pit cavity.

From this test, we concluded that LHP treatment of fresh peaches, nectarines, and plums is not a
viable option as a fruit disinfestation alternative due to the extensive damage to the fruit both
immediately after treatment and after ripening.

INTRODUCTION

Chemical disinfestation treatments of fruits are not well accepted by consumers and regulatory
agencies because they add potential residue risks to our diets and their use may have an
environmental impact. For example, methyl bromide (MeBr), an odorless and colorless gas has
been used as an agricultural fumigant to control a wide variety of pests. However, because MeBr
depletes the stratospheric ozone layer, the amount of MeBr produced and imported in the U.S.
was to be reduced until its January 1, 2005 phase-out. Exemptions from this phase-out decision
include quarantine treatments when no technically or economically feasible alternative is
available. In 2005, the available MeBr inventory in the USA reached a 40% reduction with
respect to 2003 levels demonstrating the need to find an alternative for its use in fruit treatments.

A recently proposed alternative is the so-called metabolic stress disinfestation (Lagunas-Solar et
al., 2006). Inside sealed chambers, fruits are subjected to alternating vacuum and pressurized
carbon dioxide with ethanol gas applied briefly to further damage insect eggs. Unfortunately,
effective and reproducible treatment applications require 2–3 h at room and 3–4 h at refrigeration
temperature. In addition, the ability of the treatment to inactivate eggs and larvae will depend on
the ability of carbon dioxide and ethanol gas to reach their location within the fruit.

A low hydrostatic pressure (LHP) technology has been proposed as a disinfestation alternative
(Butz and Tauscher, 1995). Butz and Tauscher found no Mediterranean fruit fly (Ceratitis
capitata) survivors when treated at pressures above 18,000 psi (125 MPa) and that inactivation at
these pressures was independent of treatment time and temperature.

LHP offers short-time treatments (few minutes) and since pressure is almost instantaneously the
same for the entire fruit, the treatment effectiveness should be the same independent of the egg
and larvae location within the fruit. A further and critical advantage from a technology transfer
point of view is LHP technology effectiveness independent from size and geometry factors for
the fruit and the pressure vessel. Therefore, LHP conditions found to be effective using research
pressure vessels for process demonstration purposes can be used commercially with minimum
need for scale-up research. Finally, high pressure processing (HPP) units are an export
opportunity that benefits the USA as it has become a world leader in this technology. Current
worldwide HPP applications include pasteurization of juices, fresh cut fruits, sliced processed


                                                 80
California Tree Fruit Agreement
2007 Annual Research Report




meats, beverages, oyster shucking, ready-to-eat dishes and many other foods. It should be noted
that these HPP applications use ~ five times higher levels of hydrostatic pressure as the one
needed for the proposed LHP disinfestation of fresh fruits. Thus, Hydrostatic Pressure
Technology (LHP) is a novel non-thermal and non-chemical technology that needs to be tested
for California crops.

OBJECTIVE

     •    Evaluate the quality of fresh peaches, nectarines, and plums subjected to LHP treatments
          immediately after treatment and after ripening.

PROCEDURES

Fruit samples were transported in a refrigerated vehicle to Corvallis, OR to use a 22 liter high
hydrostatic pressure vessel capable of reaching 85,000 psi (590 MPa or 5,800 atmospheres)
located at the Oregon State University Food Processing Pilot Plant (Fig. 1).

LHP treatments tested were: 20,000 and 30,000 psi (138 MPa and 207 MPa) for 0, 1, 3 and 10
min. Controls (untreated KAC, and untreated to OSU and back to KAC) and LHP-treated fruit
were transported back to the Kearney Agricultural Center where fruit and quality was assessed
after 3 days of ripening. A set of untreated fruit was left at KAC as a control for transportation.
LHP treatments were conducted in a randomized manner and replicated three times to assess
treatment variability.

For the fresh fruit, one peach (freestone, white flesh), one nectarine (clingstone, yellow flesh),
and one plum (red color plum) were picked at CA well matureD. Four fruit per replication
(experimental unit) were used. Bagged fruit were prepared as follows. The four fruit of an
experimental unit were placed in a vacuum bag (Fig. 2). The air was evacuated and the bag was
double sealed immediately before treatment using a Fuji Impulse Vacuum Sealer (Deerfield, IL).
Fresh fruit, both naked and bagged from the same treatment-rep were placed in the pressure
vessel sample bag, the sample bag was filled with water and the air was squeezed out of the
sample bag (Fig. 3). Next, the sample bag was lowered into the vessel on a hoist, the pressure
vessel was sealed and the treatment was applied. Immediately after treatment, the tested fruit
were removed from the sample bag, placed in labeled panta paks for immediate visual fruit
quality evaluation and digital photographs and subsequent transport back to KAC for visual fruit
quality evaluation after ripening.

RESULTS

Both naked and bagged fresh fruit, regardless of the LHP treatment pressure – time combination
showed severe cracking of the skin on the peaches (Fig. 4) and nectarines (Fig. 5) and tiny
bumps and pits on the skin of the plums (Fig. 6) immediately after treatment.

After ripening for 3 days, both the peaches and the nectarines exhibited external damage of skin
cracking and pitting, skin discoloration and breakdown of the skin. Internal damage consisted of
flesh browning and translucency (Fig. 7, 8).



                                                 81
California Tree Fruit Agreement
2007 Annual Research Report




After 3 days of ripening, the plums exhibited external damage of severe pitting of the skin, juice
leakage through the skin, cracking of the skin and skin discoloration. Internal damage consisted
of flesh browning and translucency (Fig. 9).

PRELIMINARY CONCLUSIONS

From this test, we concluded that LHP treatment, naked and vacuum sealed, of fresh peaches,
nectarines, and plums is not a viable option as a fruit disinfestation alternative due to the
extensive damage to the fruit both immediately after treatment and after ripening at the tested
pressure – time combinations.

PROJECT STATUS

This was the first year of a one-year project.

REFERENCES

Butz, P., and B. Tauscher. 1995. Inactivation of fruit fly eggs by high pressure treatment. Journal
of Food Processing & Preservation. 19(3): 161–164.

Lagunas-Solar, Manuel C., Timothy K. Essert, Cecilia Piña U., Nolan X. Zeng and Tin D.
Truong. 2006. Metabolic stress disinfection and disinfestation (MSDD): a new, non-thermal,
residue-free process for fresh agricultural products. J Sci Food Agric 86: 1814–1825.

Torres, J. Antonio and Gonzalo Velazquez. 2005. Commercial opportunities and research
challenges in the high pressure processing of foods. Journal of Food Engineering 67: 95–112.




                                                 82
California Tree Fruit Agreement
2007 Annual Research Report




Fig. 1. Twenty-two liter high hydrostatic pressure vessel.




Fig. 2. Filling pressure vessel sample bag with water.




                                                83
California Tree Fruit Agreement
2007 Annual Research Report




Fig. 3. Fruit samples in vacuum sealed bags.




Fig. 4. Skin cracking on peaches immediately after pressure treatment.




                                               84
California Tree Fruit Agreement
2007 Annual Research Report




Fig. 5. Skin cracking on nectarines immediately after pressure treatment.




Fig. 6. Pitting and bumps on plums immediately after pressure treatment.




                                               85
California Tree Fruit Agreement
2007 Annual Research Report




Fig. 7. Flesh browning and translucency on pressure treated peaches after 3 days ripening.




Fig. 8. Flesh browning and translucency on pressure treated nectarines after 3 days ripening.




                                               86
California Tree Fruit Agreement
2007 Annual Research Report




Fig. 9. Flesh browning and translucency on pressure treated plums after 3 days ripening.




                                               87
California Tree Fruit Agreement
2007 Annual Research Report




PEACH AND NECTARINE
CORKING
PROJECT LEADER:                   Kevin R. Day

COOPERATORS:                      Dr. R. Scott Johnson and Dr. Carlos Crisosto

ABSTRACT

Three trials were carried out in 2007. In the first, “Summer Fire” nectarines at Kearney were
subjected to the same treatments as in 2006. These included high and low nitrogen regimes; low
and heavy crop loads; and no summer pruning or severe summer pruning 45-60 days prior to
harvest. Fruit were harvested and kept in cold storage for about 15 days before being peeled and
evaluated for corking incidence. The incidence of corking in this block was low, but the results
can be explained within the hypothesis that vigorous growth and cool springs are the key to
producing corking. In the absence of either, the amount of corking is reduced or eliminated. As
in past year’s, there was no progression of the disorder during storage.

In the second trial, fruit from additional “Summer Fire” trees were dipped in calcium solutions 5
times at approximately weekly intervals beginning at bloom to determine if fruit calcium
concentrations can be effectively raised. The leaves and fruits from these treatments are still
being analyzed at the UC Davis analytical laboratory. The results from this trial will be
published in next year’s CTFA Research Reports and no further discussion of this project occurs
in this report.

In the third trial, a block of “August Fire” nectarines with a history of severe corking was heavily
summer pruned at 12, 8, and 4-week intervals before harvest. A 50-fruit sample was collected
from each treatment just prior to harvest and there was no corking in any of the treatments so no
formal harvest data was collected.

The relative lack of corking during this past season can likely be explained by the warm spring
temperatures experienced in March/April of 2007.

INTRODUCTION

Fruit corking has been a troublesome malady affecting peaches and nectarines for more than a
decade. When corking occurs, it can cause tremendous fruit loss – often 30 to 50% or more. It
is made worse by its seeming “progression” in storage after harvest.

Our prior CTFA funded research in 2003 established that corking is worst in seasons with cool,
wet springs; under high vigor situations, and on trees that are lightly cropped. In that study we



                                                 88
California Tree Fruit Agreement
2007 Annual Research Report




collected leaf samples from orchards displaying various degrees of corking and found that there
was no consistent relationship between orchard nutrient status and expression of corking;
however, corked fruit had a higher concentration of total nitrogen (1.15-1.42%) than did fruit
displaying no corking (0.88-0.91% total N).

Because corking is associated with cold post-bloom temperatures, the 2006 and 2007 growing
seasons provided us an opportunity to better examine this issue. Developmental temperatures in
March 2006 were the coldest they have been in the past 25 years, but March 2007 was amongst
the warmest (Figure 1). To that end, we designed an experiment to investigate the role of crop
load, tree vigor, summer pruning, and their interactions on corking incidence.

Summer Fire Nutrition, Vigor, and Crop Load Trial
This trial was performed in a mature block of Summer Fire nectarine trees growing at the
Kearney Ag Center. Our objectives were to determine the effect of the following, and their
interactions, on corking severity: 1) tree nitrogen status, 2) crop load, and 3) summer pruning.
Four single tree replicates were used. Trees were stripped of fruit on July 24 – about mid-way
between the 2nd and 3rd harvests. Fruits were initially evaluated for external corking occurrence
and then placed into cold storage at 34 F. Final fruit evaluation was performed on August 8.
Leaf and fruit samples were collected from each tree for nutritional analysis.

Treatment Summary and Explanation
   • Summer Pruning – Selected trees were heavily summer pruned on June 1 by removing
      most of the new extension growth using thinning cuts – no heading cuts that could
      stimulate new growth were used. The hypothesis here was that by reducing vigor,
      corking incidence would be suppressed.
   • Nitrogen Fertilization – Since vigorously growing trees are reported to have more
      corking, 300 pounds nitrogen per acre was applied to selected trees in mid-April to try to
      induce corking.
   • Crop Load – Large fruit size and light crops are associated with corking incidence, to
      duplicate this, selected trees were thinned to normal crop loads and light crop loads.
      Note that 2006 was a light setting year so in most instances the “normal” crop received
      little, if any, thinning; while the “light” crop trees were thinned additionally.

Fruit Evaluation
Fruit were scanned visually and rated on a 0-5 scale for corking severity, with each category
representing approximately 20% occurrence intervals. For example, a fruit with a rating of ‘0’
had no corking, while a fruit with a ‘3’ had about 60% of its surface or flesh affected. The initial
evaluation only rated external symptoms. During the second evaluation, all fruits were rated for
external symptoms and then were peeled so that initial symptoms could be observed and rated.

RESULTS

Internal corking incidence is shown in table 1. Both crop load and nitrogen status had an effect
on incidence of corking, but summer pruning failed to reduce corking. These are virtually exact
opposites of the results obtained in 2006, but make sense within the physiological hypothesis of
corking as discussed below.



                                                 89
California Tree Fruit Agreement
2007 Annual Research Report




Timing of Summer Pruning to Reduce Corking Trial
In both 2003 and 2006, we observed the beneficial effect for summer pruning on reducing the
incidence of corking. In both these years, the trees were pruned approximately 45-50 days prior
to harvest. However, we still do not know if the is the best timing for performing this activity.

To help answer this question, a trial was performed on a block of mature August Fire nectarines
with a history of severe corking, and growing in the Sultana area. Trees were heavily summer
pruned during the fruit developmental period at approximately 12, 8, and 4-weeks before harvest,
and compared to non-summer pruned trees. Fruit were monitored during the season for
expression of corking and a 50-fruit sample was collected from each tree at commercial harvest
to evaluate for corking. There was no corking in any of the treatments so no additional formal
harvest data was collected.

DISCUSSION

Our basic premise of the cause of corking is that it occurs because of competition for available
resources between developing fruits and growing shoots. Anything that tips the balance toward
vigor increases the likelihood of corking. Conversely, anything that reduces vigor reduced the
propensity for corking. In cold springs, shoot growth is favored over fruit growth rate and so the
potential for corking increases. Likewise, vigorously growing trees will be more prone to
corking than those that are less vigorous.

In 2006, summer pruning was effective at reducing corking because the record-cold spring
caused fruit to be predisposed to corking. By reducing the vigor of the tree, corking incidence
was also reduced.

In 2007, summer pruning failed to provide any benefit, because the warm spring temperatures
helped protect fruit from corking by increasing the sink strength of the fruit and preventing them
corking. Consequently, the two treatments we suspect of being potentially able to induce
corking – by stimulating the vegetative growth component of the equation – reduced crop load
and high nitrogen status, were effective in inducing corking even in a year in which corking
incidence was otherwise low.
Of the options that are commonly available to growers, proper management offers the greatest
possibility of reducing corking expression in orchards. As such, on those varieties and blocks
known to have a history of, or problems with corking, growers should avoid stimulating
excessive vigor through heavy pruning, excessive thinning, or heavy nitrogen fertilization. Most
importantly, in seasons in which March and April temperatures are significantly cooler than
normal, trees should probably be summer pruned heavily sometime in May to early June. Note
that in our trials, this is drastically earlier than the traditional timing of summer pruning
commonly practiced in this area and that even earlier summer pruning might have been more
beneficial.




                                                90
California Tree Fruit Agreement
2007 Annual Research Report




Table 1. Categorical incidence of severe internal corking in 2007, Summer Fire nectarine.

Factor                                          Corking Incidence (%)
Crop Load (*)
   Normal Crop                                                      9%
   Light Crop                                                      19%
Nitrogen Status (*)
   Normal N (~75 lbs/ac)                                            5%
   High N (~300 lbs/ac)                                            22%
Summer Pruning (n.s.)
   Performed                                                       11%
   None                                                            17%
* Indicates differences are significant at the 5% level.


Figure 1. Annual growing degree-day temperatures in March using 45 F as cutoff. Horizontal
line is the 27-year average.

                                         March Temperatures

                  600

                  500
    Degree Days




                  400

                  300

                  200

                  100

                   0
                        1982      1986     1990    1994   1998       2002      2006




                                                    91
California Tree Fruit Agreement
2007 Annual Research Report




     DEVELOPING PEDESTRIAN
     ORCHARD SYSTEMS
     PROJECT LEADER:               Kevin R. Day

     COOPERATORS:                  Dr. T.M. DeJong and Dr. R. Scott Johnson


     Economic pressures are forcing growers to reevaluate all farming practices. For
     production practices, labor costs dominate all others. Over the past few years, much has
     been learned about the relationship between tree height, production potential, and labor
     cost savings. Both dwarfing and standard rootstocks have been studied, but never within
     a comparison as part of an overall system.

     Furthermore, while we have demonstrated that orchard height can be significantly and
     successfully reduced, even while using vigorous rootstocks such as Nemaguard, we still
     do not know if a true pedestrian orchard, i.e. one in which no ladders are at all necessary,
     is economically feasible over the long-term.

     To understand these issues better, we have begun several trials that will explore the
     relationships between tree from, orchard density and rootstock vigor. Our overall goal
     will be to maintain tree height at about 7-8’ thus establishing a pedestrian orchard.
     Within those constraints we will investigate how successful and how suitable such a
     strategy is.

     METHODS

     Trial 1: “Owen T” Plum
     In March 2007 a block of “Owen T” plums growing on the semi-dwarfing rootstock
     Citation (about 75-80% of the vigor of Nemaguard) were planted at Kearney. Two row
     spacings/tree height configurations are used: 1) standard 18 foot wide rows in which the
     trees will be grown to standard height (12-14 feet tall); and 2) 15 foot wide rows in which
     the tree will be kept at a pedestrian height (7-9 feet tall). Tree conformation within each
     includes three training systems: 1) 6-leader Hex-V trees, 2) 4-leader Quad-V trees, and 3)
     2-leader Kearney V trees planted at 12, 8, and 4 feet apart respectively. This design will
     allow us to make comparisons between tree height, tree density, and per acre scaffold
     count, (table1). Trees are growing well and are anticipated to bloom and produce some
     crop in 2008.




                                                  92
California Tree Fruit Agreement
2007 Annual Research Report




     Table 1. Per acre tree and scaffold counts for “Owen T” plums on “Citation” rootstock,
     growing at differing densities and conformations and planted at the Kearney Ag Center in
     March 2007.
     Row           Tree Form        Trees/acre                   Scaffolds/acre
     Spacing                                 15’ row          18’ row     15’ row     18’ row
     4’                  Kearney-V           726              605         1452        1212
     8’                  Quad-V              363              303         1452        1212
     12’                 Hex-V               242              202         1452        1212


     Trial 2: “Springcrest”/“O’Henry” Height and Rootstock Comparison
     In order to derive yield data in 2008 an established block of five year old “Springcrest”
     and “O’Henry” peaches was differentially topped in the fall of 2007 prior to dormant
     pruning. One-half of the orchard was topped at 8’ and the other at 10’. The shorter trees
     were topped even lower during dormant pruning – i.e. approximately 7-8’ – with the
     primary purpose of making them into true pedestrian trees. Within each height, there are
     four rootstocks, Nemaguard, UC Controller 9, Hiawatha, and UC Controller 5 (listed
     from greatest to lowest vigor). This block will allow us to compare yield, fruit quality,
     and tree response across inherent vigor potential to limited/restricted tree height. This
     block is large enough that we will also be able to gain experience with the horticultural
     procedures such as summer pruning and light management, which are needed to manage
     pedestrian orchards.

     Trial 3: Tree Form and Rootstock
     An orchard block is being established at the Kearney Agricultural Center. In 2006, the
     low-volume microsprinkler irrigation system was installed. Trees were scheduled to be
     planted in 2006 but due to poor rooting percentage in the nursery insufficient trees were
     available. Potted trees are now growing at Burchell Nursery for planting in the spring of
     2008. Two varieties will be used, Spring Flame 22, an early, vigorous peach and
     Summer Flare® 28, a late-season, heavy-bearing nectarine, and they will be planted to
     the following systems.

     Rootstock                    Spacing              Density          Scaffolds   Form
                                                       (tree/acre)      per acre
     Nemaguard                    12’x16’              227              1362        6-leader Hex V
                                                                                    - tall
     Nemaguard                    12’x16’              227              1362        6-leader Hex V
     UC Controller 9              12’x16’              227              1362        6-leader Hex V
     UC Controller 9              7’ x 14’             445              1780        4-leader Quad
                                                                                    V
     UC Controller 5              7’ x 14’             445              1780        4-leader Quad
                                                                                    V
     UC Controller 5              5’ x 14’             622              1244        2-Leader
                                                                                    Kearney V




                                                             93
California Tree Fruit Agreement
2007 Annual Research Report




     All trees will be kept at a height of 7-9 feet with the exception of treatment #1, which will
     be allowed to grow to an industry standard of 12-13 feet. Trees will be planted in non-
     replicated demonstration blocks that are four rows wide and 10 trees long.




                                                  94
California Tree Fruit Agreement
2007 Annual Research Report




EVALUATION OF SIZE CONTROLLING
ROOTSTOCKS FOR CALIFORNIA PEACH
PRODUCTION
PROJECT LEADER:                   Dr. T.M. DeJong

COOPERATORS:                      Dr. R.S. Johnson and Dr. D. Ramming


Over half of the annual production costs for California peaches involve hand labor for pruning,
thinning and harvesting which is done on ladders because of the large size of trees. It is widely
recognized that production costs could be substantially reduced if the size of the trees could be
reduced enough to eliminate the need for ladders in the orchard. The benefit of size-controlling
rootstocks has been clearly demonstrated in apples and revolutionized the apple industries in Europe
and the U.S.

The primary factor limiting the use of size controlling rootstocks in stone fruit production is the lack
of commercial availability of suitable size-controlling rootstocks with a wide range of compatibility
among cultivars. From 1986 to 1994 we evaluated 80+ genotypes representing a broad range of
genetic backgrounds for their rooting capacity, compatibility with peach (O’Henry) and plum (Santa
Rosa), and size controlling characteristics. During 1990 and 1991 in the peach part of this project,
we identified 19 potential size controlling rootstock genotypes. In 1993, we selected 8 of the 19 for
further testing in a second round of experiments. Most of these sixth leaf trees were 50-80% of the
size of trees grown on standard rootstocks. In 1994 we began the current project to further evaluate
these eight selected rootstocks in replicated field production trials with Flavorcrest and Loadel scion
cultivars. In February, 1996, a four-acre experimental rootstock trial was planted at the Kearney
Agricultural Center to evaluate the commercial potential of these rootstocks. The main part of this
experiment involved ten different rootstocks and two scions. The ten rootstocks were: Alace,
Hiawatha, Sapalta (open pollinated seedlings of a Prunus besseyi x P. salicina hybrid), K-145-5, K-
146-43, K-146-44, P-30-135, (P. salicina x P. Persica hybrids) K-119-50 (P salicina x P. dulcis
hybrid), Citation and Nemaguard. The two main scion cultivars are Loadel (an early clingstone
processing cultivar) and Flavorcrest (an early fresh market freestone cultivar). The trial contained
thirty-six trees of each rootstock/scion combination. Four replications of 5 trees each were planted
and trained to the KAC-V perpendicular V system, and 4 replications of 4 trees each were planted
and trained to the standard open vase system. In row tree spacings for each rootstock/scion/training
system combination varied according to expectations of final tree size.

A secondary part of this experiment involves up to two trees of each of the eight experimental
rootstocks budded with the following scion cultivars: Firebrite, Flamekist, Juneglo, Mayglo, Rose,




                                                   95
California Tree Fruit Agreement
2007 Annual Research Report




Sparking June, Carson, Haig Arkalian, Cal Red, Carnival, Elegant Lady, Fay Elberta, Queencrest,
Red Top, Spring Lady, Snow Flame, Giant Babcock, and Ross. The cultivars were chosen to
represent a broad range of genetic backgrounds to test for scion compatibility and growth
characteristics on the various rootstocks. These trees were all planted with four feet between trees in
the row and were trained to KAC-perpendicular V system. They are on the margins of the plot and
can be removed when compatibility studies are complete without compromising the integrity of the
main plot.

Trees on six of the ten rootstocks have grown well during twelve seasons with size-controlling
characteristics of five of the rootstock/scion combinations clearly apparent. Four rootstocks in the
trial (Citation, Alace, Sapalta, K145-5) showed clear signs of scion/rootstock incompatibility with
both the Loadel and Flavorcrest scions. These incompatibilities caused tree death during 1998 and
1999 in each rootstock/scion combination and consequently trees on these rootstocks were removed
from the plot in 2001.

The best indicator of differences in relative tree size among the various scion/rootstock combinations
compared to Nemaguard is the data on trunk circumferences. Trees in each of the 4 or 5 tree
replicate subplots were measured after the growing season. Data from December, 2007, are provided
in Table 1. Trees on all five of the remaining size-controlling rootstocks had mean trunk
circumferences that were smaller than trees on Nemaguard. However, trees on P-30-135 were not
significantly different than trees on Nemaguard. Trees on K-119-50, Hiawatha, K-146-43 and K-
146-44 were all clearly smaller than trees on Nemaguard.

Prior to the summer of 2003 all of the trees were allowed to attain a tree height that appeared to be in
balance with the relative vigor of the rootstocks. Thus, by 2003 post-dormant season pruning heights
of trees on the most vigorous trees (Nemaguard, K119-50, P30-135) approached more that fourteen
feet. Since the real value of size-controlling rootstocks is foreseen to be in their ability to help
manage tree height, in September, 2003, the management strategy was changed and the trees were
severely topped at 11 ft. This topping was repeated in September, 2004. To further test the response
of the trees on the different rootstocks one-half of the replications of each scion/rootstock/training
system replication was topped to 8 ft. in September 2005. This treatment was continued in the fall
of 2006. Table 2 indicates the mass of wood that was removed from the trees during the summer in
the first full growing season after one-half of the trees had been topped at 8 feet. Table 3 indicates
the mass of wood pruned off in the dormant season after the first full growth season after topping.
Note the large differences among trees on different rootstocks. There was also a clear tendency for
trees topped to a lower height to need more summer and dormant pruning than the taller trees (see
the combined pruning weights in Table 4). This was particularly true for the trees on the more
vigorous rootstocks and is a clear demonstration of why it is not possible to efficiently lower tree
heights only by severe pruning without the use of a size-controlling rootstock. Clearly there is a
pruning advantage to using size-controlling rootstocks if a grower is interested in developing an
orchard management strategy that involves arbitrarily limiting tree height to less than 11 ft.
Dormant pruning weights of trees topped to 8 feet also reflected large differences in tree vigor due to
rootstock but the differences among trees on different rootstocks were not as great for trees topped at
11 feet (Tables 3 and 4).




                                                   96
California Tree Fruit Agreement
2007 Annual Research Report




In 2007 we attempted to adjust crop loads on all the trees of a particular system (scion cultivar and
pruning system) to similar levels regardless of rootstock and tree height. Crop loads/tree in the
KAC-V (Table 5) were much lower that the open vase (Table 6) system. Although there was
substantial variation among treatments in many cases crop loads and yields were similar across
rootstocks and tree heights for a given system but fruit size on the more size-controlling rootstocks
was generally smaller than on the vigorous rootstocks, especially as crop weight per unit trunk cross
sectional area increased. In most cases there was no problem in keeping crop loads in the shorter
trees as high as in the taller trees. However, interestingly fruit size on the trees topped at 8 feet
tended to be larger than fruit on trees topped at 11 feet when crop loads were similar for a given
rootstock/scion/training system combination. Cropping efficiency (crop weight /trunk cross
sectional area) was always higher in trees on the more size controlling rootstocks within a given
scion cultivar and training system combination.

This project clearly shows the potential of size-controlling rootstocks to be used in conjunction with
tree topping to maintain the height of trees so that virtually all horticultural operations (pruning, fruit
thinning, and harvest) can be conducted from the ground or on very short ladders. However tree
planting densities would have to be greater than used in this trial to maintain crop yields comparable
to standard, tall orchards. Also since there is the tendency for trees on the most size-controlling
rootstocks to produce smaller fruit compared to trees on more vigorous rootstocks it is recommended
that growers use the new size-controlling rootstocks (like Controller 5 aka K146-43) only in
conjunction with scion cultivars that have a propensity to produce large fruit.




                                                    97
California Tree Fruit Agreement
2007 Annual Research Report




  Table 1: Trunk circumferences (cm) of Flavorcrest and Loadel scion cultivars on six
  rootstocks and two training systems at the end of the twelfth growing season (December,
  2007). Values represent the mean (± SE) of measurements of the four replications in the high
  density “KAC-V” and standard density “open vase” parts of the trial.


                                              LOADEL                FLAVORCREST
       ROOTSTOCK
                                  Open Vase            KAC-V   Open Vase          KAC-V

    Nemaguard                     78.1±0.68        54.6±0.96   90.2±1.97         62.6±1.17
    K-119-50                      64.1±1.06        46.3±1.58   73.9±3.07         51.7±1.70
    P-30-135                      72.2±2.11        52.6±2.21   86.3±2.59         63.4±3.75
    Hiawatha                      63.0±1.28        45.8±1.34   68.7±2.24         49.4±2.31
    K-146-43                      53.0±0.36        38.1±1.69   61.7±1.18         41.6±0.39
    K-146-44                      53.2±2.61        52.6±0.93   65.3±1.15         45.8±0.47




                                                          98
California Tree Fruit Agreement
2007 Annual Research Report




  Table 2: Summer pruning weights (kg/tree) of the Flavorcrest and Loadel scion cultivars on
  six different rootstocks and two training systems and two topping treatments during the
  eleventh season of growth in the field (Flavorcrest June 27, 2006 and Loadel July 12, 2006).
   The 8 foot topping treatment was imposed during the previous September.


                                              LOADEL                  FLAVORCREST
     ROOTSTOCK
                            Topping
                                        Open Vase    KAC-V      Open Vase        KAC-V
                           Treatment
                           Topped 11’     1.63           0.78      1.03            1.10
     Nemaguard
                           Topped 8’      14.54          6.46      5.00            3.89
                           Topped 11’     0.93           0.82      0.30            0.42
       K-119-50
                           Topped 8’      4.88           3.70      3.14            2.42
                           Topped 11’     0.23           0.59      0.44            0.37
       P-30-135
                           Topped 8’      5.54           3.38      2.41            0.98
                           Topped 11’     0.49           0.30      0.69            0.16
       Hiawatha
                           Topped 8’      3.94           2.77      1.69            1.23
                           Topped 11’     0.54           0.24      0.25            0.18
       K-146-43
                           Topped 8’      1.65           1.57      0.96            1.30
                           Topped 11’     0.28           0.35      0.40            0.14
       K-146-44
                           Topped 8’      3.40           2.17      2.53            1.80




                                                    99
California Tree Fruit Agreement
2007 Annual Research Report




  Table 3: Dormant pruning weights (kg/tree) of the Flavorcrest and Loadel scion cultivars on
  six different rootstocks and two training systems and two topping treatments after the
  eleventh season of growth in the field (January, 2007). This was the first regular dormant
  pruning after half of the trees had been topped to 8 feet.


                                              LOADEL                 FLAVORCREST
     ROOTSTOCK
                            Topping
                                        Open Vase    KAC-V       Open Vase      KAC-V
                           Treatment
                           Topped 11’     8.65            4.99     9.70           4.96
     Nemaguard
                           Topped 8’      13.06           5.60     13.59          7.94
                           Topped 11’     6.63            3.84     6.37           3.11
       K-119-50
                           Topped 8’      6.40            3.33     11.37          6.68
                           Topped 11’     4.99            3.22     6.09           4.32
       P-30-135
                           Topped 8’      7.38            3.96     8.31           6.84
                           Topped 11’     4.65            3.19     5.39           2.60
       Hiawatha
                           Topped 8’      5.91            2.82     8.84           4.55
                           Topped 11’     5.28            2.71     5.88           3.02
       K-146-43
                           Topped 8’      5.52            2.28     6.20           3.94
                           Topped 11’     4.05            2.93     6.63           3.84
       K-146-44
                           Topped 8’      5.49            2.67     8.65           5.04




                                                    100
California Tree Fruit Agreement
2007 Annual Research Report




  Table 4: Combined 2006 summer and 2007 winter (January) dormant pruning weights
  (kg/tree) of the Flavorcrest and Loadel scion cultivars on six different rootstocks and two
  training systems and two topping treatments.


                                              LOADEL                  FLAVORCREST
     ROOTSTOCK
                            Topping
                                        Open Vase    KAC-V        Open Vase     KAC-V
                           Treatment
                           Topped 11’     10.28           5.77      10.73        6.06
     Nemaguard
                           Topped 8’      27.60           12.06     18.59        11.83
                           Topped 11’     7.56            4.66      6.67         3.53
       K-119-50
                           Topped 8’      11.28           7.03      14.51        9.10
                           Topped 11’     5.22            3.81      6.53         4.69
       P-30-135
                           Topped 8’      12.92           7.34      10.72        7.82
                           Topped 11’     5.14            3.49      6.08         2.76
       Hiawatha
                           Topped 8’      9.85            5.59      10.53        5.78
                           Topped 11’     5.82            2.95      6.13         3.20
       K-146-43
                           Topped 8’      7.17            3.85      7.16         5.24
                           Topped 11’     4.33            3.26      7.03         3.98
       K-146-44
                           Topped 8’      8.89            4.84      11.18        6.84




                                                    101
California Tree Fruit Agreement
2007 Annual Research Report




  Table 5. Fruit harvest data for the KAC-V Loadel and Flavorcrest trees on six different rootstocks and two topping treatments in
  2007. (TCA is trunk cross sectional area)

                                                                                           KAC-V

                                                            LOADEL                                               FLAVORCREST
    ROOTSTOCK
                                        Mean crop                    Mean crop         Fruit     Mean Crop     Mean fruit    Mean crop         Fruit
                             Topping                  Mean fruit
                                        weight/tree                     load        weight/TCA   weight/tree    weight          load        weight/TCA
                            Treatment                 weight (gm)
                                           (kg)                     (#fruit/tree)    (kg/cm2)       (kg)         (gm)       (#fruit/tree)    (kg/cm2)

                          Not topped       59.8         156.0          384            0.25         43.5         138.8          314            0.14
   Nemaguard
                          Topped 8’       58.1          142.2          409            0.24         47.5         132.2          359            0.15
                          Not topped       58.5         166.6          351            0.34         41.0         126.8          323            0.19
   K-119-50
                          Topped 8’       63.4          125.5          505            0.37         44.8         134.4          333            0.21
                          Not topped       55.2         146.0          378            0.25         45.9         124.6          369            0.14
   P-30-135
                          Topped 8’       57.9          132.0          437            0.26         40.6         128.4          317            0.13
                          Not topped       51.6         146.7          352            0.31         29.6         129.5          228            0.15
   Hiawatha
                          Topped 8’       52.0          129.8          400            0.31         37.4         126.4          296            0.19
                          Not topped       41.6         136.2          305            0.36         42.5         117.8          360            0.31
   K-146-43
                          Topped 8’       47.7          110.6          432            0.41         39.5         111.7          354            0.28
                          Not topped       50.8         142.0          358            0.37         39.7         121.5          326            0.24
   K-146-44
                          Topped 8’       55.84         127.4          438            0.41         38.7         127.3          304            0.23




                                                                            102
California Tree Fruit Agreement
2007 Annual Research Report




  Table 6: Fruit harvest data (±SE) for the open vase Loadel and Flavorcrest trees on six different rootstocks and two topping treatments
  in 2007. (TCA is trunk cross sectional area)


                                                                                        OPEN VASE

                                                            LOADEL                                               FLAVORCREST
    ROOTSTOCK
                                        Mean crop                    Mean crop         Fruit     Mean Crop     Mean fruit    Mean crop         Fruit
                             Topping                  Mean fruit
                                        weight/tree                     load        weight/TCA   weight/tree    weight          load        weight/TCA
                            Treatment                 weight (gm)
                                           (kg)                     (#fruit/tree)    (kg/cm2)       (kg)         (gm)       (#fruit/tree)    (kg/cm2)

                          Not topped      117.9         148.4          795            0.24         88.4         143.9          614            0.14
   Nemaguard
                          Topped 8’       88.7          175.2          506            0.18         78.2         146.6          534            0.12
                          Not topped       97.5         147.2          662            0.30         80.0         129.6          617            0.18
   K-119-50
                          Topped 8’       108.3         147.2          735            0.33         86.4         126.4          684            0.20
                          Not topped      102.2         124.9          818            0.25         84.9         116.8          727            0.14
   P-30-135
                          Topped 8’       85.0          142.5          600            0.20         72.0         113.7          633            0.12
                          Not topped      93.13         125.4          742            0.29         85.5         116.1          736            0.23
   Hiawatha
                          Topped 8’       88.56         133.9          661            0.28         74.1         106.6          695            0.20
                          Not topped      86.76         122.0          711            0.38         83.4         120.5          692            0.27
   K-146-43
                          Topped 8’       89.09         125.0          713            0.39         61.4         118.6          518            0.20
                          Not topped      80.68         114.5          705            0.36         92.8         119.0          780            0.27
   K-146-44
                          Topped 8’       88.87         115.7          768            0.39         76.3         113.3          673            0.22




                                                                            103
California Tree Fruit Agreement
2007 Annual Research Report




IMPROVED ROOTSTOCKS
FOR PEACH AND NECTARINE
PROJECT LEADER:                   Dr. T.M. DeJong

COOPERATORS:                      Ali Almehdi, Dr. Scott Johnson, Kevin Day

SUMMARY

The objective of this project is to develop genetically improved rootstocks for peach and
nectarine that combine tree size control and resistance to important diseases and pests including
nematodes. Fifty rootstocks were planted, in replicated trials, at the Kearney Agricultural Center
(KAC) in 2003 through 2007. All of these rootstocks are root-knot nematode resistant and have
the potential for tree size control.

Data from a previous replicated trial at (KAC) identified three rootstocks from crosses of Harrow
Blood peach x Okinawa peach, made by our program, that had significant size-controlling
potential (selections HBOK32, HBOK10 and HBOK50, in descending order of apparent size-
controlling effect). These rootstocks were also shown to be resistant to root knot nematode.
Selections HBOK32 and HBOK10 were re-replicated at KAC in spring 2003 with O’Henry
peach and the early nectarine Mayfire. They were also grafted with Springcrest peach and
Summer Fire nectarine and planted in a replicated trial at KAC in February 2004. Selection
HBOK50 was re-replicated at KAC with O’Henry peach only in spring 2003.

Data from the 2003 planting indicated that the fifth-leaf O’Henry trees on the HBOK 32 and
HBOK10 rootstocks had significantly less height, dormant and summer pruning weights and
suckers than Nemaguard and any other tested rootstock. HBOK32 had significantly higher crop
efficiency than Nemaguard. Yield efficiency (crop divided by TCA) takes the size of the tree
into account. When the early nectarine Mayfire was used as the top, trees on both HBOK32 and
HBOK10 had significantly less height, dormant and summer pruning weights and suckers, and
higher crop efficiency values than trees on Nemaguard. Similar results were obtained when the
early peach Springcrest was used as the scion.

Replicated trials of different rootstocks from our program and others, grafted with O’Henry, and
planted at KAC in 2003 and 2004, showed that the majority of the trees on the tested rootstocks
had significantly less height, dormant and summer pruning weights and suckers than trees on the
control, Nemaguard. Yield efficiency values of the majority of trees on the tested rootstocks,
planted in 2003 and 2004, were significantly higher than trees on the control, Nemaguard.

Among the rootstocks tested with O’Henry in the 2004 trial is HBOK28. Trees on this rootstock
had significantly less height, dormant and summer pruning weights, and higher cropping



                                               104
California Tree Fruit Agreement
2007 Annual Research Report




efficiency and larger fruits than trees on Nemaguard and the majority of the other tested
rootstocks.

PROBLEM AND ITS SIGNIFICANCE

Many high quality scion varieties of peach and nectarine are available to producers, but
relatively few rootstocks have been developed for the changing demands of the industry. In
recent years there has been increasing interest in the development of size-reducing rootstocks for
peaches and nectarines to reduce the labor costs involved in management and harvest of
orchards. Also as the future availability of soil fumigants becomes increasingly uncertain, there
is increased need for rootstocks with resistance/tolerance to soil-borne pests and diseases. To
develop improved rootstocks that combine several elite traits, hybridization followed by
selection is required. Within segregating seedling populations, it is possible to identify
individuals that can be clonally propagated, thus developing considerable flexibility in rootstock
options for growers.

The control of tree growth of peach and nectarine is usually accomplished by judicious use of
management practices, i.e., planting density and pruning. However, even with the best
management practices, the resultant large trees usually require large amounts of hand labor for
tree care and the use of ladders for pruning, fruit thinning and harvest. An attractive alternative
would be the management of tree growth by size-controlling rootstocks, such as are available for
apple. This would allow trees to be managed from ground level without resultant loss of yield
per acre or reduction in fruit quality while using current scion cultivars.

Several peach varieties and inter-specific hybrids have been reported to have growth controlling
ability (e.g., Layne and Jui, 1994), but the inheritance of this trait is unknown. Some peach
cultivars, including Harrow Blood, Siberian C, and Rubira, have shown growth controlling
ability but these rootstocks are either not well adapted to California or are nematode susceptible.
Concomitant with growth control in improved rootstocks is the need for resistance to nematodes
and important diseases since the diminished availability of approved chemical control agents is
likely to continue. New rootstocks should have nematode resistance similar to the levels found
in current rootstocks, i.e., Nemaguard and Nemared. Additionally, resistance to bacterial canker
and crown gall would be desirable. None of the rootstocks currently in wide use has these
combined attributes.

For each of the desired traits, there are several available sources of genetic materials that are
potentially valuable for rootstock improvement. Resistance to root knot nematode is well
defined and materials such as Okinawa, Nemared, Nemaguard, Flordaguard, etc. can be used as
parents for hybridization (Sharpe, 1957; Sherman et al., 1991). However, genetic variability for
growth control, crown gall and bacterial canker resistance is less well defined. Therefore,
systematic screening is needed to identify the most useful materials. We have done an extensive
screening of Prunus germplasm and have identified candidate genotypes to be used as sources of
resistance to crown gall disease (Bliss et al, 1999). We also have screened a large number of
Prunus genotypes for their resistance/susceptibility to the bacterial canker disease and root knot
nematode.




                                                105
California Tree Fruit Agreement
2007 Annual Research Report




GOAL AND OBJECTIVES

The goal of this project is to develop new rootstocks with pest resistance and tree size controlling
ability that can be propagated economically by commercial nurseries for use with a wide range
of California peach and nectarine varieties.

The specific objectives of this project were to:
     1) Screen Prunus populations for:
                   i) compatibility and growth controlling potential with peach and
              nectarine,
                      ii) nematode resistance, initially root knot nematode race 1,
                     iii) crown gall resistance and iv) bacterial canker resistance,
         2) Develop elite individual plants that can be used for clonal rootstocks; and
       3) Assess the potential of the best materials for commercial peach and nectarine production
     in California.


PROGRESS DURING 2007

     • New plantings:
       Eleven new rootstocks, produced by our program, were planted in 2007. These
       rootstocks are resistant to root-knot nematode and have tree vigor control potential
(Table 1). Thirty nine other rootstocks, having vigor control and resistance to root-knot
nematode, were planted in 2005, 2004, and 2003 are listed in tables 2, 3 and 4, respectively.

     •    Data from the 2003 replicated trial:
          1. Rootstocks grafted with O’Henry peach:

                A. Vegetative Data (Tables 5)
                    Height: Trees on HBOK50, HBOK1, Barrier, HBOK2 and Cadaman were
                    similar to the control (Nemaguard). Trees on the rest of the tested rootstocks
                    were shorter than the control.
                    Dormant Pruning Weight: Pruning weights of trees on HBOK50 and Barrier
                    rootstocks were similar to that of the trees on the control. Trees on the rest of
                    the tested rootstocks had significantly lower dormant pruning weights than trees
                    on the control (ranging from 15% to 86%).
                    Summer Pruning Weight: Pruning weights of trees on HBOK10, HBOK1,
                    HBOK 32, HBOK2, HBOK18, Ishtara, Sapalta-OP-3, Adesoto and Sapalta-OP-
                    24 were all significantly less (ranging between 5% to 68%) than trees on the
                    control Nemaguard.
                    Number of Suckers(Table 6): Trees on Adesoto, Cadaman and Nemaguard
                    rootstocks produced the greatest number of suckers (6.2, 4.1, and 4.1,
                    respectively). The rest of the rootstocks had fewer suckers than the control.
                    HBOK 32 had no suckers. It is worth-while mentioning that Adesoto had



                                                       106
California Tree Fruit Agreement
2007 Annual Research Report




                        suckers arising from the roots. Suckering may indicate possible incompatibility
                        with other varieties of peach and nectarine, especially since one or more of the
                        parents of some of the rootstocks are of plum origin (Table 6 – see parents
                        column).

                B.     Fruit production characteristics (Table 7):
                       Crop : Trees on HBOK1, HBOK2, , Barrier, Cadaman and HBOK50 rootstocks
                       were similar to that of the control.
                       Weight (size) of fruit: .Trees on the rootstock Barrier were similar to that of the
                       control.
                       Cropping efficiency: HBOK32, HBOK2 and Ishtara had the highest efficiency
                       values. Trees on HBOK10, HBOK18, HBOK50, Cadaman, Sapalta-OP-24 and
                       Barrier were similar to Nemaguard.

          2. Rootstocks grafted with the early nectarine, Mayfire:

                A. Vegetative Data (Table 8):
                   Trees on HBOK 32 and HBOK 10 rootstocks were significantly shorter, had
                   fewer suckers and had smaller dormant and summer pruning weights than trees on
                   the control, Nemaguard.

                B. Fruit production characteristics (Table 9):
                   Trees on the HBOK 32 and HBOK 10 rootstocks had higher yield efficiency
                   values than trees on Nemaguard.


     •    Data from the 2004 replicated trial:
          1. Rootstocks grafted with O’Henry peach

                A. Vegetative Data (Table 10):
                   Values of the height of HBOK138, HBOK123 and HBOK144 and the dormant
                   pruning weights of HBOK123 and HBOK144 were similar to that of the control
                   Nemaguard. Trees on Nemaguard had summer pruning weights significantly
                   higher than the rest of the tested rootstocks.

                B. Fruit production characteristics (Table 11):
                    Crop: Trees on HBOK36, HBOK160, HBOK121, KV84068 and HBOK138 had
                    similar crop weight as trees on Nemaguard.
                    Weight per Fruit (size): Trees on the rootstocks, HBOK28, KV84068, HBOK122,
                    HBOK160, HBOK123, HBOK144, HBOK9 and HBOK138 had fruit weight
                    (size) similar to that of the control.
                    Crop Efficiency: Trees on all of the tested rootstocks, except for HBOK144,
                    HBOK29 and HBOK123, had higher crop efficiency than that of Nemaguard.

          2. Rootstocks grafted with the early peach, Springcrest




                                                       107
California Tree Fruit Agreement
2007 Annual Research Report




                A. Vegetative Data (Table 12):
                    Similar to the results obtained from the trial with the early Mayfire nectarine
                    (Table 8), trees on the HBOK 32 and HBOK 10 rootstocks were significantly
                    shorter, and had smaller dormant and summer pruning weights, and numbers of
                    suckers values than trees on the control, Nemaguard.
                B. Fruit production characteristics (Table 13):
                    Crop efficiency (similar to Mayfire results- Table 9) was significantly higher for
                    the two rootstocks than the control Nemaguard.




                                                    108
California Tree Fruit Agreement
2007 Annual Research Report




REFERENCES

Bliss, F.A., A. A. Almehdi, A.M. Dandekar, P. L. Schuerman and N. Bellaloui. 1999. Crown gall
resistance in accessions of 20 Prunus species. HortScience 34:326-330.
Layne, E.C. and P.Y. Jui. 1994. Genetically diverse peach seedling rootstocks affect long-term
performance of ‘Redhaven’ peach on Fox sand. J. Amer. Soc. Hort. Sci. 119:1303-1311.
Sharpe, R.H. 1957. ‘Okinawa’ peach resists root-knot nematodes. Fla. Agr. Res. Rpt.
1957(Jan):18.
Sherman, W.B., P.M. Lyrene and R.H. Sharpe. 1991. Flordaguard peach rootstock. HortSci.
26:427-428.




                                             109
California Tree Fruit Agreement
2007 Annual Research Report




 Table 1. List of eleven rootstocks that have size-controlling potential being tested in a
 replicated trial. The trees were grafted with O'Henry peach and planted, at Kearney Ag.
 Center, in January and September, 2007.

     Rootstock                             Parents                  Date Planted          Description*

    95-153-141                Harrow Blood x Okinawa-141               Jan07       Size controlling; RKN resist.

      94 94 17                    Harrow Blood x Okinawa-17            Jan07       Size controlling; RKN resist.

         KV-1                        KV84068(3-6) selfed              Sept07       Size controlling; RKN resist.
                                   Flordaguard (R16,T22) x
    (FL X KV)-1                   KV84068(CBR3,T4)-19-44              Sept07       Size controlling; RKN resist.

         KV-2                     KV77015(3-3) selfed(15-4)           Sept07       Size controlling; RKN resist.

         KV-3                       KV84068(3-12) selfed              Sept07       Size controlling; RKN resist.

     FL X Weep                    FlordagxWeep. p.(31-19)             Sept07       Size controlling; RKN resist.
                                   Flordaguard (R16,T20) x
    (FL X KV)-2                   KV84068(CBR3,T4)-15-32              Sept07       Size controlling; RKN resist.

         KV-4                     KV77015(3-3) selfed(17-76)          Sept07       Size controlling; RKN resist.

         KV-5                      KV77015(3-3) selfed(5-1)           Sept07       Size controlling; RKN resist.

         KV-6                        KV84068(3-4) selfed               Sept07      Size controlling; RKN resist.
                                                                      Jan07 &
    Nemaguard                              control                     Sept07      Vigorous; resistant to RKN l
 **RKN = Root Knot Nematode.




                                                              110
California Tree Fruit Agreement
2007 Annual Research Report




 Table 2. List of eight rootstocks that have size-controlling potential being
 tested in a replicated trial. The trees were grafted with O’Henry and planted, at
 Kearney Ag. Center, in 2005.

                  Rootstock                           Description*
 Harrow Blood x Okinawa-155                 Size controlling; resistant to RKN.
 Harrow Blood x Okinawa-162                 Size controlling; resistant to RKN.
 Bl 19,T110                                 Size controlling; resistant to RKN.
 Bl19,T71                                   Size controlling; resistant to RKN.
 Flordaguard x KV84068                      Size controlling; resistant to RKN.
 FlordagxKV77015                            Size controlling; resistant to RKN.
 Sm weeping                                 Size controlling; resistant to RKN.
 Lg weeping                                 Size controlling; resistant to RKN.
 Nemaguard (control)                           Vigorous; resistant to RKN

 *RKN = Root Knot Nematode.




                                                111
California Tree Fruit Agreement
2007 Annual Research Report




 Table 3. List of twenty rootstocks that have size-controlling potential being
 tested in a replicated trial. The trees were grafted with the appropriate scion
 and planted, at the Kearney Ag. Center, in February 2004.

      Rootstock                      Scion                 Description*
 HBOK5                              O’Henry      Size controlling; resistant to RKN.
 HBOK9                              O’Henry      Size controlling; resistant to RKN.
 HBOK10                           Summer Fire    Size controlling; resistant to RKN.
 HBOK10                            Springcrest   Size controlling; resistant to RKN.
 HBOK27                             O’Henry      Size controlling; resistant to RKN.
 HBOK28                             O’Henry      Size controlling; resistant to RKN.
 HBOK 29                            O’Henry      Size controlling; resistant to RKN.
 HBOK32                           Summer Fire    Size controlling; resistant to RKN.
 HBOK32                            Springcrest   Size controlling; resistant to RKN.
 HBOK36                             O’Henry      Size controlling; resistant to RKN.
 HBOK121                            O’Henry      Size controlling; resistant to RKN.
 HBOK122                            O’Henry      Size controlling; resistant to RKN.
 HBOK123                            O’Henry      Size controlling; resistant to RKN.
 HBOK138                            O’Henry      Size controlling; resistant to RKN.
 HBOK144                            O’Henry      Size controlling; resistant to RKN.
 HBOK160                            O’Henry      Size controlling; resistant to RKN.
 Hiawatha                           O’Henry      Size controlling; resistant to RKN.
 K146-43                            O’Henry      Size controlling; resistant to RKN.
 KV84068-S                          O’Henry      Size controlling; resistant to RKN.
 Nemaguard (control)                O’Henry         Vigorous; resistant to RKN
 Nemaguard (control)              Summer Fire       Vigorous; resistant to RKN
 Nemaguard (control)               Springcrest      Vigorous; resistant to RKN
 Rubira                             O’Henry      Size controlling; resistant to RKN.
 Weeping peach 31                   O’Henry      Size controlling; resistant to RKN.
 Weeping peach 3                    O’Henry      Size controlling; resistant to RKN.

 *RKN = Root Knot Nematode




                                                   112
          California Tree Fruit Agreement
          2007 Annual Research Report




Table 4. List of fourteen rootstocks that have size-controlling potential being tested in a
replicated trial. The trees were grafted with the appropriate scion and planted, at Kearney Ag.
Center, in 2003.

Rootstock                         Parents              Scion                        Description
                                                                  From NAP*; suckers from the roots; 80% of the
                                                                  standard size of peach; early entry in production;
Adesoto            P. isititia selection               O'Henry    productive; induces larger fruit size and earlier
                                                                  ripening in peaches; good adaptation to poor or
                                                                  saline soils.
                                                                  From NAP; adaptive to a wide array of soils, was
Barrier            P. persica x P. davidiana           O'Henry    selected for longevity and performance on replant
                                                                  sites.
                                                                  From NAP; high becoming less vigorous with
                   (P. persica x P. dulcis) x P.
Cadaman                                                O'Henry    age; has a high yield efficiency. Resistant to
                   dividiana
                                                                  RKN** and LN***.
HBOK 1             Harrow Blood x Okinawa-1            O'Henry    Size controlling; resistant to RKN.
HBOK 2             Harrow Blood x Okinawa-2            O'Henry    Size controlling; resistant to RKN.
HBOK 8             Harrow Blood x Okinawa-8            O'Henry    Size controlling; resistant to RKN.
HBOK 10            Harrow Blood x Okinawa-10           Mayfire    Size controlling; resistant to RKN.
HBOK 10            Harrow Blood x Okinawa-10           O'Henry    Size controlling; resistant to RKN.
HBOK 18            Harrow Blood x Okinawa-18           O'Henry    Size controlling; resistant to RKN.
HBOK 32            Harrow Blood x Okinawa-32           Mayfire    Size controlling; resistant to RKN.
HBOK 32            Harrow Blood x Okinawa-32           O'Henry    Size controlling; resistant to RKN.
HBOK 50            Harrow Blood x Okinawa-50           O'Henry    Size controlling; resistant to RKN and LN.
                                                                  From NAP; semi dwarfing to slightly smaller than
                   Belsiana plum (P. cerasifera x
                                                                  peach seedling;. Resistant to RKN and LN but
Ishtara            P. salicina) x (natural hybrid of   O'Henry
                                                                  susceptible to LN if both RKN and LN are present
                   P. ceracifera x P. persica)
                                                                  in the soil.
                                                                  From NAP; dwarfing to semi-dwarfing (70% of
                                                                  ‘Nemaguard’); high resistance to plum pox
Pumiselect         P. pumila selection                 O'Henry
                                                                  (sharka) virus; precocious and very cold hardy.
                                                                  Resistant to RKN and moderately susceptible LN.
                   Spalta-OP 3 (P. bessyi x P.
Spalta 3                                               O'Henry    Size controlling; resistant to RKN.
                   salicina)
                   Spalta-OP 24 (P. bessyi x P.
Spalta 24                                              O'Henry    Size controlling; resistant to RKN.
                   salicina)
Nemaguard          Control                             Mayfire    Vigorous; resistant to RKN
Nemaguard          Control                             O'Henry    Vigorous; resistant to RKN
*NAP = North American Plant
**RKN = Root Knot Nematode.
LN*** = Lesion nematode.




                                                                 113
California Tree Fruit Agreement
2007 Annual Research Report




 Table 5. Mean values and % of the control of height and dormant and summer pruning
 weights of the rootstocks grafted with O'Henry for 2007.The trees were planted in a
 replicated trial, in 2003.
                                                                               Drormant
                        Height           %                                      Pruning        %
   Genotype             (cm)*          Control                    Genotype        (Kg)       Control
 Nemaguard                432.0            100        a         Nemaguard            10.1        100   a
 HBOK 50                  424.0             98        a         HBOK 50                9.4        93   ab
 HBOK 1                   424.0             98        a         Barrier                9.2        91   abc
 Barrier                  419.0             97        a         HBOK 1                 8.7        86   bc
 HBOK 2                   418.0             97        a         Cadaman                8.4        83   bc
 Cadaman                  409.0             95        ab        HBOK 2                 8.3        82   c
 HBOK 10                  390.0             90        bc        HBOK 10                6.7        66   d
 HBOK 18                  377.0             87        dc        HBOK 32                6.0        59   de
 HBOK 32                  376.0             87        dc        HBOK 18                5.6        55   e
 Ishtara                  361.0             84        de        Ishtara                4.2        42   f
 Spalta-OP-3              358.0             83        de        Spalta-OP-3            4.1        41   f
 Adesoto                  351.0             81        e         Adesoto                3.3        33   f
 Spalta-OP-24             306.0             71        f         Spalta-OP-24           1.5        15   g
                       Summer
                       Pruning           %
   Genotype              (Kg)          Control
 HBOK 50                    4.0            105        a
 Nemaguard                  3.8            100        ab
 Cadaman                    3.8            100        ab
 Barrier                    3.8            100        ab
 HBOK 10                    2.6             68        bc
 HBOK 1                     2.2             58        dc
 HBOK 32                    1.9             50        dce
 HBOK 2                     1.8             47        dce
 HBOK 18                    1.1             29        def
 Ishtara                    1.0             26        def
 Spalta-OP-3                0.9             24        ef
 Adesoto                    0.8             21        ef
 Spalta-OP-24               0.2              5        f
 * = numbers followed by the same letter(s) are not significantly different.




                                                                  114
California Tree Fruit Agreement
2007 Annual Research Report




 Table 6. Mean values and % of the control of the number of root suckers for the
 rootstocks grafted with O'Henry for 2007.The trees were planted, in a replicated
 trial, in 2003.
                            No.            %
   Genotype               Suckers       Control                         Parents            Notes
 Adesoto                       6.2        151.2       a       P. isititia selection      root suckers
 Cadaman                       4.1        100.0       ab      (P. persica x P. dulcis) x P. dividiana
 Nemaguard                     4.1        100.0       b       P. persica x P. dividiana
 Sapalta-OP-24                 1.4         34.1       c       Sapalta-OP 24 (P. bessyi x P. salicina)
 HBOK 8                        0.6         14.6       c       Harrow Blood x Okinawa-8
 HBOK 10                       0.3          7.3       c       Harrow Blood x Okinawa-8
 HBOK 50                       0.1          2.4       c       Harrow Blood x Okinawa-8
 HBOK 1                        0.1          2.4       c       Harrow Blood x Okinawa-8
 Barrier                       0.0          0.0       c       P. persica x P. davidiana
 HBOK 2                        0.0          0.0       c       Harrow Blood x Okinawa-8
 HBOK 32                       0.0          0.0       c       Harrow Blood x Okinawa-8
                                                              Belsiana plum (P. cerasifera x P. salicina) x
 Ishtara                          0.0          0.0    c       (natural hybrid of P. ceracifera x P. persica)
 HBOK 18                          0.0          0.0    c       Harrow Blood x Okinawa-8
 Sapalta-OP-3                     0.0          0.0    c       Sapalta-OP 3 (P. bessyi x P. salicina)
 * = numbers followed by the same letter(s) are not significantly different.




                                                                  115
California Tree Fruit Agreement
2007 Annual Research Report




Table 7. Mean values and % of the control of crop weight per tree, weight per fruit (size), and
cropping efficiency of the rootstocks grafted with O'Henry for 2007. The trees were planted in
2003.

                                                                                       Wt. per        %
    Genotype            Crop (Kg)           % Control                      Genotype    fruit (g)    Control
 HBOK 1                        62.8              104.0         a        Nemaguard           240.5     100.0    a
 HBOK 2                        61.9              102.5         ab       Barrier             229.0       95.2   ab
 Cadaman                       61.1              101.2         ab       Cadaman             220.2       91.6   bc
 Nemaguard                     60.4              100.0         ab       HBOK 10             208.2       86.6   dc
 Barrier                       59.2               98.0         ab       HBOK 1              206.6       85.9   dc
 HBOK 50                       58.0               96.0         b        HBOK 2              206.5       85.9   dc
 HBOK 32                       50.8               84.1         c        HBOK 50             199.8       83.1   d
 Ishtara                       47.6               78.8         dc       Ishtara             197.4       82.1   d
 HBOK 18                       46.0               76.2         de       HBOK 32             194.5       80.9   d
 HBOK 10                       45.1               74.7         de       Adesoto             170.6       70.9   e
 Spalta-OP-3                   43.7               72.4         de       Spalta-OP-3         170.6       70.9   e
 Adesoto                       42.8               70.9         e        HBOK 18             167.8       69.8   e
 Spalta-OP-24                  33.2               55.0         f        Spalta-OP-24        165.7       68.9   e
                        Cropping
    Genotype            Efficiency*         % Control
 HBOK 32                       0.86              148.3         a
 HBOK 2                        0.74              127.6         ab
 Ishtara                       0.74              127.6         ab
 Adesoto                       0.73              125.9         b
 Spalta-OP-3                   0.73              125.9         b
 HBOK 1                        0.72              124.1         b
 HBOK 10                       0.66              113.8         bc
 HBOK 18                       0.64              110.3         bc
 HBOK 50                       0.62              106.9         bc
 Cadaman                       0.61              105.2         bc
 Nemaguard                     0.58              100.0         c
 Spalta-OP-24                  0.54               93.1         c
 Barrier                       0.53               91.4         c
* = numbers followed by the same letter(s) are not significantly different.




                                                                  116
California Tree Fruit Agreement
2007 Annual Research Report




 Table 8. Mean values and % of the control of height, dormant pruning weight,
 summer pruning weight and number of suckers of the rootstocks grafted with the
 early nectarine Mayfire for 2007. The trees were planted in a replicated trial, in
 2003.
                                                            Dormant
                     Height         %                       Pruning      %
 Genotype            (cm)*        Control       Genotype     (Kg)*     Control
 Nemaguard             585.6        100.0   a   Nemaguard       27.0     100.0    a
 HBOK 10               533.3         91.1   b   HBOK 10         15.3      56.7    b
 HBOK 32               492.5         84.1   c   HBOK 32         13.5      50.0    c
                    Summer
                    Pruning         %                         No.        %
 Genotype             (Kg)*       Control       Genotype    Suckers*   Control
 Nemaguard               4.7        100.0   a   Nemaguard        1.8     100.0    a
 HBOK 32                 2.5         53.2   b   HBOK 32          0.0        0.0   b
 HBOK 10                 2.4         51.1   b   HBOK 10          0.0        0.0   b




                                                    117
California Tree Fruit Agreement
2007 Annual Research Report




 Table 9. Mean values and % of the control of crop, weight per fruit (size), and
 cropping efficiency of the rootstocks grafted with Mayfire for 2007. The trees
 were planted in 2003.
                                      %                       Wt. per
  Genotype            Crop (Kg)     Control        Genotype   fruit (g)   % Control
 Nemaguard                   43.2       100   a   Nemaguard         190       100.0   a
 HBOK 10                     33.7        78   b   HBOK 32           176        92.5   b
 HBOK 32                     29.3        68   c   HBOK 10           159        83.9   c
                      Cropping
                      Efficiency      %
  Genotype            (Kg/cm2)*     Control
 HBOK 32                      0.4       100   a
 HBOK 10                      0.4        97   a
 Nemaguard                    0.3        69   b




                                                     118
California Tree Fruit Agreement
2007 Annual Research Report




 Table 10. Mean values and % of the control of height, dormant pruning weights and
 summer pruning weights of the rootstocks grafted with O'Henry for 2007.The trees
 were planted in a replicated trial, in 2004.
                                                                                Drormant
                                  Height       %                                 Pruning        %
    Genotype                      (cm)*      Control                 Genotype      (Kg)       Control
 HBOK138                             459.0      101         a       Nemaguard           8.2       100   a
 Nemaguard                           453.0      100         a       HBOK123             8.1        99   a
 HBOK123                             448.0        99        ab      HBOK144             7.6        93   ab
 HBOK144                             441.0        97        abc     HBOK122             7.1        87   bc
 HBOK160                             426.0        94        bcd     HBOK121             7.0        86   bcd
 HBOK122                             425.0        94        bcd     HBOK36              6.8        83   cd
 Weeping peach-
 31                                 425.0            94     bcd     HBOK138            6.8         83   cd
 HBOK121                            422.5            93     cd      HBOK28             6.7         82   cd
 HBOK36                             419.0            92     cd      HBOK160            6.5         80   cd
 KV84068-S                          417.0            92     cd      HBOK9              6.4         78   d
 Rubira                             416.0            92     cd      KV84068-S          5.3         65   e
 HBOK9                              414.0            91     d       Rubira             5.3         65   e
 HBOK28                             413.0            91     d       HBOK27             4.1         50   f
                                                                    Weeping
 HBOK27                              392.0           87     e       peach-31           4.1         50   f
                                                                     Weeping
 Weeping peach-3                 366.0               81     f       peach-3            3.4         42   gf
 HBOK29                          340.0               75     g       HBOK29             3.3         40   g
                             Summer
                             Pruning           %
    Genotype                   (Kg)          Control
 Nemaguard                          4.0         100         a
 HBOK36                             2.9           72        b
 HBOK160                            2.4           59        c
 KV84068-S                          2.3           58        c
 HBOK122                            2.3           58        c
 HBOK144                            2.3           57        c
 HBOK9                              2.3           57        c
 HBOK123                            2.2           56        cd
 HBOK138                            2.1           52        cde
 Rubira                             1.9           48        cdef
 HBOK121                            1.9           46        def
 HBOK28                             1.7           43        efg
 HBOK27                             1.6           40        fgh
 Weeping peach-
 31                                    1.4           34     gh
 Weeping peach-3                       1.2           31     hi
 HBOK29                                1.0           24     i
 * = numbers followed by the same letter(s) are not significantly different.




                                                                   119
California Tree Fruit Agreement
2007 Annual Research Report




 Table 11. Mean values and % of the control of crop, weight per fruit (size), and cropping
 efficiency of the rootstocks grafted with O'Henry for 2007. The trees were planted in 2004.
                                                                                             Wt.
                                                                                             per
                                                    %                                       fruit      %
     Genotype                     Crop (Kg)      Control                     Genotype        (g)    Control
 HBOK36                               45.9        100.2        a         HBOK28             246      106.0    a
 Nemaguard                            45.8        100.0        a         KV84068-S          238      102.6    ab
 HBOK160                              45.4         99.1        a         HBOK122            235      101.3    abc
 HBOK121                               45          98.3        a         Nemaguard          232      100.0    abcd
 KV84068-S                            44.9         98.0        a         HBOK160            226       97.4    bcde
 HBOK138                              43.8         95.6        ab        HBOK123            224       96.6    cdef
 HBOK122                              42.1         91.9        bc        HBOK144            223       96.1    cdefg
 HBOK123                              41.9         91.5        bcd       HBOK9              222       95.7    cdefgh
 HBOK9                                40.6         88.6        cde       HBOK138            217       93.5    defgh
 HBOK28                               39.8         86.9        cdef      HBOK36             216       93.1    efgh
 HBOK27                               39.2         85.6        defg      HBOK27             215       92.7    efgh
 HBOK144                              38.2         83.4        efg       Weeping peach-31   209       90.1    fghi
 Weeping peach-31                     37.7         82.3        fg        HBOK29             208       89.7    fghi
 Rubira                                37          80.8        g         HBOK121            207       89.2    ghi
 HBOK29                               30.4         66.4        h         Rubira             207       89.2    hi
 Weeping peach-3                      27.6         60.3        i         Weeping peach-3    200       86.2    i
                                  Cropping          %
     Genotype                     Efficiency*    Control
 HBOK27                              0.684        145.5        a
 HBOK28                              0.627        133.4        ab
 HBOK9                               0.616        131.1        ab
 HBOK121                             0.605        128.7        ab
 HBOK160                             0.579        123.2        bc
 Weeping peach-3                     0.576        122.6        bc
 Rubira                               0.57        121.3        bc
 HBOK138                             0.567        120.6        bc
 HBOK36                              0.557        118.5        bcd
 HBOK122                             0.556        118.3        bcd
 Weeping peach-31                    0.455         96.8        bcd
 KV84068-S                            0.54        114.9        bcd
 HBOK144                              0.51        108.5        cd
 HBOK29                                0.5        106.4        cd
 HBOK123                             0.478        101.7        d
 Nemaguard                           0.473        100.6        d
 * = numbers followed by the same letter(s) are not significantly different.




                                                                  120
California Tree Fruit Agreement
2007 Annual Research Report




      Table 12. Mean values and % of the control of height, summer pruning weights, dormant
      pruning weights and number of suckers of the rootstocks grafted with the early peach
      Springcrest for 2007. The trees were planted, in a replicated trial, in 2004.
                                                                                         Summer
                                                      %                                  Pruning     %
          Genotype                Height (cm)*      Control                   Genotype     (Kg)    Control

      Nemaguard                          512.0          100.0      a    Nemaguard            2.8     100.0   a

      HBOK10                             449.0            87.7     b    HBOK10               1.5      52.5   b

      HBOK32                             436.0            85.2     b    HBOK32               1.2      41.5   c

                                    Dormant           %                                    No.       %
          Genotype                Pruning (Kg)      Control                   Genotype   Suckers   Control

      Nemaguard                           11.7          100.0      a    Nemaguard            2.8     100.0   a

      HBOK10                               8.0            68.5     b    HBOK32               0.3      10.7   b

      HBOK32                               8.0            68.4     b    HBOk10               0.1       3.6   b

      * = numbers followed by the same letter(s) are not significantly different.




                                                                  121
California Tree Fruit Agreement
2007 Annual Research Report




      Table 13. Mean values and % of the control of crop, weight per fruit (size),
      and cropping efficiency (crop weight divided by TCA) of the rootstocks
      grafted with early peach Springcrest for 2007. The trees were planted in
      2004.

                                            %                                       Wt. per
       Genotype           Crop (Kg)       Control               Genotype            fruit (g)   % Control

      Nemaguard                   22.8        100.0     a      Nemaguard               112.0         100.0   a

      HBOK10                      20.4         89.5     b      HBOK32                    93.0         83.0   b

      HBOK32                      20.3         89.0     b      HBOK10                    89.0         79.5   b

                         Cropping           %
       Genotype          Efficiency*      Control

      HBOK10                      0.27        142.1     a

      HBOK32                      0..22       115.8     b

      Nemaguard                    0.19        100.0    c


      * = numbers followed by the same letter(s) are not significantly different.




                                                                  122
California Tree Fruit Agreement
2007 Annual Research Report




REFINING CHEMICAL CONTROLS AND
APPLICATION METHODS FOR TENLINED
JUNE BEETLE GRUBS
PROJECT LEADER:                   Dr. Marshall W. Johnson

COOPERATORS:                      Kevin Day, Xingeng Wang, Walter Bentley,
                                  Michael Klein, Walter Leal, Dr. Michael McKenry,
                                  John D. Stark, Frank Zalom, Cyrille Verdun

GENERAL INFORMATION

Dr. Xingeng Wang was hired in June 2006 and has been working on the tenlined June beetle
project since that time at a level of about 0.2 FTE with support from the California Tree Fruit
Agreement grant. In 2007, Ms. Martha Gerik provided additional assistance to Dr. Wang, and
she was partially paid from UC Riverside support funding and the California Tree Fruit
Agreement grant to the senior P.I. The greatest cost of this research is the acquisition of live
grubs to conduct the experiments. Dr. Wang estimated that it costs about $5 in labor for each
grub obtained from the soil that is used in our experiments. Since the last annual report, we have
made progress on Objective 2 and plan to initiate field experiments in early 2008.

OBJECTIVES AND RESULTS

Objective 1. Evaluate new soil insecticides available for scarab grub control
In 2006, we examined the impact of the insecticides Ecozin® 3% EC (active ingredient is
azadirachtin), Diazinon 50 W, Nature Cur® (an organic insecticide containing walnut extract and
5% Potassium), and Admire® 2 (imidacloprid) on tenlined June beetle (TLJB) 3rd instar grubs in
small sand-filled container units. Of these compounds, only Diazinon and Admire® produced
effective, but slow acting, mortality in treated insects. Ecozin 3% EC and Nature Cur caused
some mortality, but not enough for further consideration. Both Diazinon and Admire® are
registered for insect control in stone fruit crops, and additional studies were conducted under
Objective 2 with these products.

Objective 2. Determine methods to facilitate penetration of insecticide solutions through
soil columns
Penetration of solution through soil column without additional water-Last year we provided
information on how well Diazinon could penetrate through a soil column filled with sand to kill
3rd instar grubs. The results of this test are provided in Table 1 for comparison with data we now
have for the compound Admire®, which is provided in Table 2.



                                                123
California Tree Fruit Agreement
2007 Annual Research Report




The soil column experiment consisted of two treatments of different application amounts of
Diazinon or Admire® solutions, and four treatments of different soil depths for each application
amount. The soil columns were made of PVC irrigation pipe (15 cm in diameter). Soil columns
of three different lengths were assembled by placing either one 7.5, 12.5 or 22.5 cm long section
on one 5 cm section. The two sections were then re-connected using Duct tape to make one soil
column. Therefore, the three different columns were 12.5 (7.5+5), 17.5 (12.5+5), and 27.5
(22.5+5) cm long, respectively. Each soil column was first filled with moist soil (leaving 2-3 cm
unfilled on the top). Water was then added to each soil column until the soil was completely
saturated. This process was repeated 2-3 times consecutively within the next 2-3 days to
improve the compactness of the soil before the test. Finally, either 250 ml or 500 ml solution
was slowly added to each soil column to ensure the solution was dispersing over the soil surface
and moving down from the interior column (not from the wall of the column).

After 24 hours following the above treatment, the top section and the bottom section of each
column were separated. A sample of about one pound soil from the bottom section was
transferred to a clean container (700 ml). One piece of carrot and one grub was placed in the
middle of the soil in the container. Additionally, for the 15 cm long column the soil from the top
section was used as 0-5 cm soil depth treatment. For other treatments, the soil from the top
section was discarded. Before the transfer, all soil in each section was fully mixed. In the control
treatment, untreated soil was used. Tests for each application amount and soil depth were
repeated 6-14 times. For the treatment of Diazinon, the first check of grub mortality was taken 2
days post-treatment, then at intervals of 5 days, following the treatment, all the grubs were
checked for mortality. For the treatment of Admire®, all the grubs were checked for mortality
once per week. After 6 weeks, all grubs were transferred to clean containers with untreated soil,
and were continually checked for mortality once per week until they were either dead or pupated.
Each time, the carrot in each container was replaced if it was ever fed upon by the grub or if it
started to rot.

All grubs used for this experiment were collected from commercial almond orchards southwest
of Fresno, California. The grubs were then individually reared on carrots in the containers (700
ml) filled with 1 lb moist sandy soil. All tests were conducted in a greenhouse (15-30 ºC, 40-60
RH%) at the UC Kearney Agricultural Center, Parlier, California.

Application amounts of Diazinon solution and soil depth (and their interactions) affected the
percentage feeding and mortality of TLJB grubs (Table 1). Regardless of the application
amount, all grubs stopped eating and were dead after 5 days when they were exposed to treated
soil from between 0 to 5 cm of the soil surface. When 250 ml Diazinon solution was applied to
the soil column, percentages of feeding grubs increased while percentages of grub mortality
decreased with soil depth. It appeared that Diazion did move down well below 0-10 cm of the
soil surface at this application amount. However, when 500 ml Diazinon solution was applied to
the soil column, most of the grubs stopped eating and percentage mortality of the grubs was
considerably high (≥ 60%) when they were exposed to the treated soil from all the levels. This
suggests that control efficiency would increase with an increase in the amount of Diazinon used.

Similarly, application amounts of Admire® solution and soil depth affected the percentage
feeding and mortality of TLJB grubs (Table 2). Regardless of the application amount, all grubs



                                                124
California Tree Fruit Agreement
2007 Annual Research Report




stopped eating and were dead after 3-4 weeks when they were exposed to treated soil from
between 0 to 5 cm of the soil surface. When 250 ml Admire® solution was applied to the soil
column, percentages of feeding grubs increased while percentages of grub mortality decreased
with increased soil depth within the first 3-4 weeks post-treatment. It appeared that Admire®
also moved down well below 0-10 cm of the soil surface at this application amount. When 500
ml Admire® solution was applied to the soil column, all grubs stopped eating after the treatment
and percentage mortality of the grubs decreased with increased soil depth. This suggests that
control efficiency would increase with an increase in the amount of Admire® solution applied.
However, eventually most of the treated grubs were dead after about 10 weeks, although some of
them fed on a small amount of carrots in the 250 ml treatment (Table 2).

Penetration of solution through soil column with additional water- Attempts were made to move
a smaller amount of Admire® through the soil using a post-application drench of water to move
the insecticide through the soil column. Without the water drench, Admire® did not appear to
move well below 10 cm of the soil surface, because the grub mortality was low while percentage
of feeding was high when compared to the less deeper soil-depth treatments. When 150 ml
water was added to the container immediately following the application of 150 ml solution, grub
mortality increased while percentage of feeding decreased when they were exposed to the treated
soil from between 10-15 cm of the soil surface (note: mortality could further increase with time
of post-treatment due to the very low percentage of feeding). Below 20-25 cm of the soil
surface, suppression efficiency was not obvious for the 3rd instar grubs after adding 150 ml
water. However, all first instars stopped feeding and caused 50% mortality after 5 weeks post-
treatment when they were exposed to the treated soil from 20-25 cm of the soil surface,
suggesting that Admire® did move down below 20 cm of the soil surface, but the amount may
be too low for the 3 instars. It also suggested that the young grubs were more susceptible than the
old grubs. We are still collecting mortality data on this experiment and will continue collecting
until 10 weeks post-treatment are reached.

According to these results, additional amounts of water may be needed to help move down
enough chemical below 20-25 cm of the soil surface for the control of 3rd instar grubs. We are
currently testing the effects with reduced application rate of Admire®, but increasing amounts of
water added to the container 24 h after the application of Admire®.




                                                125
California Tree Fruit Agreement
2007 Annual Research Report




Objective 3. Evaluate the potential of using entomopathogenic nematodes for TLJB
control
No new results to report at this time. Obtaining adequate supplies of the specific nematodes that
we need has been a problem for us. Our supplier, Becker-Underwood (United Kingdom),
produces the needed nematodes periodically and they have not been able to provide us with
nematodes on a regular basis. Given that these nematodes have not provided controls
comparable to that obtained with Diazinon and Admire®, it may be best to focus on the
conventional insecticides at this time.

Objective 4. Determine methods to facilitate penetration of entomopathogenic nematodes
through soil columns.
No results to report at this time.




                                               126
California Tree Fruit Agreement
2007 Annual Research Report




Table 1. Percentage feeding and mortality of TLJB grubs exposed to treated soil with Diazinon (5 lbs AI/acre) in soil column tests
Solution       Soil                           % Feeding of post-treatment (days)                           % Mortality of post-treatment (days)
  (ml)        depth                2          5      10      15       20      30           40       2       5      10       15       20      30              40
              (cm)       N
0 (CK)                   10       100.0     100.0    100.0    100.0    100.0    100.0    100.0      0.0      0.0      0.0       0.0       0.0       0.0       0.0

  250          0-5       6          0.0        0.0     0.0      0.0      0.0      0.0      0.0    100.0    100.0   100.0     100.0     100.0     100.0     100.0
  250          5-10      12         0.0       20.0   100.0    100.0    100.0    100.0    100.0     16.7     58.3    83.3      83.3      83.3      83.3      83.3
  250         10-15      12        16.7       50.0    62.5     62.5    100.0    100.0     87.5      0.0     33.3    33.3      33.3      33.3      33.3      33.3
  250         20-25      12         8.3       72.5    90.9     90.9     90.9     90.9     90.9      0.0      8.3     8.3       8.3       8.3       8.3       8.3

  500          0-5       6            0.0      0.0      0.0      0.0      0.0      0.0      0.0    16.7    100.0   100.0     100.0     100.0     100.0     100.0
  500         5-10       10           0.0      0.0      0.0      0.0      0.0      0.0      0.0    10.0     90.0   100.0     100.0     100.0     100.0     100.0
  500         10-15      14           0.0      7.1     33.3     33.3     33.3     33.3     33.3     7.1     78.6    78.6      78.6      78.6      78.6      78.6
  500         20-25      10           0.0     10.0     50.0     75.0     75.0     75.0     75.0     0.0     60.0    60.0      60.0      60.0      60.0      60.0


Table 2. Percentage feeding and mortality of TLJB grubs exposed to treated soil with Admire® in soil solumn tests
Solution      Soil                          % Feeding of post-treatment (weeks)                           % Mortality of post-treatment (days)
  (ml)       depth                1          2      3       4        5      6            >10        7      14     21       28      35      42             >70
             (cm)       N
0 (CK)                  10    100.0         100.0    100.0    100.0    100.0    100.0    100.0     0.0      0.0     0.0       0.0       0.0       0.0       0.0

  250         0-5       6          0.0       0.0      0.0      0.0      0.0      0.0      0.0     33.3     50.0    66.7     100.0     100.0     100.0     100.0
  250        5-10       12         0.0       8.3     16.7     16.7     16.7     16.7     16.7     25.0     25.0    41.7      41.7      41.7      41.7      83.3
  250        10-15      12         0.0      25.0     25.0     25.0     41.7     41.7      8.3      0.0      0.0     0.0       0.0       0.0       8.3      91.7
  250        20-25      12        25.0      41.7     83.3     66.7     25.0     41.7     16.7      0.0      0.0     0.0       0.0       0.0       0.0      83.3

  500         0-5       6          0.0        0.0     0.0      0.0      0.0      0.0      0.0     16.7     33.3    50.0      66.7     100.0     100.0     100.0
  500        5-10       12         0.0        0.0     0.0      0.0      0.0      0.0      0.0      8.3     41.7    75.0      91.7     100.0     100.0     100.0
  500        10-15      12         0.0        0.0     0.0      0.0      0.0      0.0      0.0      0.0      8.3    41.7     100.0     100.0     100.0     100.0
  500        20-25      12         0.0        0.0     0.0      0.0      0.0      0.0      0.0      0.0      8.3    16.7      16.7      16.7      33.3      91.7




                                                                                            127
California Tree Fruit Agreement
2007 Annual Research Report




Table 3. Comparison of feeding and mortality percentages of TLJB grubs exposed to treated soil (with reduced application rate of
Admire®) in the absence and presence of a water drench in the soil column to facilitate insecticide movement through the soil (note
that mortality data is still being collected on this test).
Solution      Water       Soil    Instars   N       % Feeding of post-treatment      % Mortality of post-treatment
  (ml)        (ml)       depth                               (weeks)                           (weeks)
                         (cm)                      1       2         3        5      1       2         3      5
   0            0          10      3rd      10   100.0    100.0    100.0     100.0    0.0     0.0       0.0     0.0
(Check)

  150           0          0-5     3rd      12     0.0      0.0      0.0      0.0    16.7    16.7     41.7    83.3
  150           0         5-10     3rd      12     0.0      0.0      0.0      0.0     8.3    25.0     25.0    33.3
  150           0        10-15     3rd      12    63.6     63.6     63.6    100.0     0.0     0.0      0.0     9.1
  150           0        20-25     3rd      12   100.0    100.0    100.0    100.0     0.0     0.0      0.0     0.0

  150          150        0-5      3rd      14     0.0      0.0      0.0      0.0    14.3    14.3     35.7    71.4
  150          150        5-10     3rd      12     0.0      0.0      0.0      0.0    16.7    16.7     33.3    83.3
  150          150       10-15     3rd      12     8.3      8.3      8.3      8.3     8.3     8.3     16.7    16.7
  150          150       20-25     3rd       6    16.7     33.3    100.0    100.0     0.0     0.0      0.0     0.0

  150          150       20-25     1st      6      0.0      0.0      0.0       0.0    0.0     0.0     16.7    50.0




                                                                             128
California Tree Fruit Agreement
2007 Annual Research Report




A GREATER NUMBER OF
ROOTSTOCK CHOICES CAN PROVIDE
A PARTIAL ALTERNATIVE TO
METHYL BROMIDE FUMIGATION
PROJECT LEADER:                   Dr. Michael McKenry


OVERVIEW

From 2004 to 2007 we developed a nematode rootstock profile for roughly forty different Prunus
rootstocks having the potential of becoming an alternative to Nemaguard rootstock. In
conducting these studies we became aware that there may be as many as 80 Prunus rootstocks
available across the globe. Some of these are not very different from those in our studies while
others may be ones we have already screened but under a different name. In general we believe
we have developed the nematode host status for the bulk of Prunus rootstocks currently
available. Our studies received funding from CTFA and California Almond Board; the latter
group being more interested in stocks imparting vigor greater than that of Nemaguard. An
important bias in our study was to make sure we also searched among rootstocks having
parentage quite different from that of Nemaguard. Although some of these studies were
originally planned to be 6-month studies we quickly learned that our best answers were coming
from studies that lasted two years as populations we thought were not resistant actually finally
showed their resistance and vice versa. For ring nematode we planned on a 2-year study but we
are now aware of a short-coming when evaluating Viking, Atlas and Hansen 536 rootstocks so
half of the ring nematode tests will be continued into a third-year.

Three fourths of the rootstocks were resistant to root-knot nematode, an aggressive population of
Meloidogyne incognita. There are other species and races of root-knot nematode but the
population we chose did exhibit abundant virulence as it enabled the separation of Guardian from
Nemaguard as well as a few other surprises. The thirty-one rootstocks with resistance to root-
knot oftentimes had Nemaguard within their parentage but, not always. Other sources of
resistance included Okinawa parentage and in one case the parentage also included Harrow
Blood (HBOK). Hiawatha is also known for its root- knot resistance.

Only a single grouping of rootstocks provided resistance to Pratylenchus vulnus, root-lesion
nematode. These stocks are named Krymsk 1 and Krymsk 2 and originate from the Black Sea
area of the Ukraine. These two stocks contain Prunus tomentosa as one of the parents and this
source we reported many years ago to possess resistance to this nematode. During these studies




                                               129
California Tree Fruit Agreement
2007 Annual Research Report




we learned that this cross of P. tomentosa and P. cerasiferae also provides tolerance to feeding
by root-lesion and root-knot nematodes.
We can also report there is moderate tolerance to root-lesion within Garnem rootstock however
this rootstock is highly susceptible to ring nematode and therefore Bacterial Canker Complex.
All the other rootstocks were susceptible to P. vulnus but several of the stocks were significantly
more susceptible than Nemaguard so there are some rootstocks that should be avoided.

We did not find a single rootstock that could be referred to as resistant to ring nematode,
Criconemoides xenoplax. Viking and Atlas came the closest to being called resistant but only
when they had been in a commercial setting for at least three years. Lovell supports
approximately 40% of the ring nematode population of Nemaguard, and Guardian approximately
60% of that of Nemaguard. In three replicated field tests monitored at 3 to 7 years after planting
the ring nematode populations on Viking did not exceed 15% of that found on Nemaguard. As
previously experienced with grape rootstocks, there must be fewer than 5% of the own-rooted
population level for us to refer to a rootstock as resistant to ring nematode.

The Prunus/nematode profiles that we have developed from these studies have major value as an
indicator of which rootstocks not to choose when searching for an alternative to Nemaguard. In
the results section we indicate a short list of rootstocks having value as long as their limitations
are also taken into account.

OBJECTIVES

1) In greenhouse or small plot settings determine first year growth rate of Nemaguard compared
   to eight alternative rootstocks in the presence of replant soil with or without nematodes
   compared to fumigated soil.
2) Determine first and second year growth rate of eight alternative rootstocks in various field
   settings previously planted to Nemaguard or Marianna Plum.
3) Interact with farm advisors, extension specialists, or the Protected Harvest group to insert
   field diagnosis, use of new rootstocks, Roundup treatments, and other strategies into the
   overall replanting process where MB and Telone II will not be used.

PROCEDURES

Obj. 1. In 2005 we installed in randomized complete blocks six replicates of six rootstocks,
irrigated by drip for one full season. This was a small plot study. The rootstocks included
Marianna 2624, Nemaguard, Viking, two sets of Torinel, Empyrean 2, and Atlas. We then
harvested entire trees and their roots to determine tree biomass and nematode development.

Obj. 2. Trees to be planted include some that are ½ or ¼ Nemaguard parentage and a few with
no Nemaguard parentage (Krymsk 1 and Flordaguard). They will be planted into a field with P.
vulnus nematode and M. incognita nematode present. Trees will be planted on 8-foot spacings
down the row with 15 feet between rows. In spring 2006 trees will be budded to a common plum
or peach scion. The planting site consists of one row treated with Telone II adjacent to an
untreated row with eight reps of each. Tree growth will be monitored along with nematode
development. Selections include: Nemaguard, Empyrean 2, Monegro, Torinel, Viking,




                                                130
California Tree Fruit Agreement
2007 Annual Research Report




Krymsk 1, open space, Marianna 2624, Krymsk 8, Flordaguard, Garnem, and Cadaman. One of
our goals is to eventually monitor yield and fruit size from these trees.

Obj. 3. Interactions with personnel from the Protected Harvest group have been meager. This PI
is submitting for a large grant to study the entire process of replanting without methyl bromide or
Telone. If that grant is funded the work will be in grower settings and with the assistance of
interested farm advisors.

RESULTS AND DISCUSSION

Our nematode/Prunus rootstock profiles can be summarized into three charts where host status of
the various rootstocks is compared to that of Nemaguard. The affinity of root-knot nematode,
Meloidogyne incognita, for the various rootstocks is listed in Chart 1. Notice the lengthy list of
rootstocks available for root-knot nematode resistance.

The affinity of root-lesion nematode, Pratylenchus vulnus, for the various rootstocks is listed in
Chart 2. Notice the only source of resistance is Krymsk 1 and its parentage is Prunus tomentosa.
Garnem, Bright’s Hybrid and Hansen 536 exhibit moderate resistance. The remaining rootstocks
are all susceptible to root-lesion nematode but there are some that are likely poorer hosts than
others with Nemaguard approximately in the middle of the list.

The affinity of ring nematode, Criconemoides xenoplax, for the various rootstocks is listed in
Chart 3. It was the development of this latter chart where we encountered greatest difficulties
when comparing our two-year data sets with data that came from farm advisor trials in
commercial field settings. Notice that we conducted tests on Viking in 04-05 and then repeated
them in 06-07 only to find the same result but both these results are different from 3-year field
tests. We will continue this trial for one more year before we publish any of our rootstock
profiles. It appears that 2 years of evaluation against ring nematode is not as accurate as 3-year
evaluations. Field evaluations indicate our data for Atlas, Viking and Hansen 536 are inaccurate
and we do not currently have an explanation for this discrepancy.

In spring 2007 John Slaughter of Burchell Nursery assisted us with grafting of various scions
onto various rootstocks. Our particular interest was scion compatibilities of Krymsk 1 and
Flordaguard but he also grafted eight other rootstocks in which we still have interest. In Table 4
we have indicated the compatibility of Krymsk 1 for a dozen scions. It appears that these 12
scions have affinity for Krymsk 1 in the first year but with all the suckering we are seeing we
anticipate perhaps some problems ahead. Meanwhile, we do have four-year old Krymsk 1 with
nonpareil almond as a scion and it has never suckered. Perhaps Krymsk 1 needs to be disbudded
at grafting time.

Roger Duncan, the farm advisor in Stanislaus Co, is conducting a field trial with a number of
rootstocks that were not available when we first began this four-year study.
We sampled that site in 2005 and will do so again in 2007-08, see Table 5. We believe data from
his research site are providing useful answers about ring nematode but also he has one HBOK
rootstock under evaluation that is performing as well as Viking. Viking always starts out better in
fumigated soil but Okinawa parentage may provide tolerance to the rejection component of the



                                                131
California Tree Fruit Agreement
2007 Annual Research Report




replant problem. It does in Hansen 536. Apparently HBOK-1 is also slightly reduced in vigor
when compared to Nemaguard.

ROOTSTOCKS OF FURTHER INTEREST TO STONE FRUIT GROWERS
Viking Rootstock
Bare root trees of Viking rootstock [(plum x almond) X Nemaguard] have always grown best for
us when planted to fumigated soil compared to non-fumigated. This has occurred whether they
were planted to soil with nematodes but no replant problem; or when planted to the replant
problem alone. The nursery has long indicated that roots of Viking should not be allowed to dry
out just prior to planting but from our studies young roots of Viking are susceptible to many
types of root feeding or obvious damage that might occur in their first leaf or just prior to
planting. Strip fumigation will benefit the first-year growth of these trees and in the second year
any poor growth can usually be overcome. This rootstock needs to be on the top of the rootstock
list for any stone fruit replanting that occurs in sandy or loamy sand soils where ring nematode is
known to occur. In many of these sandy soils there is also present the root-lesion nematode.
Viking is a slightly better host for root-lesion than Nemaguard. It appears to be equal to
Nemaguard in its resistance to root-knot nematodes. Viking exhibits affinity to all the same
scions as Nemaguard.

Hansen 536 Rootstock
This hybrid of Titan almond x Okinawa peach can impart 20% more vigor than Nemaguard.
Those growers not wishing to fumigate can achieve excellent first-year stands by treating the
previous Nemaguard orchard with Roundup and waiting a full year.
Hansen 536 is of parentage that provides tolerance to the rejection component of the replant
problem. It displays adequate resistance to root knot nematode when following Nemaguard. It
displays resistance to root-lesion nematode that is somewhat better than that of Nemaguard.
However, its downfall is that it is a superior host of ring nematode so it should not be planted
into soils having high water infiltration capability, primarily sands or well structured clay loam
soils. This is a rootstock suited to fine sandy loam or silty textured soils where plenty of vigor is
not a problem.

HBOK rootstocks
We have not evaluated this grouping of stocks as thoroughly as others discussed here. One
selection, HBOK-10, was as resistant to root-knot as Nemaguard but supported half the number
of root-lesion as Nemaguard. Another selection HBOK-50 supported five-fold the population of
root-lesion that Nemaguard supported while providing root-knot nematode resistance. Then, in a
3-year-old field trial of Roger Duncan it was apparent HBOK-1 showed ring nematode
protection greater than that of Lovell and similar to that of Viking among the replicated
rootstocks. This grouping of selections needs greater investigation because Okinawa parentage
could likely provide greater tolerance to the rejection component of the replant problem.

Krymsk 1
This is the only rootstock we have identified to provide resistance to root-lesion nematode. It is
dwarfing by as much as 50% of that of Nemaguard. It hosts ring nematode at about the same
level as Nemaguard so avoidance of sandy soils would be important. It has a resistance



                                                 132
California Tree Fruit Agreement
2007 Annual Research Report




mechanism to root-knot nematodes within root tissues older than 60 days but at its root tips it is
susceptible to root-knot. Lovell, for example, is root- knot susceptible even within tissues that
are five years old. Krymsk 1 rootstock has peculiar grafting affinities and the scions may not
fully express incompatibility in their first year. It also suckers, thus there is need to obtain
nursery stock that has been disbudded below the graft union.

Guardian
This rootstock is an offspring of the 1937 Stribling 37 rootstock. It does support some
populations of root-knot nematode, M. incognita, but like Krymsk 1 can limit nematode infection
to its youngest roots. It is preferred for the protection it offers against ring nematode but our
evaluations indicate that protection is not quite as good as that offered by Lovell. Against the
root-lesion nematode it has performed similar to Nemaguard.
This rootstock offers vigor similar to Nemaguard and will be useful in Bacterial Canker sites that
have received a good pre-plant fumigation.

FUTURE EXPIREMINATION
Based on the above rootstock information we now have at least two rootstocks worthy of field
evaluation in settings where pre-plant fumigation is not planned. These include Krymsk 1,
particularly in sites where root-lesion nematode is prevalent and HBOK, particularly HBOK-1 in
sites where ring nematode is prevalent. In ring nematode sites where strip fumigation is
permissible it is Viking and Guardian rootstocks that should be considered. Wherever there is an
8 to 10 foot wide strip application the rejection component is adequately controlled but
nematodes are missed beyond that zone. Where trees are to be replanted without fumigation we
will be treating the previous Nemaguard trees with Roundup, waiting a full year and then
replanting on one of these two rootstocks that looks promising.




                                               133
California Tree Fruit Agreement
2007 Annual Research Report




Table 1. Ranking of Prunus rootstocks against M. incognita
                                    A 2-year study
                                   nematodes/gr root

Pistacia atlantica                        0
Nemaguard                                 0
Garnem                                    0
Bright's Hybrid-4                         0
Julior                                    0
Bright's Hybrid-1                         0
Hansen 536                                0
Flordaguard                               0
Torinel                                   0
Empyrean 2                                0
Hiawatha                                  0
Cornerstone                               0
Viking                                    0
Empyrean 1                                0
Okinawa                                   0
Cadaman                                   0
Pumiselect                                0
Ishtara                                   0
Monegro                                   0
Atlas                                     0
Nickels                                   0
Flor x Alnem                              0
Krymsk 8                                  0
RedGlow                                   0
Citation                                  0
MRS 2-8                                   0
HBOK 50                                   0
Flor x weep peach                         0
Bright's Hybrid-5                         0
HBOK-10                                0.08
Empyrean 101                           0.29
Empyrean 3                             0.91
Controller 9                           11.6
Guardian                               12.1
Krymsk 1                               15.9
Paramount                                17
Lovell                                   31
Krymsk 2                               31.4
Controller 5                           42.9
Krymsk 86                              51.6
                                            P=0.05




                                              134
California Tree Fruit Agreement
2007 Annual Research Report




Table 2. Ranking of Prunus rootstocks against P. vulnus
                    A 2-year study as % of       Soil counts reported as a % of those on Nemaguard

                         nematodes/gr rootNemaguard 2-year trial          3-year field trial        7-year field trial
Krymsk 2                             0.03               0.40%
Krymsk 1                             0.17                   2.4
Pistacia atlantica                     0.2                  2.8
Garnem                                 0.3                  4.2
Bright's Hybrid -4                     0.5                    7
Bright's Hybrid -5                     0.6                  8.4
Hansen 536                           0.61                   8.6                                22                    187
Bright's Hybrid-1                    0.63                   8.9                                                      189
Paramount                              1.2                16.9
Controller 9                           1.6                22.5
Flordaguard                            1.6                22.5
HBOK-10                                3.3                   46
Empyrean 2                               5                70.4                             294
Torinel                                5.3                   75
Guardian                               6.2                87.3                             111                       138
Hiawatha                               6.8                   96
Nemaguard                              7.1                 100            (actual # 1.8) 100        (actual # 305) 100
Lovell                                 7.4                 104                            411                      247
Cornerstone                            8.5
Viking                                 8.9                                                211                        100
Empyrean 1                               9                                               1133
Okinawa                                9.7
Cadaman                              10.8                                                1344
Krymsk 86                               11
Pumiselect                           11.7
Ishtara                              13.7
Citation                             17.4
Monegro                              17.7
Atlas                                23.9                                                1177                        204
Nickels                              26.3                                                  22                        183
Flor x Alnem                         27.2
Krymsk 8                             28.9
Redglow                              32.3
MRS 2-8                              37.7
HBOK-50                                 39
Flor x Weep peach                      40
Controller 5                         51.6
Empyrean 101                         57.6
Julior                               71.4                                              38,611
Empyrean 3                           72.8
                                                                 P=0.05




                                                       135
California Tree Fruit Agreement
2007 Annual Research Report




Table 3. Ranking of Prunus rootstocks against Criconemoides xenoplax
                    2-yr soil counts expressed    Values reported as a % of that on Nemaguard
                      as a % of Nemaguard          3-yr field trial 7-yr field trial    7-yr field trial
Lovell 04-05                                   48                  1                 26
Lovell 06-07                                   34
Flordaguard                                    40
Hiawatha                                       56
UCB1 Pistachio                                 58
Guardian                                       61               111                  44
Pumiselect                                     63
Bright's Hybrid -1                             67                                  153               147
Bright's Hybrid-5                              68
Torinel                                        71
Hansen 536                                     73              7300                119               430
E54-043                                        75
Viking 06-07                                   78
Krymsk 1                                       94
Viking 04-05                                   95                  0                 13                  0
Cadaman                                        96                 94
Nemaguard 04-07                              100      (38.1) 100        (423) 100           (375) 100
Del Rey Plum                                 108
MRS 2-8                                      109
Marianna 2624                                113
Empyrean 1                                   117                  13
Cornerstone                                  117               6200
D63-182                                      118
Nickels                                      119                578                104               159
Krymsk 86                                    121
E54-043                                      130
Monegro                                      140
Ishtara                                      148
Garnem                                       193
Atlas                                        234                   0                 95                  9
Empyrean 2                                   323                  92
Julior                                       406               4870




                                                    136
California Tree Fruit Agreement
2007 Annual Research Report




Table 4. First-year grafting affinity of Krymsk 1 rootstock for various scions
                                        % take      % trees w/ sprouts
Spring Flare Nectarine                         100                        100
Spring Flame Peach                             100                        100
J40.111 Peach                                    66                       100
July Flame Peach                               100                        100
Glacier White Peach                            100                        100

Black Splendor Plum                              83                          100
Owen T Plum                                     100                           60
Tulare Giant Prune                              100                          100
French Prune                                    100                           80
Castlebrite Apricot                             100                           80

Padre Almond                                    100                          83
Nonpareil Almond                                100                          80




Table 5. Field trial data from Roger Duncan field trial, Stanislaus Co.
                              ring nema     root lesion      root knot
Rootstock
Nickles                               1705                24            11
K119-50                               1348               5.8          165
Hansen 536                            1239              148            0.2
Hiawatha                                937               35           4.4
Prunus subhirtella                      895               11          426
Controller 9                            860               38          125
Nemaguard                               676             218              1
Controller 5                            656               82          161
Flordaguard                             587             107            0.2
Cadaman                                 521              3.7             0
St Anthony                              463               27            50
HBOK-32                                 413             108            5.3
Atlas                                   281             106             18
Guardian                                275              2.8            66
Prunus mira                             273                5             0
Compass                                 249             172            4.5
Lovell                                  215             101          12.4
HBOK-15                                 171             434              0
Viking                                  163               14             1
HBOK-1                                  163               61             0
Prunus ferganensis                       66              3.8          153
HBOK-17(1 rep only)                       6                0            56




                                                    137
California Tree Fruit Agreement
2007 Annual Research Report




SOURCES OF INOCULUM, BIOLOGY,
EPIDEMIOLOGY, AND TRANSMISSION OF
SOUR ROT OF STONE FRUIT AND
MANAGEMENT OF THE DISEASE IN THE
ORCHARD
PROJECT LEADER:                   Dr. Themis J. Michailides

COOPERATORS:                      M. Yaghmour, D. P. Morgan, H. Reyes,
                                  Dr. C. Crisosto, and Dr. J.E. Adaskaveg

INTRODUCTION

In early July 2001, various samples of nectarine and peach fruit from orchards in northern Tulare
and in Fresno counties and from packinghouses in this area were brought to our laboratory for
diagnosis of an unusual decay. When the decay lesions originated close to the stylar end, leaking
juice streamed from the lesions. When the lesion was on the stem end of the fruit and touched the
packing box, it developed a ring-shape decay of 0.5 to 2.0 cm inner and 1.0 to 3.0 cm outer
diameter. The leaking juice dissolved the cuticle, the epidermis, and the outer layers of the flesh,
creating distinct furrows in the fruit tissue. Samples with similar decay lesions were observed
and isolations were made several times during 2001-2007.

Isolations from these fruit consistently yielded Geotrichum candidum frequently along with two
other yeasts, which were identified as Issatchenkia scutulata and Kloeckera apiculata. G.
candidum was isolated more frequently than the other two yeasts. Pathogenicity tests were
performed with all three organisms, and we concluded that each of these yeasts by itself and in
combination with one or both of the others was able to cause sour rot decay on stone fruit
(Michailides et al., 2004). Because G. candidum was shown to be more aggressive than the other
yeasts and was the most frequently isolated microorganism, all the inoculation and transmission
experiments were done using G. candidum isolates.

During 2005 to 2007 significant progress was made in understanding the biology of the main
cause of sour rot (G. candidum) and the various factors affecting the disease in California stone
fruit orchards. Specifically, the objectives in 2007 were:




                                                138
California Tree Fruit Agreement
2007 Annual Research Report




OBJECTIVES

1. Determine differences in pathogenicity and polygalacturonase production by G. candidum
   corresponding to various levels of virulence.
2. Complete the study on stone fruit cultivar susceptibility.
3. Determine whether G. candidum multiplies in the packinghouse.
4. Identify sanitation practices in harvest equipment and the field which can reduce sour rot
   decay.

METHODS AND RESULTS

1.     Determine differences in pathogenicity and polygalacturonase production by
G. candidum corresponding to various levels of virulence.
In 2006, we compared 41 isolates of Geotrichum candidum isolated from soil, decayed fruit,
packing lines, and surfaces of peach leaves and fruits for their pathogenicity and found that all of
them were pathogenic with some differences in pathogenicity. In 2007, we tested Geotrichum
citri-aurantii the causal agent of sour rot on citrus. An isolate of G. citri-aurantii was grown on
acidified potato-dextrose agar for 72 hours, and a 106 spores/ml suspension was prepared and
used to inoculate nectarine fruits. The isolate was tested in a randomized complete design with
four replicates and three subsamples. Nectarine fruits were surface sterilized by dipping them in
a solution of 160 ml of chlorine, 160 ml ethanol, and 0.5 ml Tween 20 surfactant in 10 liters
water for 4 minutes. Fruits were placed on a raised plastic mesh in plastic containers and water
was added to the bottom of the containers to create high humidity (close to 100% relative
humidity). Fruits were wounded and inoculated with 20 µl of 106 spores/ml. The plastic
containers were incubated on a laboratory bench (74°±2°F). Pathogenicity of the isolates and
lesion diameter were recorded after 5 days inoculation.

Geotrichum citri-aurantii was found to be pathogenic on nectarine fruits and caused and average
lesion size of 18.7 mm. The citrus strain is considered very pathogenic if compared to the most
pathogenic isolates of G. candidum causing the highest decay on nectarine fruits (Fig. 1). This
result suggests that the citrus strain may be as virulent as the isolates collected from decayed
stone fruits, soil, and packing house isolates. More citrus isolates is need to confirm this result.
Also this result suggests that extra caution needs to be taken when processing stone fruits and
citrus fruits with the same packing line at the end of the citrus packing and the beginning of the
stone fruit season, as well as to dispose cull citrus fruits away from stone fruit orchards.

Polygalacturonase (PGase) production: Polygalacturonase activity of 18 isolates of
G. candidum, and one isolate of G. citri-aurantii, used for the pathogenicity experiments was
used in this experiment. Geotrichum isolates were grown in 50 ml of yeast extract pectin broth
(0.3% yeast extract and 0.5% pectin). The cultures were inoculated with a spore suspension of
each Geotrichum isolate. A negative control was inoculated with sterilized water and incubated
at 77°F for 72 hours in the dark on a rotary shaker operated at 100 rpm. Cultures were filtered
using a 0.45-µm Millipore filter and the samples were stored at -4°F until used for analysis. A
quick method, the cup-plate assay, was used to determine any differences among the Geotrichum
isolates. Media for the cup-plate enzyme assay were prepared using sodium polypectate as a
substrate for polygalacturonase and poured into plates of 15 cm in diameter. Wells were created



                                                139
California Tree Fruit Agreement
2007 Annual Research Report




by removing agar plugs with a #2 cork borer, and 100 µl of each sample were dispensed in each
well as, and each sample was duplicated in a different well on the same plate. Possible
relationships between PGase production and pathogenicity were determined. Differences among
pathogenicity, virulence, and PGase activity will indicate variability in the pathogen’s
population. Great diversity in pathogen population suggests that control can be more difficult
than with a uniform fungal population.

There were differences in enzyme production by different isolates using the cup- plate assay.
Enzyme activity was as low as 9.5 mm for isolate 16 and 20 mm for isolates 1, 3, and 4 (Fig. 2A).
To decide if disease severity represented by lesion size is dependent upon enzyme production,
lesion size was plotted against enzyme production. R square explaining the relationship between
the lesion size and enzyme production was low (0.11). This is due to the fact that there were few
highly pathogenic isolates that produced low amounts of enzyme as compared to other isolates.
In general, a trend of increased severity was associated with increased production of
polygalacturonase (Fig. 2B). Citrus strain production of polygalacturonase was among the
highest producing isolates and the activity zone was 18.5 mm. The production of
polygalacturonase is an important pathogenicity factor among bacterial and fungal pathogens
causing soft rot and post harvest rots by dissolving the middle lamella that adheres plant cells
together, resulting in the disintegration of plant tissues. A more accurate method
(i.e., viscometry) will be used to look more closely at the differences among different isolates
which may suggest a more diverse population of G. candidum.

2. Complete the study on cultivar susceptibility.
In 2006, we compared several varieties of peaches and nectarines and we found some differences
in susceptibility. In 2007 we evaluated 36 varieties for their susceptibility to sour rot. Fruits
were collected from commercial orchards that have not been treated with fungicides. Fruits were
surface sterilized by dipping them in a solution of 160 ml of chlorine, 160 ml ethanol, and 0.5 ml
Tween 20 surfactant in 10 liters water for 4 minutes. Fruits then were placed randomly on plastic
trays and placed in boxes in a randomized complete block design with 8 replicates and 4
subsamples per replicate (32 fruits per variety). Fruits were wound inoculated with a 106
spores/ml suspension and were incubated at 68°F and 90% humidity for 5 days. Disease severity
was measured as decay lesion diameter.

There were significant differences between different varieties (Fig. 3A). In general, white flesh
varieties tested in this experiment were more resistant to sour rot than yellow flesh varieties
(Fig. 3B). The most susceptible varieties were 2 yellow varieties with a lesion size of 17.3 and
18.3 mm, respectively. The most resistant varieties developed lesions with less than 3 mm in
diameter. Gil et al. (2002) compared yellow and white flesh cultivars for their content of
phenolic compounds and other chemicals present in the peel and flesh and found significantly
high phenolic compounds in some varieties (such as Snow King and Bright Pearl), which were
tested by us for sour rot susceptibility and found them to be more resistant to sour rot than Spring
Lady which had significantly lower amounts of phenolics. They also found that titratable acidity
was higher in yellow flesh than white flesh peach cultivars. Prusky (1996) reviewed pathogen
quiescence in post harvest diseases and discussed fruit factors and how high acidity in unripe
fruits and high phenolics could contribute to fruits being less susceptible to certain postharvest
diseases. On the other hand, Prusky and Lichter reviewed the effect of pH on the expression of



                                                140
California Tree Fruit Agreement
2007 Annual Research Report




fungal virulence factors such as the enzyme polygalactorunase. Acidic environments enhanced
the expression of polygalactorunase genes in fungi such as Botrytis cinerea and Penicillium
expansum. Polygalacturonase expression was high at pH 4, but then was minor at pH 5. This
may explain why yellow varieties (which are more acidic than the white varieties) were more
susceptible to G. candidum which produces polygalactorunase, too. The sour rot susceptibility
study suggests that special care is needed when harvesting and handling the yellow varieties to
minimize any physical damage that may cause any injuries resulting in an increase in disease
severity, and also to closely monitor those varieties during fruit preconditioning.

Because high relative humidity is a critical factor for the development of sour rot decay, in 2007,
we designed and experiment to test the effect of different relative humidities (100%, 99%, 85%,
and 75%) created by various salt solutions (Winston & Bates, 1960) in sealed plastic container.
Fruits were surface sterilized and inoculated with spore suspension as described above. Fruits
were incubated at 68°F.

There was no significant difference between different relative humidities. The highest disease
severity was at 100% and 99%, and then dropped as expected as the relative humidity dropped to
85%, and increased unexpectedly as the relative humidity decreased to 75%. This inconsistency
in disease severity might be due to the fungus acquiring humidity and water necessary for its
growth directly from the saturated fruit tissues via the wound. To test this theory again, fruits
will be inoculated without wound, and it is of relevance to test the effect of different relative
humidity on spore germinations and growth and infection of unwounded fruit.

3. Determine whether G. candidum multiplies in the packinghouse.
A packing line in each of seven packing houses was sampled six times during the 2007 season.
Samples were taken by sampling randomly the surfaces of the line at different locations (Fig. 4)
using Rodac plates containing potato dextrose agar amended with novobiocin (Nov-PDA) and
supplemented with fludioxonil. The locations where sampling was done included the fruit
dumping location, the brushes, belt after the brushes, and finally the fruit sorting tables.

Propagules of G. candidum were detected on all four areas sampled in five packinghouses out of
seven (Fig. 5A, B, C, F & G) at some point during the whole period of sampling. In three
packinghouses where good sanitation measures were applied, the frequency and G. candidum
population was less than in other packinghouses (Fig. 5C, D & E). In those three packinghouses,
the packing line was cleaned every day after operation. These data confirmed the 2006 data and
suggested that the brushes may create minute wounds that allow nutrients from the fruit tissues
to leak and support the growth and reproduction of G. candidum and “inoculation” of the fruits
can occur in this way. The results also show that whenever good sanitation practices are taken,
then the frequency and numbers of G. candidum will be reduced, and thus the risk to have a sour
rot problem in the packing house will also be reduced.

We also collected solution that was drained after washing the fruit in the brush area to determine
if these liquids have enough nutrients (i.e., sugars, vitamins, etc.) may support growth and
reproduction of G. candidum. The solution was collected from one packinghouse in a sterile
container, stored at 36 to 39°F, and used either the same or the day following its collection. An
aliquot of 100 µl of the solution were plated on semi-selective media at time 0; then the solution



                                                141
California Tree Fruit Agreement
2007 Annual Research Report




was kept on a rotary shaker at 100 rpm and 77°F and then plated again every 24 hours for 72
hours. Any increase in the G. candidum propagules numbers will support the theory that
G. candidum has the ability to multiply in this solution.

There were no G. candidum propagules growing on the plates when the solution was plated
immediately after collection or after shaking in the rotary shaker. In a previous year, we could
detect G. candidum propagules in the solution, but no propagules were detected in the 2007
sampling. It might be that fruits were cleaner during the 2007 season and they did not bring a lot
of propagules of G. candidum to contaminate the wash solution. It seems that when fruit are
handled properly in the field and picked at proper maturity, and they are free of defects, it may
be possible to reduce the number of fruit that can be damaged by the packing system without
leaving any plant residues and fruit juice on the brushes. Another explanation could be the use of
Mentor® fungicide as a postharvest treatment has a major effect on G. candidum propagules
present in the solution.

4. Identify sanitation practices in harvest equipment and the field which can reduce sour
rot decay.
Compare orchards with tillage and non-tillage: In 2007 we could not locate fields with tillage to
compare orchards with tillage and non-tillage. In 2007 we repeated the experiment from 2006 to
evaluate the distribution and the numbers of G. candidum propagules in the soil, on the leaves,
and fruit surface in non-tilled orchards. Leaves, fruits, and soil samples were collected. Three
composite soil samples were collected from the top first inch per field from 43 peach and
nectarine orchards from Fresno, Kings, and Tulare counties. Twenty five leaves and 30 fruits
collected per orchard were washed with water and surfactant. The washings were plated in plates
containing Novobiocin-amended PDA (Nov-PDA) supplemented with 1 ppm fludioxonil, using
the Spiral Plater to enumerate the G. candidum propagules on leaf and fruit surface. A composite
soil sample of representative fields with different propagules levels of G. candidum and soils of
fields that did not yield any G. candidum were submitted to the UC Analytical Laboratory for
organic matter analysis. To determine disease incidence in cull fruits and in fruit boxes, ten
boxes of fruits were harvested directly from five fields (#56, #57, #59, #62, and #63); the fruits
were not treated with any fungicides, placed in industry’s standard cardboard boxes, and
incubated at 68ºF and >90% relative humidity for 5 days when incidence of fruit with sour rot
was recorded. In addition, we recorded the number of boxes showing at least one decayed fruit
with sour rot. Also cull fruit from the same fruit lots that were treated with Scholar® and
Mentor® in the packinhouse were collected and evaluated for sour rot as described earlier.

G. candidum was detected on the leaves in 7.1% of the fields and on the fruit surface in 3.6% of
the fields sampled. G. candidum was detected in soils of 44.2% fields sampled (Table 1). These
results confirmed the 2006 results that soil is a major source of inoculum of G. candidum that
can reach the canopy (leaves and fruit) and move to the packing house on plant material or
harvesting equipment.

Sour rot developed only in fruit of one field collected directly from the field without running
them through the packing line. The percentage of the fruit with sour rot from that field was 0.2%
and sour rot was present only in 10% of the boxes. On the other hand, sound cull fruit developed
sour rot after running fruits from the same lots through the packing line for all sampled fields



                                               142
California Tree Fruit Agreement
2007 Annual Research Report




(Fig. 6). The percentage of fruit decayed with sour rot ranged between 1 and 19.7%. This result
confirms that the packing line is a major source of inoculum and can “inoculate” fruit through
creating micro wounds and contaminating fruit that are sour rot free. These cull fruit were sorted
out after they have been treated with Scholar® and Mentor®. There is no report or any evidence
that G. candidum growing on treated fruit are resistant to these newly registered fungicides, or if
the infection already started before the fruit were treated in the packinghouse. Because a
Mentor® application may also be applied in the field for the control of other stone fruit diseases
(i.e., brown rot) prior to the treatment in the packinghouse, it is likely that there may be pressure
for the selection of resistant isolates of G. candidum. Therefore, there is a possibility for resistant
population to emerge in the field or the packinghouse. Screening isolates of G. candidum for
resistance to these fungicides could provide the stone fruit growers an advantage to make
decisions on resistance management. Currently, a number of isolates of G. candidum are being
checked for resistance to Scholar® and Mentor® fungicides.

Effect of soil depth. Soil samples were collected from five fields at three soil depths 1, 2, and 4
inches deep and population levels of G. candidum were determined as described earlier. In 2006
we recovered propagules of G. candidum in soil as deep as 4 inches. In 2007 we recovered
propagules also as deep as 4 inches. The highest population was in the top 1 inch and decreased
significantly as the depth increased. This result suggests that G. candidum population decreases
as soil depth increases due to non-tillage practices that allow the accumulation of fruit and plant
residues on the surface, resulting in higher population of G. candidum on the surface. Also this
result raises the questions whether G. candidum propagules can survive deep in the soil. If
G. candidum does not survive well deeper in soil than on the surface, plowing the field once in
while could serve as a cultural practice to reduce the propagules of G. candidum in soil.


CONCLUSIONS

     1. Main source of inoculum of sour rot decay caused by Geotrichum candidum of peach and
        nectarine is the orchard soil brought in the packinghouse as dust on the fruit surface and
        occasionally on leaf debris.

     2. No definite conclusions can be made regarding reproduction of G. candidum in the
        packinghouse, although G. candidum could be detected in wash water in one year and not
        in 2007.

     3. Based on the 2005, 2006, and 2007 results, G. candidum propagules can contaminate the
        packing line particularly at the fruit dump area and the area at the brushes and after the
        brushes and “inoculate” fruit that originated from orchards whose soil and fruit were free
        of any G. candidum propagules.

     4. The species Geotrichum citri-aurantii, whish attacks citrus, is as pathogenic as
        G. candidum to nectarines and produces polygalacturonase comparable to highly
        pathogenic isolates of G. candidum.




                                                  143
California Tree Fruit Agreement
2007 Annual Research Report




     5. Isolates of G. candidum from different substrates produced pectinolytic enzymes
        (polygalacturonase) that are considered pathogenicity factors and can be similar to those
        produced by bacteria and other fungi causing soft rots on different agricultural
        commodities. Differences in the production of polygalacturonase could account for
        differences in pathogenicity since there was a trend between enzyme production and
        disease severity.

     6. Peach and nectarine cultivars vary in their susceptibility to sour rot. In general, white
        flesh varieties are less susceptible to sour rot than yellow flesh. More care is needed when
        handling and processing sensitive cultivars to reduce injuries to fruits.

     7. Significant development of sour rot on cull fruit resulted mainly from contamination of
        the packing line with G. candidum propagules. These fruits were also treated with
        Mentor®, and the resistance of G. candidum to this fungicide is not known yet. Isolates
        are now being screened to determine if there are any resistant isolates that may have
        emerged in 2007. Screening isolates for resistance to Mentor® and/or Scholar® in a
        timely fashion will be an advantage to growers to make decisions on resistance
        management as needed.

     8. Populations of G. candidum decrease as soil depth increases. If G. candidum did not
        survive in deep soil as well as on the soil surface, then plowing the soil once in while
        would result in reducing the propagules of the pathogen in the orchard. More studies are
        needed on this area of investigation.




                                                 144
California Tree Fruit Agreement
2007 Annual Research Report




REFERENCES

Förster, H., Kanetis, L., and Adaskaveg, J. E. 2004. Spiral gradient dilution, a rapid method for
determining growth responses and 50% effective concentration values in fungus-fungicide
interactions. Phytopathology 94:163-170.

Gil, M. I., Tomas-Barberan, F. A., Hess-Pierce, B., and Kader, A. A. 2002. Antioxidant
capacities, phenlic compounds, carotenoids, and vitamine C contents of nectarine, peach, and
plum cultivars from California. Journal of Agric. and Food Chemistry 50:4976-4982.

Michailides, T. J., Morgan, D. P., and Day, K. R. 2003. First report of sour rot of California
peaches and nectarines caused by yeasts. Plant Disease 88:222.

Prusky, D. 1996. Pathogen quiescence in postharvest diseases. Annual Review of
Phytopathology. 34:413-434.

Prusky, D., and Lichter, A. 2007. Activation of quiescent infections by postharvest pathogens
during transition from the biotrophic to necrotrophic stage. FEMS Microbiol. Lett. 268:1-8.




                                                145
Table 1. California Tree Fruit Agreement
         Geotrichum candidum population on the surface of leaves, fruits, and soil of commercial orchards in 2006 and 2007.
        2007 Annual Research Report
                 Leaf surface         Fruit surface     Soil            Leaf surface       Fruit surface         Soil
      Field      (propagules/         (propagules/ (propagules/         (propagules/       (propagules/      (propagules/
                     leaf)                fruit)      gram)                 leaf)              fruit)           gram)
                                         2006                                                  2007
        5              100                   0         244.4                   0                  -                 0
        6                0                   0           0                   1.64                 -               16.7
        7                0                   0         44.4                    0                 0               1766.7
        8                0                   0           0                     0                 0                  0
        9                0                   0           0                     0                 0                77.8
        10               0                   0           0                     0                  -                 0
        19               0                   0           0                     0                 0                  0
        20               0                   0           0                     0                 0                  0
        21               0                   0         44.4                    0                 0                  0
        22               0                   0           0                     0                  -                 0
        23               0                   0           0                     0                  -                 0
        25               0                   0           0                     0                  -                 0
        27               0                   0           0                     0                 0                  0
        28             256                   0           0                     0                  -               105.6
        29               0                   0         88.9                    0                 0                  0
        31               5                  67         377.8                   0                 0                  0
        32               0                   0         155.6                   0                  -                 0
        33               0                   0           0                     0                  -                 0
        34               0                   0           0                     0                  -                 0
        35               0                   0          200                    0                  -                 0
        36               0                   0         1200                    0                 0                  0
        38               0                   0           0                     0                 0                255.6
        39               0                   0         555.6                   0                 0                55.6
        41               0                   0           0                     0                 0                  0
        42               0                   0         66.7                    0                 0                44.4
        43               0                   0         133.3                   0                 0                27.7
        44               0                   0         22.2                    0                  -              1344.4
        45               0                   0         22.2                    0                 0                27.8
        46               0                   0           0                     0                 0                27.8
        47               0                   0         333.3                   0                 0                16.6
        48               0                   0        2155.5                   0                 0               1177.8
        49               0                   0         866.7                   0                 0                  0
        50               0                   0           0                     0                 15               22.2
        51               0                   0       17111.1                   0                 0                  0
        52               0                   0           0                     0                 0                  0
        53               0                   0           0                     0                 0               1127.8
        54             323                 593         22.2                    0                 0                  0
        56              18                   0         66.7                    0                 0                194.4
        57             116                   0         133.3                   -                 0                  -
        59               0                   0        3333.3                  48                 0               2383.3
        60               8                   0         111.1                   0                 0                  0
        62               -                   -           -                    3.3                 -               455.6
        63               -                   -           -                     0                  -               44.4
        64               -                   -           -                     0                  -                 0



                                                                146
California Tree Fruit Agreement
2007 Annual Research Report




                                25.0




                                                                                                                                 Citru s strain
                                20.0
         L esio n size (m m )




                                15.0




                                10.0




                                 5.0




                                 0.0                                                                 9




                                                                                                                             8
                                                                                                                                      2
                                                                                                                                                  3
                                  25
                                       45
                                            18
                                                 38
                                                      35
                                                           20
                                                                31
                                                                     19
                                                                          48
                                                                                33
                                                                                     37
                                                                                          22
                                                                                                32


                                                                                                         10
                                                                                                              46
                                                                                                                   29
                                                                                                                        36
                                                                                      Isolate


     Figure 1. Pathogenicity and disease severity of 41 isolates of Geotrichum candidum
     isolated from leaves, fruit surface, soil, decayed nectarines and peaches, tomato, and from
     packing lines in commercial packinghouses.




                                                                          147
California Tree Fruit Agreement
2007 Annual Research Report




                                                                                                                                                   A


                                             20
         polygalacturonase production (mm)


                                             18
                                             16

                                             14
                                             12
                                             10
                                              8
                                              6

                                              4
                                              2
                                              0
                                                                  5




                                                                                                                       2




                                                                                                                                1

                                                                                                                                    3

                                                                                                                                        4
                                               16

                                                        13

                                                             46



                                                                      18

                                                                           17

                                                                                36

                                                                                     38

                                                                                          12

                                                                                                47

                                                                                                     37

                                                                                                           45




                                                                                                                           11




                                                                                                                                              48
                                                                                                                       s
                                                                                                                    tru
                                                                                                                 Ci
                                                                                                 Isolate


                                                                                                                                                   B


                                             25.0



                                             20.0                                                                           y = 0.4713x + 7.4641
                                                                                                                                 R2 = 0.111
         Lesion size (mm)




                                             15.0
                                                                                                                                    Series1
                                                                                                                                    Linear (Series1)
                                             10.0



                                              5.0



                                              0.0
                                                    0             5             10             15           20             25
                                                                  Polygalacturonase production (mm)



     Figure 2. A, Production of polygalacturonase from 18 different isolates of Geotrichum
     candidum and one isolate of G. citri-aurantii. B, Correlation between polygalacturonase
     production (measured as the diameter of the clear area of the polypectate medium in a
     cup-plate assay) and lesion size.



                                                                                               148
                                                                                                                          Lesion size (mm)                                           Lesion size (mm)




                                                                                                                                                                         0
                                                                                                                                                                             2
                                                                                                                                                                                 4
                                                                                                                                                                                      6
                                                                                                                                                                                            8
                                                                                                                                                                                                  10
                                                                                                                                                                                                       12
                                                                                                                                                                                                            14
                                                                                                                                                                                                                 16
                                                                                                                                                                                                                      18
                                                                                                                                                                                                                           20




                                                                                                                           0
                                                                                                                           2
                                                                                                                           4
                                                                                                                           6
                                                                                                                           8
                                                                                                                          10
                                                                                                                          12
                                                                                                                          14
                                                                                                                          16
                                                                                                                          18
                                                                                                                          20
                                                                                                                 White                                          fire sweet       A
                                                                                                                                                             Bright Pearl        A
                                                                                                                 White
                                                                                                                 White                                        sugar Giant        A
                                                                                                                                                                                                                                        2007 Annual Research Report




                                                                                                                 White                                                           A
                                                                                                                                                                                                                                        California Tree Fruit Agreement




                                                                                                                                                            early red Jim
                                                                                                                 White                                          Fire Pearl       AB
                                                                                                                 White                                     Giant Babook          AB
                                                                                                                 White
                                                                                                                                                              Yukon King             ABC
                                                                                                                 White
                                                                                                                 White                                         Snow King             ABC
                                                                                                                 White                                     Snow princes              ABCD
                                                                                                                 White                                           Zee Lady            ABCDE
                                                                                                                 Yellow                                       Fay Elberta             ABCDE
                                                                                                                 Yellow                                           Arkalian           ABCDE
                                                                                                                 Yellow
                                                                                                                 Yellow                                     Elegant Lady             ABCDE
                                                                                                                 Yellow                                           Zee lady           ABCDE
                                                                                                                 Yellow                                    Honey Royale              ABCDE
                                                                                                                 Yellow                                                              ABCDE
                                                                                                                                                                                                                                    A




                                                                                                                                                             Summer fire
                                                                                                                 Yellow




149
                                                                                                                                                              John Henry             ABCDE
                                                                                                                 Yellow                                             Sweet             ABCDEF
                                                                                                                 Yellow
                                                                                                                 Yellow                                       Snow flame              ABCDEF



                                                                                                                                                 Variety




                                                                                           Variety flesh color
                                                                                                                 Yellow                                              Ross             ABCDEF
                                                                                                                 Yellow                                    Independence                BCDEFG
                                                                                                                 Yellow                                           Summer               BCDEFG
                                                                                                                 Yellow                                        White lady              BCDEFG
                                                                                                                 Yellow                                           Red Top              BCDEFG
                                                                                                                 Yellow
                                                                                                                 Yellow                                             Regina                 CDEFG
                                                                                                                 Yellow                                          Mid Ripe                  CDEFG
                                                                                                                 Yellow                                             Nectar                  DEFG
                                                                                                                 Yellow                                      arctic queen                   DEFG
                                                                                                                 Yellow                                        May Grand                    EFG
                                                                                                                 Yellow                                         Gold Dust                   EFG
                                                                                                                 Yellow
                                                                                                                 Yellow                                        Fire sweet                   FG
                                                                                                                                                                                              G




      Figure 3. A, Sensitivity of different varieties to sour rot caused by Geotrichum
                                                                                                                                                                Sun Crest




      candidum; and B, Sensitivity of different varieties arranged by their flesh color.
                                                                                                                                                                    Loadel                      G
                                                                                                                                                                   Country                       G
                                                                                                                                                              Spring lady                                             H
                                                                                                                                                             Spring Crest                                                  H
                                                                                                                                Series1
                                                                                                                                             B
                                                                                                                                                                                                                                A
California Tree Fruit Agreement
2007 Annual Research Report




                                                                                  Geotrichum
            Geotrichum                                    Geotrichum
                                                                                  candidum
            candidum                                      candidum




           Fruit                  Washing with             Brushes            Treating with
          Dumping                  chlorinated                                   wax and
                                      water                                     fungicide

                                                                                               Geotrichum
                                                                                               candidum


       Preconditioning                       Packing                             Grading
     room (68-70°F and                        Line
        90-95/98 RH)



          Geotrichum                        Geotrichum
          candidum                          candidum                              Culls
                                                                                  Line




                                                                                  Geotrichum
                                                                                  candidum




     Figure 4. A diagram showing the areas of a packing line in a packinghouse where
     Geotrichum candidum propagules was recovered.




                                                 150
California Tree Fruit Agreement
2007 Annual Research Report




                                                                                                A

                                40

                                35
       G. candidum propagules




                                30                                                     Sampling 1
                                25                                                     Sampling 2
                                                                                       Sampling 3
                                20
                                                                                       Sampling 4
                                15                                                     Sampling 5
                                10                                                     Sampling 6

                                5

                                0
                                     Dumping   Brushes   After Brushes   Final table


                                                                                                B

                                40

                                35
       G. candidum propagules




                                30
                                                                                       Sampling 1
                                25                                                     Sampling 2
                                20                                                     Sampling 3

                                15                                                     Sampling 4
                                                                                       Sampling 5
                                10

                                5

                                0
                                     Dumping   Brushes   After Brushes   Final table




                                                                                                C

                                40

                                35
       G. candidum propagules




                                30                                                     Sampling 1
                                25                                                     Sampling 2
                                                                                       Sampling 3
                                20
                                                                                       Sampling 4
                                15                                                     Sampling 5
                                10                                                     Sampling 6

                                5

                                0
                                     Dumping   Brushes   After Brushes   Final table


                                                                                                D

                                40

                                35
       G. candidum propagules




                                30                                                     Sampling 1
                                25                                                     Sampling 2
                                                                                       Sampling 3
                                20
                                                                                       Sampling 4
                                15                                                     Sampling 5
                                10                                                     Sampling 6

                                5

                                0
                                     Dumping   Brushes   After Brushes   Final table




                                                                                                    151
California Tree Fruit Agreement
2007 Annual Research Report




                                                                                                          E

                                  40

                                  35
         G. candidum propagules


                                  30
                                                                                               Sampling 1
                                  25                                                           Sampling 2
                                  20                                                           Sampling 3
                                                                                               Sampling 4
                                  15
                                                                                               Sampling 5
                                  10

                                   5

                                   0
                                       Dumping    Brushes    After Brushes     Final table


                                                                                                          F

                                  40

                                  35
         G. candidum propagules




                                  30                                                           Sampling 1
                                  25                                                           Sampling 2
                                                                                               Sampling 3
                                  20
                                                                                               Sampling 4
                                  15                                                           Sampling 5
                                  10                                                           Sampling 6

                                   5

                                   0
                                       Dumping    Brushes    After Brushes     Final table




                                                                                                      G

                                  40

                                  35
       G. candidum propagules




                                  30
                                                                                             Sampling 1
                                  25
                                                                                             Sampling 2
                                  20                                                         Sampling 3

                                  15                                                         Sampling 4
                                                                                             Sampling 5
                                  10

                                  5

                                  0
                                       Dumping   Brushes    After Brushes    Final table




     Figure 5. Geotrichum candidum propagules per plate after sampling four times from
     various locations along the packing line in each packinghouse. Packing line B, E, and G
     was sampled only five times.




                                                                                                              152
California Tree Fruit Agreement
2007 Annual Research Report




                                               25
          Percentage of Fruits with sour rot
                                               20


                                               15
                                                                                   Field
                                                                                   Packing line
                                               10


                                               5


                                               0
                                                     1   2     3           4   5
                                                             Field




                                               100
          Percentage of boxes with sour rot




                                               90
                                               80
                                               70
                                               60
                                                                                   Field
                                               50
                                                                                   Packing line
                                               40
                                               30
                                               20
                                               10
                                                0
                                                     1   2     3           4   5
                                                             Field



     Figure 6. Percentage of fruits, and boxes with sour rot after collecting them directly from
     the field (white bars) or after processing through the packing line (black bars).




                                                                     153
California Tree Fruit Agreement
2007 Annual Research Report




                                   3000



                                   2500
         Propagules/gram of soil




                                   2000

                                                                                     1 inch
                                   1500                                              2 inches
                                                                                     4 inches

                                   1000


                                   500



                                     0
                                          1   2     3        4            5
                                                  Fields



     Figure 7. Soil population of Geotrichum candidum at different soil depths in five
     different orchards.




                                                    154
California Tree Fruit Agreement
2007 Annual Research Report




CONTROLLED ATMOSPHERE/HIGH
TEMPERATURE FORCED AIR: A NON-
CHEMICAL QUARANTINE TREATMENT
FOR STONE FRUIT

PROJECT LEADERS:                  Dr. David Obenland and Dr. Lisa Neven

This work is part of a continuing project designed to determine if controlled atmospheres
combined with high temperature forced air (CATTS) can be used as a quarantine treatment for
peaches and nectarines. An important part of this season’s work was to initiate experiments
using a semi-commercial scale CATTS chamber, and applying the treatment to boxed/palletized
fruit, to begin evaluating whether this treatment is feasible on a commercial scale.
Entomological work included research into two different technologies (controlled atmosphere
(CA) water bath and CA heating block) designed to speed the development of CATTS treatments
for new insect pests and the initiation of testing of the effectiveness of CATTS against San Jose
scale (SJS), European red mite (ERM) and spider mites (SM).

METHODS AND MATERIALS

Semi-commercial CATTS chamber installation
The new semi-commercial scale CATTS chamber arrived on July 9 and was installed by the
manufacturer (Techni-Systems, Chelan, WA) over a period of 11 days. This included assembly
and testing of heating and controlled atmosphere capabilities. The chamber is capable of
simultaneously treating two full pallets of boxed fruit.

Semi-commercial CATTS chamber testing
Commercially-packed fruit were utilized due to the great difficulty that there would be in
obtaining sized fruit from culls. Initial fruit temperatures were adjusted to 23 °C by placing
packed fruit which had not been cooled into an environmental room set at 23 °C or higher
overnight prior to the run. Boxes were removed from the pallet stack to insert temperature
probes into the fruit from boxes throughout the stack. Fruit were stacked into the chamber in
standard configuration, with 80 boxes per each of the two pallets. The standard run conditions
were the same as for prior treatments using the laboratory chamber. The initial chamber
temperature (23 °C) was rapidly achieved by heating at 60 °C/hour. Dew point was maintained
during the entire run at 2 ° C below the chamber temperature. Fan flow through the box stacks
reversed every 15 minutes. The chamber temperature was held at 23 °C until the CA reached 1%
oxygen and 15% carbon dioxide, which required at least 30 to 60 minutes. When the correct CA
was reached the chamber was heated at 12 °C/h until the chamber reached 46 °C (115 °F) where
it was held until all probed fruit core temperatures had reached and remained at 43.8 °C for 30



                                               155
California Tree Fruit Agreement
2007 Annual Research Report




minutes. This was the end of the treatment. Since the testing was preliminary and heat flow
through the boxes was of the greatest interest, no quality data was taken and instead fruit were
used for at least two runs.

RESULTS

Semi-commercial CATTS chamber
A total of seven treatment runs were conducted with the semi-commercial chamber. The results
for each run are as follows:

Run 1:      2-layer boxes filled with size 64 yellow nectarines, 56 fruit/box, 80 boxes per pallet, 2
            pallets.
          - Was a testing run utilized to help set up the chamber when the chamber designer was
            still in the installation process. Problems with the heating (software issues) makes it
            difficult to utilize the data for any type of comparisons.

Run 2:       2-layer boxes filled with size 56 August Red nectarines, 56 fruit/box, 80 boxes per
             pallet, 2 pallets.
             - Stopped run prior to cores reaching final temperature due to hardware problems with
               the CA system. Later resolved hardware issues.

Run 3:      2-layer boxes filled with size 56 August Red nectarines, same fruit as Run 2.
          - Total run time would have been around 7 hours (including time for CA establishment).
            This is largely due to a very slow heating rate (Figure 1).
          - The heating rate among the boxes was very uneven, as the coolest box required 329
            minutes to reach 43.8 °C core and the warmest 163 minutes (Figure 2). Warmest were
            in the outside corners of the stack and coolest were inside boxes in the middle of the
            stack.

Run 4:      2-layer boxes, size 56 yellow nectarines, 56 fruit/box, 80 boxes per pallet, 2 pallets.
            Replaced some of the standard boxes with boxes with enlarged vents and others with
            enlarged vents and apple trays, all done to test the effects of improved airflow on
            heating.
          - a software problem caused loss of data from this run.

Run 5:      2-layer boxes, size 56 yellow nectarines, same fruit as Run 4. Replaced some of the
            standard boxes with boxes with enlarged vents, enlarged vents and apple trays, and
            others with plastic RPCs, all done to test the effects of improved airflow on heating.
          - Heating rates (time needed to reach 43.8 °C) were faster in the altered boxes/RPC’s,
            especially for enlarged vent + apple trays:

                                  Normal box    Enlarged vents   Enlarged vents       RPCs
                                                                  + apple trays
     Time needed
     for coolest box              338 minutes    326 minutes      232 minutes     306 minutes




                                                     156
California Tree Fruit Agreement
2007 Annual Research Report




          -     Difficult, however, to use this data to make comparisons with other runs as the full
                stack was not modified.

Run 6:      Volume-filled boxes, size 56 September Red nectarines.
          - Purpose was to test whether volume-filled boxes without trays might heat more
            effectively than boxes with trays.
          - Very long treatment time needed. More than 9 hours would be needed if the time to
            establish CA was included. A problem with the seals around the boxes may have
            contributed to the long treatment time.

Run 7:      Picking totes (8 high), size 56 September Red nectarines (same fruit as Run 6).
          - Used picking totes to try to enhance airflow. The totes were used for the entire 2
            pallets.
          - Total run time would have been 6.9 hours, which is very similar to the time required
            using 2-layer boxes. The lack of much improvement in the time needed could have
            been partly due to the greater amount of fruit in each tote as compared to a 2-layer box.
          - The average heating rate was similar to that of the 2-layer boxes, but much slower than
            that for the laboratory chamber (Figure 1).
          - Heating was very uneven among the totes (Figure 2) with corner, outside boxes being
            the warmest and inside boxes the coldest.

Entomological Research – CA water bath
The regular air (RA) treatments on codling moth CM indicated that the 5th instar was the most
thermotolerant larval stage (Table 1). However, when the controlled atmosphere was applied the
mortality of the instars was not significantly different from each other. Previous in-fruit tests
identified the 4th instar as being the most tolerant, but the tests are difficult to compare as the
heating rates were different.

In agreement with test results from CM eggs treated on fruit in the CATTS chamber, the egg
stages did not differ from each other in terms of tolerance for both the RA and CA treatments
(Table 2).

For Oriental fruit moth (OFM) larvae under RA conditions, the 4th and 3rd instars were equally
thermotolerant to each other and more thermotolerant that the 1st and 2nd instars (Table 3).
Under CA treatments, the 1st instar was significantly less tolerant than the 2nd – 4th instars, which
were equally tolerant to one another. This is in contrast with previous results obtained from in-
fruit treatments, where the 4th instar was determined to be the most tolerant to CATTS. Again,
the difference in heating rate could have been responsible.

For OFM eggs under RA, all of egg stages had a similar tolerance (Table 4). Under CA
conditions there were also no differences in tolerance. These results are in agreement with
previous findings using fruit treated in a CATTS chamber.

When the larval mortalities of both species were compared under CA conditions, neither species
was significantly different from each other. When only the 4th and 5th instars of CM were
compared with the 4th instar of OFM, no stage or species were significantly different from each




                                                   157
California Tree Fruit Agreement
2007 Annual Research Report




other. These findings are in contrast with previous research where the 4th instar of CM was
determined to be more tolerant than the 4th instar OFM.
When the response of the egg stages are compared, codling moth were more tolerant of the CA
and RA treatments than the OFM eggs. This is in contrast to previous studies where the
whitehead stage of oriental fruit moth was more tolerant than the CM whitehead stage.
However, the red ring and black head stages of both species were not significantly different from
each other.

Entomological Research – CA heat block
We evaluated the CA heat block system using codling moth and found the results to be
compatible to those obtained using the CA water bath system. We are now in the process of
testing oblique banded leafroller (OBLR) in the CA heat block system. Initial results indicate
that the last two instars of OBLR, the most thermotolerant stages, are less resistant to CATTS
treatments than codling moth and Oriental fruit moth.

Entomological Research – Other Tests
We have obtained fruits infested with San Jose scale (SJS), European red mite (ERM) diapausing
eggs, and diapausing spider mites (SM) for tests in the CATTS system. These tests need to be
performed on infested fruits in the laboratory test chamber. Initial trials with diapausing eggs of
ERM resulted in 100% mortality (0% egg hatch) following treatment of infested apples using a
12°C/h heating rate to 46°C under a 1% O2, 15% CO2 environment. Preliminary tests on non-
diapausing spider mites indicated that the deuteronymph was the most resistant stage to the
24°C/h, 46°C CATTS treatment. There were no diapausing females in this trial. Test on SJS are
a bit more difficult since the adults and immatures are more sessile, and determination of
mortality requires numerous evaluations over time. Our goal is to treat over 5,000 of the most
resistant stage of these pests with the same treatments currently developed to control CM and
OFM.

SUMMARY

Results from a series of seven separate treatment runs using the new semi-commercial CATTS
chamber indicated that the rate of heating of the fruit in the large chamber is substantially slower
than that previously observed in the laboratory CATTS chamber, resulting in much longer
treatment times. Total treatment times using the large chamber were around 7 hours versus 3.5
hours for the laboratory chamber. Although it is yet to be determined, these longer treatment
times could be injurious to the quality of the fruit and may affect the insect efficacy. Also
observed was the rate of heating among the boxes in the stacks is not equal, and will result in
some fruit receiving a much greater heat dose than others. The long treatment times and unequal
heating are likely partially attributable to the requirement in the large chamber that the treatment
be conducted using boxed fruit. Altering the boxes to improve airflow or using plastic containers
with greater venting did act to enhance the heating rate but further experimentation is needed to
determine the full effect of these alterations.

The CA water bath system was developed to provide a lower cost and faster alternative to the
conventional means of quarantine testing using large treatment chambers and infested fruit. This
system was evaluated on the immature stages of CM and OFM and found to be effective for this



                                                158
California Tree Fruit Agreement
2007 Annual Research Report




purpose. Another system that is being developed to facilitate treatment development is the CA
heat block system. This system has an advantage over the CA water bath system in that it is able
to treat larger numbers of insects at the same time, enabling a more robust statistical analysis and
more accurate determination of treatment tolerance. Testing using OFM found the two systems
to give comparable results, indicating that the CA heat block system can be used to speed the
development of CATTS quarantine treatments.




                                                159
California Tree Fruit Agreement
2007 Annual Research Report




Figure 1. Temperature curves (internal fruit seed surface temperatures) from runs performed in a
laboratory CATTS chamber or in the semi-commercial CATTS chamber using 2-layer boxes or
picking totes.



                       50
                                                                  2-layer box, large
                                                                  chamber
    Temperature (°C)




                       45
                                laboratory
                       40       chamber
                       35
                                                              picking tote, large
                       30                                     chamber
                       25
                       20
                            0                100            200             300        400
                                                   Elapsed Time (minutes)




                                                                  160
        California Tree Fruit Agreement
        2007 Annual Research Report


             Figure 2. Time in minutes needed for the probed fruit in each box to reach 43.8 °C for
             Run 3 (2-layer boxes) and Run 7 (plastic totes). Four diagrams are given for each run,
             indicating the rear pallet (front and back row) and front pallet (front and back row), with
             each square indicating an individual box.

                                                            2-Layer Boxes (Run 3)
                  210                      264      189                   261     266    266
                                263        258                                    258    234
                                292        297                                    244    254
                                                                                  239    255               Back
Front             263           303        329      253                   249     269    285      260
Side                                                                                                       Side
                                266        301                                    265    282
                                283        278                                    283
                                           297                                           268
                                280                                                264
                  187           237        248      223                     173          199      264
                                                            REAR PALLET

                  198                      236      220                     181    230   253      223
                                           225                                     266   231
                                195                                                262   262
                                                                                   249   274
Front                                                                                                      Back
                  234           204        230                              230    240   250      226
Side                                                                                                       Side
                                241                                                247   257
                                251                                                261
                                238        224                                           246

                                197        213      163                    186           222      185
                                                            FRONT PALLET
                                                            Picking Totes (Run 7)
                  297                      338      307                292        327    305
                                322        313                                           317
                                                                                  327    321
Front                           303                 321               302         327    336      307      Back
Side                                                                              322                      Side
                                                                                         327
                                           322                                    337
                  267           287        317                     230, 260              322      230
                 front                                      REAR PALLET

                  297                      307      279               297         322    306
                                           296
                                           322      251               299         332    328      321
Front                           298
Side                                                                                                       Back
                                           278
                                297
                                                                                                           Side
                                                                                  327
                                                    221                           325             287
                                                            FRONT PALLET
                                          100 – 200 min
                                          201 – 300 min
                                          300+ min
                                          never reached 43.8 °C
                                                              161
California Tree Fruit Agreement
2007 Annual Research Report




Table 1. Proportion corrected mortality (± SEMs) of codling moth larval stages following heat treatments in CAWB system under air
(RA) and controlled atmosphere (CA) environments. CA conditions were 1% O2, 15% CO2. Beginning temperature was 23°C and
ending temperature was 45.5°C. Heating rate was 24°C/hr. Times are total times from the start of the heat treatment.

                            1st                           2nd                          3rd                         4th                         5th


 Time             RA                 CA            RA             CA           RA              CA           RA            CA            RA             CA


 0.5 h       0.150±0.084          0.223±0.128   0.461±0.176   0.362±0.097   0.113±0.065   0.362±0.087    0.233±0.134   0.460±0.177   0.105±0.092   0.056±0.089



 1.0 h       0.493±0.103          0.978±0.081   0.311±0.092   0.532±0.151   0.311±0.193   0.532±0.156    0.215±0.085   0.204±0.036   0.144±0.101   0.290±0.112



 1.5 h       0.785±0.051          0.975±0.049   0.424±0.049   0.672±0.082   0.424±0.045   0.672±0.067    0.503±0.035   0.934±0.034   0.067±0.121   0.857±0.119



 2.0 h       0.940±0.138           1.00±0.00    0.844±0.040     1.00±0.00   0.844±0.049      1.00±0.00   0.896±0.049   0.986±0.012   0.288±0.140     1.00±0.00




                                                                                 162
California Tree Fruit Agreement
2007 Annual Research Report




Table 2. Proportion corrected egg hatch (± SEMs) of codling moth egg stages treated in CAWB system under air (RA) and controlled
atmosphere (CA) environments. CA conditions were 1% O2, 15% CO2. Beginning temperature was 23°C and ending temperature
was 45.5°C. Heating rate was 24°C/hr. Times are total times from the start of the heat treatment.

                                                    White                        Red Ring                Black Head


                                    Time      RA            CA            RA                CA        RA            CA


                                  0.5 h    1.00±0.022    0.97±0.038    0.941±0.022   0.875±0.044   0.956±0.044   0.769±0.087



                                  1.0 h    0.877±0.067   0.657±0.128   0.908±0.019   0.684±0.068   0.672±0.195   0.352±0.155



                                  1.5 h    0.781±0.019   0.381±0.068   0.793±0.044   0.434±0.091   0.574±0.067   0.204±0.080



                                  2.0 h    0.422±0.120   0.00±0.00     0.300±0.068   0.00±0.00     0.289±0.062   0.00±0.00




                                                                           163
California Tree Fruit Agreement
2007 Annual Research Report




Table 3. Proportion corrected mortality (± SEMs) of oriental fruit moth following heat treatments in CAWB system under air (RA)
and controlled atmosphere (CA) environments. CA conditions were 1% O2, 15% CO2. Beginning temperature was 23°C and ending
temperature was 45.5°C. Heating rate was 24°C/hr. Times are total times from the start of the heat treatment.

                                               1st                         2nd                          3rd                              4th


                  Time               RA                CA           RA             CA            RA              CA            RA                CA


                   0.5 h          0.00±0.041     0.973±0.027     0.336±0.140   0.259±0.033   0.218±0.0454     0.391±0.074   0.00±0.009     0.167±0.012



                   1.0 h          0.905±0.063        1.00±0.00   0.897±0.083   0.654±0.019   0.351±0.217      0.670±0.076   0.333±0.174    0.986±0.009



                   1.5 h          0.911±0.059    0.971±0.028     0.800±0.046     1.00±0.00   0.814±0.123       1.00±0.00    0.796±0.086        1.00±0.00



                   2.0 h          0.882±0.068        1.00±0.00   0.701±0.131     1.00±0.00   0.707±0.062       1.00±0.00    0.572±0.147    0.974±0.026




                                                                                    164
California Tree Fruit Agreement
2007 Annual Research Report




Table 4. Proportion corrected egg hatch (± SEMs) of oriental fruit moth egg stages treated in CAWB system under air (RA) and
controlled atmosphere (CA) environments. CA conditions were 1% O2, 15% CO2. Beginning temperature was 23°C and ending
temperature was 45.5°C. Heating rate was 24°C/hr. Times are total times from the start of the heat treatment.

                                                   White                        Red Ring                 Black Head


                                  Time       RA            CA            RA                CA         RA            CA


                                  0.5 h   0.436±0.069   0.121±0.038   0.430±0.040    0.178±0.029   0.203±0.029   0.076±0.033



                                  1.0 h   0.360±0.096   0.022±0.017   0.184±0.040     0.00±0.00    0.302±0.112   0.024±0.022



                                  1.5 h   0.534±0.250   0.054±0.022   0.472±0.135    0.012±0.011   0.536±0.204    0.00±0.00



                                  2.0 h   0.303±0.145    0.00±0.00    0.301±0.123    0.020±0.009   0.251±0.086    0.00±0.00




                                                                          165
California Tree Fruit Agreement
2007 Annual Research Report




MICROBIAL FOOD SAFETY AND
POSTHARVEST FRUIT DISINFECTION
PROJECT LEADER: Dr. Trevor Suslow


No report is available at this time.




                                       166

								
To top