Docstoc

CHARACTERIZATION OF BONE MARROW STROMAL CLONAL POPULATIONS DERIVED

Document Sample
CHARACTERIZATION OF BONE MARROW STROMAL CLONAL POPULATIONS DERIVED Powered By Docstoc
					CHARACTERIZATION OF BONE MARROW STROMAL
    CLONAL POPULATIONS DERIVED FROM
            OSTEOARTHRITIS PATIENTS




           Institute of Health and Biomedical Innovation,
    Medical Engineering Program, School of Engineering Systems,
           Faculty of Built Environment and Engineering,
          Queensland University of Technology, Brisbane




      A thesis submitted for the degree of Doctor of Philosophy,


                                2008
Keywords

Osteoarthritis, cell based therapy, bone marrow stromal cells, mesenchymal stem cells,.

clone culture, clonal population, osteoblast, chondrocyte, adipocyte, progenitor,

precursor, differentiation, population doubling, autologous, tissue engineering, flow

cytometry, gene expression, proteomics, and biomarker.
Abstract

          This work is concerned with the characterization of mesenchymal stem cells

(MSC) specifically from bone marrow samples derived from patients with osteoarthritis

(04.


          The multilineage potential of mesenchymal stem cells as well as their ease of ex-

vivo expansion makes these cells an attractive therapeutic tool for applications such as

autologous transplantation and tissue engineering. Bone marrow is considered a source

of MSC. However, there is a general assumption that the occurrence of MSCs and their

activity in bone marrow diminishes with age and disease. This prompted us to isolate

and identify multipotential and self-renewing cells from patients with the degenerative

disease osteoarthritis, with the view of using these cells for autologous cell therapies. It

is therefore of great potential benefit to investigate the isolation and characterization of

stem celllprogenitors from bone marrow samples of patients with osteoarthritis in greater

detail.


          We employed a single cell clone culture method in order to develop clonal cell

populations from three bone marrow samples and characterized them based on their

proliferation and differentiation capabilities. The clonal populations were grouped into

fast-growing and slow-growing clones based on their proliferation rates. The fast-

growing clones displayed 20-30% greater proliferation rate than the slow-growing

clones. The study also revealed that the proliferation rates were directly proportional to

their.differentiationcapacities. Most of the fast-growing clones were found to be

tripotential for osteogenic, chondrogenic and adipogenic lineages, whereas the slow-
growing clones were either uni or bipotential. Flow cytometry analysis for the phenotype

determination using putative MSC surface markers did not reveal any difference

between the two clonal populations indicating a need for further molecular studies.


       Two approaches were employed to further investigate the molecular processes

involved in the existence of such varying populations. In the first method gene

expression studies were performed between the fast-growing (n=3) and slow-growing

(n=3) clonal populations to identify potential genetic markers associated with cell

'sternness' using the Stem Cell RT2 ProfilerTM PCR Array comprising a series of 84

genes related to stem cell pathways. Ten genes were identified to be commonly and

significantly over represented in the fast-growing stem cell clones when compared to

slow-growing clones. This included expression of transcripts beyond MSC lineage

specification such as SOX2, NOTCH1 and FOXA2 which signified that stem cell

maintenance requires a coordinated regulation by multiple signalling pathways.


      The second study involved an extensive protein expression profiling of the fast

growing (n=2) and slow growing (n=2) clonal populations using off-line Two

Dimensional Liquid Chromatography (2D-LC)/Matrix-Assisted Laser

Desorption/Ionization(MALDI) Mass Spectrometry (MS). A total of 67 proteins were

identified, of which 11 were expressed at significantly different levels between the sub-

populations. Protein ontology revealed these proteins to be associated with cellular

organization, cytokinesis, signal transduction, energy pathways and cell stress response.

Of particular interest was the differential presentation of the proteins calmodulin,

tropomyosin and caldesmon between fast- and slow-growing clones. Based on their

reported roles in the regulation of cell proliferation and maintenance of cell integrity, we

                                             iv
draw an association between their expression and the altered status in which the sub-

populations exist. Based on our observations, these proteins may be prospective

molecular markers to distinguish between the fast-growing and slow-growing sub-

populations.


       In summary, this study demonstrated the existence of potential stem cells of

therapeutic importance in spite of a supposedly smaller stem cell compartment in

patients with osteoarthritis. Furthermore, the differentially expressed genes between the

sub-populations highlight the 'sternness' of the potential clones, an observation

supported by the expression of proteins which act as effective modulators in the

maintenance of cell integrity and cell cycle regulation. This study provides a basis for

more detailed investigations in search of selective cell surface markers.
List of Publications and Manuscripts

The following is a list of publications, submitted manuscripts and manuscripts in

preparation that have been derived from the work performed for this thesis:


   1 . Mareddy S, Crawford R, Brooke G, Xiao Y. Clonal isolation and

       characterization of bone marrow stromal cells from patients with osteoarthritis,

       Tissue Engineering 2007,13; 819-829.


   2. Mareddy S, Crawford R, Xiao Y. Identification of genes regulating cell growth

       and multipotency from clonal populations derived from bone marrow (under

       submission).


   3. Mareddy S, Broadbent J, Crawford R, Xiao Y. Proteomic profiling of distinct

       clonal populations of bone marrow mesenchymal stromal cells (submitted to

       Stem Cells and Development).
Declaration




The work contained in this thesis has not been previously submitted for a degree or
diploma at this or any other higher education institution. To the best of my knowledge
and belief, the thesis contains no material previously published or written by any other
person(s) except where due reference is made.




Signed:..... .............. .... ....................


                   Shobha Mareddy




Date:. ....... ...... ... ........... . ............ ......
Acknowledgements

       First of all, I wish to thank my principal supervisor, Professor Ross Crawford for
his invaluable guidance and suggestions throughout my candidature. His enthusiasm,
optimism and genuine curiosity have inspired me to tackle the challenges faced during
the period. He is a great motivator and I consider myself to be fortunate to work with
him.


       I am grateful to my associate supervisor, Associate Professor Yin Xiao, who has
guided'me and showed the way whenever I was heading down a cul-de-sac. He has been
readily available throughout, a fact that was both comforting and gave me confidence
when experiments didn't go to plan.


       I thank the Research Committee of QUT for granting me a QUT Blueprint
Scholarship, without which this project would not have been possible.


       A warm thank you goes to Sanjleena Singh, for training me in cell culture
techniques, and Navdeep Kaur, for assisting me with laboratory techniques. Learning
and working with them has been made so enjoyable by their great sense of humor and
lively attitude, enlivening the work environment for us all. Heartfelt thanks goes to all
my colleagues, Indira, Wei Shi, Wei Fan and Jian Li form the bone group and various
departments, for their useful interactions and cooperation.


        1 extend special thanks to Thor Friis for his valuable assistance in the short
period of our association. His meticulous effort in proofreading my manuscript has
improved this thesis. His help in the laboratory as well as at the workstation is greatly
appreciated.


       I thank James Broadbent for his support with all the proteomics based research.
His expertise at proteomics has been instrumental in bringing the experiment to fiuition.
I also wish to thank Dr Gary Brooke of MMRI for assisting with flow cytometry.
       I would like to thank Dr. John Hooper, Prof. Dietmar Hutmacher and Dr.
Cameron Lutton for their constructive comments on my manuscript.


       A special note of appreciation goes to the IHBI support staff, in particular Scott
Tucker and David Smith, for organizing and delivering timely help in the laboratory.


       Finally, I wish to dedicate this dissertation to my husband Vijay, my two
wondefil sons Naveen and Nikhil and my extended family hack in India for their
unconditional love and support.
Table of Contents
CHARACTERIZATION                       OF B O N E MARROW STROMAL CLONAL P O P U L A T I O N S
DEIUVED FROM OSTEOARTHRITIS PATIENTS                                             ..............................................................................
                                                                                                                                                       I




    LIST OF PUBLICATIONS AND MANUSCRIPTS
    DECLARATION
    ACKNOWLEDGEMENTS
    TABLE OF CONTENTS

    GLOSSARY OF TERMS AND ABBREVIATION

CHAPTER 1................................................................................................................................................ 1

INTRODUCTION                 ......................................................................................................................................
                                                                                                                                                          1

    DESCRIPTIONOF THE SCIENTIFIC PROBLEM INVESTIGATE                                                                                                      1
    SPECIFIC AIMS OF THE STUDY                                                                                                                            2
    AN ACCOUNT OF SCENTIFIC PROGRESS LINKING THE SCIENTIFIC PAPERS                                                                                        4
    REFERENC                                                                                                                                              6

CHAPTER 2................................................................................................................................................
                                                                                                                                                   7

LITERATURE REVIEW .......................................................................................................................          7

    BACKGROUND
    PATHO PHYSIOLOG

    CURRENT TREATM
    REGENERATWE MEDICINE

    STEM CELLS AND THEIR DERIVATNES

    CLASSIFICATION
    BONE MARROW STROMAL CELL

    MESMCHYMAL STEM CELLS

    THE MESENCHYMAL STEM CELL NICHE
    ISOLATION AND CHARACTERIZATION STUDIES OF MESENCHYMAL STZM CELLS                                                                .
                                                                                                                     .............. ...............     24
    COLONY-FORMING FIBROBLAST ACTIVITY
               UNIT                                                                                                                                     25
    CLONALCHARACTERIZA~ON
                     OF MSC                                                                                                                             26
    PHENOTYPECHARACTERISTICS OF M K S                                                                                                                   28
    SELF-RENEWING POTENTIAL OF M S C S                                                                                                                  31
    DIFFERENTIATION POTENTIAL OF MSC                                                                                                                    33
    STEM CELLS AND AGING                                                                                                                                                 36
    IMMUNOMODULATORY ROLE OF MSCs                                                                                                                                        38
    THERAPEUTIC APPLICATIONS                                                                                                                                             39
    REFERENCE                                                                                                                                                            42

CHAPTER 3 ..............................................................................................................................................
                                                                                                                                                   57

MATERIALS AND METHODS   .............................................................................................................57

CELL CULTURE METHODS................................................................................................................ 57

    ISOLATION AND EXPANSION OF BONE MARROW STROMAL CELLS                                                                                                                 57
    CLONAL CULTURE OF MSCS                                                                                                                                              58
    MIXED CULTURE                                                                                                                                                        59
    POPULATION DOUBLING                                                                                                                                                  59
    CELL STAINLNG AND MICROSCOPY                                                                                                                                         59
    DIFFERENTIATION OF CLONE AND MIXED CELL CULTURES IN VlTR                                                                                                            60
    BETA-GALACTOSIDASE STAINING                                                                                                                                         62
    KARYOTYPING                                                                                                                                                         62
    PHENOTYF'EETERMINATION BY FLOW CYTOMETR
             D                                                                                                                                                          62

MOLECULAR BIOLOGY METHODS .................................................................................................                                             63

    REVERSE TRANSCRLPTASE-POLYMERASE REACTDN
                                CHAIN                                                                      (RT-PCR) ANALYSIS ................................. 63
    PROTEIN EXPRESSION PROFILING ............................................................................................................ 67
                  ...............
    WESTERN BLOTTING                                       .
                                                          . ...................................................................................................
                                                          ..                                                                                                            71
                  ....................................................................................................................... 72
    IMMUNOCYTOCHEMISTRY

CHAPTER 4              ..............................................................................................................................................   75

CLONAL ISOLATION AND CHARACTERIZATION OF BONE MARROW STROMAL CELLS
FROM PATIENTS WITH OSTEOARTHRITIS                                                        ..................................................................................
                                                                                                                                                                      75

    STATEMENT OF JOINT AUTHORSHIP ........................................................................................................                              76
    ABSTRACT           ..............................................................................................................................................    77
    INTRODUCTION              .......................................................................................................................................   78
    MATERIALS AND METHODS ....................................................................................................................                           80
    RESULTS ................................................................................................................................................             85
    DISCUSSION ............................................................................................................................................ 98
    R m R E N C E S .....................................................................................................................................               102
    A P P E N D I X - 1 .......................................................................................................................................         105

CHAPTER 5              ............................................................................................................................................
                                                                                                                                                         117
IDENTIFICATION OF GENES REGULATING CELL GROWTH AND MULTIPOTENCY
FROM CLONAL POPULATIONS DEIUVED FROM BONE MARROW .....................................                                                                117

  STATEMENT OF JOINT AUTHORSHE'                                                                                                                       118
                                                                                                                                                      119
  INTRODUCTION                                                                                                                                        120
  MATERIALS AND METHODS                                                                                                                               121
                                                                                                                                                      125
                                                                                                                                                      136
                                                                                                                                                      142

CHAPTER 6   ............................................................................................................................................ 149
PROTEOMIC PROFILING OF DISTINCT CLONAL POPULATIONS OF BONE MARROW
MESENCHYMAL STEM CELLS                        ......................................................................................................
                                                                                                                                            149

  STATEMENT OF JOINT AUTHORSHIP                                                                                                                       150
                                                                                                                                                      151
  INTRODUCTION                                                                                                                                        152
  MATERIALS AND METNODS                                                                                                                               154
                                                                                                                                                      162
                                                                                                                                                      175
                                                                                                                                                      181
                                                                                                                                                      185

CHAPTER 7  .......................................................................................................................................... 203
Glossary of Terms and Abbreviations

OA - Osteoarthritis
BMSC -Bone marrow stromal cells
CFU-F - Colony forming unit fibroblast
MSC - Mesenchymal stem cell
HSC - Haematopoietic stem cells
FGF-2 -Fibroblast growth factor 2
PDs -Population doublings
COL 1 - Collagen 1
COL 2 - Collagen 2
OPN - Osteopontin
OCN - Osteocalcin
AGG- Aggrecan
ALP - Alkaline phosphatase
P P w 2 - Peroxisome proliferator activated receptor-gamma 2
AP2 - Adipocyte fatty acid binding protein
p2M- Beta-2 microglobulin (house keeping gene)
DMEM - Dulbecco's modified eagle medium
FBS Foetal bovine serum
     -



T75- 75cm2 tissue culture flask
T175- 1 75cmZtissue culture flask
PBS - Phosphate buffered saline
EDTA - Ethylmediaminetetraaceticacid
RT-PCR R e v e r s e transcriptase-polymerasechain reaction
FACS -Fluorescence activate cell sorting
PE - Phycoerythnn
BSA -Bovine serum albumin
Ab -Antibody
CD - Cluster of differentiation
 MHC -Major histocompatibility complex
 SO=- SRY (sex determining region y)-box 2
 NOTCHI- Notch homolog 1



                                             xiii
DLL3 - Delta-like 3
COL2A1- Collagen 2A1
FGF-2 - Fibroblast growth receptor 2
BMP-2 -Bone morphogenetic protein 2
IGF-1 - Insulin like growth factor 1
FOXAZ - Forkhead box a2
CDC2 - Cell division cycle 2
QRT-PCR - quantitative real-time polymerase chain reaction
HMG - high-mobility-group
Wnt - wingless-type
FGFR2 - fibroblast growth factor receptor 2
SDS-PAGE- sodium dodecyl sulfate-polyacrylamide gel electrophoresis
TBE- Tris-borate EDTA
TBS- Tris buffered saline
TBST- Tris buffered saline with Tween 20
TEMED- Tetramethylethylenediamine
TGFp- Transforming growth factor beta
kDa- Kilo Daltons
Wlv- Weight per volume
bp- Base pairs
nm- Nanometre
pmol- Pico moles
IU-International unit
RNA- Ribonucleic acid
DNA- Deoxyribonucleic acid
MALDI- Matrix-assisted laser desorptiodionization
TOF-TOFMS- Tie-of-flight mass spectrometry
PMF- Peptide mass fingerprinting
MOWSE- Molecular weight search
PI- Isoelectric point
                                     Chapter 1

Introduction

Description of the scientific problem investigated



       Bone marrow derived mesenchymal stem cells (MSC) are a population of

self-renewing multipotent cells that have significant clinical potential in cellular

therapies and tissue regeneration owing to their potential ease of in vitro culture and

manipulation.


       The basic requirement for developing autologous cell transplants is the

presence of a sufficient number of unspecialized multipotent MSCs. The candidate

cells must possess some necessary characteristics such as multipotential nature, high

proliferative capacity and an ability to deposit the required matrix proteins.

Friedenstein and co-workers conducted pioneering studies involving characterization

of MSC populations over three decades ago (1). There is a growing body of evidence

to suggest that bone marrow MSCs exists at different states of commitment, and

hence it is necessary to be able to isolate and enrich the multipotent and self-

renewing cells from the heterogeneous mixture. Adding to the difficulty of isolating

MSCs is a lack of MSC specific cell markers. Many enrichment studies, employing

novel approaches to isolate purified populations of MSCs, have reported the

occurrence of sub-populations with the ability of self-renewal and a capacity for

multilineage differentiation within the bone marrow stomal compartment of healthy

donors (2, 3).




                                            1
        Previous studies have reported a gradual age and disease associated decline in

the number and activity of MSCs in the bone marrow, a factor which decreases the

ability of tissues to regenerate naturally (4, 5). Studies comparing MSC populations

from normal donors and OA patients revealed reduced proliferative capacities

associated with reduced chondrogenic and adipogenic activities (6). It will be of

great interest to determine the existence of multipotent cells from patients with OA

and particularly whether such cells have proliferation potential. Such knowledge

could contribute to the design of protocols for ex vivo expansion of cells suitable for

cellular transplantation. Most molecular characterization studies of stem/progenitor

cells are based on cells derived from colony forming unit fibroblasts (CFU-F), which

assume that the CFU-F is derived from a single cell in the first place (7, 8). The

present study is specifically based on clone culture of stem/progenitor cells obtained

from single cell derived colonies. This study has attempted to isolate and identify

cells of therapeutic importance form the bone marrow samples of osteoarthritic

patients. The bone marrow samples used in the study were derived from three

patients with osteoarthritis.



Specific Aims of the Study

Three specific aims have been addressed in this study.


    1. The first aim has been to focus on the possibility of deriving and expanding

        multipotential MSCs from bone marrow samples of patients with OA, by

        characterizing bone marrow stromal cells (BMSC) at the single cell level.

        This was achieved by establishing single cell clone cultures by limiting

        dilutions from the bone marrow samples derived from three patients with




                                           2
    osteoarthritis, and assessing the proliferation and differentiation capacities of

    the individual clones.


2. The second aim was to investigate the molecular pathways governing MSC

    self-renewal and lineage differentiation potential and to identify candidate

    genes regulating cell growth and multipotency of the clonal populations. A

    stem cell gene expression tool was employed to screen and quantify the

    expression of stem cell pathway related genes between the clonal

    populations.


3. Finally, the third aim was to understand the cellular and sub-cellular

    processes responsible for the existence of different sub-populations and to

    identify prospective biomarkers which will enable the separation of sub-

    populations. Protein profiling studies (2D LC, MALDI-TOF-TOF/MS)

    were therefore conducted to identify potential marker proteins associated

    with stem cell clones for clinical applications.




                                        3
An Account of Scientific Progress Linking the Scientific Papers

This thesis is presented in the format of “PhD Thesis by Submitted Manuscript”

according to the guidelines of Queensland University of Technology.


       It begins with an introduction as Chapter 1 giving a brief description of the

scientific problem that has been investigated and the specific aims that have been

addressed.


       Chapter 2 is the detailed literature review, starting with a brief background of

the patho-physiology of OA and the current treatment methods further leading to the

recent advances in tissue engineering and concepts of regenerative medicine. It then

goes on to give a comprehensive overview of the past and current developments in

the adult stem cell research highlighting on the mesenchymal stem cell biology and

the importance of stem cell based therapies.


       Chapter 3 presents a detailed overview of the materials and methods

employed during the course of this study.


       Chapter 4 is the first published paper and is an initial study describing the

establishment of clone cultures from the bone marrow samples of patients with

osteoarthritis and characterizing the individual clones based on their proliferation and

differentiation capacities. The study was conducted to determine the existence of

multipotent self-renewing cells with in the bone marrow samples of diseased patients

with the prospect of using these cells for autologous cell therapies.


      Chapter 5 is a more advanced study extending the work described in chapter 2.

The Stem Cell RT² Profiler™ PCR Array was used to screen and quantify the


                                            4
expression of a set of 84 genes related to stem cell pathway. The study was

conducted to investigate the molecular pathways governing the cell growth and

multipotency of the clonal populations and to identify the genes involved in the

maintenance of ‘stemness’ of the clones.


       Chapter 6 encompasses the protein profiling studies of the clonal populations

to identify prospective biomarkers to facilitate distinguishing between the clonal

populations. The study used Two-Dimensional Liquid Chromatography (2-D

LC)/Matrix Assisted Laser Desorption/Ionisation (MALDI) Mass Spectrometry (MS)

to unravel the cellular and sub cellular processes underlying the existence of different

sub-populations.


       The thesis concludes with a summary (Chapter 7) of the outcomes and a

general discussion of the three papers presented for examination followed by future

perspectives.




                                           5
References:

1.   Friedenstein, A.J., R.K. Chailakhjan, and K.S. Lalykina, 1970 The
     development of fibroblast colonies in monolayer cultures of guinea-pig bone
     marrow and spleen cells. Cell Tissue Kinet, 3(4): p. 393-403.

2.   Colter, D.C., I. Sekiya, and D.J. Prockop, 2001 Identification of a
     subpopulation of rapidly self-renewing and multipotential adult stem cells in
     colonies of human marrow stromal cells. Proc Natl Acad Sci U S A, 98(14):
     p. 7841-5.

3.   Simmons, P.J. and B. Torok-Storb, 1991 Identification of stromal cell
     precursors in human bone marrow by a novel monoclonal antibody, STRO-1.
     Blood, 78(1): p. 55-62.

4.   Quarto, R., D. Thomas, and C.T. Liang, 1995 Bone progenitor cell deficits
     and the age-associated decline in bone repair capacity. Calcif Tissue Int,
     56(2): p. 123-9.

5.   Oreffo, R.O., S. Bord, and J.T. Triffitt, 1998 Skeletal progenitor cells and
     ageing human populations. Clin Sci (Lond), 94(5): p. 549-55.

6.   Murphy, J.M., et al., 2002 Reduced chondrogenic and adipogenic activity of
     mesenchymal stem cells from patients with advanced osteoarthritis. Arthritis
     Rheum, 46(3): p. 704-13.

7.   Malaspina, C.H., et al., 1980 Characterization of human bone marrow
     fibroblast colony-forming cells (CFU-F) and their progeny. Blood, 56: p.
     289-301.

8.   Kuznetsov, S.A., et al., 1997 Single-colony derived strains of human marrow
     stromal fibroblasts form bone after transplantation in vivo. J Bone Miner Res,
     12(9): p. 1335-47.




                                        6
                                   CHAPTER 2


Literature Review


Background


       The joint disease OA is the most common musculoskeletal disorder affecting

the aging population. OA is caused by the breakdown, and eventual loss, of the

articular cartilage. It is the leading cause of pain and disability in the community and

the predominant condition leading to joint replacement surgery. Physiologically OA

is regarded as an imbalance between the catabolic and anabolic processes of the

articular cartilage resulting in increased deterioration or breakdown of the cartilage

and the formation of new bone at the joint surfaces and margins. The result is joint

pain and loss of mobility which subsequently leads to long term disability thus

limiting quality of life (1, 2). OA is a major concern for health authorities since the

prevalence of OA is expected to increase dramatically over the next 20 years in

conjunction with the rise of an aging population.


       OA commonly affects the hands, feet, spine and large weight-bearing joints,

such as the hips and knees. Most cases of osteoarthritis have no known cause and are

referred to as primary OA; when the cause of the osteoarthritis is known, the

condition is referred to as secondary OA (3, 4) .




                                            7
          Primary OA is mostly related with aging. Repetitive use of the joints over the

years tends to irritate and inflame the cartilage, causing joint swelling and pain. Over

time the cartilage begins to degenerate by flaking or forming tiny crevasses (5). In

advanced cases there is a total loss of the cartilage cushion between the bones of the

joints, which causes friction between the bones and leads to pain and limitation of

joint mobility. Inflammation of the cartilage may also stimulate new bone

outgrowths, osteophytes to form around the joints. OA can occasionally be found in

multiple members of the same family, suggesting a genetic basis for this condition

(6, 7).


          Secondary OA is typically caused by another disease or condition including

obesity, repeated trauma or surgery to the joint structures, abnormal joints at birth

(congenital abnormalities), gout and other hormonal disorders (8, 9).



Patho physiology

          Although OA is mainly attributed to the loss of joint cartilage, detectable

changes have been noted in subchondral bone, synovium and ligaments at early

stages, thus raising questions with regards to the multifactorial causative factors

associated with the onset of OA.


          The degenerative process of osteoarthritis, at the tissue and cellular level, is

associated with the destruction and loss of cartilage, remodelling of bone and

intermittent inflammation. Degradation and synthesis of cartilage matrix are driven

by mediators that are released by chondrocytes and synoviocytes. These mediators

include cytokines (e.g. interleukin-1 and tumour necrosis factor), nitric oxide and

growth factors (10). Processes which trigger increased release of these factors



                                              8
include joint overload and injury (11). Furthermore, synovium and/or cartilage

derived proteases, such as metalloproteinases and aggrecanases play a major role in

cartilage matrix degradation (12-14). Together, these proteases have the ability to

degrade the major molecular constituents of the cartilage matrix, such as collagens,

aggrecan and matrix proteins leading to loss of cartilage and joint function (15).



Current treatments

       Treatment strategies currently employed include education and awareness

programs, physiotherapy and mechanical aids, non-steroidal anti-inflammatory drugs

(non-steroidal anti-inflammatory drugs, NSAIDs) and joint injections. Surgical

interventions such as drilling, micro fracture techniques, soft tissue grafts or

osteochondral grafts, are at best substitutes with no treatment providing remedial

formation of long-lasting hyaline cartilage (16-18). Total joint replacement (TJR) in

which all or part of the joint is replaced with metal or ceramic implants, is the

treatment of last resort. At present, with the exception of surgery, all other treatments

are palliative. Surgical interventions, such as total joint replacement (TJR) are

reported to provide relief from the pain of OA and facilitate long-term improved

function (19). However, over a period of time these implants are prone to wear out

and loosen necessitating remedial surgical interventions.


       Recent advances in tissue engineering, involving ex vivo expansion of cells to

develop tissue engineered constructs, have offered new hope for the treatment of OA.

Articular cartilage, damaged by trauma or disease, has a limited ability for repair due

to lack of vascular supply and a dense extracellular matrix sparsely embedded with

chondrocytes (20). Generating a three-dimensional cartilage using adult human

chondrocytes is limited by the lack of suitable donor sites coupled with their limited


                                            9
ability for in vitro expansion (18). This has led a number of groups to explore the use

of MSCs for the generation of autologous chondrocytes (21). MSCs are mulitpotent

cells with a capacity for self-renewal, which provide an attractive option for patient

and clinician since, as autologous stem cells, they overcome the problems of

transplant rejection.


         However it must also be recognized that autologous therapies are expensive,

requiring growth of cells and tissue over an extended time period. It will be

important therefore, to develop tissue engineering protocols to identify and isolate

MSCs and their sources so that they can be expanded in the shortest possible time

frame.



Regenerative Medicine

         Organ transplants and prosthesis are the current treatment strategies in the

event of failure of the inherent regenerative capacity of a tissue or organ function.

However, these treatments are associated with problems such as critical shortage of

donor organs, rejection, the need for life-long immunosuppressant and unstable

biocompatibility. These shortcomings have prompted the development of

regenerative medicine.


         Regenerative medicine is defined as an innovative approach of medical

therapies that will enable the body to repair, replace, restore and regenerate damaged

or diseased cells, tissues and organs(22). It includes both the regeneration of tissues

in vitro for subsequent in vivo implantation, as well as regeneration directly in vivo

by engineering the basic building blocks of the human body. It has been proposed

that regenerative medicine is an amalgamation of a multitude of disciplines including



                                           10
cell biology, tissue engineering, biomaterials science, endocrinology and

transplantation science. If realized, it offers the prospect of extending healthy life

span and improving the quality of life by supporting and activating the body’s own

natural healing (22). Recent interest in stem cell biology and novel biomaterials have

raised hopes that manipulation and delivery of patient compatible cells and tissues

could recapitulate the regenerative process and lead to more functional responses to

injury(23).


       A current research goal is to determine the existence of diverse types of adult

stem cells that may occur in niche environments in various tissue sources. However,

irrespective of the source, these cells occur in very low numbers which further

decreases with age, making the identification, isolation and purification of adult stem

cells a challenge. The most acute challenge is to identify the sites and properties of

these stem cells including proliferation, migration, differentiation and apoptosis (24).


       Based on the extensive body of research conducted in this field, biomedical

scientists are looking into novel treatment strategies involving potential use of stem

cells to replace damaged or dead tissue. The earliest evidence in support of tissue

repair came from the observations made by the German pathologist Julius Cohnheim,

who reported the occurrence of fibroblast-like cells along with other inflammatory

cells at the site of wound and that these fibroblast-like cells originated from bone

marrow (25). Among the various diseases that can potentially be cured by stem cell

                                                           s,         s,
based therapies are neurological diseases such as Parkinson' Alzheimer' stroke

and spinal cord injury; both rheumatoid and OA; and heart disease and type 1

diabetes. Development of successful application methods will obviate the need for

organ and tissue transplants (26).



                                           11
        In order to translate the potential of cell based therapies to clinical

applications, various technical challenges must be addressed (27). These include


    •   Identify and isolate pure sub-populations of MSCs from different tissue

        sources. Identification of distinguishing cell surface markers to facilitate their

        isolation.

    •   Novel cell expansion system/bioreactors need to be developed which can

        provide sufficient quantity of cells for transplantation purposes.

    •   Regulation of the differentiation process towards specific phenotypes.

    •   Development of novel biomaterials/scaffolds that are designed to direct the

        growth, differentiation and organisation of cells in the process of forming

        functional tissue by providing physical, chemical and mechanical cues.

    •   Vascularisation and integration of the transplant to progress into functional

        tissue (27).




Stem cells and their derivatives

        The term “stem cells” refers to a diverse group of unprogrammed cells which

are capable of self-renewal and retain the plasticity to differentiate into various

tissues (28).


        Stem cells are characterized by their ability to remain quiescent in vivo for

extended periods of time. Their deployment into the cell cycle is determined by an

appropriate signal for development into a specialized cell. They serve as an

important reservoir from which cells can be recruited to replenish tissues which have



                                            12
experienced cell loss as a result of injury, disease and aging, and form a natural

support system aiding in repair of the damaged tissues. Stem cells possess the

potential for asymmetric cell division by giving rise to a daughter cell with self-

renewing capacity, and a progenitor which is committed to undergo differentiation

along a particular cellular development pathway (Figure 1) (29, 30).




                                           13
Adapted from www.bioethics.gov


Figure 1: Schematic diagram of the stages in cell differentiation, starting with an
undifferentiated stem cell followed by a more “specialized” stem cell (also called
precursor cells or progenitor cells) and further succeeded by various differentiated
cells that are derived from the specialized stem cells.




                                           14
       Stem cells are categorized based on the varying degree of their developmental

potential. Totipotent stem cells are characterized by their ability to create an entire

organism, a property retained by early progeny of the zygote up to the 8-cell stage of

the ‘morula’ (Figure 2). The cells subsequently, begin to specialize after four days of

embryonic cell division (31). The inner cell mass (ICM) of the 5 to 6 day old human

‘blastocyst’ is the source of pluripotent embryonic stem cells (hESCs). While

pluripotent cells are capable of forming tissues from all embryonic germ layers, they

are not able to develop into an entire organism (28). Eventually, with progressive

development of the zygote, formation of specialized tissues results in various subsets

of cells with specialized functions. These tissues harbour multipotent cells in niche

environments capable of giving rise to various germ layer-specific lineage cells (32).

For instance MSC can give rise to osteoblasts, chondroblast and adipocytes (31).




                                           15
Adapted from www.molecularstation.com


Figure 2: The figure illustrates the various stages of development starting with
zygote and subsequently leading to the formation of specialized tissues. Pluripotent,
embryonic stem cells originate as inner mass cells within a blastocyst. These cells
can become any tissue in the body, excluding a placenta. Only the zygote up to 8 cell
stage (morula) is capable of giving rise to all tissues and a placenta. As development
proceeds, there is a loss of potential and gain of specialization.




                                           16
Classification

        Based on the developmental stage, stem cells are broadly classified as

embryonic, foetal, umbilical cord and adult stem cells.



Embryonic stem cells

        Embryonic stem cells are derived from the inner cell mass of embryos at the

blastocyst stage. The blastocyst stage defines the early stage in human ontogeny

where the developmental fate of the cells is not yet defined. With further divisions,

the embryonic cells acquire characteristic changes and are surrounded by a different

set of neighbouring cells. Cell-to-cell interactions comprise the major factor

influencing the cells to differentiate and give rise to all of the somatic and germ cell

lines of the fully developed organism (32-34). During normal development, the

blastocyst will implant in the wall of the uterus to become the embryo and continue

developing into a mature organism (31).



Foetal stem cells

        The foetal organs harbour a primitive cell type, the foetal stem cells. A wide

variety of cells such as neural crest stem cells, foetal haematopoietic stem cells and

pancreatic islet progenitors have all been successfully isolated from aborted foetuses

(35).


Umbilical cord stem cells

        Umbilical cord blood contains circulating stem cells which form a rich source

of stem cells with potential clinical use. Although these cells are not as primitive as

the ESCs, they bypass many of the ethical issues surrounding the use of ESCs.



                                           17
Moreover they are more unspecialized than the adult stem cells thus being able to

contribute to a broader range of tissues (36). Stem cells from Umbilical Cord Blood

(UCB) provide a readily obtainable and available source of cells for cell therapy

treatment. Reports suggest that UCB transplants evoke a lower incidence of immune

rejections, especially from an unrelated donor (35).



Adult Stem Cells

       Adult stem cells (ASCs) are postnatal stem cells which persist throughout life

and whose role is to repair or replace cells within certain tissues in response to cell

damage or natural cell turnover. ASCs have been isolated from numerous adult

tissues, umbilical cord, and other non-embryonic sources, and have demonstrated a

surprising ability for transformation into other tissue and cell types and for repair of

damaged tissues (34, 37). Unlike embryonic stem cells, ASCs are considered to be

less capable of proliferation and are thought to be more tissue-specific or lineage

restricted, but new research contradicts this notion and postulates that even ASCs

have a greater developmental potential than previously thought (28). Furthermore,

systemic migration enables ASCs to reach various organs and tissues, and their

plasticity enables them to acquire the role and function according to the

microenvironment (28, 38).


         A number of reports of ASC plasticity, which challenge the general

assumption that adult mammalian stem cells are lineage restricted, arise from murine

plasticity studies. For example, mouse bone marrow (BM) cells gave rise to skeletal

muscle cells when transplanted into a mouse muscle cell (39), and similar studies

have revealed that bone marrow cells are capable of producing hepatocytes, (40, 41)

endothelial and myocardial cells (42, 43), as well as generating neurons and glial


                                           18
cells of the central nervous system (44-46). Though these studies are encouraging

and enhance our understanding of the plasticity of adult stem cells, there is a need to

rigorously evaluate claims of differentiation “plasticity” of ASCs and their long term

therapeutic potential (28).


       Of the tissues known to harbour stem cells throughout postnatal life, bone

marrow has been studied extensively as a source of both haematopoietic stem cells

(HSCs) and mesenchymal stem cells (MSCs) (37). Other sources of adult tissue from

which stem cells were isolated include mesodermal tissues such as muscle, adipose

tissue, synovium and periosteum. Stem cells have also been isolated from tissues of

endodermal lineages such as intestine and from ectodermal tissues including skin,

deciduous teeth and nerve tissue (32).


       Given the moral and ethical concerns surrounding embryonic stem cell

research, other possible sources of pluripotent cells have been sought. ASCs, or

tissue-specific stem cells, do not elicit the same heated debate as embryonic stem

cells and are thus gaining immense research interest in the field of tissue engineering.

ASCs for use in cell therapy have two advantages, apart from bypassing ethical

concerns: 1) Since the cells can be isolated from the patient requiring treatment, it

eliminates the problem of alloimmune rejection; 2) It reduces the risk of tumour

formation, which occurs with high frequency when mouse embryonic stem cells (ES)

or embryonic germ cells (EG) are transplanted into histocompatible adult mice (28,

47). Given the unique biological properties and potential medical importance of stem

cells, the study of their underlying biology is the subject of intense investigations.




                                           19
Bone marrow stromal cells

       As mentioned above, bone marrow has been studied extensively as a source

of both haematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs) (37).

Bone marrow has been defined as a complex tissue comprised of haematopoietic

precursors and a connective tissue network referred to as stroma (Figure 3). The

HSCs are probably the best characterized and most widely understood of all stem

cells species. The marrow stromal tissue is a heterogeneous mixture of cells

including adipocytes, osteoblasts, reticulocytes, endothelial cells and fibroblastic

cells which are in contact with the haematopoietic environment (48-50). Many

investigators have recognised that the adherent cell layer emerging from the primary

marrow cultures is composed of different cell populations capable of proliferation,

renewal and differentiation into several phenotypes (51, 52). Cultured BMSCs are

therefore an interesting target for use in cell and gene therapy because of the ease

with which they readily proliferate and give rise to a differentiated progeny that can

substitute for the diseased counterpart (53).




                                           20
Adapted from chroma.med.miami.edu/micro/faculty-jurecic.html



Figure 3: The figure illustrates the haematopoietic and stromal cell differentiation. It
shows bone marrow as a reservoir for two distinct developmental systems, the
haematopoietic system and the marrow stromal network. The haematopoietic system
gives rise to blood cell phenotypes and the stromal cell network comprises a mixed
cell population that generates bone, cartilage, fat, fibrous connective tissue and the
reticular network that supports blood cell formation.




                                             21
Mesenchymal Stem Cells

       MSCs are the non-haematopoietic cell component of the bone marrow stroma

which is capable of generating the cells of mesenchymal lineages, including bone,

cartilage, adipose, tendon and muscle tissue. The in vivo existence of MSCs is

supported by the fact that the tissue remodelling process during development and

throughout postnatal growth, repair and regeneration requires a continuous supply of

new cells suggesting the subsistence of these cells (24, 54).


       In fresh bone marrow, MSCs account for only 0.0001 to 0.01% of nucleated

marrow cells(37) (55, 56) Cells exhibiting MSC morphology and cellular

characteristics have been isolated from adult peripheral blood (57), adipose

tissue(58), skin tissue(59), trabecular bone(60), as well as foetal blood, liver, bone

marrow (61) and lung (62) and umbilical cord blood, (63). Amniotic fluid has also

been cited as a source of MSCs, with potential far-reaching implications for such

areas as prenatal diagnosis and gene therapy (64).



The mesenchymal stem cell niche

       A stem cell niche is known to integrate the effects of secreted factors,

intercellular interactions and cell-matrix interactions. It has been proposed that stem

cell niches, identified in a number of different adult tissues including skin, hair

follicles, bone marrow, intestine, brain, pancreas, and more recently dental pulp, are,

more often than not, highly vascularised cells (65). This proposition was further

supported by the recent findings that two different MSC populations, bone marrow

stromal stem cells (BMSSCs) and odontoblasts (DPSCs), both quite distinct in their




                                           22
ontogeny and developmental potentials, reside in the perivascular sites or

microvasculature of their respective tissues (65). The concept of the “stem cell

niche” evolved from studies on epithelial stem cells residing in intestinal crypts. It

has been reported that the crypt microenvironment provides important cues for

maintaining cells in their primitive state (66, 67). It is believed that the stem cells

progression or recruitment towards differentiation is associated with their physical

migration out of that niche.


        There is much research interest in determining what constitutes the

mesenchymal stem cell niche (68). The stroma and stromal cells together, provide a

physical support for maturing precursors of blood cells and serve as a repository of a

broad range of cell derived cues and signals driving the commitment, differentiation

and maturation of haematopoietic cells (69, 70). It is within this dynamic and cellular

microenvironment that MSCs are presumed to exist. Given the close physical

proximity to one another of both haematopoietic and mesenchymal cells in the bone

marrow, it could be argued that these two cell components occupy the same niche.

However, the extracellular and intracellular signals that are required to maintain both

the HSC and MSC developmental programs in the bone marrow microenvironment

are likely to be vastly different (24). Furthermore it has been proposed that the

colony forming ability of the primary MSCs increase in hypoxic conditions,

suggesting that oxygen may also be important in determining MSC fate (71, 72). A

complete characterization of the cellular, biochemical and molecular interactions of

MSCs within their niche is needed in order to understand how these cells can be

optimally regulated (24).




                                            23
       Despite the fact that bone marrow is considered an ideal source of MSCs,

these cells have been isolated from other tissue sources, including trabecular bone

(70), adipose tissue (58), synovium (73), skeletal muscle (74) and human umbilical

                                                s
cord perivascular cells derived from the Wharton' jelly (36). These findings show

that MSCs have a diverse in vivo distribution, and may in fact occupy a ubiquitous

stem cell niche (24).



Isolation and Characterization Studies of mesenchymal stem cells

       Initial approaches to enrich primary MSC cultures isolated from bone marrow

have utilized simple spatial separation of the haematopoietic cells from marrow

stromal elements within liquid suspension culture systems (75-77). Cells that

preferentially attach to the tissue culture plastic constitute the phenotypically and

functionally heterogeneous fibroblastoid cell population and are considered more

likely to be MSCs. On the other hand cells from the bone marrow stroma such as

macrophages and plasma cells do not typically adhere to the culture plates (76).


       Many approaches have investigated the isolation of increasingly homogenous

population of MSCs based on differential cellular morphological and dimensional

features within the bone marrow stroma using flow cytometry (78, 79) (which has

been discussed in detail in the phenotype characteristics of MSCs section of the

Literature Review). Recently, a relatively simple culture protocol based on size-

dependent sieving of a cell population from human bone marrow aspirates through a

porous membrane resulted in a relatively homogeneous population that had the

capacity of self-renewal and the multilineage differentiation potential, as indicated by

morphology and a wide range of cell-surface markers (77, 80) .




                                           24
Colony-forming unit fibroblast activity

In adult vertebrates, stem cells for mesenchymal tissue were initially isolated from

post natal bone marrow (81). When bone marrow cells are cultured in vitro the

resulting adherent population form colonies of spindle shaped cells, termed colony-

forming unit-fibroblasts. These colonies display the ability of extended proliferation

and differentiation towards multiple mesenchymal lineages, and are assumed to be

derived from a single precursor (51, 54, 82-84). A CFU-F assay has been adopted as

a standard functional in vitro assay for evaluating the mesenchymal tissue potential

(85-87). Employing this assay, many groups estimate that the number of

mesenchymal stem cells in marrow is approximately 1 per 100,000 marrow

mononuclear cells(85).


        Several studies indicate that within a given culture of mesenchymal stem cells

derived from a single colony forming unit, a broad variation in differentiation

potential exist, with tripotential cells making up a small minority, and most of the

cells exhibiting bi or unipotential capacities (87, 88). In keeping with this finding is

the varying extent of differentiation based on morphologic features that can be seen

in typical MSC culture, ranging from spindle to cuboidal cell types (89, 90).These

findings indicate that the cell population in any given isolation is heterogeneous with

respect to one of the criteria that define stem cells (87).


        This claim is further supported by evidence, from studies conducted on

individual colonies derived from single MSC precursors, which are heterogeneous in

terms of their multilineage differentiation potential. Pittinger et al (51) reported that

only one-third of the MSC clones are pluripotent (osteo, chondro, adipo).

Furthermore, non immortalized cell clones examined by Muraglia et al (91)



                                            25
demonstrated that 30% of the in vitro derived MSC clones exhibited tri-lineage,

while the remaining displayed a bilineage (osteo, chondro) or unilineage (osteo).

Kuznetsov et al (83) in their study demonstrated that roughly 60% of the single

colony derived clones had the ability to form bone within hydroxyapatite-tricalcium

phosphate ceramic scaffolds after implantation in immunodeficient mice. Although

CFU-Fs are clearly indicative of cells capable of forming colonies and are

representative of the more highly proliferative cells in these cultures, they are

extremely heterogeneous in both appearance (morphology and size) and

differentiation potential. So the most useful approach for presumptive identification

of MSC remains functional (92).



Clonal characterization of MSC

       Stem cells are generally defined as clonogenic cells capable of both self-

renewal and multilineage differentiation (93). It has been proposed that the MSC

pool comprises not only putative "MSCs", but also cell populations at different

stages of differentiation. During development and regeneration of a given tissue

these various multipotential MSCs give rise to non self-renewing progenitors with

restricted differentiation potential and finally to functionally mature cells (90). Other

studies have reported that hMSC population exhibited changes in morphology from

an initial spindle shaped morphology to a broader and flattened morphology as they

approached senescence (48). Subsequent studies demonstrated that MSC are

comprised of various sub-populations, differentiated by size and morphology having

diverse differentiation capabilities. They reported the occurrence of a third, smaller

and rounded cell (RS-1) that had a faster doubling time, longer life-spans and greater

differentiation capability (94, 95). Another characterization study conducted by



                                           26
Verfaille et al remarked upon the occurrence of a more primitive, pluripotent

progenitor of MSCs, termed multipotent adult progenitor cells (MAPCs) (96, 97)

which are reported to be capable of in vitro differentiation into endothelial, epithelial

and mesenchymal cell types (98, 99).


        To date, a large volume of research has been focused in characterizing MSC

population in the bone marrow and other sources using novel approaches to

understand MSCs capacity for self-renewal and multilineage differentiation.

Different strategies have been used to improve isolation and ex vivo expansion of

MSCs, including optimization of initial plating density, initial selection of a more

purified and homogeneous MSC population based on cell surface markers or cell

size. When plated at low densities in the presence of media supplemented with

mitogenic growth factors or serum, they form adherent clonogenic cells and the

resulting population will be less heterogeneous morphologically and phenotypically

(24).


        It was also noted that cells grown at low cell densities demonstrated

proliferation up to 50 population doublings, whereas at higher densities proliferation

was observed only for 15 population doublings (100, 101). Another study examining

seeding cell densities in a larger interval (10-1000 cells/cm2) showed that the lowest

density produced the highest fold increase in cell number (102). Over the years,

researchers adopted different cell seeding densities and novel approaches to isolate

purified populations of MSCs for further characterization studies(83, 88, 91, 97, 103,

104).


        Interestingly, the majority of the molecular characterization studies

performed on MSCs used a larger interval of seeding densities (≥10cells/cm²) for in


                                           27
vitro clonal subculture and are based upon cells derived from CFU-Fs which are

presumed to originate from a single BMSC cell. Further to get an adult stem cell

preparation that is 100% stem cells, it has to be “single cell cloned” in vitro so that

the proliferating cells will be genetically homogeneous to begin with (24).



Phenotype Characteristics of MSCs

       The in vitro characterization and maintenance of tissue stem/progenitor cells

is a critical aspect when assessing their potential for clinical applications (105).

Despite nearly three decades of research efforts into revealing their biological

properties, the phenotypic and functional characteristics of MSCs isolated from

various animal species still remains obscure. Many attempts have been made to

develop a cell-surface antigen profile, in order to better purify and identify MSCs,

especially a common immunophenotype which could enable isolation of a purified

population of MSCs from different tissues (106). Analysis using a combination of

monoclonal antibodies, developed against known and unknown surface markers of in

vitro derived MSCs, have led to the identification of a group of cell surface epitopes,

which include STRO-1, considered to be the best known MSC marker. It selectively

binds to non-haematopoietic progenitor cells and enrich the frequency of CFU-Fs in

primary bone marrow cells (107). Another antibody, SB-10 binds to undifferentiated

MSCs by binding with antigen,CD166 (activated leukocyte-cell adhesion molecule

[ALCAM]) and loses its affinity with the onset of osteogenesis (108, 109). Similarly,

the SH-2 antibody (110) selectively binds to the TGF- receptor endoglin/ CD105

found on human MSCs. The SH3 and SH4 antibodies were developed against

membrane-bound ecto-5-nucleotidase (CD73) (111). Other surface markers include,

nucleostemin, Sca-1 (stem cell antigen-1), SCF R/c-kit (stem cell factor), Thy-



                                            28
1/CD90, HLA-class I, Beta 1 integrin/CD29 and Indian blood group/CD44 (106). In

addition, the characterization of the various integrin - and -subunits and their

known non-covalent associations suggests that MSCs have receptors for numerous

extracellular matrix components, including collagen ( 1 1, 2 1), laminin ( 6 1,

 6 4), fibronectin ( 3 1, 5 1) and vitronectin ( v 1, v 3)(112). These results

point to several potentially key in vivo interactions between MSCs and other cell

types. However, no single marker has yet been identified that definitively delineates

in vivo MSCs and hence there is a lack of thorough understanding of the mechanisms

underlying stem cell renewal and its functional differentiation characteristics. As a

consequence, the quest for the identification of a prospective definitive biomarker

remains very much alive. Most stem cell enrichment protocols rely on fluorescence-

activated cell sorting (FACS) and use a set of antibodies against cell surface proteins

(38). There is, in addition, general agreement that human MSCs do not express

CD11b (an immune cell marker), glycophorin-A (an erythroid lineage marker) and

typical haematopoietic antigens such as CD45, CD34 (106). Molecular studies

involving unspecialized MSCs against its various terminally differentiated lineage

specific phenotype are necessary and are being pursued, to establish a molecular

signature which will aid in selective isolation of homogeneous population of MSCs.



Molecular approaches for phenotype determination

       A number of studies have been undertaken to gain insight into the molecular

mechanisms which control the various core stem cell properties. These studies have

employed high throughput techniques, such as DNA microarrays, SAGE, expressed

sequence tag (EST) Scan etc, focussing on the genetic level of in vitro differentiation

and direct comparison of different MSC preparations, seeking to identify molecular



                                          29
signatures specific to human MSCs (113). The obvious limitation to this approach is

that only changes at the mRNA level are measured and there are clear indications

that protein expression does not always correlate with modifications at the mRNA

level (114, 115).


       Rapid developments in proteomic technology over the last decade, with

regard to protein separation, quantification and identification, allows for a more

reliable comparison of proteomes. The importance of constructing a proteomic

profile characterizing multipotent MSCs directly, in addition to their transcriptomes,

is also becoming increasingly recognized. Accordingly, proteomic approaches have

been applied in order to identify key regulatory molecules and potential biomarkers.

Whole cell proteomes of MSCs have been evaluated with two dimensional

electrophoresis (2-DE) coupled with mass spectrometry (MS) (113, 116, 117).

Proteomic tools are invaluable in the elucidation of the underlying molecular

mechanisms of MSC differentiation. A number of publications have attempted to

compare differentiated and undifferentiated MSCs (117). Future developments of

MSC-based therapeutics and regenerative medicine will depend heavily on our

knowledge of MSCs specific biological properties, most notably self-renewal,

differentiation, tissue homing and mobilization (118).


       MS-based quantitative proteomic technologies have been employed

principally to reveal novel markers for MSCs, which can be utilized both for

isolation and to monitor differentiation. Using MS-based proteomic methods Foster

et al (119) and Salasznyk et al (120) attempted to profile the differential expression

of membrane protein markers in MSCs undergoing osteoblast differentiation, and

Kratchmarova et al (121) found that closely related signals frequently result in very



                                          30
different cellular outcomes, highlighting the effects of divergent growth factors on

MSCs differentiation.


        Published proteomic studies on MSCs already provide some relevant

information regarding the characteristics of these cells and factors associated with

their differentiation, but it is still difficult to glean a definitive proteomic profile from

these data, of undifferentiated and differentiated MSCs, owing to variations between

proteomic technologies, cell models and cell origins used by the various published

studies. Nonetheless, such profiling is essential to characterize MSCs, and identify

pathways involved in self-renewal, multipotency and differentiation. Further

proteomics work is necessary and, if possible, as an integrated paradigm that

includes cells from different origins and with access to phenotypic and genotypic

data of the cultures (114).



Self-renewing potential of MSCs

        Self-renewal is defined as the ability of cells to proliferate while maintaining

proliferation and differentiation potential (122). One of the defining characteristics of

stem cells is the ability to generate identical copies of themselves through mitotic

division over extended periods (88). It has been proposed that stem cells are in an in

vivo resting state and only divide when a stimulus is provided by neighbouring cells

in the microenvironment (123, 124). Depending on the stimulus, cells are known to

undergo either symmetric or asymmetric division, thus the stem cell pool is kept

constant but may expand in case of an injury or damage (122).


        As a population, bone marrow derived MSCs have been demonstrated to have

a significant but highly variable self renewal potential during in vitro serial



                                             31
propagation (24). Their entry into the cell cycle and subsequent development into

colonies depend on serum growth factors. Recent studies suggest that basic fibroblast

growth factor-2 (FGF-2) maintains human bone marrow stromal cells in an immature

state during in vitro expansion (125-127). It has been reported that higher population

doublings (PDs) i.e. >50 PDs have been achieved as a consequence of the addition of

specific growth factors (FGF-2) to the basal culture medium (125). Further it was

revealed that FGF-2 suppressed cellular senescence through down-regulation of

TGF- 2 expression in hMSCs and prevented the growth arrest in G1 phase by

suppressing the expression level of p21Cip1, a well characterized p53 target gene

(128-131). Cell seeding density also plays a role in the expansion capacity of MSCs.

Colter et al (95) demonstrated that higher expansion profiles of MSCs can be attained

when plated at low density (1.5 - 3 cells/cm²) resulting in the remarkable increase in

the fold expansion of total cells. Similar results were obtained by other researchers

suggesting that MSC clones are highly heterogeneous with respect to their self-

renewal capacity (24, 132). Furthermore, coordinated activities of a number of

signalling pathways, such as Wnt, Notch and BMP, have been reported to influence

the process of self-renewal in a context dependent manner (122). For example,

Wnt3a (a member of Wnt pathway) induce the activation of Wnt signalling which

leads to the induction of genes involved in proliferation such as

c-Myc and cyclinD1 in MSCs (133). Similarly, Notch1 and BMP signalling appear

to respectively maintain haematopoietic and embryonic stem cells in a

undifferentiated state (122). In order to harness the clinical potential of MSCs new

protocols must be established which allows the generation of large numbers of MSCs

without affecting their differentiation potential so as to meet the needs of tissue

engineering.



                                           32
Differentiation Potential of MSCs

       Differentiation is the process which leads to the expression of phenotypic

properties characteristic of the functionally mature cell in vivo. Ideal conditions

inducing the process of differentiation include a high cell density, enhanced cell-cell

and cell-matrix interactions and the presence of various differentiation factors. The

ability to differentiate into a variety of connective tissue cell types makes MSCs an

ideal candidate cell source for clinical tissue regeneration strategies (24).

Considerable research has been done in assessing the ability of MSCs derived from a

variety of different species to develop into terminally differentiated mesenchymal

phenotypes both in vitro and in vivo.


       The commitment and differentiation of MSCs to specific mature cell types is

influenced by the activities of various transcription factors, cytokines, growth factors

and extracellular matrix molecules. An optimal culturing strategy would involve

mimicking the in vivo environment of MSCs. Under defined inductive conditions,

MSCs are able to acquire characteristics of cells derived from embryonic mesoderm

such as osteoblasts, chondrocytes, adipocytes, tendon cells, as well as cells

possessing ectodermal and neuronal properties (24). Effects of various hormones,

vitamins, growth factors and cytokines on MSC proliferation and differentiation have

been assessed by in vitro differentiation assays, focusing mainly on osteogenic (134,

135), chondrogenic (136, 137) and adipogenic differentiation (138). Of the many

growth factors intrinsic to skeletal tissues, members of the fibroblast growth factor

family, and in particular FGF-2, are recognised as potent mitogens for a variety of

mesenchymal cells. In skeletal tissues, FGF-2 is produced by cells of the osteoblastic

lineage, accumulating in bone matrix, and acting as an autocrine/paracrine manner.


                                           33
Several genetic bone and cartilage abnormalities, for instance achondroplasia, are

due to mutations of genes for FGFs or their receptors, a fact that underlines the

importance of FGFs in bone and cartilage formation (24, 132). Enhanced

differentiation towards the osteoblastic lineage has been achieved with over-

expression of bone morphogenetic proteins (BMPs), and BMP-2 alone can boost the

bone nodule formation and calcium content of in vitro osteogenic cultures, while

simultaneous application of BMP-2 and FGF-2 enhances MSC osteogenesis both in

vivo and in vitro (139, 140). Likewise, cartilage phenotype was improved by over-

expression of transforming growth factor (TGF- ) in bone marrow derived MSCs

(54, 141). The TGF- superfamily of proteins and their members, which include

BMPs, are well known regulatory factors in chondrogenesis. TGF- 1 and more

recently TGF- 3 have been shown to readily induce the expression of chondrogenic

markers (53, 139, 142). In addition, supplementation of BMP-6 increases matrix

proteoglycan production in pellet cultures. Osteogenic and adipogenic differentiation

appears to be the best characterized MSC lineages. The runt homology domain

transcription factor (Runx2) and peroxisome proliferators-activated receptor gamma

(PPAR ) are, respectively, the key transcription factors responsible for the

osteogenic and adipogenic lineages (54, 143).


       Cell based therapies rely to a large degree on the preparation of an effective

dose of ex vivo expanded cells capable of self renewal and differentiation. The

identification of physiologically relevant cells forms an integral part of the emerging

field of tissue engineering. A number of comparative cell molecular studies have

been conducted in an attempt to identify the tissue source and cell types best suited

for cell based therapies (120, 144-147). Changing perceptions about the pluripotency

of MSCs, in the light of recent findings, indicate these cells are capable of


                                           34
differentiating into tissues of other germ layers and further broadens their potential

application (99, 148). Independent gene expression studies, conducted on various

stem cell populations, have reported the involvement of a diverse range of signalling

mechanisms regulating stem cell renewal and maintaining their differentiation

potential (147, 149-155), but these generally fail to identify genes that may be

involved in more than one differentiation lineage. Recently a group of eight genes,

which are up-regulated during all three mesenchymal lineage differentiations, have

been identified. These genes include: period homolog (PER1), nebulette (NEBL),

neuronal cell adhesion molecule (NRCAM), FK506 binding protein 5 (FKBP5),

interleukin 1 type II receptor (IL1R2), zinc finger protein 145 (ZNF145), tissue

inhibitor of metalloproteinase 4 (TIMP4) and serum amyloid A2 (156). A similar

study has reported another five genes: actin filament associated protein, frizzled 7,

dickkopf 3, protein tyrosine phosphatase receptor F and RAB3B, all of which

promote cell survival without altering cell proliferation, as well as influencing the

commitment of hMSCs into multiple mesenchymal lineages (154). These genes are

associated with a broad range of cellular processes, implying that the initiation and

commitment of adult stem cells is a complex process requiring the coordination of

multiple molecules and signalling pathways (155). In another interesting study it was

reported that fully differentiated MSC derived cells were able to switch phenotypes

to other mesenchymal lineages in response to specific extracellular stimuli (156). In

vitro differentiation of MSCs under appropriate conditions has led to the

identification of various factors essential for stem cell commitment. Among these are

secreted molecules and their receptors such as transforming growth factor- (TGF-

 ), extracellular matrix molecules (collagens and proteoglycans), actin cytoskeleton

and intracellular transcription factors (Cbfa1/Runx2, PPAR , Sox9 and MEF2) all



                                           35
which are proposed to play important roles in driving the commitment of multipotent

stem cells into specific lineages, and maintaining a differentiated phenotype (157,

158).



Stem cells and aging

        Most somatic cells in the human body are considered to have a finite

replicative potential. Following repeated cell divisions, cells eventually acquire

replicative senescence, a state in which they are viable, yet no longer able to divide

and display reduced functionality, termed the ‘Hayflick limit’ (159). This condition

is due to the eukaryotic cells’ inability to completely replicate their chromosomes

with cell division. The ends of chromosomes are capped by non-coding telomeres,

which consist of thousands of linear repeats of the 6-base pair (bp) sequence 5 -

TTAGGG-3 (160). Due to the nature of DNA polymerases, the final 30–120 bp of

the telomeres cannot be replicated with cell division, and these losses accumulate

with repeated cell divisions. When the telomeres are shortened beyond a critical

length, replicative senescence (phase M1) results (161). Most cells can only divide

and thus replace themselves between 30 and 50 times (161). Considering the limited

life span of various cells, the organs they form have a defined life span beyond which

they lose functionality. In this regard, a variety of genetic manipulations have been

explored in order to expand differentiated cell populations. Interestingly, ectopic

expression of human telomerase reverse transcriptase (hTERT) on some tissue cells

effectively increased cell lifespan, but also introduced the danger of malignant

transformation in the transplanted cells (159). Furthermore, the potential of

telomerase over-expressing cells to form in vivo bone is reported to be greatly

increased (162). This implies that ectopic expression of telomerase in human MSCs



                                          36
prevent a senescence associated phenotype and maintains proliferative ability and the

capacity to differentiate. It has further been reported that MSCs derived from

knockout mice, lacking telomerase activity completely, failed to differentiate into

adipocytes and chondrocytes, even at early passages (163).


       It has been argued that in vitro senescence of MSC appears to occur in

conjunction with a progressive loss of clonal multipotentiality and there is data to

suggest a progressive hierarchal loss of adipogenic potential and retention of

osteogenic potential until later passages (91). Similar studies indicate a decline in the

number of self renewing cells and CFU-Fs associated with loss of proliferation and

reduced multilineage potential with progressive aging (164). Stem cells are thought

to remain in a state of in vivo quiescence only to re-enter the cell cycle in response to

various physiological and pathological stimuli in order to promote regeneration and

repair processes. Stem cells therefore appear to regulate their cell cycle in a manner

different to most other cell types (165). On the other hand senescence is believed to

be an irreversible status associated with the expression of senescence-associated ß-

galactosidase. Senescent cells display a characteristic enlarged and flattened

morphology and are characterised by an irreversible G1 growth arrest involving the

repression of genes that drive cell cycle progression with an up regulation of cell

cycle inhibitors like p53/p21 and p16/RB (166, 167). Also, senescent cells secrete

factors which include degradative enzymes, inflammatory cytokines and growth

factors that accelerate tissue aging and tumorigenesis (168). Whether the

extracellular matrix surrounding the stem cell, namely the niche, is influenced by the

aging process still remains unsolved; however, it is plausible that signals inhibit

progenitor cell proliferation, as well as self-renewal of the stem cell, and that these

cell types could simply be inhibited by an aged environment (166).


                                           37
        The potential clinical demand for tissue engineered bone is high, but before

any widespread therapeutic use is possible, methods for generating large numbers of

MSCs, without affecting their differentiation potential, have to be established, and

models highlighting the molecular mechanisms underlying the phenomenon of in

vitro senescence of this cell type have to be addressed accordingly (25).



Immunomodulatory role of MSCs

        Another property of human MSCs, apart from their proliferation and

differentiation characteristics, is the absence of allogenic rejection of these cells in

humans and in different animal models (54, 169, 170); an attribute which further

renders them suitable for tissue transplantation purposes. MSCs often lack the major

histocompatibility complex (MHC)-II and co-stimulatory molecules that activate T-

cell receptors (171), and suppress T-cell function in co-culture (170), inhibit

leukocyte proliferation in vivo and prolong the potency of skin grafts (172). It is still

unclear whether the basis of the immunosuppressive properties of MSCs is due to

physical cellular contact or cytokine secretion. Treatment of severe acute graft-

versus-host diseases has been tried with transplantation of MSCs with promising

results, and the immunosuppressive properties of MSCs may be of great interest

when designing new strategies to treat these complicated conditions (54, 173).



Therapeutic applications

        The multilineage potential and self-renewing capacity of MSC make these

cells obvious candidates for tissue and gene based clinical applications. The ability of

MSCs to migrate in a preferential manner to the defect site is an added bonus and is




                                            38
governed by the expression of Stromal derived factor-1 (SDF-1) and its specific

receptor CXCR4, stem cell factor (SCF) and granulocyte-colony stimulating factor

(G-CSF). This process enables the mobilization of progenitor cells into the peripheral

blood allowing them to participate in endogenous tissue repair (174-176). Moreover,

the immunomodulatory properties of MSC confer a distinctive status on MSCs when

dealing with graft versus host disease (GvHD) following organ transplantation, as

well as the treatment of autoimmune diseases. Promising results have been shown

with patients suffering from hereditary diseases, such as osteogenesis imperfecta, the

nature of which imparts weak and brittle bones, rendering patients susceptible to

bone fractures. Allogenic bone marrow transplantation has demonstrated skeletal

engraftment of MSCs, osteogenic differentiation of these cells, followed by

improved consolidation of the bone matrix (177).


       Cartilage has notoriously poor regenerative abilities following injury, and

wear and tear typically leads to age related OA. Bone marrow cells derived from OA

patients have decreased chondrogenic and adipogenic activity, as well as

proliferative capacity (178); this patient group is therefore a prime target for MSCs

based therapy (54, 179). Autologous culture expanded bone marrow derived

mesenchymal stem cells have recently been successfully applied in patients with OA

(180) and such studies demonstrate proof of principle and the potential of MSCs

therapy for cartilage repair (180, 181). Apart from bone and cartilage, other

musculoskeletal tissues, such as tendons, ligaments and menisci are also potential

targets for tissue engineering (182, 183).


       The improved regeneration of the heart muscle, following the engraftment of

MSCs into the heart after a myocardial infarction, is one of the most fascinating



                                             39
example of the plasticity of MSCs (184). MSCs have also been used as vehicles for

targeted delivery of specific gene constructs and molecules. For example, genetically

modified MSCs transfected with an adenoviral vector encoding human interleukin-2

(IL-2), clearly demonstrated an enhanced anti-tumour effect and prolonged the

survival of tumour carrying animals (185) Another study demonstrated the

suppression of pulmonary metastasis by injecting MSCs over expressing interferon

into the tumour microenvironment (186).



       Together with the additional role of targeting vector and an inherent ability to

preferentially home in on defect sites, MSCs take on additional significance, opening

new horizons in medical research and applications. This review has summarized the

role of stem cells in basic biological processes highlighting MSC biology and

characterization.




                                          40
References


1.    March, L.M. and C.J. Bachmeier, 1997 Economics of osteoarthritis: a global
      perspective. Baillieres Clin Rheumatol, 11(4): p. 817-34.

2.    March, L.M. and H. Bagga, 2004 Epidemiology of osteoarthritis in Australia.
      Med J Aust, 180(5 Suppl): p. S6-10.

3.    Felson, D.T., 2004 Risk factors for osteoarthritis: understanding joint
      vulnerability. Clin Orthop Relat Res, (427 Suppl): p. S16-21.

4.    Felson, D.T., 1990 Osteoarthritis. Rheum Dis Clin North Am, 16(3): p. 499-
      512.

5.    Pai, Y.C., et al., 1997 Effect of age and osteoarthritis on knee proprioception.
      Arthritis Rheum, 40(12): p. 2260-5.

6.    Spector, T.D., et al., 1996 Genetic influences on osteoarthritis in women: a
      twin study. Bmj, 312(7036): p. 940-3.

7.    Kellgren, J.H., J.S. Lawrence, and F. Bier, 1963 Genetic Factors in
      Generalized Osteo-Arthrosis. Ann Rheum Dis, 22: p. 237-55.

8.    Felson, D.T., et al., 2000 Osteoarthritis: new insights. Part 1: the disease and
      its risk factors. Ann Intern Med, 133(8): p. 635-46.

9.    Felson, D.T., 1993 The course of osteoarthritis and factors that affect it.
      Rheum Dis Clin North Am, 19(3): p. 607-15.

10.   Sutton, S., et al., 2007 The contribution of the synovium, synovial derived
      inflammatory cytokines and neuropeptides to the pathogenesis of
      osteoarthritis. Vet J.

11.   Grodzinsky, A.J., et al., 2000 Cartilage tissue remodeling in response to
      mechanical forces. Annu Rev Biomed Eng, 2: p. 691-713.

12.   Lark, M.W., et al., 1997 Aggrecan degradation in human cartilage. Evidence
      for both matrix metalloproteinase and aggrecanase activity in normal,
      osteoarthritic, and rheumatoid joints. J Clin Invest, 100(1): p. 93-106.

13.   Lohmander, L.S., M.W. Lark, and J.D. Sandy, 1996 [Mechanisms of
      degradation of argecanes in osteoarthritic cartilage]. Rev Prat, 46(6 Spec No):
      p. S11-S14.

14.   Dahlberg, L., et al., 1994 Cartilage metabolism in the injured and uninjured
      knee of the same patient. Ann Rheum Dis, 53(12): p. 823-7.




                                         41
15.   Lohmander, L.S., 2000 What can we do about osteoarthritis? Arthritis Res,
      2(2): p. 95-100.

16.   Kuroda, R., et al., 2007 Treatment of a full-thickness articular cartilage defect
      in the femoral condyle of an athlete with autologous bone-marrow stromal
      cells. Osteoarthritis Cartilage, 15(2): p. 226-31.

17.   Kafienah, W., et al., 2007 Three-dimensional cartilage tissue engineering
      using adult stem cells from osteoarthritis patients. Arthritis Rheum, 56(1): p.
      177-87.

18.   Bosnakovski, D., et al., 2004 Chondrogenic differentiation of bovine bone
      marrow mesenchymal stem cells in pellet cultural system. Exp Hematol,
      32(5): p. 502-9.

19.   Schurman, D.J. and R.L. Smith, 2004 Osteoarthritis: current treatment and
      future prospects for surgical, medical, and biologic intervention. Clin Orthop
      Relat Res, (427 Suppl): p. S183-9.

20.   Majumdar, M.K., et al., 2000 Isolation, characterization, and chondrogenic
      potential of human bone marrow-derived multipotential stromal cells. J Cell
      Physiol, 185(1): p. 98-106.

21.   Raghunath, J., et al., 2005 Advancing cartilage tissue engineering: the
      application of stem cell technology. Curr Opin Biotechnol, 16(5): p. 503-9.

22.   Weiss, R., 2005 The Power to Divide. National Geographic.

23.   Gurtner, G.C., M.J. Callaghan, and M.T. Longaker, 2007 Progress and
      potential for regenerative medicine. Annu Rev Med, 58: p. 299-312.

24.   Baksh, D., L. Song, and R.S. Tuan, 2004 Adult mesenchymal stem cells:
      characterization, differentiation, and application in cell and gene therapy. J
      Cell Mol Med, 8(3): p. 301-16.

25.   Fehrer, C. and G. Lepperdinger, 2005 Mesenchymal stem cell aging. Exp
      Gerontol, 40(12): p. 926-30.

26.   Doss, M.X., et al., 2004 Embryonic stem cells: a promising tool for cell
      replacement therapy. J Cell Mol Med, 8(4): p. 465-73.

27.   Bruder, S.P. and B.S. Fox, 1999 Tissue engineering of bone. Cell based
      strategies. Clin Orthop Relat Res, (367 Suppl): p. S68-83.

28.   Raff, M., 2003 Adult stem cell plasticity: fact or artifact? Annu Rev Cell Dev
      Biol, 19: p. 1-22.

29.   2006 The Adult Stem Cell [Stem Cell Information].
      http://stemcells.nih.gov/info/scireport/chapter4.



                                         42
30.   Robey, P.G., 2000 Stem cells near the century mark. Journal of Clinical
      Investigation, 105: p. 1489–1491.

31.   2006 Understanding Stem Cells. The National Academies.

32.   Fortier, L.A., 2005 Stem cells: classifications, controversies, and clinical
      applications. Vet Surg, 34(5): p. 415-23.

33.   Sylvester, K.G. and M.T. Longaker, 2004 Stem cells: review and update.
      Arch Surg, 139(1): p. 93-9.

34.                                                                        s
      Prentice, D., 2003 Adult stem cells. Paper prepared for the President'
      Council on Bioethics. Appendix K.

35.   Bongso, A. and M. Richards, 2004 History and perspective of stem cell
      research. Best Pract Res Clin Obstet Gynaecol, 18(6): p. 827-42.

36.   Sarugaser, R., et al., 2005 Human umbilical cord perivascular (HUCPV)
      cells: a source of mesenchymal progenitors. Stem Cells, 23(2): p. 220-9.

37.   Jackson, L., et al., 2007 Adult mesenchymal stem cells: differentiation
      potential and therapeutic applications. J Postgrad Med, 53(2): p. 121-7.

38.   Blau, H.M., T.R. Brazelton, and J.M. Weimann, 2001 The evolving concept
      of a stem cell: entity or function? Cell, 105(7): p. 829-41.

39.   Ferrari, G., et al., 1998 Muscle regeneration by bone marrow-derived
      myogenic progenitors. Science, 279(5356): p. 1528-30.

40.   Theise, N.D., et al., 2000 Derivation of hepatocytes from bone marrow cells
      in mice after radiation-induced myeloablation. Hepatology, 31(1): p. 235-40.

41.   Petersen, B.E., et al., 1999 Bone marrow as a potential source of hepatic oval
      cells. Science, 284(5417): p. 1168-70.

42.   Orlic, D., et al., 2001 Bone marrow cells regenerate infarcted myocardium.
      Nature, 410(6829): p. 701-5.

43.   Lin, Y., et al., 2000 Origins of circulating endothelial cells and endothelial
      outgrowth from blood. J Clin Invest, 105(1): p. 71-7.

44.   Priller, J., et al., 2001 Neogenesis of cerebellar Purkinje neurons from gene-
      marked bone marrow cells in vivo. J Cell Biol, 155(5): p. 733-8.


45.   Brazelton, T.R., et al., 2000 From marrow to brain: expression of neuronal
      phenotypes in adult mice. Science, 290(5497): p. 1775-9.




                                         43
46.   Mezey, E., et al., 2000 Turning blood into brain: cells bearing neuronal
      antigens generated in vivo from bone marrow. Science, 290(5497): p. 1779-
      82.

47.   Smith, A.G., 2001 Embryo-derived stem cells: of mice and men. Annu Rev
      Cell Dev Biol, 17: p. 435-62.

48.   Bruder, S.P., N. Jaiswal, and S.E. Haynesworth, 1997 Growth kinetics, self-
      renewal, and the osteogenic potential of purified human mesenchymal stem
      cells during extensive subcultivation and following cryopreservation. J Cell
      Biochem, 64(2): p. 278-94.

49.   Beresford, J.N., 1989 Osteogenic stem cells and the stromal system of bone
      and marrow. Clin Orthop Relat Res, (240): p. 270-80.

50.   Owen, M., 1988 Marrow stromal stem cells. J Cell Sci Suppl, 10: p. 63-76.

51.   Pittenger, M.F., et al., 1999 Multilineage potential of adult human
      mesenchymal stem cells. Science, 284(5411): p. 143-7.

52.   Benayahu, D., et al., 1991 Subpopulations of marrow stromal cells share a
      variety of osteoblastic markers. Calcif Tissue Int, 49(3): p. 202-7.

53.   Johnstone, B., et al., 1998 In vitro chondrogenesis of bone marrow-derived
      mesenchymal progenitor cells. Exp Cell Res, 238(1): p. 265-72.

54.   Vaananen, H.K., 2005 Mesenchymal stem cells. Ann Med, 37(7): p. 469-79.

55.   Dazzi, F., et al., 2006 The role of mesenchymal stem cells in haemopoiesis.
      Blood Rev, 20(3): p. 161-71.

56.   Sakaguchi, Y., et al., 2005 Comparison of human stem cells drived from
      various mesenchymal tissues: Superiority of synovium as a cell source.
      Arthritis & Rheumatism, 52: p. 2521-9.

57.   Zvaifler, N.J., et al., 2000 Mesenchymal precursor cells in the blood of
      normal individuals. Arthritis Res, 2(6): p. 477-88.

58.   Zuk, P.A., et al., 2001 Multilineage cells from human adipose tissue:
      implications for cell-based therapies. Tissue Eng, 7(2): p. 211-28.

59.   Chunmeng, S. and C. Tianmin, 2004 Effects of plastic-adherent dermal
      multipotent cells on peripheral blood leukocytes and CFU-GM in rats.
      Transplant Proc, 36(5): p. 1578-81.


60.   Sottile, V., et al., 2002 Stem cell characteristics of human trabecular bone-
      derived cells. Bone, 30(5): p. 699-704.




                                         44
61.   Campagnoli, C., et al., 2001 Identification of mesenchymal stem/progenitor
      cells in human first-trimester fetal blood, liver, and bone marrow. Blood,
      98(8): p. 2396-402.

62.      t
      in 'Anker, P.S., et al., 2003 Mesenchymal stem cells in human second-
      trimester bone marrow, liver, lung, and spleen exhibit a similar
      immunophenotype but a heterogeneous multilineage differentiation potential.
      Haematologica, 88(8): p. 845-52.

63.   Erices, A., P. Conget, and J.J. Minguell, 2000 Mesenchymal progenitor cells
      in human umbilical cord blood. Br J Haematol, 109(1): p. 235-42.

64.   Pieternella, S., et al., 2003 Amniotic fluid as a novel source of mesenchymal
      stem cells for therapeutic transplantation. Blood, 102: p. 1548-9.

65.   Shi, S. and S. Gronthos, 2003 Perivascular niche of postnatal mesenchymal
      stem cells in human bone marrow and dental pulp. J Bone Miner Res, 18(4):
      p. 696-704.

66.   Potten, C.S. and M. Loeffler, 1987 A comprehensive model of the crypts of
      the small intestine of the mouse provides insight into the mechanisms of cell
      migration and the proliferation hierarchy. J Theor Biol, 127(4): p. 381-91.

67.   Loeffler, M., C.S. Potten, and H.E. Wichmann, 1987 Epidermal cell
      proliferation. II. A comprehensive mathematical model of cell proliferation
      and migration in the basal layer predicts some unusual properties of
      epidermal stem cells. Virchows Arch B Cell Pathol Incl Mol Pathol, 53(5): p.
      286-300.

68.   Koller, M.R., I. Manchel, and B.O. Palsson, 1997 Importance of
      parenchymal:stromal cell ratio for the ex vivo reconstitution of human
      hematopoiesis. Stem Cells, 15(4): p. 305-13.

69.   Strobel, E.S., R.E. Gay, and P.L. Greenberg, 1986 Characterization of the in
      vitro stromal microenvironment of human bone marrow. Int J Cell Cloning,
      4(5): p. 341-56.

70.   Noth, U., et al., 2002 Multilineage mesenchymal differentiation potential of
      human trabecular bone-derived cells. J Orthop Res, 20(5): p. 1060-9.

71.   Lennon, D.P., J.M. Edmison, and A.I. Caplan, 2001 Cultivation of rat
      marrow-derived mesenchymal stem cells in reduced oxygen tension: effects
      on in vitro and in vivo osteochondrogenesis. J Cell Physiol, 187(3): p. 345-
      55.

72.   D' Ippolito, G., et al., 2004 Marrow-isolated adult multilineage inducible
      (MIAMI) cells, a unique population of postnatal young and old human cells
      with extensive expansion and differentiation potential. J Cell Sci, 117(Pt 14):
      p. 2971-81.



                                        45
73.   Sakaguchi, Y., et al., 2005 Comparison of human stem cells derived from
      various mesenchymal tissues: superiority of synovium as a cell source.
      Arthritis Rheum, 52(8): p. 2521-9.

74.   Young, H.E., et al., 1995 Mesenchymal stem cells reside within the
      connective tissues of many organs. Dev Dyn, 202(2): p. 137-44.

75.   Gordon, M.Y., J.M. Goldman, and E.C. Gordon-Smith, 1983 Spatial and
      functional relationships between human hemopoietic and marrow stromal
      cells in vitro. Int J Cell Cloning, 1(6): p. 429-39.

76.   Mendelow, B., et al., 1980 Characterization of bone marrow stromal cells in
      suspension and monolayer cultures. Br J Haematol, 46(1): p. 15-22.

77.   Alhadlaq, A. and J.J. Mao, 2004 Mesenchymal stem cells: isolation and
      therapeutics. Stem Cells Dev, 13(4): p. 436-48.

78.   Von Drygalski, A., et al., 2004 Murine bone marrow cells cultured ex vivo in
      the presence of multiple cytokine combinations lose radioprotective and long-
      term engraftment potential. Stem Cells Dev, 13(1): p. 101-11.

79.   Zohar, R., J. Sodek, and C.A. McCulloch, 1997 Characterization of stromal
      progenitor cells enriched by flow cytometry. Blood, 90(9): p. 3471-81.

80.   Hung, S.C., et al., 2002 Isolation and characterization of size-sieved stem
      cells from human bone marrow. Stem Cells, 20(3): p. 249-58.

81.   Friedenstein, A.J., J.F. Gorskaja, and N.N. Kulagina, 1976 Fibroblast
      precursors in normal and irradiated mouse hematopoietic organs. Exp
      Hematol, 4(5): p. 267-74.

82.   Friedenstein, A.J., R.K. Chailakhjan, and K.S. Lalykina, 1970 The
      development of fibroblast colonies in monolayer cultures of guinea-pig bone
      marrow and spleen cells. Cell Tissue Kinet, 3(4): p. 393-403.

83.   Kuznetsov, S.A., et al., 1997 Single-colony derived strains of human marrow
      stromal fibroblasts form bone after transplantation in vivo. J Bone Miner Res,
      12(9): p. 1335-47.

84.   Castro-Malaspina, H., et al., 1980 Characterization of human bone marrow
      fibroblast colony-forming cells (CFU-F) and their progeny. Blood, 56(2): p.
      289-301.

85.   Deans, R.J. and A.B. Moseley, 2000 Mesenchymal stem cells: biology and
      potential clinical uses. Exp Hematol, 28(8): p. 875-84.

86.   Short, B., et al., 2003 Mesenchymal stem cells. Arch Med Res, 34(6): p. 565-
      71.




                                        46
87.    Park, P.C., et al., 2007 Stem cell enrichment approaches. Semin Cancer Biol,
       17(3): p. 257-64.

88.    Gronthos, S., et al., 2003 Molecular and cellular characterisation of highly
       purified stromal stem cells derived from human bone marrow. J Cell Sci,
       116(Pt 9): p. 1827-35.

89.    Owen, M. and A.J. Friedenstein, 1988 Stromal stem cells: marrow-derived
       osteogenic precursors. Ciba Found Symp, 136: p. 42-60.

90.    Digirolamo, C.M., et al., 1999 Propagation and senescence of human marrow
       stromal cells in culture: a simple colony-forming assay identifies samples
       with the greatest potential to propagate and differentiate. Br J Haematol,
       107(2): p. 275-81.

91.    Muraglia, A., R. Cancedda, and R. Quarto, 2000 Clonal mesenchymal
       progenitors from human bone marrow differentiate in vitro according to a
       hierarchical model. J Cell Sci, 113 ( Pt 7): p. 1161-6.

92.    Javazon, E.H., K.J. Beggs, and A.W. Flake, 2004 Mesenchymal stem cells:
       paradoxes of passaging. Exp Hematol, 32(5): p. 414-25.

93.    Suzuki, A. and H. Nakauchi, 2002 Identification and propagation of liver
       stem cells. Semin Cell Dev Biol, 13(6): p. 455-61.

94.    Shur, I., et al., 2002 Identification of cultured progenitor cells from human
       marrow stroma. J Cell Biochem, 87(1): p. 51-7.

95.    Colter, D.C., I. Sekiya, and D.J. Prockop, 2001 Identification of a
       subpopulation of rapidly self-renewing and multipotential adult stem cells in
       colonies of human marrow stromal cells. Proc Natl Acad Sci U S A, 98(14):
       p. 7841-5.

96.    Reyes, M. and C.M. Verfaillie, 2001 Characterization of multipotent adult
       progenitor cells, a subpopulation of mesenchymal stem cells. Ann N Y Acad
       Sci, 938: p. 231-3; discussion 233-5.

97.    Reyes, M., et al., 2001 Purification and ex vivo expansion of postnatal human
       marrow mesodermal progenitor cells. Blood, 98(9): p. 2615-25.

98.    Reyes, M., et al., 2002 Origin of endothelial progenitors in human postnatal
       bone marrow. J Clin Invest, 109(3): p. 337-46.

99.    Jiang, Y., et al., 2002 Pluripotency of mesenchymal stem cells derived from
       adult marrow. Nature, 418(6893): p. 41-9.

100.   Ulloa-Montoya, F., C.M. Verfaillie, and W.S. Hu, 2005 Culture systems for
       pluripotent stem cells. J Biosci Bioeng, 100(1): p. 12-27.




                                          47
101.   Colter, D.C., et al., 2000 Rapid expansion of recycling stem cells in cultures
       of plastic-adherent cells from human bone marrow. Proc Natl Acad Sci U S
       A, 97(7): p. 3213-8.

102.   Sekiya, I., et al., 2002 Expansion of human adult stem cells from bone
       marrow stroma: conditions that maximize the yields of early progenitors and
       evaluate their quality. Stem Cells, 20(6): p. 530-41.

103.   Banfi, A., et al., 2000 Proliferation kinetics and differentiation potential of ex
       vivo expanded human bone marrow stromal cells: Implications for their use
       in cell therapy. Experimental Hematology, 28(6): p. 707-715.

104.   Tremain, N., et al., 2001 MicroSAGE analysis of 2,353 expressed genes in a
       single cell-derived colony of undifferentiated human mesenchymal stem cells
       reveals mRNAs of multiple cell lineages. Stem Cells, 19(5): p. 408-18.

105.   Shih, D.T., et al., 2005 Isolation and characterization of neurogenic
       mesenchymal stem cells in human scalp tissue. Stem Cells, 23(7): p. 1012-20.

106.   Kolf, C.M., E. Cho, and R.S. Tuan, 2007 Mesenchymal stromal cells.
       Biology of adult mesenchymal stem cells: regulation of niche, self-renewal
       and differentiation. Arthritis Res Ther, 9(1): p. 204.

107.   Simmons, P.J. and B. Torok-Storb, 1991 Identification of stromal cell
       precursors in human bone marrow by a novel monoclonal antibody, STRO-1.
       Blood, 78(1): p. 55-62.

108.   Barry, F.P., 2003 Biology and clinical applications of mesenchymal stem
       cells. Birth Defects Res C Embryo Today, 69(3): p. 250-6.

109.   Bruder, S.P., et al., 1998 Mesenchymal stem cell surface antigen SB-10
       corresponds to activated leukocyte cell adhesion molecule and is involved in
       osteogenic differentiation. J Bone Miner Res, 13(4): p. 655-63.

110.   Haynesworth, S.E., M.A. Baber, and A.I. Caplan, 1992 Cell surface antigens
       on human marrow-derived mesenchymal cells are detected by monoclonal
       antibodies. Bone, 13(1): p. 69-80.

111.   Barry, F.P., et al., 1999 The monoclonal antibody SH-2, raised against human
       mesenchymal stem cells, recognizes an epitope on endoglin (CD105).
       Biochem Biophys Res Commun, 265(1): p. 134-9.

112.   Majumdar, M.K., et al., 2003 Characterization and functionality of cell
       surface molecules on human mesenchymal stem cells. J Biomed Sci, 10(2): p.
       228-41.

113.   Park, H.W., J.S. Shin, and C.W. Kim, 2007 Proteome of mesenchymal stem
       cells. Proteomics, 7(16): p. 2881-2894.




                                           48
114.   Roche, S., et al., 2006 Proteomics of primary mesenchymal stem cells. Regen
       Med, 1(4): p. 511-7.

115.   Anderson, L. and J. Seilhamer, 1997 A comparison of selected mRNA and
       protein abundances in human liver. Electrophoresis, 18(3-4): p. 533-7.

116.   Wang, D., et al., 2004 Proteomic Profiling of Bone Marrow Mesenchymal
       Stem Cells upon Transforming Growth Factor beta-1 Stimulation. The
       Journal of Biological Chemistry, 279: p. 43725-43734.

117.   Sun, H.J., et al., 2006 A Proteomic Analysis during Serial Subculture and
       Osteogenic Differentiation of Human Mesenchymal Stem Cell. Journal of
       Orthopaedic Research, 24: p. 2059-2071.

118.   Jeong, J.A., et al., 2006 Proteomic analysis of the hydrophobic fraction of
       mesenchymal stem cells derived from human umbilical cord blood. Mol
       Cells, 22(1): p. 36-43.

119.   Foster, L.J., et al., 2005 Differential expression profiling of membrane
       proteins by quantitative proteomics in a human mesenchymal stem cell line
       undergoing osteoblast differentiation. Stem Cells, 23(9): p. 1367-77.

120.   Salasznyk, R.M., et al., 2005 Comparing the protein expression profiles of
       human mesenchymal stem cells and human osteoblasts using gene ontologies.
       Stem Cells Dev, 14(4): p. 354-66.

121.   Kratchmarova, I., et al., 2005 Mechanism of divergent growth factor effects
       in mesenchymal stem cell differentiation. Science, 308(5727): p. 1472-7.

122.   Satija, N.K., et al., 2007 Mesenchymal stem cells: molecular targets for tissue
       engineering. Stem Cells Dev, 16(1): p. 7-23.

123.   Wilson, A. and A. Trumpp, 2006 Bone-marrow haematopoietic-stem-cell
       niches. Nat Rev Immunol, 6(2): p. 93-106.

124.   Moore, K.A. and I.R. Lemischka, 2006 Stem cells and their niches. Science,
       311(5769): p. 1880-5.

125.   Bianchi, G., et al., 2003 Ex vivo enrichment of mesenchymal cell progenitors
       by fibroblast growth factor 2. Exp Cell Res, 287(1): p. 98-105.

126.   Mastrogiacomo, M., R. Cancedda, and R. Quarto, 2001 Effect of different
       growth factors on the chondrogenic potential of human bone marrow stromal
       cells. Osteoarthritis Cartilage, 9 Suppl A: p. S36-40.

127.   Martin, I., et al., 1997 Fibroblast growth factor-2 supports ex vivo expansion
       and maintenance of osteogenic precursors from human bone marrow.
       Endocrinology, 138(10): p. 4456-62.




                                         49
128.   LaBaer, J., et al., 1997 New functional activities for the p21 family of CDK
       inhibitors. Genes Dev, 11(7): p. 847-62.

129.   el-Deiry, W.S., et al., 1993 WAF1, a potential mediator of p53 tumor
       suppression. Cell, 75(4): p. 817-25.

130.   Itahana, K., G. Dimri, and J. Campisi, 2001 Regulation of cellular senescence
       by p53. Eur J Biochem, 268(10): p. 2784-91.

131.   Ito, T., et al., 2007 FGF-2 suppresses cellular senescence of human
       mesenchymal stem cells by down-regulation of TGF-beta2. Biochem Biophys
       Res Commun, 359(1): p. 108-14.

132.   Bianco, P., et al., 2001 Bone marrow stromal stem cells: nature, biology, and
       potential applications. Stem Cells, 19(3): p. 180-92.

133.   de Boer, J., et al., 2004 Wnt signaling inhibits osteogenic differentiation of
       human mesenchymal stem cells. Bone, 34(5): p. 818-26.

134.   Zhou, S., et al., 2003 Estrogens activate bone morphogenetic protein-2 gene
       transcription in mouse mesenchymal stem cells. Mol Endocrinol, 17(1): p.
       56-66.

135.   Arikawa, T., K. Omura, and I. Morita, 2004 Regulation of bone
       morphogenetic protein-2 expression by endogenous prostaglandin E2 in
       human mesenchymal stem cells. J Cell Physiol, 200(3): p. 400-6.

136.   Schmitt, B., et al., 2003 BMP2 initiates chondrogenic lineage development of
       adult human mesenchymal stem cells in high-density culture. Differentiation,
       71(9-10): p. 567-77.

137.   Solchaga, L.A., et al., 2005 FGF-2 enhances the mitotic and chondrogenic
       potentials of human adult bone marrow-derived mesenchymal stem cells. J
       Cell Physiol, 203(2): p. 398-409.

138.   Neubauer, M., et al., 2004 Basic fibroblast growth factor enhances
       PPARgamma ligand-induced adipogenesis of mesenchymal stem cells. FEBS
       Lett, 577(1-2): p. 277-83.


139.   Tuan, R.S., G. Boland, and R. Tuli, 2003 Adult mesenchymal stem cells and
       cell-based tissue engineering. Arthritis Res Ther, 5(1): p. 32-45.

140.   Hanada, K., J.E. Dennis, and A.I. Caplan, 1997 Stimulatory effects of basic
       fibroblast growth factor and bone morphogenetic protein-2 on osteogenic
       differentiation of rat bone marrow-derived mesenchymal stem cells. J Bone
       Miner Res, 12(10): p. 1606-14.

141.   Palmer, G.D., et al., 2005 Gene-induced chondrogenesis of primary
       mesenchymal stem cells in vitro. Mol Ther, 12(2): p. 219-28.


                                          50
142.   Barry, F., et al., 2001 Chondrogenic differentiation of mesenchymal stem
       cells from bone marrow: differentiation-dependent gene expression of matrix
       components. Exp Cell Res, 268(2): p. 189-200.

143.   Moerman, E.J., et al., 2004 Aging activates adipogenic and suppresses
       osteogenic programs in mesenchymal marrow stroma/stem cells: the role of
       PPAR-gamma2 transcription factor and TGF-beta/BMP signaling pathways.
       Aging Cell, 3(6): p. 379-89.

144.   Jeong, J.A., et al., 2005 Differential gene expression profiling of human
       umbilical cord blood-derived mesenchymal stem cells by DNA microarray.
       Stem Cells, 23(4): p. 584-93.

145.   Wagner, W., et al., 2005 Comparative characteristics of mesenchymal stem
       cells from human bone marrow, adipose tissue, and umbilical cord blood.
       Exp Hematol, 33(11): p. 1402-16.

146.   Ulloa-Montoya, F., et al., 2007 Comparative transcriptome analysis of
       embryonic and adult stem cells with extended and limited differentiation
       capacity. Genome Biol, 8(8): p. R163.

147.   Liu, T.M., et al., 2007 Identification of common pathways mediating
       differentiation of bone marrow- and adipose tissue-derived human
       mesenchymal stem cells into three mesenchymal lineages. Stem Cells, 25(3):
       p. 750-60.

148.   Serafini, M. and C.M. Verfaillie, 2006 Pluripotency in adult stem cells: state
       of the art. Semin Reprod Med, 24(5): p. 379-88.

149.   Wieczorek, G., et al., 2003 Gene expression profile of mouse bone marrow
       stromal cells determined by cDNA microarray analysis. Cell Tissue Res,
       311(2): p. 227-37.

150.   de Jong, D.S., et al., 2004 Identification of novel regulators associated with
       early-phase osteoblast differentiation. J Bone Miner Res, 19(6): p. 947-58.

151.   Duan, R.P., et al., 2006 [The gene expression patterns of bone-marrow
       mesenchymal stem cells under different osteogenic induction]. Sichuan Da
       Xue Xue Bao Yi Xue Ban, 37(6): p. 856-9.

152.   Kulterer, B., et al., 2007 Gene expression profiling of human mesenchymal
       stem cells derived from bone marrow during expansion and osteoblast
       differentiation. BMC Genomics, 8: p. 70.

153.   Molofsky, A.V., R. Pardal, and S.J. Morrison, 2004 Diverse mechanisms
       regulate stem cell self-renewal. Current Opinion in Cell Biology, 16(6): p.
       700-707.




                                          51
154.   Song, L., et al., 2006 Identification and functional analysis of candidate genes
       regulating mesenchymal stem cell self-renewal and multipotency. Stem Cells,
       24(7): p. 1707-18.

155.   Molofsky, A.V., R. Pardal, and S.J. Morrison, 2004 Diverse mechanisms
       regulate stem cell self-renewal. Curr Opin Cell Biol, 16(6): p. 700-7.

156.   Song, L. and R.S. Tuan, 2004 Transdifferentiation potential of human
       mesenchymal stem cells derived from bone marrow. Faseb J, 18(9): p. 980-2.

157.   Madras, N., et al., 2002 Modeling stem cell development by retrospective
       analysis of gene expression profiles in single progenitor-derived colonies.
       Stem Cells, 20(3): p. 230-40.

158.   Harada, S. and G.A. Rodan, 2003 Control of osteoblast function and
       regulation of bone mass. Nature, 423(6937): p. 349-55.

159.   Petersen, T. and L. Niklason, 2007 Cellular lifespan and regenerative
       medicine. Biomaterials, 28(26): p. 3751-6.

160.   Moyzis, R.K., et al., 1988 A highly conserved repetitive DNA sequence,
       (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl
       Acad Sci U S A, 85(18): p. 6622-6.

161.   Hayflick, L. and P.S. Moorhead, 1961 The serial cultivation of human diploid
       cell strains. Exp Cell Res, 25: p. 585-621.

162.   Simonsen, J.L., et al., 2002 Telomerase expression extends the proliferative
       life-span and maintains the osteogenic potential of human bone marrow
       stromal cells. Nat Biotechnol, 20(6): p. 592-6.

163.   Liu, L., et al., 2004 Telomerase deficiency impairs differentiation of
       mesenchymal stem cells. Exp Cell Res, 294(1): p. 1-8.


164.   D' Ippolito, G., et al., 1999 Age-related osteogenic potential of mesenchymal
       stromal stem cells from human vertebral bone marrow. J Bone Miner Res,
       14(7): p. 1115-22.

165.   Rubin, H., 2002 The disparity between human cell senescence in vitro and
       lifelong replication in vivo. Nat Biotechnol, 20(7): p. 675-81.

166.   Sethe, S., A. Scutt, and A. Stolzing, 2006 Aging of mesenchymal stem cells.
       Ageing Res Rev, 5(1): p. 91-116.

167.   Campisi, J., 2005 Senescent cells, tumor suppression, and organismal aging:
       good citizens, bad neighbors. Cell, 120(4): p. 513-22.

168.   Krtolica, A. and J. Campisi, 2003 Integrating epithelial cancer, aging stroma
       and cellular senescence. Adv Gerontol, 11: p. 109-16.


                                         52
169.   Le Blanc, K., et al., 2004 Treatment of severe acute graft-versus-host disease
       with third party haploidentical mesenchymal stem cells. Lancet, 363(9419):
       p. 1439-41.

170.   Aggarwal, S. and M.F. Pittenger, 2005 Human mesenchymal stem cells
       modulate allogeneic immune cell responses. Blood, 105(4): p. 1815-22.

171.   Schoeberlein, A., et al., 2005 Tissue-specific engraftment after in utero
       transplantation of allogeneic mesenchymal stem cells into sheep fetuses. Am
       J Obstet Gynecol, 192(4): p. 1044-52.

172.   Bartholomew, A., et al., 2002 Mesenchymal stem cells suppress lymphocyte
       proliferation in vitro and prolong skin graft survival in vivo. Exp Hematol,
       30(1): p. 42-8.

173.   Troeger, A., et al., 2005 Immunotherapy in allogeneic hematopoietic stem
       cell transplantation--not just a case for effector cells. Bone Marrow
       Transplant, 35 Suppl 1: p. S59-64.

174.   Orlic, D., et al., 2001 Mobilized bone marrow cells repair the infarcted heart,
       improving function and survival. Proc Natl Acad Sci U S A, 98(18): p.
       10344-9.

175.   Ratajczak, M.Z., et al., 2004 Transplantation studies in C3-deficient animals
       reveal a novel role of the third complement component (C3) in engraftment
       of bone marrow cells. Leukemia, 18(9): p. 1482-90.

176.   Kan, I., E. Melamed, and D. Offen, 2005 Integral therapeutic potential of
       bone marrow mesenchymal stem cells. Curr Drug Targets, 6(1): p. 31-41.

177.   Mauney, J.R., V. Volloch, and D.L. Kaplan, 2005 Role of adult mesenchymal
       stem cells in bone tissue engineering applications: current status and future
       prospects. Tissue Eng, 11(5-6): p. 787-802.

178.   Murphy, J.M., et al., 2002 Reduced chondrogenic and adipogenic activity of
       mesenchymal stem cells from patients with advanced osteoarthritis. Arthritis
       Rheum, 46(3): p. 704-13.

179.   Luyten, F.P., 2004 Mesenchymal stem cells in osteoarthritis. Curr Opin
       Rheumatol, 16(5): p. 599-603.

180.   Wakitani, S., et al., 2002 Human autologous culture expanded bone marrow
       mesenchymal cell transplantation for repair of cartilage defects in
       osteoarthritic knees. Osteoarthritis Cartilage, 10(3): p. 199-206.

181.   Fibbe, W.E., 2002 Mesenchymal stem cells. A potential source for skeletal
       repair. Ann Rheum Dis, 61 Suppl 2: p. ii29-31.




                                         53
182.   Hui, J.H., et al., 2005 Mesenchymal stem cells in musculoskeletal tissue
       engineering: a review of recent advances in National University of Singapore.
       Ann Acad Med Singapore, 34(2): p. 206-12.

183.   Pittenger, M., et al., 2002 Adult mesenchymal stem cells: potential for muscle
       and tendon regeneration and use in gene therapy. J Musculoskelet Neuronal
       Interact, 2(4): p. 309-20.

184.   Amado, L.C., et al., 2005 Cardiac repair with intramyocardial injection of
       allogeneic mesenchymal stem cells after myocardial infarction. Proc Natl
       Acad Sci U S A, 102(32): p. 11474-9.

185.   Nakamura, K., et al., 2004 Antitumor effect of genetically engineered
       mesenchymal stem cells in a rat glioma model. Gene Ther, 11(14): p. 1155-
       64.

186.   Studeny, M., et al., 2004 Mesenchymal stem cells: potential precursors for
       tumor stroma and targeted-delivery vehicles for anticancer agents. J Natl
       Cancer Inst, 96(21): p. 1593-603.




                                         54
                                   Chapter 3


Materials and Methods


Cell culture methods

Isolation and expansion of Bone Marrow Stromal Cells

Ethics clearance for this project was approved by the QUT Human Ethics Committee

(QUT 3099H), The Prince Charles Hospital Human Ethics Committee (EC2310) and

The Holy Spirit North Side Hospital Human Ethics Committee, Brisbane, Australia.

Bone marrow samples were obtained, after informed consent, from OA patients

undergoing elective knee replacement surgery. The bone marrow in this study was

sourced from the femoral canal. The joint was opened followed by draining of

synovial fluid and extensive lavage, as per standard knee replacement operation

procedure. A femoral drill hole was made through the distal femur and a rod passed

into the marrow allowing it to be aspirated with a syringe. Care was taken to avoid

contamination from other sources of MSCs. Samples were placed in 50ml falcon

tubes containing 5ml phosphate buffered saline (PBS) supplemented with 200U/ml

heparin. After filtering through a 100µm filter, the samples were mixed with Hanks

buffer (GIBCO, Invitrogen Corporation, Australia), then 15ml of Lymphoprep (Aix-

Shield PoC AS, Norway) was gently layered under the sample (15ml Lymphoprep

per 30ml sample). The samples were then centrifuged at 400 x g without acceleration

or brake for 35 minutes at 20ºC. The bottom layer contained erythrocytes which were

aggregated and sedimented completely through the Lymphoprep. Cells located at the

interface between the bone marrow sample and Lymphoprep were collected and



                                         57
further resuspended in 1ml of Dulbecco’s Modified Eagle’s Medium with low

glucose (DMEM) (GIBCO) supplemented with batch tested 10% foetal bovine serum

(FBS) (HyClone, USA), 10U/ml penicillin G and 10µg/ml streptomycin (GIBCO)

(complete medium).


MSC cultures were performed by plating the cell suspension in a 75cm2 culture flask

at 37°C in a humidified atmosphere containing 5% CO2. No media changes were

made in the initial five days; from the fifth day onwards, media was changed every 3

days until the culture flask was confluent. Upon confluence the cells were detached

with 0.05% trypsin-EDTA (GIBCO) and the cells were taken to the next passage.



Clonal Culture of MSCs

Single-cell derived colonies (clones) of MSCs were obtained from cells resulting

from the initial limiting dilution cultures. Cultures were grown in standard complete

medium supplemented with 2 ng/ml of fibroblast growth factor (FGF-2) (Auspep Pty

Ltd, Australia). Cells were seeded at the rate of 1-3 cells per well in a 96 well plate,

after which wells containing single cells were selected by visualization under a

microscope. Cells that grew to confluence were harvested by 0.05% trypsin-EDTA

and first seeded into 24 well plates and then into 6 well plates under the same

conditions and maintained as pure cell lines. Subsequently, these cells were further

passaged into 25cm2 and 75cm2 culture flasks under the same conditions. Once

confluent, the cells were preserved in liquid nitrogen for future experiments.




                                           58
Mixed Culture

The adherent cells resulting from the initial culture were seeded in two T75 flasks.

Cultures were grown in the standard medium supplemented with and without 2 ng/ml

of FGF-2. The flasks were observed daily for cell proliferation and the media

changed every 3 days. When the cells had grown to 80% confluence, the cells were

trypsynized and taken to the next passage and maintained under the same culture

conditions until passage five. At every passage, cells were frozen for future

experiments.



Population doublings

The number of viable cells/ml was determined at each passage by hemocytometer. A

graph was plotted against the time in culture for a single cell to reach a population of

approximately 1 million cells, or conversely undergo 20 PDs.



Cell staining and Microscopy

The proliferation ability of the fast- and slow-growing clones was assessed by plating

cells at a concentration of 8,000 cells/ml in a twenty four well plate. After three days

in culture the cells were fixed with 4% paraformaldehyde and stained with a drop of

crystal violet stain for 10 minutes. Excess stain was washed away with tap water and

after drying the plates were examined under a microscope.


Differentiation of clone and mixed cell cultures in vitro

Differentiation potential of the clone and mixed cell populations towards the

osteogenic, chondrogenic and adipogenic lineages was verified by stimulating the

cells in the respective selective differentiation media.


                                           59
Osteogenic differentiation

MSCs were seeded at a density of 5x10³cells/cm2. Osteogenic differentiation of

confluent monolayers was induced with complete medium (DMEM-HG

supplemented with 10% FBS and Penicillin / Streptomycin) supplemented with

50µM ascorbic acid, 10mM -glycerol phosphate and 100nM dexamethasone (All

from Sigma-Aldrich, Australia). The media was changed twice weekly over a period

of 21 days. Differentiation was noticed as the cells formed aggregates or nodules at

about two weeks and progressed to form mineralized bone matrix.

von Kossa staining

After three weeks, cells were fixed with 4% paraformaldehyde and incubated in 1%

silver nitrate solution under a 60-100 watt light bulb for 60 minutes. Un-reacted

silver nitrate was removed by incubating with 5% sodium thiosulphate for 5 minutes.

The monolayer of cells was rinsed with distilled water and allowed to dry. Matrix

mineralization and deposition of calcium phosphate nodules was observed under a

light microscope and the image captured.


Chondrogenic differentiation

Chondrogenic differentiation was induced by growing the cells (5x10³ cells/cm²),

over a period of 21 days, in serum free medium consisting of high glucose DMEM

supplemented with 10ng/ml TGF- 3, 100 nM dexamethasone, 50 µg/ml ascorbic

acid 2-phosphate, 100 µg/ml sodium pyruvate, 40 µg/ml proline and a commercial

preparation of ITS-plus (final concentration: 6.25 µg/ml insulin, 6.25 µg/ml

transferrin, 6.25 µg/ml selenious acid, 5.33 µg linoleic acid and 1.25mg/ml bovine

serum albumin) (All from Sigma-Aldrich).

Alcian Blue Staining


                                           60
After 21 days the cells were fixed with 4% Para formaldehyde. Matrix deposition of

glycosaminoglycans was detected by staining the cells with 1% Alcian blue in 3%

acetic acid for 15 minutes and then rinsing the excess stain with distilled water, air

dried and observed under a light microscope and the image captured.


Adipogenic differentiation

The adipogenic differentiation was induced by growing the cells (5x10³ cells/cm²) in

complete medium supplemented with 0.5 mM isobutyl methyl xanthine, 100-200 µM

indomethacin, 1 µM dexamethasone, and 10 µg/ml insulin (All from Sigma-Aldrich).

To induce adipogenic differentiation MSCs were subjected to a total of 3 cycles of

three days of adipogenic induction medium followed by one day of adipogenic

maintenance medium (10 µg/ml insulin in DMEM with 10% FBS). Following the

initial induction cycle the cells were kept in adipogenic maintenance medium until

the 21st day, with change of medium every three days.

Oil red-O staining

The cell monolayer was washed with PBS, fixed with 4% paraformaldehyde and

stained with Oil red-O. The Oil red-O solution was prepared by vigorously mixing 3

parts solution (0.5% in isopropanol) with 2 parts water for 5 minutes and filtering

through a 0.4 µm filter. The cells were stained for 15 minutes to detect the lipid

droplets within the differentiated cells. Excess stain was removed by rinsing with

60% isopropanol and water. Clusters of lipid droplets were detected by observing

under a light microscope and the image captured.



  eta-galactosidase staining

Cytochemical staining for senescence associated -galactosidase staining was

performed by seeding BMSCs from fast-growing, slow-growing and mixed culture at

                                           61
the seventh passage at the cell density of 1x10³ cells/well in a 24 well plate. The cells

were allowed to attach overnight and then were washed with PBS, fixed and

incubated overnight at 37˚C with X-gal chromogenic substrate at pH 6.0 according to

the protocol provided by the -galactosidase staining kit (Cell Signaling

Technology). The colour development was observed under a light microscope and

the image captured.



Karyotyping

Briefly, cells from actively growing cultures were trypsinized and pelleted. The cells

were incubated with colcemid for 1.5 hours and lysed with hypotonic KCl followed

by fixation in acid/alcohol (3:1 of methanol/glacial acetic acid). Karyotype was

analyzed by the cytogenetics department, Sullivan Nicolaides Pathology, Brisbane.



Phenotype determination by Flow Cytometry

Clonal surface marker expression was characterized by flow cytometry. Confluent

cultures were harvested by treating with 0.05% trypsin/EDTA for 1 minute and

pelleted at 1000 rpm for 10 minutes. Cells were re-suspended in fluorescence-

activated cell sorting (FACS) buffer (PBS + 0.1% (w/v) sodium azide + 1% (w/v)

bovine serum albumin) and incubated with primary unconjugated antibodies (CD29,

CD34, CD45, CD44, CD73, CD90, CD105, CD166, major histocompatibility

complex (MHC class I, and MHC class II) (BD Biosciences, Clontech, Palo Alto,

CA, USA) for 15 minutes at room temperature. The cells were then washed and

incubated with goat anti-mouse immunoglobulin G phycoerythrin conjugate

secondary antibody, (Jackson Immunoresearch laboratories, West Grove, PA, USA)

for 15 minutes. The cells were then washed and analysed by flow cytometry on a


                                           62
FACS Calibur (Becton Dickinson, UK). Data was analysed using FCSExpressTM

software.



Molecular biology methods

Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)

analysis



Total RNA isolation

Total RNA was extracted from clonal cell populations at passage 6 using Tri Reagent

(Sigma) following the manufacturer’s protocol. Phase separation was performed by

treating with 100 µl chloroform per 500 µl of Tri Reagent used. The suspension was

vortexed and incubated for 15 minutes at room temperature followed by

centrifugation at 12,000 x g at 4ºC for 20 minutes. The aqueous phase was carefully

transferred and precipitated with 500µl of isopropanol per 1 ml Tri Reagent used.

Following incubation at room temperature for 10 minutes the suspension was

centrifuged at 12,000 x g at 4ºC for 20 minutes. The RNA pellet was washed twice

with 1 ml of 75% ethanol and centrifuged for at 7,500 x g at 4ºC for 8 minutes. After

vacuum drying for 5-10 minutes the RNA pellet was rehydrated in RNase free water.

RNA concentration and purity was examined by diluting total RNA at 1:40 and

measuring the absorbance ratios at 260 and 280 nm on a DU 800 UV/Visible

spectrophotometer (Beckman Coulter). The RNA quality was verified by the

integrity and size distribution of the 18s and 28s ribosomal bands on a non-

denaturing 1.5% agarose Tris borate EDTA (TBE) buffered gel.




                                         63
DNase treatment

Any genomic DNA contamination present was removed by DNase (Invitrogen)

treatment according to the supplier’s instructions. The reaction mixture (10µl)

containing 1µg of RNA sample, 1µl 10x DNase I reaction buffer, 1µl DNase I

(1U/µl) and RNAse free water was incubated for 15 minutes at room temperature.

The reaction mixture was inactivated by the addition of 1µl of 25 mM EDTA

followed by further heat inactivation for 10 minutes at 65ºC. DNase traces were

removed using an RNeasy cleanup kit (Qiagen).


cDNA synthesis

1 g of total RNA was used to synthesize template cDNA. Total RNA (10pg-5µg)

along with oligo dT (invitrogen) was heated to 65ºC for 5 minutes and then a final

reaction volume of 20 µl containing 4 µl 5x first strand buffer (RT buffer), 1 µl of

0.1 M DTT, 1 µl recombinant RNase inhibitor and 1µl of SuperScript™ III Reverse

Transcriptase (Invitrogen) was incubated at 50ºC for 60 minutes followed by heat

inactivation of the reaction mixture at 70ºC for 15 minutes.


PCR

Polymerase chain reactions were performed in 20µl total reaction volume containing

2µl of RT reaction, 10 pmol of forward primer, 10 pmol of reverse primer, 0.4 mM

dNTP and 0.5U of RedTaq Polymerase. The reactions were run for 30 cycles of

denaturation at 95ºC for 1 min, primer annealing at 55ºC and primer extension at

72ºC for 2 minutes.    10 µl of the PCR product was analysed by agarose gel

electrophoresis. The house keeping gene, -2 microglobulin ( -2M) served as

control.




                                          64
Real-Time Quantitative PCR

Real Time-PCR was performed in reactions containing 12.5 µl of 2x PCR Master

Mix (SYBR green), 2.5 µl (10 µM) of each forward and reverse primer for each gene

of interest for a final concentration of 20pmol, 2.5 µl of cDNA template and RNase

free water for a total reaction volume of 25µL. The reactions were run on a ABI

Prism 7000 Sequence Detection System (Applied Biosystems) using these cycling

parameters: 1cycle of 30 minutes at 48ºC for reverse transcription, 1 cycle of 10

minutes at 95ºC for activation of polymerase, 40 cycles of 15 seconds at 95ºC for

denaturation and 1minute at 60ºC for extension. Melting curve analysis was

performed to ensure that the specific amplicon amplification was free from genomic

DNA contamination. The Ct value for each sample was defined as the cycle number

at which the fluorescence intensity reached a certain threshold where amplification of

each target gene was within the linear region of the reaction amplification curves.

Relative expression level for each target gene was normalized by the Ct value of the

housekeeping gene 18S and determined by using        Ct method.


RT² Profiler™ PCR Array

The stemness of the fast-growing clones was compared to the slow-growing clones

by means of stem cell RT² Profiler™ PCR Array system (SuperArray Bioscience

Corporation, www.superarray.com). The RT2 Profiler PCR Array takes advantage of

real-time PCR performance and combines it with the multigene profiling capabilities

of microarrays to detect the simultaneous expression of many genes related to a

biological pathway.


1 g of total RNA was used to synthesize template cDNA using the SuperArray RT²

First Strand Kit following the manufacturer’s protocol. The template cDNA was



                                          65
mixed with 2X RT2 qPCR Master Mix and 25 l of the cocktail aliquoted into each

well on the PCR array plate containing pre-dispensed gene specific primer sets. Each

array consisted of a panel of 96 primer sets for 84 stem cell pathway genes, plus five

housekeeping genes and three RNA and PCR quality controls. Reactions were

carried out using an ABI Prism 7300 Sequence Detection System (Applied

Biosystems, Australia). PCR amplification followed a two-step cycling program: 10

minutes denaturizing at 95˚C, 40 cycles of 95˚C for 15 seconds and 60˚C for 1

minute.


Data Analysis

Analysis of the expression of the panel of genes was determined by the      Ct method

using an excel-based PCR Array Data Analysis template from the SuperArray web

site: http://www.superarray.com/pcrarraydataanalysis.php



Protein expression profiling


Preparation of cell lysis buffer

The lysis buffer consisted of 7.5 M urea, 2.5 M thiourea, 12.5% glycerol, 62.5mM

Tris-HCl 2.5% (w/v) n-octylglucoside (octyl -D-glucopyranoside), 6.25mM TCEP

(Tris (2-carboxyethyl) phosphine hydrochloride), 1.25mM protease inhibitor

cocktail. Stock Lysis Buffer was prepared according to the Proteome Lab™ PF 2D

manufacturer’s protocol. All the above chemicals were biotechnology grade from

Sigma Aldrich Pty (Castle Hill, New South Wales, Australia).


Cell culture for protein extraction

Fast- and slow-growing clone cultures were plated at a density of 5×10³ cells/cm² in



                                          66
175cm² flask for continuous passaging in complete DMEM. The cells were incubated

at 37ºC and 5% CO2.


Sample Preparation

Cells were recovered from eight 175 cm² culture flasks, pooled together and washed

twice in Dulbecco’s phosphate buffered saline, DPBS (GIBCO). A total of 500µL of

the cell pellet was suspended in 2mL of lysis buffer containing a protease inhibitor

cocktail and vortexed rigorously. The suspension was centrifuged at 20,000 x g for

60 mins at 18ºC to prevent precipitation of the lysis buffer. The resulting supernatant

was stored at -80ºC until further use.


Buffer Exchange

Due to the incompatibility of the lysis buffer with ProteomeLab chromatofocusing

columns (Beckman Coulter), buffer exchange of the protein lysate with the Start

buffer (supplied with the kit) was performed using PD-10 Desalting columns (GE

Healthcare Biosciences, NSW, Australia). The PD-10 column was initially

equilibrated with 25 ml of the Start buffer and then a total volume of 2.5 ml of the

protein sample was added on to the column. The protein was eluted by adding 3.5 ml

of the Start buffer and was collected in 0.5 ml fractions.



Determination of the protein concentration

The protein fraction concentrations were estimated by dot blot assay using a set of

standards ranging from 0.3 mg to 2 mg. The fractions of interest were combined and

serially diluted to 1:4 and 1:10. Protein concentration was determined with a BCA™

protein assay kit (Pierce, Quantum Scientific, QLD, Australia) following the

supplier’s instructions. A set of protein standards (BSA) ranging from 0.3 mg to 2


                                           67
mg and Blank replicates were included along with the unknown sample replicates.

Absorbance was measured at 562 nm on a spectrophotometer and a standard curve

was prepared by plotting the average Blank-corrected 562 nm measurement for each

BSA standard versus its concentration in µg/ml. The standard curve was used to

determine the protein concentration of each unknown sample.


1st-Dimension Separation - Chromatofocusing

First and second dimension separations were based on the ProteomeLab ™ PF 2D

default method. Start and Eluent Buffers, supplied in the PF 2D chemistry kit

(Beckman Coulter, Fullerton, CA, USA), were sonicated for 5 minutes and pH

adjusted to 8.5 ± 0.1 and 4.0 ± 0.1 with saturated iminodiacetic acid (Sigma Aldrich

Pty) and 1M NH4OH respectively. Chromatofocusing was performed at ambient

temperature with a flow rate of 0.2 ml/min, and absorbance of the column eluent

monitored at 280 nm. The chromatofocusing column was first equilibrated with 30

volumes of Start Buffer, after which 1 to 5 mg of protein sample, previously

exchanged into Start Buffer, was injected onto the column. Proteins were then

fractionated by their isoelectric point (pI) over a pH gradient of pH 4.0 to pH 8.5.

Liquid fractions were collected at 0.3 pH intervals during the pH gradient and at 5

minute intervals at all other times. The first dimension fractions were collected into a

96 well plate by the combination fraction collector/auto-injector (FC/I).


2nd -Dimension Separation - High Performance Reversed-Phase

Chromatography

The pI fractions from the first dimension were sequentially injected onto the second

dimension High Performance Reverse Phase Liquid Chromatography column as

specified in the ProteomeLab™ PF 2D users manual. The first dimension fractions



                                          68
were separated based on their hydrophobicity over a solvent gradient of H2O/0.1%

trifloroacetic acid (TFA), (Solvent A) and acetonitrile / 0.08% TFA, (Solvent B)

(both reagents from Sigma Aldrich Pty Ltd, NSW, Australia). The second dimension

separation was performed at 50ºC at a flow rate of 0.75 ml/min and column eluent

absorbance was measured at 214 nm. The column was first equilibrated with 10

volumes of 100% Solvent A. From each first dimension fraction 200 µL was injected

and the column was eluted with a gradient of 0-100% Solvent B. The reverse phase

fractions were collected at a rate of 1 min/fraction into 96-deep well plates for

subsequent processing and digestion with trypsin for analysis by mass spectroscopy,

without any additional extraction or solubilisation of the sample with other

fractionation techniques.


Data Analysis

UV absorbance profiles, were generated for each of the fast- and slow-growing clone

separations using the ProteoVue application of the ProteomeLab™ PF 2D Software

Suite 1.0. A comparison of the UV absorbance profiles for the fast and slow clones

was performed using the DeltaVue application of the software suite. The Peak

Picking analytical tool of the DeltaVue software enabled quantitation of differences

in UV absorbance between the fast- and slow-growing clone profiles and the results

were displayed as fold changes.


Sample Preparation and Mass Spectrometry

Selected reverse phase fractions were concentrated using a Speedi-Vac concentrator

(Thermo Savant) and subsequently reduced by treating each fraction with 100 µL

0.1M NH4CO3, pH 7.9 and 20 mM DTT (Sigma Aldrich) and incubated for one hour

at 56°C. Samples were then alkylated by adding 0.5 M iodoacetamide stock (Sigma



                                           69
Aldrich) for a final concentration of 50 mM in each tube and incubated for 30

minutes at 37°C in the dark. All the samples were digested with sequencing grade

modified trypsin (Promega, NSW, Australia), by adding 50 g/µL stock to a final

concentration of 1 g/µL and incubating overnight at 37°C. The trypsinized peptides

were then desalted using Perfect Pure c18 tips (Quantum Scientific, Brisbane,

Australia) and 0.4 µL of each sample was spotted onto a MALDI target plate (96 × 2

spot Abi 4700 target), which before had been spotted with 0.4µL of -cyano-4-

hydroxy-trans-cinnamic acid (CHCA) matrix (Sigma) at a concentration of 5 mg/ml

in 60% acetonitrile, 0.1% TFA. The spots were air dried and MALDI TOF–TOF /

MS analysis was performed using a 4700 Proteomics Analyser mass spectrometer

(Applied Biosystems) at the Molecular and Cellular Proteomics Mass Spectrometry

Facility, Australian Research Council Special Research Centre for Functional and

Applied Genomics, the University of Queensland.


Peptide Identification

The MASCOT (Matrix Science) search engine was used to deconvolute the raw mass

spectra to obtain a list of probability-based protein/peptide matches for each of the

samples. The taxonomy parameter was restricted to mammalia; trypsin cleavage

specificity was allowed one missed cleavage, peptide tolerance was limited to 50

ppm, fixed modifications were carbamidomethylation of cysteine, variable

modifications were oxidation of methionine.




                                          70
Western Blotting

Total protein lysate (5 µg), from fast- and slow-growing clone cultures, were

separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-

PAGE). A 12% separating gel was prepared by adding 6mL of 30% acrylamide/0.8%

bisacrylamide, 3.75mL of 1.5 M Tris-Cl , 0.4% SDS, 5.25mL of ddH20, 0.05mL of

10% ammonium persulfate and 0.01mL of TEMED. A 3.9% stacking gel was

prepared by adding 0.65 ml of 30% acrylamide/0.8% bisacrylamide, 1.25 ml 0.5 M

Tris-Cl, 0.4% SDS, 3.05 ml H2O, 25 µl of 10% ammonium persulfate and 5 µl

TEMED. The electrophoresis was run in an SDS electrophoresis buffer (0.025M Tris

base, 0.192M glycine, 0.1% SDS and the pH adjusted to 8.3) at 15mA until the dye

front reached the bottom of the separating gel. The separated proteins were

transferred to a nitrocellulose membrane at 100 V for 60 minutes in CAPS transfer

buffer (2.21 g of CAPS, cyclohexylaminopropane sulfonic acid was dissolved in

800mL of ddH20. 150mL of methanol was added and the pH adjusted to 11, ddH20

was then added to make 1L). Following the membrane transfer the blots were

blocked with Tris-buffered saline containing 0.1% Tween20 and 5% non-fat milk,

followed by incubation with primary antibodies against calmodulin (Millipore, NSW,

Australia), heat shock protein 27kDa (Bio Scientific Pty, NSW, Australia) and alpha

tubulin (Abcam, Sapphire Bioscience, NSW, Australia) at 1: 1000 dilution for 60

minutes at room temperature. Membranes were then washed thoroughly in tris

buffered saline containing tween TBS-T buffer (20mM Tris-Cl at pH 7.5, 500mM

NaCl and 0.05% Tween-20) 3 times for 10 minutes each time. After primary

antibody incubation the membranes were incubated with a goat anti-mouse or goat




                                         71
anti-rabbit IgG-horseradish peroxidase conjugated antibody (diluted in blocking

buffer) at 1:1000 dilution for 60 minutes and washed as before. ECL Plus™ Western

Blotting Detection Reagent (Amersham Biosciences, Castle Hill, Australia) was used

for detection according to the manufacturer’s instructions and visualized by exposure

to X-ray film (Fujifilm, Stafford, Australia) and development in an AGFA CP 1000

automatic film processor (AGFA-GEVAERT Limited, Burwood, Australia).



Immunocytochemistry

Clonal cultures were plated at a density of 3000 cells/well on an 8-well chamber

slide (In Vitro Technologies Pty Ltd, Victoria). The cells were allowed to attach

overnight at 37ºC in a CO2 incubator, and fixed in 4% paraformaldehyde in PBS for

15 minutes, followed by permeabilization with 0.5% triton X-100 in PBS for 10

minutes. Non-specific protein binding was blocked by incubation with 1:10 normal

swine serum for 30 minutes. The cells were immunostained against calmodulin, heat

shock protein 27 kDa and alpha tubulin by incubating with a 1:1000 primary

antibody dilution in PBS with 0.1% bovine serum albumin at 4ºC overnight. The

cells were then incubated with a biotinylated swine-anti-mouse or anti-rabbit or anti-

goat IgG antibody (DAKO Multilink, CA, USA) for 15 minutes, and then incubated

with horseradish peroxidise-conjugated avidin-biotin complex (ABC) for 15

minutes. Antibody complexes were visualized after the addition of a buffered

diaminobenzidene (DAB) substrate for 4 minutes. The reaction was stopped by

immersion and rinsing of the slide in PBS. Cells were then lightly counterstained

with Mayer’s haematoxylin and Scott’s Blue for 40 seconds each, in between 3

minute rinses with running tap water. Following this the cells were dehydrated with

ascending concentrations of ethanol solutions, cleared with xylene and mounted with



                                          72
a cover slip using DePex mounting medium (BDH Laboratory Supplies, England).

Control for the immunocytochemical cell staining procedures included conditions

where the primary antibody was omitted. The colour development was observed

under a light microscope and the image captured.




                                        73
74
                     CHAPTER 4




CLONAL ISOLATION AND CHARACTERIZATION OF
BONE MARROW STROMAL CELLS FROM PATIENTS
            WITH OSTEOARTHRITIS




     S. Mareddy, R. Crawford, G. Brooke and Y. Xiao




          Tissue Engineering (2006). 13, 819-829




                            75
This article is not available here.
Please consult the hardcopy thesis
available from QUT Library
                 CHAPTER 5



IDENTIFICATION OF GENES REGULATING CELL
GROWTH AND MULTIPOTENCY FROM CLONAL
POPULATIONS DERIVED FROM BONE MARROW




       S. Mareddy, R. Crawford and Y.Xiao




            Manuscript in preparation



                      117
Statement of Joint Authorship
In the case of this chapter:


Identification of genes regulating cell growth and multipotency from clonal
populations derived from bone marrow (Manuscript in preparation)


The authors listed below have certified* that:
    1. they meet the criteria for authorship in that they have participated in the conception,
       execution, or interpretation, of at least that part of the publication in their field of
       expertise;
    2. they take public responsibility for their part of the publication, except for the
       responsible author who accepts overall responsibility for the publication;
    3. there are no other authors of the publication according to these criteria;
    4. potential conflicts of interest have been disclosed to (a) granting bodies, (b) the
       editor or publisher of journals or other publications, and (c) the head of the
       responsible academic unit, and
    5. they agree to the use of the publication in the student’s thesis and its publication on
       the Australasian Digital Thesis database consistent with any limitations set by
       publisher requirements. ___________

   _______________________________________________
Contributor        Statement of contribution*

Shobha Mareddy         Involved in the conception and design of the project, performed all
                       laboratory experiments, data analysis and interpretation.        Wrote the
Signature
                       manuscript.
Date
                       Involved in the conception and design of the project, assisted in the
Ross Crawford          collection of the sample and reviewed manuscript

                       Involved in the conception and design of the project, technical guidance,
Yin Xiao               manuscript preparation and review.




Principal Supervisor Confirmation
I have sighted email or other correspondence from all Co-authors confirming their certifying
authorship.
_______________________ ____________________ ______________________
Name                           Signature                 Date




                                             118
Abstract

Decline in the frequency of potent mesenchymal stem cells (MSCs) has been

implicated in ageing and degenerative diseases. Increasing the circulating stem cell

population can lead to renewed recruitment of these potent cells at sites of damage.

Therefore, identifying the ideal cells for ex vivo expansion will form a major pursuit

of clinical applications.


This study is a follow up of previous work which demonstrated the occurrence of

“fast-growing” multipotential cells from the bone marrow samples of OA. To

investigate the molecular processes involved in the existence of such varying

populations gene expression studies were performed between fast- (n=3) and slow-

growing (n=3) clonal populations derived from three OA patients, to identify

potential genetic markers associated with “stemness” using the Stem Cell RT²

Profiler™ PCR Array comprising a series of 84 genes related to stem cell pathways.


A group of ten genes were commonly over represented in the fast-growing stem cell

clones. These included genes that encode proteins involved in the maintenance of

embryonic and neural stem cell renewal (SOX2, NOTCH1 and DLL3), proteins

associated with chondrogenesis (ACAN and COL2A1), growth factors ( BMP2 and

IGF1); an endodermal organogenesis protein(FOXA2) and proteins associated with

cell-fate specification (FGF2 and CDC2). The expression of diverse differentiation

genes in MSC clones, suggest that these commonly expressed genes may confer the

maintenance of multipotentiality and self-renewal of MSCs.




                                         119
Introduction

Adult MSCs have generated immense research interest in cell based therapies owing

to their multipotentiality and capacity for self renewal. Bone marrow stromal tissue

has been regarded as the most likely source to obtain MSCs. One of the most

important aspects which favour use of MSCs for clinical applications is the

possibility of harvesting these cells from the patient and devising autologous

treatment strategies after sufficient expansion ex vivo. This approach obviates the

potential risks of immune rejection and contraction of infectious diseases typically

associated with allograft.


The occurrence of MSCs in mixtures of bone marrow mononuclear cells has been

suggested to be approximately 1:100,000 (1). It has further been reported that the

proliferation rates, colony-forming-unit-fibroblasts (CFU-F) efficiency and

multilineage differentiation potential of MSCs decrease with progressive age and

diseases (2, 3). Various investigators have also noted a gradual loss of proliferative

and differentiation potential of MSCs with successive passages ex vivo (4-8). Hence,

improving strategies for effectively expanding the number of cells necessary for

clinical applications represents a major challenge. Previous studies suggest that

human MSC cultures consist of morphologically and functionally heterogeneous

cells at various stages of commitment (9, 10). In an attempt to characterize MSC

with good proliferative and differentiation capacities we adopted the single-cell clone

culture model to identify stem cell clones in our previous study (11). Fast-growing

stem cell clones were tripotential, whereas slow-growing clones lost lineage

differentiation potential. In this study to further investigate the molecular pathways

governing MSC self-renewal and lineage differentiation potential in the stem cell



                                          120
clones, we employed a stem cell RT² Profiler™ PCR Array to screen and quantify

the expression of a set of 84 genes related to stem cell pathways. We identified a

group of genes that encode proteins involved in self-renewal, growth and cell-fate

that play a significant role in maintaining MSC stemness which may potentially lead

to the identification and subsequent purification of these stem cells.




Materials and Methods


Patient Samples
Stem cell pathway-focused gene expression profiling studies were conducted on the

fast- (n=3) and slow-growing (n=3) clones derived from bone marrow samples

obtained from 3 patients with OA (designated patients A, B and C). Clone cultures

were established by limiting dilution method as described in our previous study (11).



Differentiation of clonal cultures in vitro
The ability of the fast- and slow-growing clonal cell populations to differentiate into

osteogenic, chondrogenic and adipogenic lineages was assessed by stimulating the

cells with selective differentiating media and performing RT-PCR analysis.


Osteogenic differentiation

Osteogenic differentiation of confluent monolayers was induced with complete

medium (DMEM-LG + FBS + 10 U/ml penicillin G and 10µg/ml streptomycin)

supplemented with 50 µM ascorbic acid, 10 mM -glycerol phosphate and 100 nM

dexamethasone (All from Sigma-Aldrich, Australia). The medium was replenished

twice weekly over a period of 21 days.




                                          121
Chondrogenic differentiation

Chondrogenic differentiation was induced by growing the cells, over a period of 21

days, in serum free medium consisting of high glucose DMEM +10 U/ml penicillin

G and 10µg/ml streptomycin supplemented with 10 ng/ml TGF- ³, 100 nM

dexamethasone, 50 µg/ml ascorbic acid 2-phosphate, 100 µg/ml sodium pyruvate, 40

µg/ml proline and a commercial preparation of ITS-plus (final concentration: 6.25

µg/ml insulin, 6.25 µg/ml transferrin, 6.25 µg/ml selenious acid, 5.33 µg/ml linoleic

acid and 1.25 mg/ml bovine serum albumin) (All from Sigma-Aldrich).


Adipogenic differentiation

Adipogenic differentiation was induced by growing the cells in complete medium

supplemented with 0.5 mM isobutyl methyl xanthine, 100-200 µM indomethacin,

1µM dexamethasone, and 10 µg/ml insulin (All from Sigma-Aldrich). After

completion of 3 cycles of adipogenic induction, the cells were kept in adipogenic

maintenance medium (10 µg/ml insulin in DMEM with 10% FBS) for a total of 21

days, changing the medium every three days.



Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) analysis

RT-PCR analysis was performed on the differentiated MSCs for the expression of

lineage markers towards the directed lineages. Total RNA from the differentiated

cells was extracted using Tri Reagent (Sigma) following the manufacturer’s protocol.

Total RNA (1 g) was used to synthesize template cDNA (complimentary DNA) and

RT-PCR performed to determine the expression of genes using primers (Table 1) for

the osteogenic (COL1; ALP; OCN), chondrogenic (ACAN) and adipogenic (AP2)

lineages. The house keeping gene, -2 microglobulin ( -2M) was used as a control.




                                         122
Table 1: List of primer pairs used for quantitative RT-PCR analysis


Gene               Abbr.   Forward Primer 5'-3'          Reverse Primer 5'-3'
Alkaline                   TCAGAAGCTCAACACCAACG          TTGTACGTCTTGGAGAGGGC
Phosphatase        ALP
type 1 collagen    COL1    CTTTGGAGCCAGCTGGA             GTGGGCTTCCTGGTGA
Osteocalcin
                   OCN     CACCGAGACACCATGAG             TGGAGAGGAGCAGAACTG
Aggrecan
                   ACAN    AGACTTGGTGGGGTCAG             GATGTTTCCCCACTAGTG
Adipocyte fatty
acid binding
protein            AP2     TCAGTGTGAATGGGGATG            AAACTCTCGTGGAAGTG
 2-Microglobulin    2M     CCCCCACTGAAAAAGATGAG          TCATCCAATCCAAATGCGGC




Karyotyping

Chromosome samples were prepared according to the method described previously

(12). Briefly, cells at passage seven from actively growing cultures were trypsinized

and pelleted. The cells were incubated with colcemid for 1.5 hours and lysed with

hypotonic KCl followed by fixation in acid/alcohol (3:1 of methanol/glacial acetic

acid). Karyotype was analysed by the cytogenetics department, Sullivan Nicolaides

Pathology, Brisbane.



RT²Profiler™ PCR Array

The stem cell properties of the fast-growing clones were compared to the slow-

growing clones by means of stem cell RT² Profiler™ PCR Array system (SuperArray

Bioscience Corporation, www.superarray.com). The RT² Profiler™ PCR Array takes

advantage of quantitative real-time PCR performance and combines it with the

multigene profiling capabilities of microarrays to detect the simultaneous

quantitative expression of many genes related to a biological pathway (13).




                                            123
Total RNA was extracted from cells at passage 6 of the fast- and slow-growing

clonal populations using Tri Reagent (Sigma) following the manufacturer’s protocol.

The RNA quality was determined by the integrity of the 18s and 28s ribosomal bands

on a non-denaturing 1.5% agarose Trisborate EDTA (TBE) buffered gel. Total RNA

(1 g) was used to synthesize template cDNA using the SuperArray RT² First Strand

Kit following manufacturer’s protocol. The template cDNA was mixed with 2X RT²

qPCR Master Mix and 25 l of the cocktail aliquoted into each well on the PCR

array plate containing pre-dispensed gene specific primer sets. Each array consisted

of a panel of 96 primer sets of 84 stem cell pathway genes, plus five housekeeping

genes and three RNA and PCR quality controls. Reactions were carried out using an

ABI Prism 7300 Sequence Detection System (Applied Biosystems, Australia). PCR

amplification followed a two-step cycling program: 10 minutes denaturizing at 95˚C,

40 cycles of 95˚C for 15 seconds and 60˚C for 1 minute.



Data Analysis

Analysis of the expression of the panel of genes was determined by the      Ct method

using excel-based PCR Array Data Analysis template from the SuperArray web site:

http://www.superarray.com/pcrarraydataanalysis.php. Relative expression of the

panel of genes was determined by using      Ct method, where       Ct = Ct of Test

– Ct of Control (14). Student’s t- test was used to test for difference in the absolute

expression levels between fast- and slow-growing clones and statistical significance

was accepted at p 0.05.




                                         124
Results

Gene expression profiling studies were conducted on the fast- (n=3) and slow-

growing (n=3) clones derived from bone marrow samples obtained from 3 patients

with OA (designated patients A, B and C). The clonal populations used in this study

were characterized in our previous study. The clones A7, B3 and C2 are fast-growing

and multipotential. The clones A2, B1 and C1 are slow-growing and have limited

differentiation potential.


Differentiation Potential

We have previously demonstrated that the majority of the fast-growing clones are

tripotential in nature, expressing markers for osteogenic (OPN), chondrogenic

(COL2) and adipogenic (PPARG) cell lineages (11). In this study we widened the

field of markers relevant to these three cell lineages by including collagen 1 (COL1),

alkaline phosphatase (ALP) and osteocalcin (OCN) for osteogenesis, aggrecan

(ACAN) for chondrogenesis and adipocyte fatty acid binding protein (AP2) for

adipogenesis.



As shown in (Figure 1) at passage 6 all the fast-growing clones expressed the full

range of osteogenic, chondrogenic and adipogenic differentiation markers

corresponding to the selective media in which they had been grown. Closer lineage

analysis of the slow-growing clones, revealed an absence of expression of all the

osteogenic and chondrogenic markers in the slow clone A2 from patient “A”, but

expression of the adipogenic marker AP2. Similarly, the slow clone B1 from patient

“B”, expressed AP2 and the early osteogenic marker, COL1. The slow clone C1

from patient “C”, expressed only OCN displaying a faint band, which is a late




                                         125
osteogenic marker, but did not express any chondrogenic and adipogenic lineages

markers (Figure 1). These results demonstrated evidence of a progressive loss of

multilineage potential associated with decreased proliferative rates among the slow-

growing clones.




                                        126
Figure 1: Reverse transcriptase polymerase chain reaction (RT-PCR) analysis for the
expression of lineage markers of osteogenesis (COL1, ALP, and OCN),
chondrogenesis (ACAN) and adipogenesis (AP2). Total ribonucleic acid was
extracted from the fast and the slow-growing clone cultures that were subjected to
lineage-induction for a period of three weeks at passage 6. The differentiation marker
gene expression was detected by performing RT-PCR. All the fast-growing clones
selected for this study expressed all the osteogenic, chondrogenic and adipogenic
markers. Among the slow-growing clones, A2 from patient “A” displayed negative
expression for all the osteo and chondrogenic lineage markers, but expressed AP2,
which is a marker for adipogenesis. Similarly B1, another slow-growing clone from
patient “B” expressed adipogenic marker AP2 and an early osteogenic marker,
COL1. Likewise, C1 a slow clone from patient “C” expressed only OCN,
characteristic of osteogenic lineage, but did not express the markers of chondrogenic
and adipogenic lineages. The house keeping gene, -2 microglobulin ( -2M) was
used as control.




                                         127
Stem cell pathway-focused quantitative gene expression profiling

Quantitative gene expression profiling was carried out with RT² Profiler™ PCR

Arrays to assess the stemness of clonal populations of interest, in relation to their in

vitro expansion and differentiation potential. The Applied Biosystems analytical

software was employed to quantitate the expression of 84 genes representing the

stem cell pathways. Relative expression of the panel of genes was determined by

using    Ct method, where       Ct = Ct of Test – Ct of Control. We identified

24 genes that were differentially expressed between the fast and slow-growing clones

with a minimal fold change of 1.5. Of these, 17 transcripts were up-regulated in the

fast-growing clones (Table 2) and 7 were up-regulated in the slow-growing clones

(Table 3). Of the 17 transcripts up-regulated in the fast-growing clones, 10 genes

consistently differed by a minimum fold change of 2 (p      0.05 on a t- test). This pool

of ten genes was associated with maintenance of self-renewal of a wide range of cell

types including MSCs, as well as lineage determining factors. These included genes

encoding proteins involved in the maintenance of embryonic and neural stem cell

renewal such as SOX2 and NOTCH1 and its ligand DLL3, expression markers

associated with chondrogenesis such as ACAN and COL2A1 and growth factors

such as BMP2 and IGF1. Other up-regulated genes included FOXA2, CDC2 and

FGF2, respectively associated with endodermal organogenesis and cell-fate

specification (Figure 2). On the other hand, seven genes of interest with a minimal

fold-difference of 1.5 that were up-regulated in each group of the fast- and slow-

growing clones are presented here (Figure 3 and 4).




                                           128
                     Genes Up-regulated in the fast-growing clones
                                                                              Fold
Symbol     Description                       Functional gene grouping        change   P-values
                                             mesenchymal cell lineage

ACAN       Aggrecan                          marker                           7.14     0.0086

                                             mesenchymal cell lineage

ALP1       Alkaline phosphatase              marker                           2.03      0.42

BMP2       Bone morphogenetic protein 2      cytokines and growth factors     4.92     0.0085

CDC2       Cell division cycle 2             cell cycle regulator             2.07     0.0244

CDH1       Cadherin 1, type 1, E-cadherin    cell adhesion molecule           2.39     0.2168

COL1A1     Collagen, type I, alpha 1         mesenchymal lineage marker       2.53     0.253

COL2A1     Collagen, type II, alpha 1        mesenchymal lineage marker       5.11     0.0473

DLL3       Delta-like 3                      stem cell maintenance            4.1      0.0163

DVL1       Dishevelled, dsh homolog 1        stem cell maintenance            2.59     0.4791

           Fibroblast growth factor 2

FGF2       (basic)                           cytokines and growth factors     4.64     0.0247

FOXA2      Forkhead box 2                    embryonic cell lineage marker    4.25     0.0471

GDF2       Growth differentiation factor 2   cytokines and growth factor      5.88     0.2603

IGF1       Insulin-like growth factor 1      cytokines and growth factor      2.97     0.0008

JAG1       Jagged 1                          cytokines and growth factor      2.23     0.052

NEUROG2    Neurogenin 2                      self-renewal marker              2.3      0.2616

NOTCH1     Notch homolog 1                   stem cell maintenance            2.93     0.0007

SOX2       SRY (sex determining region       self-renewal marker              3.14     0.0372
           Y)-box 2




Table2: Genes identified to be up regulated in fast-growing clones. Fold change was
calculated as ratio of fast-growing clones’ expression relative to slow-growing
clones.




                                             129
                         Genes Up-regulated in the slow-growing clones
                                                                     Fold
Gene             Description          Functional gene grouping      change    P-values
           Aldehyde dehydrogenase
ALDH1A1                               metabolic marker               3.48      0.3729
           1 family, member A1
CCND2      Cyclin D2                  cell cycle regulator           2.95      0.0663

CD44       CD 44 molecule             cell adhesion molecule         1.59      0.1281

DTX1       Deltex homolog 1           stem cell maintenance          2.4       0.295

           Fibroblast growth factor

FGF1       1(acidic)                  cytokines and growth factor    2.4       0.1286

           Heat shock 70kDa protein

HSPA9      9                          self-renewal marker             29       0.3189

                                      embryonic cell lineage

MSX1       Msh homeobox 1             marker                         4.77      0.1602

TUBB3      Tubulin, beta 3            neural cell lineage marker     2.01      0.5518




Table 3: Genes identified to be up regulated in slow-growing clones. Fold change
was calculated as ratio of slow-growing clones’ expression relative to fast-growing
clones.




                                        130
Figure 2: A common pool of ten transcripts that were significantly up-regulated in
all the fast-growing clones (n=3) with a minimal change of 2-fold when compared to
slow-growing clones (n=3). Student’s t- test was used to test for difference in the
absolute expression levels between fast- and slow-growing clones and statistical
significance was accepted at p 0.05. The genes include fibroblast growth factor 2
(FGF2) and cell division cycle 2 (CDC2) which are cell cycle regulators; growth
factors, bone morphogenetic protein 2 (BMP2) and insulin like growth factor 1
(IGF1); notch homolog 1 (NOTCH 1) and its ligand delta-like 3(DLL3);
mesenchymal lineage markers, aggrecan (ACAN) and collagen 2 (COL2A1);
embryonic lineage markers, forkhead box (FOXA2) and and sex determining region
Y (SOX2). Error bars reflect the mean (±SEM) across 3 fast- versus 3 slow-growing
clones.




                                         131
                                11.00
                                10.00
                                 9.00
          absolute expression




                                 8.00
                                 7.00
                                 6.00                                                          Fast
                                 5.00                                                          Slow
                                 4.00
                                 3.00
                                 2.00
                                 1.00
                                 0.00




                                                                                           2
                                                                         F2
                                                   1




                                                                                G1
                                                          H1
                                          P1




                                                               L1




                                                                                        OG
                                                    A




                                                                      GD
                                                               DV
                                                        CD
                                        AL


                                                 L1




                                                                              JA


                                                                                     UR
                                               CO




                                                                                     NE



Figure 3: Up-regulated transcripts identified in the fast-growing clones following
quantitative gene expression profiling of stem cell pathway genes. They include
ALP1 and COL1A1 which are markers for mesenchymal lineage; CDH1 (cadherin,
type1) a cell adhesion molecule, DVL1 (dsh homolog 1) a member of NOTCH
pathway, GDF2 (growth differentiation factor 2) and JAG 1 (jagged 1) which are
cytokines and NEUROG 2 (neurogenin 2) which is a self-renewal marker. Error bars
reflect the mean (±SEM) across 3 fast- versus 3 slow-growing clones.


.




                                                                132
                             12.00

                             10.00



       absolute expression
                              8.00
                                                                                    Fast
                              6.00
                                                                                    Slow
                              4.00

                              2.00

                              0.00

                                              2
                                     1




                                                                  A9




                                                                               B3
                                                    1


                                                           F1




                                                                         1
                                          ND
                                   A




                                                                       SX
                                                     X

                                                         FG
                                 H1




                                                  DT




                                                                   P




                                                                               B
                                         CC




                                                                       M
                                                                HS




                                                                             TU
                                 D
                              AL




Figure 4: Stem cell array profiling employing quantitative RT-PCR revealed 7 genes
that were down-regulated in the fast-growing clones with a minimal fold-difference
of 1.5 when compared to slow-growing clones. They include metabolic marker,
ALDH1A1 (aldehyde dehydrogenase 1 family, A1); cell cycle regulator, CCND2
(cyclin D2); DTX1 (deltex homolog 1); FGF 1 (fibroblast growth factor 1), HSPA9
(heat shock 70 kDa protein 9), MSX 1 (msh homeobox 1) and TUBB3 (tubulin, beta
3). Error bars reflect the mean (±SEM) across 3 fast versus 3 slow-growing clones
from 3 patient samples.




                                                           133
Karyotyping

Given that the gene expression studies were performed at a relatively late passage

number 6, cytogenetic stability of the in vitro expanded fast- and slow-growing

clonal populations used in this study (n=3) was assessed. Cytogenetic test returned

normal diploid karyotype showing no cytogenetic abnormalities (Figure 5)

suggesting the gene expression results were a reflection of normal cellular processes.




                                         134
Figure 5: Karyotype of fast- and slow-growing clones was performed at passage 6
and 7 to assess the cytogenetic stability of the in vitro expanded clonal populations.
A, C & E is the karyotype results of the fast-growing clones from 3 patient samples.
B, D & F is the karyotype results of the slow-growing clones from 3 patient samples.
Cytogenetic testing returned normal diploid karyotype with no cytogenetic
abnormalities.




                                          135
Discussion


Changing perception about the pluripotency of MSCs, in the light of recent findings,

indicate these cells are capable of differentiating into tissues of other germ layers , a

fact that further broadens their potential application (15, 16). A number of

comparative cellular and molecular studies have recently been conducted in an

attempt to identify the tissue source and cell types best suited for therapeutic

applications (17-21). Emerging information on molecular signatures conducted on

various stem cell populations, have reported the involvement of a diverse range of

signalling mechanisms regulating stem cell renewal and maintenance of their

differentiation potential (21-27).


In our previous work we have identified the existence of different subpopulations of

cells, grouping them into fast- and slow-growing clones, based on their proliferative

and differentiation potential (11). We hypothesized that specific molecular

mechanisms must underlie the stemness of the clones exhibiting superior ex vivo

expansion potential. In the current work we have undertaken to identify stem cell

associated gene expression signatures that could potentially qualify the stemness of

these clones. A stem cell gene expression profiling tool was employed to investigate

the molecular basis responsible for the ability of the fast-growing clones to retain

their replicative and developmental potential. This study revealed a pool of ten genes

which were significantly up-regulated in all the fast-growing clones as opposed to

the genes expressed in slow-growing clones, with a p value 0.05. These genes

were found to be associated with the maintenance of self-renewal and lineage

markers of a wide array of cell types (embryonic, neural and endodermal), in


                                           136
addition to those specific for MSCs. They include genes encoding proteins involved

in the maintenance of embryonic stem cell renewal and endodermal organogenesis

such as Sox2 and Fox A2 (26, 28, 29), expression markers associated with

chondrogenesis such as ACAN and COL2A1 and growth factors such as BMP2 and

IGF1, which are involved in both cell proliferation, as well as induction of

differentiation in a context dependent manner (30, 31). Other genes that were

expressed include NOTCH1 and DLL3, which are involved in stem cell maintenance

in diverse niches (32, 33) and cell cycle regulators, FGF2 and CDC2 (34, 35).


Previous studies suggest that a coordinated activity of a number of pathways are

required to maintain stemness since it involves maintenance of both proliferation and

a multipotential state (26, 36). This study demonstrates quantitative differential gene

expression of 84 genes related to stem cell pathway in an attempt to identify the

molecular signature responsible for the status of the fast-growing clones.


Among the significantly up-regulated genes in the fast-growing clones were

transcripts that regulate the process of cell cycle which include fibroblast growth

factor 2 (FGF2) (37) and cell division cycle 2 (CDC2) (35). Members of the

fibroblast growth factor (FGF) family are known to play a major role during skeletal

development, postnatal osteogenesis and tissue repair (38). FGF2, among other

                                                         stemness'
growth factors and cytokines, has been implicated in MSC '        maintenance by

prolonging their non-committed, immature state during expansion in vitro (34, 39,

40). Previous studies also suggest supplementation with FGF-2 selects a subset of

cells with longer telomeres from BMSC primary cultures (41). Further, FGF2

suppressed cellular senescence in hMSCs by down regulating the expression of TGF-

 2 (40). The transcription of the cell cycle regulating gene CDC2 has been shown to



                                          137
be restricted to proliferating cells (42). This gene influences some of the mechanisms

underlying cell cycle control by bringing about an orderly progression through the S-

phase and mitosis resulting in cell proliferation (35). Similarly, the expression of

FGF-2, in the resting and proliferating zones of the epiphyseal growth plate in

cartilage, appears to regulate chondrogenesis by promoting the proliferation of

chondroblast and inhibiting differentiation (43). Thus the greater proliferative

capacities of the fast-growing clones when compared to slow-growing clones may be

attributed to the significant up-regulation of these two genes.


Other transcripts of interest that were significantly expressed include embryonic

lineage markers such as SOX2 and FOXA2. SOX2 belongs to the Sox family of

high-mobility-group (HMG) transcription factors and is recognised as a self-renewal

marker. It is normally expressed in embryonic stem cells and embryonic neural stem

cells and is associated with the maintenance of the undifferentiated state of neural

progenitors (26). Ectopic expression of SOX2 inhibits neuronal differentiation and

osteoblast differentiation (45, 46). SOX2 can interfere with the transcriptional

activity of -catenin/lymphoid enhancer factor which is a classical effector of Wnt

signalling and inhibits osteoblast differentiation (46). Correspondingly, FOXA2

(forkhead box a2) is a marker associated with endodermal lineage (28). Recent

studies have revealed that FOXA2 serves as a master gene that controls key factors

involved in the development of lungs in the foetus (29). Also other studies have

shown that transcription of this gene is required to generate dopamine neurons during

foetal development and from embryonic stem cells (47).


Additionally, two growth factors found to be significantly up-regulated include

BMP2 and IGF1. Both are involved in regulation of cell proliferation, differentiation



                                          138
and apoptosis and play essential roles during embryonic development and skeletal

pattern formation (31). IGF1 is known to promote both transformation of

mesenchyme into chondroblasts and their proliferation (48, 49). It is also known to

regulate central nervous system development and promote growth differentiation and

survival of glial cells (50-52). Likewise, BMP2 belongs to the major group of bone

morphogenetic factors that mediate a number of mesodermal developmental

processes as well as regulation of postnatal development of mesenchymal skeletal

tissues and skeletal repair (53). BMP2 treatment of osteogenic cultures increases

bone nodule formation and calcium deposition, and a combination of BMP2 and

FGF2 increases MSC osteogenesis both in vivo and in vitro (54, 55). BMP2

expression is found in the developing heart, tooth buds and craniofacial mesenchyme

supporting the view that the protein plays a pivotal role in the development and

growth of many tissue types during embryogenesis and organogenesis (46, 56). The

many roles of BMP2 in a variety of tissue types, coupled with our own observation

that it is up-regulated in fast-growing clones, highlights BMP2’s plasticity in a

context dependant manner.


Another set of genes associated with stem cell maintenance, NOTCH1 (notch

homolog 1) and DLL3 (delta-like 3), that were up-regulated in the fast-growing

clones, are known to play an important role in the regulation of stem cell renewal in

diverse stem cell niches (26, 57, 58). Constitutive expression of active NOTCH1 in

haematopoietic progenitors and stem cells allows the establishment of immortalized

cells (32) and it has been demonstrated that Notch signalling is used by

haematopoietic stem cells (HSCs) in their native microenvironment and is down-

regulated as HSCs differentiate. (32). The Notch pathway is also known to be active

during the early stages of chondrogenesis in murine and chick limb development (59,


                                          139
60). Immunolocalization studies have revealed the occurrence of NOTCH1 in the

zone of articular cartilage which comprises a pool of chondroprogenitor cells that are

able to differentiate into connective tissue cell lineages (60, 61). Similarly, DLL3 is

a member of the Notch pathway (33) and has been linked to skeletal development

and neurogenesis. A mutation in the human DLL3 is associated with axial skeletal

and developmental defects (62). Other up-regulated genes in our study include

ACAN (aggrecan) and COL2A1 (collagen2 A1), which are the markers of

chondrogenic lineage. Interestingly, Hermanson and colleagues observed an increase

in type II collagen synthesis in articular cartilage compared to the normal cartilage

(63).


The expression of a variety of cell type-specific genes in the fast-growing clones

suggest that regulation of stem cell maintenance requires a coordinated action of

multiple signalling pathways to maintain a balance between the ability to proliferate

and the capacity to differentiate. Moreover, the plasticity of the fast-growing clone is

reflected by the gene expression pattern, evident by the expression of genes typical

of other trans-germ layer cell types which supports recent findings that MSCs have a

greater developmental potential (15, 16).

Conclusion

This study assessed the stemness of fast-growing clones by quantifying the

expression of stem cell-pathway related genes. Interestingly, the broad transcriptional

inventory exhibited by the fast-growing clones is well complimented by the

transcriptional profile required for self-renewal, a typical stemness feature (16, 26,

64). Further, the analysis of two sub-populations of cells derived from single-cell

clonal cultures from the same cell-pool source, highlights the genes of interest

specifically involved in cell proliferation and differentiation pathways. Future studies


                                            140
on the molecular pathways of these up-regulated genes in the fast-growing clones,

may lead to the identification of markers which can be used in the isolation of cells

of interest. Additionally, this knowledge may find its application in the separation of

desired sub-population of cells across a range of tissue sources.




                                          141
References


1.    Ohgushi, H. and A.I. Caplan, 1999 Stem cell technology and bioceramics:
      from cell to gene engineering. J Biomed Mater Res, 48(6): p. 913-27.

2.    Banfi, A., et al., 2000 Proliferation kinetics and differentiation potential of ex
      vivo expanded human bone marrow stromal cells: Implications for their use
      in cell therapy. Exp Hematol, 28(6): p. 707-15.

3.    Tokalov, S.V., et al., 2007 Age-related changes in the frequency of
      mesenchymal stem cells in the bone marrow of rats. Stem Cells Dev, 16(3):
      p. 439-46.

4.    Bruder, S.P., N. Jaiswal, and S.E. Haynesworth, 1997 Growth kinetics, self-
      renewal, and the osteogenic potential of purified human mesenchymal stem
      cells during extensive subcultivation and following cryopreservation. J Cell
      Biochem, 64(2): p. 278-94.

5.    Digirolamo, C.M., et al., 1999 Propagation and senescence of human marrow
      stromal cells in culture: a simple colony-forming assay identifies samples
      with the greatest potential to propagate and differentiate. Br J Haematol,
      107(2): p. 275-81.

6.    D' Ippolito, G., et al., 1999 Age-related osteogenic potential of mesenchymal
      stromal stem cells from human vertebral bone marrow. J Bone Miner Res,
      14(7): p. 1115-22.

7.    Oreffo, R.O., S. Bord, and J.T. Triffitt, 1998 Skeletal progenitor cells and
      ageing human populations. Clin Sci (Lond), 94(5): p. 549-55.

8.    Quarto, R., D. Thomas, and C.T. Liang, 1995 Bone progenitor cell deficits
      and the age-associated decline in bone repair capacity. Calcif Tissue Int,
      56(2): p. 123-9.

9.    Phinney, D.G., et al., 1999 Donor variation in the growth properties and
      osteogenic potential of human marrow stromal cells. J Cell Biochem, 75(3):
      p. 424-36.

10.   Kuznetsov, S.A., et al., 1997 Single-colony derived strains of human marrow
      stromal fibroblasts form bone after transplantation in vivo. J Bone Miner Res,
      12(9): p. 1335-47.

11.   Mareddy, S., et al., 2007 Clonal isolation and characterization of bone
      marrow stromal cells from patients with osteoarthritis. Tissue Eng, 13(4): p.
      819-29.




                                         142
12.   Verfaillie, C.M., et al., 1992 Selection of benign primitive hematopoietic
      progenitors in chronic myelogenous leukemia on the basis of HLA-DR
      antigen expression. Blood, 79(4): p. 1003-10.

13.   Arikawa, E., et al., 2007 P53-M Real-Time PCR Array for Multi-Gene
      Expression Profiling and Microarray Data Validation: RT²Profiler PCR
      Array. Journal of Biomolecular Techniques, 18: p. 18-19.

14.   Yuan, J.S., et al., 2006 Statistical analysis of real-time PCR data. BMC
      Bioinformatics, 7: p. 85.

15.   Jiang, Y., et al., 2002 Pluripotency of mesenchymal stem cells derived from
      adult marrow. Nature, 418(6893): p. 41-9.

16.   Serafini, M. and C.M. Verfaillie, 2006 Pluripotency in adult stem cells: state
      of the art. Semin Reprod Med, 24(5): p. 379-88.

17.   Jeong, J.A., et al., 2005 Differential gene expression profiling of human
      umbilical cord blood-derived mesenchymal stem cells by DNA microarray.
      Stem Cells, 23(4): p. 584-93.

18.   Salasznyk, R.M., et al., 2005 Comparing the protein expression profiles of
      human mesenchymal stem cells and human osteoblasts using gene ontologies.
      Stem Cells Dev, 14(4): p. 354-66.

19.   Wagner, W., et al., 2005 Comparative characteristics of mesenchymal stem
      cells from human bone marrow, adipose tissue, and umbilical cord blood.
      Exp Hematol, 33(11): p. 1402-16.

20.   Ulloa-Montoya, F., et al., 2007 Comparative transcriptome analysis of
      embryonic and adult stem cells with extended and limited differentiation
      capacity. Genome Biol, 8(8): p. R163.

21.   Liu, T.M., et al., 2007 Identification of common pathways mediating
      differentiation of bone marrow- and adipose tissue-derived human
      mesenchymal stem cells into three mesenchymal lineages. Stem Cells, 25(3):
      p. 750-60.

22.   Wieczorek, G., et al., 2003 Gene expression profile of mouse bone marrow
      stromal cells determined by cDNA microarray analysis. Cell Tissue Res,
      311(2): p. 227-37.

23.   de Jong, D.S., et al., 2004 Identification of novel regulators associated with
      early-phase osteoblast differentiation. J Bone Miner Res, 19(6): p. 947-58.

24.   Duan, R.P., et al., 2006 [The gene expression patterns of bone-marrow
      mesenchymal stem cells under different osteogenic induction]. Sichuan Da
      Xue Xue Bao Yi Xue Ban, 37(6): p. 856-9.




                                        143
25.   Kulterer, B., et al., 2007 Gene expression profiling of human mesenchymal
      stem cells derived from bone marrow during expansion and osteoblast
      differentiation. BMC Genomics, 8: p. 70.

26.   Molofsky, A.V., R. Pardal, and S.J. Morrison, 2004 Diverse mechanisms
      regulate stem cell self-renewal. Current Opinion in Cell Biology, 16(6): p.
      700-707.

27.   Song, L., et al., 2006 Identification and functional analysis of candidate genes
      regulating mesenchymal stem cell self-renewal and multipotency. Stem Cells,
      24(7): p. 1707-18.

28.   Wan, H., et al., 2004 Foxa2 is required for transition to air breathing at birth.
      Proc Natl Acad Sci U S A, 101(40): p. 14449-14454.

29.   Whitsett, J.A. and Y. Matsuzaki, 2006 Transcriptional regulation of perinatal
      lung maturation. Pediatr Clin North Am, 53(5): p. 873-87, viii.

30.   Gerstenfeld, L.C., et al., Osteogenic growth factors and cytokines and their
      role in bone repair.

31.   Sandell, L.J. and P. Adler, 1999 Developmental patterns of cartilage. Front
      Biosci, 4: p. D731-42.

32.   Duncan, A.W., et al., 2005 Integration of Notch and Wnt signaling in
      hematopoietic stem cell maintenance. Nat Immunol, 6(3): p. 314-22.

33.   Conboy, I.M., et al., 2005 Rejuvenation of aged progenitor cells by exposure
      to a young systemic environment. Nature, 433(7027): p. 760-4.

34.   Martin, I., et al., 1997 Fibroblast growth factor-2 supports ex vivo expansion
      and maintenance of osteogenic precursors from human bone marrow.
      Endocrinology, 138(10): p. 4456-62.

35.   Nurse, P., 1993 The Wellcome Lecture, 1992. Cell cycle control. Philos
      Trans R Soc Lond B Biol Sci, 341(1298): p. 449-54.

36.   Tremain, N., et al., 2001 MicroSAGE analysis of 2,353 expressed genes in a
      single cell-derived colony of undifferentiated human mesenchymal stem cells
      reveals mRNAs of multiple cell lineages. Stem Cells, 19(5): p. 408-18.

37.   Zaragosi, L.E., G. Ailhaud, and C. Dani, 2006 Autocrine fibroblast growth
      factor 2 signaling is critical for self-renewal of human multipotent adipose-
      derived stem cells. Stem Cells, 24(11): p. 2412-9.

38.   Gerstenfeld, L.C., et al., 2007 Osteogenic Growth Factors and Cytokines and
      Their Role in Bone Repair. Engineering of Functional Skeletal Tissues, 3: p.
      17-45.




                                         144
39.   Mastrogiacomo, M., R. Cancedda, and R. Quarto, 2001 Effect of different
      growth factors on the chondrogenic potential of human bone marrow stromal
      cells. Osteoarthritis Cartilage, 9 Suppl A: p. S36-40.

40.   Ito, T., et al., 2007 FGF-2 suppresses cellular senescence of human
      mesenchymal stem cells by down-regulation of TGF-beta2. Biochem Biophys
      Res Commun, 359(1): p. 108-14.

41.   Bianchi, G., et al., 2003 Ex vivo enrichment of mesenchymal cell progenitors
      by fibroblast growth factor 2. Exp Cell Res, 287(1): p. 98-105.

42.   Dalton, S., 1992 Cell cycle regulation of the human cdc2 gene. Embo J,
      11(5): p. 1797-804.

43.   Kato, Y. and M. Iwamoto, 1990 Fibroblast growth factor is an inhibitor of
      chondrocyte terminal differentiation. J Biol Chem, 265(10): p. 5903-9.

44.   Molteni, A., et al., 1999 Differential expression of fibroblast growth factor
      receptor-1, -2, and -3 and syndecan-1, -2, and -4 in neonatal rat mandibular
      condyle and calvaria during osteogenic differentiation in vitro. Bone, 24(4):
      p. 337-47.

45.   Graham, V., et al., 2003 SOX2 functions to maintain neural progenitor
      identity. Neuron, 39(5): p. 749-65.

46.   Mansukhani, A., et al., 2005 Sox2 induction by FGF and FGFR2 activating
      mutations inhibits Wnt signaling and osteoblast differentiation. J Cell Biol,
      168(7): p. 1065-76.

47.   Kittappa, R., et al., 2007 The foxa2 gene controls the birth and spontaneous
      degeneration of dopamine neurons in old age. PLoS Biol, 5(12): p. e325.

48.   Quarto, R., et al., 1997 Modulation of commitment, proliferation, and
      differentiation of chondrogenic cells in defined culture medium.
      Endocrinology, 138(11): p. 4966-76.

49.   Hill, D.J., 1979 Stimulation of cartilage zones of the calf costochondral
      growth plate in vitro by growth hormone dependent rat plasma somatomedin
      activity. J Endocrinol, 83(2): p. 219-27.

50.   Bondy, C.A. and C.M. Cheng, 2004 Signaling by insulin-like growth factor 1
      in brain. Eur J Pharmacol, 490(1-3): p. 25-31.

51.   Shetty, A.K., B. Hattiangady, and G.A. Shetty, 2005 Stem/progenitor cell
      proliferation factors FGF-2, IGF-1, and VEGF exhibit early decline during
      the course of aging in the hippocampus: role of astrocytes. Glia, 51(3): p.
      173-86.




                                        145
52.   Sonntag, W.E., M. Ramsey, and C.S. Carter, 2005 Growth hormone and
      insulin-like growth factor-1 (IGF-1) and their influence on cognitive aging.
      Ageing Res Rev, 4(2): p. 195-212.

53.   Rosen, V. and R.S. Thies, 1992 The BMP proteins in bone formation and
      repair. Trends Genet, 8(3): p. 97-102.

54.   Hanada, K., J.E. Dennis, and A.I. Caplan, 1997 Stimulatory effects of basic
      fibroblast growth factor and bone morphogenetic protein-2 on osteogenic
      differentiation of rat bone marrow-derived mesenchymal stem cells. J Bone
      Miner Res, 12(10): p. 1606-14.

55.   Tuan, R.S., G. Boland, and R. Tuli, 2003 Adult mesenchymal stem cells and
      cell-based tissue engineering. Arthritis Res Ther, 5(1): p. 32-45.

56.   Kanzler, B., et al., 2000 BMP signaling is essential for development of
      skeletogenic and neurogenic cranial neural crest. Development, 127: p. 1095-
      1104.

57.   Calvi, L.M., et al., 2003 Osteoblastic cells regulate the haematopoietic stem
      cell niche. Nature, 425(6960): p. 841-6.

58.   Hansen, D., et al., 2004 Control of the proliferation versus meiotic
      development decision in the C. elegans germline through regulation of GLD-
      1 protein accumulation. Development, 131(1): p. 93-104.

59.   Crowe, R., J. Zikherman, and L. Niswander, 1999 Delta-1 negatively
      regulates the transition from prehypertrophic to hypertrophic chondrocytes
      during cartilage formation. Development, 126(5): p. 987-98.

60.   Hardingham, T.E., R.A. Oldershaw, and S.R. Tew, 2006 Cartilage, SOX9 and
      Notch signals in chondrogenesis. J Anat, 209(4): p. 469-80.

61.   Dowthwaite, G.P., et al., 2004 The surface of articular cartilage contains a
      progenitor cell population. J Cell Sci, 117(Pt 6): p. 889-97.

62.   Bulman, M.P., et al., 2000 Mutations in the human delta homologue, DLL3,
      cause axial skeletal defects in spondylocostal dysostosis. Nat Genet, 24(4): p.
      438-41.


63.   Hermansson, M., et al., 2004 Proteomic analysis of articular cartilage shows
      increased type II collagen synthesis in osteoarthritis and expression of inhibin
      betaA (activin A), a regulatory molecule for chondrocytes. J Biol Chem,
      279(42): p. 43514-21.

64.   Pittenger, M.F., et al., 1999 Multilineage potential of adult human
      mesenchymal stem cells. Science, 284(5411): p. 143-7.




                                        146
147
                       CHAPTER 6



 PROTEOMIC PROFILING OF DISTINCT CLONAL
POPULATIONS OF BONE MARROW MESENCHYMAL
                      STEM CELLS




    S. Mareddy, J. Broadbent, R. Crawford and Y. Xiao




        (Under submission to Stem Cells and Development)




                              149
This article is not available here.
Please consult the hardcopy thesis
available from QUT Library
                                       Chapter 7

Summary


         The bone marrow is considered a potential source of multipotential MSCs with

an ability of self-renewal. MSCs are known for their pluripotential nature, capable of

giving rise to cells of various mesenchymal lineages including fibroblasts, osteoblasts,

chondroblasts and adipoblasts. However, they exist as heterogeneous cell mixtures in the

bone marrow stroma at various stages of commitment (1, 2). Ex vivo expansion of these

cells has met with limited levels of success as the cells tend to loose their stem cell

properties in vitro, typically after 10 to 20 PDs. The majority of research to date has

primarily focused on the prospect of isolating and characterizing MSC populations that

exhibit ex-vivo self-renewal over an extended period of time, while, at the same time,

retaining their native developmental potential. Many such studies have resulted in the

development of novel approaches to isolate purified populations of MSCs and

consequently new terms to describe the identified populations. Colter et al identified a

sub-population of cells that has faster doubling time and greater differentiation potential

and termed them as self-renewing (RS) cells (3). Similarly, Gronthos and Simmons

separated a cell population from the initial cultures of primary bone marrow tissue, using

the antibody STRO-1 in combination with VCAM-1, and named these cells bone

marrow stromal stem cells (BMSSCs) (4, 5). Schwartz et al reported the occurrence of

primitive progenitor cells which they termed multipotential adult progenitor cells

(MAPCs), that co-purified with mesenchymal stem cells and were able to differentiate

into endothelial and neuroectodermal lineages (6).


                                            203
         The present project attempts to determine the existence of such potential cells

in patients with osteoarthritis. In this study single-cell clone cultures were established by

limiting dilution and this approach enabled us to investigate various sub-populations of

cells that exist in the heterogeneous blend. Fourteen clonal populations were established

from three bone marrow samples derived from three OA patients (Chapter 4).

Proliferation of the single-cell clones was achieved by supplementation of the culture

medium (LG-DMEM, 10% FBS and 5% penicillin/streptomycin) with 2 ng/ml of FGF-

2. FGF-2 is known to increase the lifespan of bone marrow stromal cell primary

cultures when cultivated at low cell densities (7), supporting the proliferation as well as

the differentiation potential of these cells (8, 9). Based on their proliferation potential

the clones were broadly grouped into fast-growing or slow-growing clones. The

majority of the fast-growing clones were tripotential for osteogenic, chondrogenic and

adipogenic lineages, whereas the slow-growing clones were either uni or bipotential.

This research found a direct correlation between proliferation rates and differentiation

potential, as well as the ability to deposit the necessary matrix proteins upon induction.

It is worth noting that the differentiation experiments were conducted at passage 6

(approximately 20 PDs) in order to get enough cells for 2 dimensional differentiation

and gene expression studies. Typically these studies are performed on cells at passage 2

or 3, so our results highlights the robust nature of the fast-growing clones and

demonstrated both an extended proliferation potential coupled with multilineage

differentiation ability. In addition to these properties, the fast-growing clones retained

their initial fibroblastic morphology at higher population doublings, as well as being

negative for senescence associated beta-galactosidase staining, when compared with



                                             204
slow-growing and mixed cultures. These attributes broadly qualify the fast-growing

clones as possessing stem cell properties, or stemness. Moreover, the fact that the fast-

growing clones were able to deposit the necessary matrix proteins makes them

potentially ideal for use in an ex vivo developed implant, thus facilitating regeneration to

match the natural equivalent of the original tissue.


         Further, in this study we draw an association between the status of the clones

and their transcription profile by quantifying the expression of 84 stemness genes. Gene

expression studies of the clonal populations (Chapter 5), in which the quantitative Stem

Cell RT² PCR array was employed, revealed a significant up-regulation of genes

transcending MSC lineage specification by the fast-growing clones, signifying their

broad differentiation potential. These included gene products involved with maintenance

of embryonic and neural stem cell renewal, such as Sox2 and Notch1 and its ligand

DLL3. In addition, expression of factors involved in cell cycle maintenance, such as

CDC2 and growth factors including FGF-2, BMP-2 and IGF-1, could explain the ability

of the fast-growing clones to tolerate an extended number of passages without losing

their stemness properties. The results obtained in this study suggest that genes, which

were commonly expressed by the fast-growing clones, confer multipotentiality

competence, while retaining the ability to proliferate.


         To date, a definitive cell surface marker for MSC has not been found,

presenting a major barrier to selectively isolate potential cells. In an experiment in which

flow cytometry was used, there was no apparent variation between fast- and slow-

growing clones in the expression of putative MSC cell surface markers. Therefore

protein profiling studies (2D LC, MALDI-TOF-TOF/MS) were performed to identify

                                            205
differentially expressed proteins potentially involved in the cellular processes

responsible for the existence of various sub-populations, and to identify potential marker

proteins associated with the stem cell clones. The ProteomeLab™ PF 2D method

employed in our study requires 1 to 5 mg of protein for analysis, requiring the sub-

culturing of cells up to 28 PDs in order have sufficient number of cells required for

protein extraction. The protein expression profile is thus a reflection of cells at a high

passage number and, hence, the up-regulation of those proteins involved in the

maintenance of cell integrity, cytokinesis, apoptosis and stress response. The study

highlighted certain proteins that were differentially expressed between fast- and slow-

growing clones. The most noteworthy of these proteins were calmodulin and

tropomyosin, which were expressed by the fast-growing clones, and both of which play

a major role in cell proliferation and maintenance of cell integrity. In the slow-growing

clones the expression of stress response and apoptic proteins, such as heat shock protein

27kDa and Annexin1 respectively, were noteworthy. Another protein, caldesmon which

is known to create a regulated brake during the process of cytokinesis, was up-regulated

in the slow-growing clones. The expression pattern of these proteins, and the crosstalk

between them, potentially confer the altered status in which the cell populations exist.


         In summary, this study has evaluated the phenotypic plasticity of the bone

marrow stromal cell populations in the OA patients. It has identified cells of

therapeutic importance which have distinct properties suitable for the development

of implants. It forms a basis for future cellular and molecular studies that can help in

identifying a definitive cell surface marker which can aid in the selection and

isolation of potent cells. The genes expressed differentially between the sub-



                                             206
populations highlight the ‘stemness’ of the fast-growing clones, an observation

supported by the expression of proteins which act as effective modulators in the

maintenance of cell integrity and cell cycle regulation. Though the gene expression

and proteomic studies were conducted at different population doublings according

to the protocol needs, noticeable relationship can be drawn between highly

expressed stemness genes and associated gene products. For instance, up regulation

of stemness gene CDC2, a cell cycle regulator which aids in orderly progression of

mitosis, in the fast-growing clones is complimented by the expression of calmodulin

and tropomyosin which are reported to promote cell division and maintain cell

integrity. On the contrary expression of metabolic proteins (GAPDH and PKM2) in

the slow-growing clones is associated with up regulation of a metabolic marker

gene ALDH1A1.



Future Directions

   •   In this preliminary investigation, we have shown that the fast-growing clones,

       apart from being superior to slow-growing clones, also outperformed the mixed

       cultures in terms of protein matrix deposition when inducted into various

       lineages (Chapter 4). Detailed comparative characterization and molecular

       studies involving fast-growing clones and mixed cultures and further in vivo

       transplantation studies using an animal model can ascertain the advantages of

       using fast clones for cell based therapies.




                                           207
•   Evidence from previous studies suggests that Ca²+/calmodulin promote cell

    proliferation, migration and cytokinesis by phosphorylation of myosin light chain

    and subsequent myosin ATPase activation. Conversely, caldesmon impedes the

    same cellular processes by inhibiting the activated myosin ATPase (10). Specific

    investigations, involving purified or recombinant calmodulin application to slow-

    growing clone culture, will help in understanding physiological and functional

    role of calmodulin in maintenance of cell integrity and reversal of apoptosis

    through reprogramming of the cellular machinery.



•   Finally, studies involving the evaluation of suitable cell surface receptors,

    mediating the molecular pathways of the proteins calmodulin and caldesmon,

    may provide a better insight into how to isolate fast-growing clones from a

    heterogeneous population of the bone marrow stromal cells.




                                        208
References


1.    Banfi, A., et al., 2000 Proliferation kinetics and differentiation potential of ex
      vivo expanded human bone marrow stromal cells: Implications for their use in
      cell therapy. Experimental Hematology, 28(6): p. 707-715.

2.    Pittenger, M.F., et al., 1999 Multilineage potential of adult human mesenchymal
      stem cells. Science, 284(5411): p. 143-7.

3.    Colter, D.C., I. Sekiva, and D.J. Prockop, 2001 Identification of a subpopulation
      of rapidly self-renewing and multipotential adult stem cells in colonies of human
      marrow stromal cells. Proceedings of National Academy Science, 98: p. 7841-
      7845.

4.    Simmons, P.J. and B. Torok-Storb, 1991 Identification of stromal cell precursors
      in human bone marrow by a novel monoclonal antibody, STRO-1. Blood, 78(1):
      p. 55-62.

5.    Gronthos, S., et al., 2003 Molecular and cellular characterisation of highly
      purified stromal stem cells derived from human bone marrow. J Cell Sci, 116(Pt
      9): p. 1827-35.

6.    Schwartz, R.E., et al., 2002 Multipotent adult progenitor cells from bone marrow
      differentiate into functional hepatocyte-like cells. J Clin Invest, 109(10): p. 1291-
      302.

7.    Bianchi, G., et al., 2003 Ex vivo enrichment of mesenchymal cell progenitors by
      fibroblast growth factor 2. Exp Cell Res, 287(1): p. 98-105.

8.    Zaragosi, L.E., G. Ailhaud, and C. Dani, 2006 Autocrine fibroblast growth factor
      2 signaling is critical for self-renewal of human multipotent adipose-derived
      stem cells. Stem Cells, 24(11): p. 2412-9.

9.    Martin, I., et al., 1997 Fibroblast growth factor-2 supports ex vivo expansion and
      maintenance of osteogenic precursors from human bone marrow. Endocrinology,
      138(10): p. 4456-62.

10.   Eppinga, R.D., et al., 2006 Tropomyosin and caldesmon regulate cytokinesis
      speed and membrane stability during cell division. Arch Biochem Biophys,
      456(2): p. 161-74.




                                          209

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:66
posted:8/1/2011
language:English
pages:128