Docstoc

Mycobacterium_tuberculosis_genelist

Document Sample
Mycobacterium_tuberculosis_genelist Powered By Docstoc
					All oligos have been initially designed from one strain and have
been mapped to the other strain. An oligo is said to represent the
other strain if the oligo has a >97% match over the length of the
oligo to the ORF of the other strain. A greater than a 97% match
translates to a 70, 69, or 68 basepair match for a 70mer.
plate   well   Oligo_ID     Oligo_sequence Sanger_H37RV_ORF_name
1       A01    T000001_01                  Rv0001
                            GTTCTTCCACACCTTCAACACCTTGCACAATGCCAACAAGCAAATCG
1       A03    T000002_01                  Rv0002
                            TCCGCCGAGGCCCAGGTTGGCGCTGAAATTGTTTCTCCTGGAAGC
1       A05    T000003_01                  Rv0003
                            TTGAATCGATCATCGGTCCGAAGTACACGTGATGTGGTCGGAGTG
1       A07    T000004_01                  Rv0004
                            ATCAATGAAGTCACCAGGGTTGGATTTGGTCAGGCGCACCCTGGA
1       A09    T000005_01                  Rv0005
                            GGAAGACGGCATTCAGCGGTACAAGGGTCTAGGTGAAATGGACGC
1       A11    T000006_01                  Rv0006
                            AAGCAGGACGACATCGTCGCGCACTTCTTCGTGTGCTCCACCCAC
1       A13    T000007_01                  Rv0007
                            TGCGTTCGTCTACAACCTGATCACCGATCTGATCGGCGGCATCGAA
1       A15    T000008_01                  Rv0008c
                            TGGCCAACCTACCGCAGGCCCTACAGGACGCCCGGACCCAACGTC
1       A17    T000009_01                  Rv0009
                            TTTTCATCACCGTCGGCAAGACTCCGCACCTGAACCGGCGCCACA
1       A19    T000010_01                  Rv0010c
                            GATCCGAGGTTGGTTCCGGACGCAGCTATTACGACATTCCAATATC
1       A21    T000011_01                  Rv0011c
                            TCGGTCTGATGCTGATCGGACTCATCTGGTTAATGGTGTTTCAGTT
1       A23    T000012_01                  Rv0012
                            ATCGCGATGTCGATAGCTCGTTGTGTCGGAAACACGTTGCTGCTCA
1       C01    T000013_01                  Rv0013
                            CGTATTCCACACCAATGTCGGTGTGCTACAAGGGCTTCCGGATCCC
1       C03    T000014_01                  Rv0014c
                            AATCCACCCGCAGGCACCACAGTTCCGGTCGATTCAGTCATCGAAC
1       C05    T000015_01                  Rv0015c
                            GACGCCAGCCCGGCCAGCGACGTCTATTCACTGGGAGTTGTTGGG
1       C07    T000016_01                  Rv0016c
                            CGGTTACCGGCTTCTACTCCCTGCGCTATTCCAGCACCGCCCTAGA
1       C09    T000017_01                  Rv0017c
                            CGCGTTCGGCGAAGAGCTTGGGTTGGTGGGCTTGACGGCCATCCT
1       C11    T000018_01                  Rv0018c
                            GACGGTGAGCTGACGCAGATCACCAAGGACGACACGTTTGTCCAA
1       C13    T000019_01                  Rv0019c
                            GAAGATCTAGGATCGACCAACGGCACTTACCTGGACAGGGCGAAG
1       C15    T000020_01                  Rv0020c
                            AGAAGTTGGGCGCTGATCCTGAGCTGAAGTCAACCGGTTTTGCTC
1       C17    T000021_01                  Rv0021c
                            CCTCACCGACCAATTCGAGGACACCGAACTCGACATTCTCCATCGC
1       C19    T000022_01                  Rv0022c
                            GCGAGATCAATTCCAGGCAGCTCCCGGACAATGCGGCTCTGCTGG
1       C21    T000023_01                  Rv0023
                            CCTGAGCTATCTGGAGCGCGGTGCCCGCAAGCCACACAAAAGCAC
1       C23    T000024_01                  Rv0024
                            AACCAGTTCGACTGTTCCGGTTTGGTCCAGTGGGCCTACGCCCAG
1       E01    T000025_01                  Rv0025
                            AGGATCAGCTTGCCGTCGATACGCCCATGGGAGCGCGTGAGTTTC
1       E03    T000026_01                  Rv0026
                            TCACGTCCACGACACGTTCCGAACAGCTCGATGCCATTTTGCGTAA
1       E05    T000027_01                  Rv0027
                            AGCTCAGAAAGCAGTGCTACCAGCAGCAAGCCGACAACCACGCCG
1       E07    T000028_01                  Rv0028
                            CACGACCGACGACCTGAACGTCGCGATCGAAAAGCTGCTGGCCCA
1       E09    T000029_01                  Rv0029
                            AAGCGGATCTGCATCGGATAGTTGGTTCTGCCAACGACGAGCTGA
1       E11    T000030_01                  Rv0030
                            CGTCACGCAGGCTGAAACTGTTACCTACAGCGTGGACTTGGGAGA
1       E13    T000031_01                  Rv0031
                            ATCCAGACCCCGAAGCCGCGATGCGAATCAGATGTGTTCGCGCGA
1       E15    T000032_01                  Rv0032
                            CATACGGCAACGTTAGCGCGAATGATGATGCACAATATTCAACGGC
1       E17    T000033_01                  Rv0033
                            ATCGCCATCTCTTTCCGCGACGCACAGAACATCAAAACAGTGGGAG
1       E19    T000034_01                  Rv0034
                            TAAGCAACACCGATGGCCAGGTGATCGCCGTGTATCGATTGCGGG
1       E21    T000035_01                  Rv0035
                            AGGAAGGCTTCTGCGACACCCACGACTTGGGTTTTCTTGTAGACGA
1       E23    T000036_01                  Rv0036c
                            GAGCACTCTTGACGTCAACGCAGTAGGGGAGGACGCACAACGCTG
1       G01    T000037_01                  Rv0037c
                            ATGCACTGTTTTGGGTCTCATACATCCTCTCGATTACCGTGGCCGC
1       G03    T000038_01                  Rv0038
                            TCGGTCAGCTCGAAGGTGAAATCGAGCGCGACGACTGGATTGTGT
1       G05    T000039_01                  Rv0039c
                            TGAAACCGCTAGCCCCACCGCCAACTGCGTTGGCAGCTGCGCGGT
1       G07    T000040_01                  Rv0040c
                            ATTTCGACGGCTTTCCGTCATCAATCATCGAGGGCACCTACCGCGA
1       G09    T000041_01                  Rv0041
                            GACTTTGCGGCACTTCGCAATAACACCGCAACGGCTAAGTTGATCG
1       G11    T000042_01                  Rv0042c
                            TTGGCGGTCAAAGGTCGCCCGACACAAGTCTACGGTCACACGCAT
1   G13   T000043_01                  Rv0043c
                       GGGGTTAAGGAAAAGGACCAGGTTGTCGCCCACATCCTCAACCTG
1   G15   T000044_01                  Rv0044c
                       CGCTTTTACCTGGGACCACTTCTTTCCGCTCTACGGCGACCCTGAC
1   G17   T000045_01                  Rv0045c
                       CACAGGCGTGCAACGCATTTCCGTGGCGTTCACATCGTCGAGAAG
1   G19   T000046_01                  Rv0046c
                       GGAGTCCAAGAAGATCTCCAAGACCCAGGCCGTCACTTCGAATCTG
1   G21   T000047_01                  Rv0047c
                       TCTGTTGATCGAGTCACCGATGCATGGCTACGAGTTGCGCAAGAG
1   G23   T000048_01                  Rv0048c
                       GCCTCAAACAATCCGACGTCAAAAGCATGTACCTGATCGTCGAACC
1   I01   T000049_01                  Rv0049
                       CGACCCGGTTCTCCGAGTTCGCGGTCCACGTGGTGGAGGTATGTC
1   I03   T000050_01                  Rv0050
                       GTGCGTACTACGGTGGCGACAATGCCAATGGCTTTGACTTCGCTC
1   I05   T000051_01                  Rv0051
                       TGGAGTATCCGGTGCTGACTGGGATCTATCAGTACCTGTCGATGG
1   I07   T000052_01                  Rv0052
                       CGGCTCCCTGGCCAAGGCCTCGCCGGCTACCCATCGGCTCGCGT
1   I09   T000053_01                  Rv0053
                       ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
1   I11   T000054_01                  Rv0054
                       CGAGTCATCGTTAGCGGGCGGCTTAAGCAGCGGTCGTTTGAAACC
1   I13   T000055_01                  Rv0055
                       AAAGCCGGTCAAGACGCGTAAATGCGTGTTCTGCGCGAAGAAGGA
1   I15   T000056_01                  Rv0056
                       CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
1   I17   T000057_01                  Rv0057
                       GTTGTCGAATATGCGTTCGGGTGCTTGTGTCGGAGGAGGTGAGAG
1   I19   T000058_01                  Rv0058
                       GAGATCACCAGCATTGGAGATCAACATGTTTTCGATGGGACTGTAA
1   I21   T000059_01                  Rv0059
                       GGTACGAACTCTGCTCGATCCTGTCGGTGGGGTGCGAAAGTATGT
1   I23   T000060_01                  Rv0060
                       GCACCGCAAGAGTTCTTGCGAACCAACCGATCTCGTTGACTACTAA
1   K01   T000061_01                  Rv0061
                       CGCCGCTGCACAACCCAGTATCGCAGTACTCAGGCGAGCAAACTT
1   K03   T000062_01                  Rv0062
                       CCACCTGTCGTCGGCATTTGGCGTTTGTCGAATTGCGGCATTATTT
1   K05   T000063_01                  Rv0063
                       TCAACTATCTGGACCTGGTCAGATATCTGGCCGTCGGGAACCTCAA
1   K07   T000064_01                  Rv0064
                       CGCATATCCTGTCCCGAACCTTCACCCAGCAACAGCAGCTCAAGAA
1   K09   T000065_01                  Rv0065
                       CGCACAGCCCACGACTGATCGAATACACATGGCAGCTAAGGCACA
1   K11   T000066_01                  Rv0066c
                       TGGCAGATGTGTTGACCAAAAACGAAGACGTCATCGTGCGAGAGC
1   K13   T000067_01                  Rv0067c
                       GACGTGCTTGAAGTCAAGACGCTCCTAGTCGGCTGCCAAGCGATG
1   K15   T000068_01                  Rv0068
                       TTCGAGATGCAGTTCGGCACCAACCACTTGGGCCATTTCGCGTTGA
1   K17   T000069_01                  Rv0069c
                       CACCAAGTACAAGGAAACCTCGGCCGGCGGGCTCGCCATCAACGT
1   K19   T000070_01                  Rv0070c
                       CCAAGGCCACCGCATTCAAGATGGCAGCACAACCTGAATTCGCGC
1   K21   T000071_01                  Rv0071
                       CCGGATCAAAGACAAGCGGGTGTTGCGGCTGGTGAACTGGCAGCG
1   K23   T000072_01                  Rv0072
                       GACCGAGGGCTTACAGAAATTGGCGTACAACGGGCAGCCGAATAT
1   M01   T000073_01                  Rv0073
                       GGCCGATCGCGTCGTTGAGCTGACACCCGATTTCGCGGAGACAAA
1   M03   T000074_01                  Rv0074
                       GACGTGCTCCCCGACGATTTGGTGTATCTGTCTCGACACGGGTTC
1   M05   T000075_01                  Rv0075
                       CAGGACAGCATCTTCAATCTGTTGACCGAGGAACAGCTTCGGGGT
1   M07   T000076_01                  Rv0076c
                       GGCACTGAACTTCCTGATCTGCCTCGCCTACATCTTCTTCAGCCTG
1   M09   T000077_01                  Rv0077c
                       CTAGTTGCGATGCGTTCGAACACTTTCCGCCGCCGATCCTCAAACC
1   M11   T000078_01                  Rv0078
                       TCACGCGGGGGGCGATGTACCACCAATTCGCCGATAAAGCAGCAC
1   M13   T000079_01                  Rv0079
                       GATTGCCGCTATGGACGCCATGGACTACGACGTGCATTTGTTCACC
1   M15   T000080_01                  Rv0080
                       AACATGGCGATGGACACCGTGGTCGCGATCGAACCCGAGATCGTC
1   M17   T000081_01                  Rv0081
                       TCAAGGCGGAGTTCTTCAAAACCCTTGCGCATCCGGCGCGGATCA
1   M19   T000082_01                  Rv0082
                       CCGACATGTTGACGCGGGTTCGTGCAACGGGTGTGAGGTGGAGAT
1   M21   T000083_01                  Rv0083
                       GCCTGTGGTACGCCGTGATGACTCAGCTGGGATTCATCGCAATCC
1   M23   T000084_01                  Rv0084
                       ACGTTCGAGGTGTTCCTCGCCAAACTGCGATTGTTCCGGGTACCC
1   O01   T000085_01                  Rv0085
                       GTGCCGCTGATCGTCGAACTTGGTGCCTCGCTGGACGTGCTGTTC
1   O03   T000086_01                  Rv0086
                       CGCGATGGTTCTGGCGGTGTGCGCCAACAACATCGGCGTCATTTG
1   O05   T000087_01                  Rv0087
                       TGCGGCGCGACGAATTCGCCGCGTCTGCCGCTCTTGCTCAACACA
1   O07   T000088_01                  Rv0088
                       AATTAGTTGTCGGGTCGAAGTTTTCGACGAAGATGAAGTTGTTCGG
1   O09   T000089_01                  Rv0089
                       GCCCTCGCTGCGAAACGGCTTATGGCACTTGACAAGCTGGGTTGC
1   O11   T000090_01                  Rv0090
                       AGGGCATCACGACGACTCGGGTCGTGACCTTCAGCATCAATGTCG
1   O13   T000091_01                  Rv0091
                       CACATCCCCTTCATCGAACCGACCGAGCGGCTCGGATACCCGGTT
1   O15   T000092_01                  Rv0092
                       CACCTCGACGTTGTACCCCTTGCGCTTGACCTGGCAAGGGCCACG
1   O17   T000093_01                  Rv0093c
                       CTTTAACCACCACGCATCAACCGTTTTGCAAGGCTGCAGGGGTGTG
1   O19   T000094_01                  Rv0094c
                       CCGCACCAACACCTTCCACCACCCCGAACGATTCCTCCACAACCAA
1   O21   T000095_01                  Rv0095c
                       TCCCTTGTGTCACTTCAGTTTCACGGTTATCAGCGGGGCGCTCTTT
1   O23   T000096_01                  Rv0096
                       GGCGGCGATGCCGCAGATACCCGGCTAGACGTATTGAGTTCAATT
1   A02   T000097_01                  Rv0097
                       AGGAAGGTCAGGGGGTCCCAAAAACCGGCGCGTTCTGGCATATCG
1   A04   T000098_01                  Rv0098
                       CGGTGAGTCCGCCTATATTCGAAGCACGGGGCACTTCAACGCGGT
1   A06   T000099_01                  Rv0099
                       AGGCTGTGCTACTGGCCAACCGCACCTTCTTCGCCGTCCCGGACA
1   A08   T000100_01                  Rv0100
                       CTGCTGATGAAGCAGCTAGGCGTGAACCGACAATCCGAACTGCCG
1   A10   T000101_01                  Rv0101
                       CAGCCTGGCCGCCTACGAAAATCAAGACGTACCTTTCGAGGTGCT
1   A12   T000102_01                  Rv0102
                       CACCGCATTCGTCCTCTTTGTGGCCTCGCCCTATATCGTCTATTTC
1   A14   T000103_01                  Rv0103c
                       ATGATGGTTGCTTCCGGACGGGGAGCGCAGCTAGGGATCTTTATC
1   A16   T000104_01                  Rv0104
                       CGCCTACGCACCCCACGAATCATTCGACACCCAGTACACCCGCCA
1   A18   T000105_01                  Rv0105c
                       ACTTACCGTCGGAGGACCGCCGCATCAAGGTGCGGGTCAGCGCCC
1   A20   T000106_01                  Rv0106
                       CTGCCACGCTGAGCCGTGGCGAATTGATCACCACGGAGGACGCTT
1   A22   T000107_01                  Rv0107c
                       GGACTCGTCAACTGCTGCTGGTGAATCTGCTCACCGACATGTTTCC
1   A24   T000108_01                  Rv0108c
                       GCTGCAGGTCATCGAGAAGTCCTTCCCGGCGGGTTACCACGTCGG
1   C02   T000109_01                  Rv0109
                       AGACAGCCAACGCAACTCCGCTGCAGGCTCTGCAGACTGTGCAGC
1   C04   T000110_01                  Rv0110
                       CCGGTTGGTGACCTCGGCGTTCCTGCACTACGGGGCGATGCACCT
1   C06   T000111_01                  Rv0111
                       ACCCGAGCGTGTGAACAAATGGAACGCCATGTTACATAACGCCATT
1   C08   T000112_01                  Rv0112
                       GAGGCCGGGGCTGACTACAATGTGGGAGGTTCGATCGCCTACGAG
1   C10   T000113_01                  Rv0113
                       CAATTCTATGAGTGTACTGCGGGCCGCGAAAACCGCAAGGGAGTT
1   C12   T000114_01                  Rv0114
                       GATGAGCGCCGTCGACGTGATGGTGATACATCGGCACCTCCAAAT
1   C14   T000115_01                  Rv0115
                       TCGTGGTGAATCCGCTTCGGATACGGCGGGAGGTGATCGCCGAAC
1   C16   T000116_01                  Rv0116c
                       CATCGGCATCCCGCTGAATTCCTCGGACGGGTATCTGCTCACCGC
1   C18   T000117_01                  Rv0117
                       TGCCGTCATCGTGCACCCCGAGACCCAAGACAGTGATGATGTTGA
1   C20   T000118_01                  Rv0118c
                       GGTTCTACAACGCGCTTGGTGCCATTAGGTCTGTGCTGCAACGCA
1   C22   T000119_01                  Rv0119
                       TGACCGAAGCCACCCACCAGGTAACGACAACGCAGATTGAGGGTA
1   C24   T000120_01                  Rv0120c
                       TTATCCCCAATGTGGAGAAAGGTGTCCGCGCACAGATGGATAAGG
1   E02   T000121_01                  Rv0121c
                       CCAATCGGTTCCGTTGAACGGCCCGGTAATCGCAATAGCAGTCCA
1   E04   T000122_01                  Rv0122
                       CGTCGCCGTCGAAGCCGACGACGGTGACCTGATCATCACTCACGC
1   E06   T000123_01                  Rv0123
                       TCGAGGTGTCTGACGTCGATCTCAAGCAAGAGGAGGTCTATGTCG
1   E08   T000124_01                  Rv0124
                       ATGTCGTTTGTCAGCGTAGCCCCGGAGATTGTGGTGGCCGCGGCA
1   E10   T000125_01                  Rv0125
                       GGATTCGCTGACCGGTGCCGAAGAGACATTGAACGGGTTGATCCA
1   E12   T000126_01                  Rv0126
                       CTGTGTCAACAACCTGTCGCGATTCCCGCAGCCCATCGAATTGGAC
1   E14   T000127_01                  Rv0127
                       CAACGATCGAACAGCAATTCCAGAAGCTCGCGGCGGAGGCAATCA
1   E16   T000128_01                  Rv0128
                       ATTCTGTTCGTGGTCTTCGGGATTGGCGCCTTGAACACATCGTTCG
1   E18   T000129_01                  Rv0129c
                       CCCAACGGAACACACTCGTGGCCCTACTGGAACGAGCAGCTGGTC
1   E20   T000130_01                  Rv0130
                       CGTCAAGGGCGTCAAGCTGGCAATCAACTACGGCCTGAACAAGGT
1   E22   T000131_01                  Rv0131c
                       CAAGCTGGATTGGGTCGAAAAATTCATGGCCGAGGAACTCGAACC
1   E24   T000132_01                  Rv0132c
                       TTCGATGTTTCCCTGGCTGACCCTGGCGTTGGTGGGCAACAGCAC
1   G02   T000133_01                  Rv0133
                       GAATCCACCAAACCCGAGAATGTGCCCTACTATCAACGGTTCGGTT
1   G04   T000134_01                  Rv0134
                       CTCGCGGTATACCAAGACCGAGATGGCTGACGATCTGGCTGCGGT
1   G06   T000135_01                  Rv0135c
                       TCGAGGCCTACGTCACCCATATCGAATCCAGGCCGGCGGTGACGT
1   G08   T000136_01                  Rv0136
                       TGATTCCCCGCGGGTATTCGATCATTATCAATATCGCCCAGATACA
1   G10   T000137_01                  Rv0137c
                       CACGGTCACCGATTACCGCACCCTGCTGGAATTCTTCTTCCAGATC
1   G12   T000138_01                  Rv0138
                       TTCAAGAAACGATGACGACCTTCCCGGGCAGTCACATGGTGGCCT
1   G14   T000139_01                  Rv0139
                       GTCCTCGATGTGGCCACAGACGCCAGCCTGCGCAGGTTCGTCTTC
1   G16   T000140_01                  Rv0140
                       GCGGCGCTGTGCTTGCAGGAAGCCAGTTACCCTGCAGTGCAATAT
1   G18   T000141_01                  Rv0141c
                       GGTCAACATCGAACTCATCCGCTGCGTCAACGAGGGTGAAACGGT
1   G20   T000142_01                  Rv0142
                       TGTTCGGTGACGCCGACGCCGTGTCGGTCGGCGACTACCACATTC
1   G22   T000143_01                  Rv0143c
                       ATACACCAGCGAGTTTCTGCTCGGCTACCTCGCGGACTATCAGATT
1   G24   T000144_01                  Rv0144
                       GTCGTGTTGTGTGGCGTGGGCTTCTATATCGGTTTTGTCGGGAGC
1   I02   T000145_01                  Rv0145
                       ACCATGAACACAAAGGGCAACACGCAGCGCTGGAATCGGATGCGC
1   I04   T000146_01                  Rv0146
                       CGATGTGCTCGGTATCGAGCAGACCATCGACGTGCAGGAACTGGT
1   I06   T000147_01                  Rv0147
                       CTTCGGACCGATCCTGCCGGTGGTCACCGTCAAATCTCTGGACGA
1   I08   T000148_01                  Rv0148
                       AGCAACGCCGGGATCTTGCGCGACGGCACCTTCCACAAGATGTCG
1   I10   T000149_01                  Rv0149
                       TTGTTGATCGGCTTTGCCGCGGGTGCTGTACCGACCCTCAAGGTC
1   I12   T000150_01                  Rv0150c
                       GAATTCCTCGTGTTGGCCCGCCGATCCGTCACAGCATCACCGTATC
1   I14   T000151_01                  Rv0151c
                       GATTGAATTCATCGCGATTGTGGTGACGTTGGCCGACATTACTCAG
1   I16   T000152_01                  Rv0152c
                       TTCCGACCTCAACGCGGTTGCAGGCATCACATTCGTACACACCAAG
1   I18   T000153_01                  Rv0153c
                       CGAGATGATCCAGCAGCGTTTCGACACCGAACTGGCACCCGAGGT
1   I20   T000154_01                  Rv0154c
                       GAGTCGGGATTGACCAACCTGGAGTACGCGCCGCTGGCCGAAATG
1   I22   T000155_01                  Rv0155
                       CTCTACAGCAAGAACATCACCGCGCTACTCGACTTGTTGATCAAAG
1   I24   T000156_01                  Rv0156
                       GTGATCTCGAAAGTGCCCAACACGTTGCACACCCCGCTGATGTCAG
1   K02   T000157_01                  Rv0157
                       GCACTACCTGGTCGAGATTCTCTACATCATCTCCTTTTCACTCTTCA
1   K04   T000158_01                  Rv0158
                       GCTCAACAAAGCAACGGTCTATCACTACTACGCCAGCAAGTCGCTG
1   K06   T000159_01                  Rv0159c
                       GTCACGCTGCTGAACAACGGCATCAACGCGGAACTACAAAATGGG
1   K08   T000160_01                  Rv0160c
                       CGCCACGATCATCAACAACTACATCAATTCGCTGATGGCGATGGGT
1   K10   T000161_01                  Rv0161
                       TTGCCGCTGTTGTTCGGTCACATCGGTGAGGGCAACCTGCACCTG
1   K12   T000162_01                  Rv0162c
                       CTGCCGGTGGAGTCGCTGGTGACGTCAACGATTCGGTTGGACGAT
1   K14   T000163_01                  Rv0163
                       CCTGTGCTGGGCATTGTCGCGGAGTCGGGCTGCCGTTATTTCTCG
1   K16   T000164_01                  Rv0164
                       TCCACGCCGTGTACTACCCAGGCGAAAACCAGATTCAAACCGTCAT
1   K18   T000165_01                  Rv0165c
                       TTGACCCGCCAAGACATCGACGACATTTTCTGGCTGCAGGCCACC
1   K20   T000166_01                  Rv0166
                       AGGGTGGTCGATCAGAACATGAACGATGTCCCCGTCGGCGAAGTG
1   K22   T000167_01                  Rv0167
                       TGTGATTGCCCTGTTCGCCGTCAACGTGATCTTGACGACCATCGGT
1   K24   T000168_01                  Rv0168
                       GGGCAGTCGAACGGCACCTACGAGCATTACTTTCAAACGTTCCTGC
1   M02   T000169_01                  Rv0169
                       TGACGGCGAGTCGGCGGCCAAGTTCATCTTGGATGTGGATCCGCG
1   M04   T000170_01                  Rv0170
                       CATCGTGATTTTCGGTCAGATGCGCTTCGACCGGACTAATGGCTAT
1   M06   T000171_01                  Rv0171
                       GGCCAAAGCTTTACCAGTGTTCCCATGCTATTCGCAAAGCCGAGCT
1   M08   T000172_01                  Rv0172
                       CAAAAACTGACGAACAACACGGTGGTCGCCTACTTCACCCAAGCCA
1   M10   T000173_01                  Rv0173
                       CTCAACCAGCAACGCGATGACATTACCCGCGCCATTGATTCCACCA
1   M12   T000174_01                  Rv0174
                       TGATCCTTTTTGCGATCGTCTCCGTAGTCGCAATCGTCGTATTGGG
1   M14   T000175_01                  Rv0175
                       CCGATGCTGGGGCGATGTCGGCTAGCATGCAGAAGATCATCGAGT
1   M16   T000176_01                  Rv0176
                       CAGCTCAGGCGACCATGCTGTTGTTCATGCAGGGTGAACGCGGTA
1   M18   T000177_01                  Rv0177
                       GCCACGGGCGACTTCGCCAAGCAGTACCACGAAAGAGCAAACGAT
1   M20   T000178_01                  Rv0178
                       AAGAACATCCCAGCATTGAAGTATCTGTCCTACCGGCTGTTCATGA
1   M22   T000179_01                  Rv0179c
                       CCCAAAAGCAGACAGGACTACGATCTTGCCACTCCGGTGATCGAG
1   M24   T000180_01                  Rv0180c
                       CGCCGTGGAACACCAAGCTCAATACCAAGCTCGCCAAAGCGCACG
1   O02   T000181_01                  Rv0181c
                       ACCACGGGCTCCTGTTGGTGAACAACGACGACCAAATGGAACCGG
1   O04   T000182_01                  Rv0182c
                       TGGTAGTCATTACCGGGAGCGTAACGGCTGCTCCGGTGAGAGTGT
1   O06   T000183_01                  Rv0183
                       CGGGCACAGCATGGGCGGCGGCATTGTGTTCGCTTACGGTGTCGA
1   O08   T000184_01                  Rv0184
                       ACGTGGCATCGAATTCGACGTTCGTGTACGCCTACGGGTTCGCCG
1   O10   T000185_01                  Rv0185
                       CGATGCGCGAGTTGGTCGTGCTACACGAAGTGGCGCATCATTTGT
1   O12   T000186_01                  Rv0186
                       GGTTACCGCTGGTTTGCCAGCACAAATCAGACCCCGATGTTCGCG
1   O14   T000187_01                  Rv0187
                       CCGTTCGACCTGGTGTTCATCGACGCCGACAAAGAGAACAACGTC
1   O16   T000188_01                  Rv0188
                       CATTCATCAATTGATCAACACCCTGATTTGTTGGCTCTGCGTGCCA
1   O18   T000189_01                  Rv0189c
                       CAGGCGCGATCAAAGGCGCAGGACTCGGTAAAGATGTTCTACTGC
1   O20   T000190_01                  Rv0190
                       AGTGCGCGGCATCGCGCGAATGATCGAGGAAGACAAGTACTGCAT
1   O22   T000191_01                  Rv0191
                       ACGTTGGCCGACGGGCTCGTCACCACCGTAATCCTCGCCTGGTCA
1   O24   T000192_01                  Rv0192
                       GGGAAAGCAATTATGTCGCGCTGGAAGCAGGGCTGGACGAGGGG
1   B02   T000193_01                  Rv0193c
                       GAATTGGTAAAACGCTACGACGAACTCATGGCCCGGGAGGGCAGT
1   B04   T000194_01                  Rv0194
                       TCTACATCGAGCTGTTGTACACGCCGATAGGCGAACTGGCGCAAA
1   B06   T000195_01                  Rv0195
                       GATGATCAAGCTGGGGTTGACCGGGTTGTTGTATCGCAGCCAGAG
1   B08   T000196_01                  Rv0196
                       CGGCCTATCACTACTTCCCGGGCGGTCGTACCCAACTGCTATGCG
1   B10   T000197_01                  Rv0197
                       AACTACGAAGACGACTTCGCTTTGATTAGCCACCCCGATCACAAGA
1   B12   T000198_01                  Rv0198c
                       CGACGAGTGGTTCATGACACCACAAACCGTCAACGCCTACTACAAC
1   B14   T000199_01                  Rv0199
                       CCCAAATCATCAGCCGGTCCGATGTTCTCGACCTACGGTATCGCCT
1   B16   T000200_01                  Rv0200
                       GTGTTGGTGCTGCTGGTGGTCGAAGGTGTGGCAATCAACTTCTGG
1   B18   T000201_01                  Rv0201c
                       GATGATCCGGATGCGGCGGCTGTCGGACCGGTTCGTCAGAGCCAA
1   B20   T000202_01                  Rv0202c
                       CGTTCCCCCGCTGGTCCTGGCGATGACGTTCGGGTTGTCGATGGA
1   B22   T000203_01                  Rv0203
                       AGGACGGTCGGTTCGGTCGCCAAGTCGATGGGCGACTACCTGGAT
1   B24   T000204_01                  Rv0204c
                       AGAGCACCGCCGATTCCGACAACGATCGCGACCCGCCAACCGATC
1   D02   T000205_01                  Rv0205
                       TACGCGCTGATCACGGTCGGTTTGCTAATCGCGGTGAACCAACTTG
1   D04   T000206_01                  Rv0206c
                       AGTTCGACAAACTCTTCCCCGGATACCGCACCAATCCGCTGACACT
1   D06   T000207_01                  Rv0207c
                       ACGCCAGTTGGGCGCTAGCGTCGGATACCTTGGAGTTCGTCGACC
1   D08   T000208_01                  Rv0208c
                       GGGCGGCGCAGTCATCGAGTTGTTATGGAAAAAGCACGGTTGCTC
1   D10   T000209_01                  Rv0209
                       GTGATGGCGCAGGCCCGGTGCGCGCAATTTTCTACACTCCTCGGG
1   D12   T000210_01                  Rv0210
                       CTCGGGTCAAATTGTCCTACTTTGCCCGCAATCGGTGTTCGTTGCT
1   D14   T000211_01                  Rv0211
                       AGCTAGTCGAGGCCGGCACGTTCATCAGGCTCAACCCCGAGAAGC
1   D16   T000212_01                  Rv0212c
                       TCTACCTTTGCGAGTTCGCGCGGCGATGGGTGGATGAGCTGACCA
1   D18   T000213_01                  Rv0213c
                       GTAGCCAAGGTCGCTCCTGACGTCGGAATCAGCTTCGATGAGGCT
1   D20   T000214_01                  Rv0214
                       TTACGAGACCGCTTGTCACACTTCAAGTGTCCAAGGTCGATCGCGT
1   D22   T000215_01                  Rv0215c
                       TAGCTACCCGGAGGCGTGGATCGAGCAGATGAAACACATCGGCAT
1   D24   T000216_01                  Rv0216
                       CTTTGGCGACTCAGCGGGTCAAAGCCAACCTGTTCTACCGCGGGC
1   F02   T000217_01                  Rv0217c
                       TCAGCAGCAGACTGGGCATCACTGTCGCATCGGTGGACTACCGCC
1   F04   T000218_01                  Rv0218
                       TGACTACATCTTCGGGTTCAGCTTCTACACCGGCCACTATTTTGGG
1   F06   T000219_01                  Rv0219
                       CTCCTACGGGTCAGGTCCATTGCACCTGCTGGCGATGGTGTCTGG
1   F08   T000220_01                  Rv0220
                       GCGTGGGCACGGGCCAATGTCGACAAATTCGGCGGTGACCGCAAT
1   F10   T000221_01                  Rv0221
                       GATCTATTCGGTGGGCCCGTTGACCGCCGGTAGCGGATTGAATAT
1   F12   T000222_01                  Rv0222
                       CCCGACACTATGTTCGCTGAGCAGATGAAGATCCTGGTGCCGGTG
1   F14   T000223_01                  Rv0223c
                       CGGCTTCTTTATCCAACCCACCGTATTCGCCGATGTCGACAACAAG
1   F16   T000224_01                  Rv0224c
                       GTGGCTGACATCCGTCCCGGTGCTGCGTGAGTTCCTGGTGAGCAA
1   F18   T000225_01                  Rv0225
                       GCATGTCGACGATGTGACCAAACACCATGTGCTGCAAAGCTCCTGG
1   F20   T000226_01                  Rv0226c
                       TGTCGCGATCACGCTGGCGATCTGGAATCCCTATGTGGCCGAACG
1   F22   T000227_01                  Rv0227c
                       AGACATACCCCTATTTCGACCCCATCGCACAGAAGGCGTTTGACGC
1   F24   T000228_01                  Rv0228
                       GCCCGGCGGACGAATCGGGTGCACCGATTCGCCCGCAAACACCTC
1   H02   T000229_01                  Rv0229c
                       AATGAGACCGAGTGGCAGCGGCTCATGGTGGCATTGAGCGCGTTC
1   H04   T000230_01                  Rv0230c
                       TGCACGAGCACGTCTTCATCATGACCACCGAGATTGCGCAGAACTA
1   H06   T000231_01                  Rv0231
                       CTCCCAGCACGAGCGGTATGACCTGATCAAGAATGTGGTGAACTC
1   H08   T000232_01                  Rv0232
                       CGACCTCTACGCGTTTATTGCCGACATCGCCAGCCAGCGAGTCCG
1   H10   T000233_01                  Rv0233
                       GTATCTGACGCAGTTCGCGTTCGAGGAAGCCAAACACACCCAGGT
1   H12   T000234_01                  Rv0234c
                       GGACACCGGACGATTTGTGCAAACCCACCCAGCAAAGGATGTCAG
1   H14   T000235_01                  Rv0235c
                       CTATGGCTGGTGGCATCGGGAAATTTCTCCTGGCTCAATTGGCTGA
1   H16   T000236_01                  Rv0236c
                       GTCGACGGTGCCCAGTTGTCAACTCCCGGTGCTGGATTGTCAAGC
1   H18   T000237_01                  Rv0237
                       TCACCAACTACCACGTCGGCGGCATCCTCATCGGCAGCGACACCG
1   H20   T000238_01                  Rv0238
                       CGTGAGATGAGCCGGTTCATCGACGCGTTGCGTTCCAGCATCAAC
1   H22   T000239_01                  Rv0239
                       AGTCCAGCTCCCAGATGAGCTTTACCGGGACGCCAAGCGGGTCGC
1   H24   T000240_01                  Rv0240
                       AACTCGTGCTTATGGAGCTGTATCAATTGCTGCGGAATCCTACGGT
1   J02   T000241_01                  Rv0241c
                       GGTGCCGTTGACCTATCCGTTCGCGTTGACTTTTCCATCGGTGATG
1   J04   T000242_01                  Rv0242c
                       CCCGTGACAAGCTGCTGGCCAACATGGACGATGCGCGTTGGGACG
1   J06   T000243_01                  Rv0243
                       GGGTTTCTTCGACGACCTGGTCAGTCCGTTTTTAGGGCTGTACCGA
1   J08   T000244_01                  Rv0244c
                       ACCAGCCTCTACAAGGTGGGCTTGGGTTCGGTGCGCTTCTTGATG
1   J10   T000245_01                  Rv0245
                       AAAAACTGGGGACAGGTTCGCCGGTTTGGAGACGGTATCCAACGA
1   J12   T000246_01                  Rv0246
                       GAGTAAGCGTATTTTGCGTTTGATAATCGCGCAGAGCGGCTTCTAT
1   J14   T000247_01                  Rv0247c
                       AGTGCATTGAATGCTTCCTGTGCCAAAACGTCTGCCACGTAGTTCG
1   J16   T000248_01                  Rv0248c
                       AAACGGCGATTGCCGTCGATGTATCACCAGTTCAAAGAGCTCGCTG
1   J18   T000249_01                  Rv0249c
                       GGCGCTCACCGATTTCTACATCATGCTGGTGGCCAGTGGCAGCAT
1   J20   T000250_01                  Rv0250c
                       ACCGGATCCTCACCGACATCGAATTGCTCGACACCGACGTCTCTGA
1   J22   T000251_01                  Rv0251c
                       CGGTGGTCCGTTTGGAACTGCCCGGCATTGACGTCGACAAGGACG
1   J24   T000252_01                  Rv0252
                       CAGGATTCGGTGCAGCTGGCCATCGACCTGGAACTGCGTTATCGC
1   L02   T000253_01                  Rv0253
                       CCTGCGCATACGACCATCTCATTCCGGGACGTGGTGTCGGGGTGT
1   L04   T000254_01                  Rv0254c
                       CAACCGACGCGTGGCAGCCGTCTGCGATGAGGTACATCTGGTCAT
1   L06   T000255_01                  Rv0255c
                       ATTGGGTCTTGAGCCCGACTTGGATGTCGTGTTCGCTTCCGACCC
1   L08   T000256_01                  Rv0256c
                       ACATTGCGTTCGCCCTTGGCTACCCCATGGACATCGGATCTTATGT
1   L10   T000257_01                  Rv0257c
                       GTTTCTGCAGGTCAACGCCGCCTCCAATCCCGCACAGCCACGACC
1   L12   T000258_01                  Rv0258c
                       CATGTTCATCGGACCGGTCTTCAACCCGTTGCTCAAGATGCTCGGG
1   L14   T000259_01                  Rv0259c
                       ATCGTGGTGCCCGCGTTCTTGTCCCGCGGATATCATGTTCGCACC
1   L16   T000260_01                  Rv0260c
                       AAGATGATCGCGCTTCCCGACGACGATGAACTGCAGAACAACACC
1   L18   T000261_01                  Rv0261c
                       CGCTTCCCTTACACATTTGCCACCGCAAAGTTCGGGGGGCGCAAC
1   L20   T000262_01                  Rv0262c
                       CCAACCGGTCCAGTCCGTACACCCGATGACGACGGAACGGTGTTC
1   L22   T000263_01                  Rv0263c
                       TGCATACCATCTGGATGGCGTCCAACCGCAGTGACCGCGTAGGAA
1   L24   T000264_01                  Rv0264c
                       TGGCCTGCACCGTGCTCGACTACGGCGACCATGCGCTGATGCTGC
1   N02   T000265_01                  Rv0265c
                       CGGCGCCACATCTTCACTTCCAAGGAACAGGCCGGAGCCATCGCC
1   N04   T000266_01                  Rv0266c
                       GCGGTGGCGAACATGGCCAACGCGGTCAAAAAGATCTCCGTGCAA
1   N06   T000267_01                  Rv0267
                       CACTTCGGCAATATCGAACCCGCCCTGCACTTCTACGTGGCGTTCT
1   N08   T000268_01                  Rv0268c
                       GGGGGTCTACCGATGACCAGCAGTCTAGTGCCTATTAGTGAAGCC
1   N10   T000269_01                  Rv0269c
                       CGTCTTCCCCGCTCACAACGATCGAAAGGGCTACACCAAGTTCGAT
1   N12   T000270_01                  Rv0270
                       AGCACAAGGCGACATCCATGGTCGTTGTACCAGTGATGCTGTCGC
1   N14   T000271_01                  Rv0271c
                       ACAACGGCATCACCTACTTCCTGCTGGACATGAAAAGCGAAGGCG
1   N16   T000272_01                  Rv0272c
                       AGTTCAGGGCGTGGAAACAGTGGTGTTGCTTGGCAATTCAGGTGG
1   N18   T000273_01                  Rv0273c
                       GACTTCGCGCAATACTGGTCCGAAATATGCCAGATTCCAATATCGT
1   N20   T000274_01                  Rv0274
                       GACCCCGATGGGATAACTCTGGAATTCGCTTGCTGGACAAAGGAA
1   N22   T000275_01                  Rv0275c
                       CTGTCGGTGCGCTACTTCTACGAAAGCTTCACCGACAAGGACGAAT
1   N24   T000276_01                  Rv0276
                       ACGACCAGAAGGCGGCCTTTCGTCGCGCGGTGAATAAGGTTCACG
1   P02   T000277_01                  Rv0277c
                       CGCCGTGGTGAGCCTGGATAGGGATTTCGCCCGGTTTGCCTCTGT
1   P04   T000278_01                  Rv0278c
                       CATAGCAGGCAGACCTGCGACCACACGCGGCGTTGAGGGCATCAG
1   P06   T000279_01                  Rv0279c
                       TACTAGGTCGAGACGGATTCAACGCCCCCGCCAGCACGCCACTGC
1   P08   T000280_01                  Rv0280
                       GGCATTTCAGTTCTACTTTGAGCTTCTATTGTTCGACTACCCGACCC
1   P10   T000281_01                  Rv0281
                       TTGCGGGACAGTGGTTTCGATGCGGCTGCACCGTCGGCATGGATT
1   P12   T000282_01                  Rv0282
                       AGATGGCCGAACAGCGAGACAGCGTCTTCGAACAGTCCGCGCTGC
1   P14   T000283_01                  Rv0283
                       TCACGGGGTTGATCGGCTCCTTCGTATTCTCGTTGATTCGGCCCAA
1   P16   T000284_01                  Rv0284
                       GGCTGATGATCGGCATGACCGGTTCGGGCAAGTCGCAGACTTTGA
1   P18   T000285_01                  Rv0285
                       TTCAGTGCACAGGGCGTCGAGCACGCGGTCGTCACCGCCGAAGG
1   P20   T000286_01                  Rv0286
                       GATCCCATTGGTAACTCGATCAAGATCATCATCGCCTTCCTCACGA
1   P22   T000287_01                  Rv0287
                       AGTCAACACCTTGTTGGATGTCGCGCAGGCGAATCTGGGTGAGGC
1   P24   T000288_01                  Rv0288
                       TGGAACCAGGCCATGGAAGATTTGGTGCGGGCCTATCATGCGATG
1   B01   T000289_01                  Rv0289
                       ATGGGGCTGTTATCGCCGCAGGGTGTTATCAACCCTGCGGTCGCC
1   B03   T000290_01                  Rv0290
                       GCTGGATGTTTCGCTGATCCCCGTCATGGCCTACCTGGTCGGATT
1   B05   T000291_01                  Rv0291
                       ACGATGCTGAATCTGCCTGCGGCTTGGCAGTTTTCCCGGGGTGAG
1   B07   T000292_01                  Rv0292
                       GATTCTCGCGAGACGTGGCGCGGAATGCGGCACACCGACTCGGAT
1   B09   T000293_01                  Rv0293c
                       AGCTGTTCGACGAATGGTTTCCGGCCAATAAGCTCGTCAAGCTAGG
1   B11   T000294_01                  Rv0294
                       TTCGTGTGGGCGCGGTGGTCCAATCTCCGGCGTATTACGCGGAGC
1   B13   T000295_01                  Rv0295c
                       CGCGACGTCATTGGCAACGAACCGGTTTTCGTGCACGTCCACCGG
1   B15   T000296_01                  Rv0296c
                       ACCGCAATTGCTATCCGAATCGGGTTGGTACTCAGCTCTTTTCGGT
1   B17   T000297_01                  Rv0297
                       TTTGTGATCGCACAACCGGAGATGATCGCGGCGGCGGCCGGTGAG
1   B19   T000298_01                  Rv0298
                       CTGCGCAACGAGCACCTGCGTGTCGCTCTGCGCGATTACACGGCT
1   B21   T000299_01                  Rv0299
                       CGATGGTGGTGGCGGTCGAGCAACCCAACGGCACGCTGCTGCCG
1   B23   T000300_01                  Rv0300
                       GAGTGATGTACTGATTCGGGACATCCCCGACGACGTGTTAGCAAG
1   D01   T000301_01                  Rv0301
                       ATAGCGCGACGGGAGTTTCGTGAACCGCCGCTGTCTGCGATGCCC
1   D03   T000302_01                  Rv0302
                       CGACATCCGCGACGCGTGCGGGCTAGCACCCAGCTCTATTTACTG
1   D05   T000303_01                  Rv0303
                       GTCCTACGATCGGGCAAAGGCGCTCGACCTCTGGGAGACCAGTGA
1   D07   T000304_01                  Rv0304c
                       CACAACGATCACCATTCCCGAAATCCCCTACCGCTACGACTTGAGT
1   D09   T000305_01                  Rv0305c
                       CACGGACATCGTATACAGCGGGCTCGATCTTCCACCGAACACAGC
1   D11   T000306_01                  Rv0306
                       GGAATTCGTCTCCGAAAACCGATGGAGTTATCCGTCGGCGCTGGC
1   D13   T000307_01                  Rv0307c
                       TCGATCTCGATGTCGCCGATGTCGACCCGAAGTTCAGCGGCCAGC
1   D15   T000308_01                  Rv0308
                       AACCGCGGTGTATGCCGTCATGTGGGTGGGGCACTCCCAGGATTG
1   D17   T000309_01                  Rv0309
                       AATAGCCCCACCTTTAACTCCATGCAGGTCTGTCAGAAGTCCCAGT
1   D19   T000310_01                  Rv0310c
                       TATCTGCGGGCATTGGACACCAAGCATTGGGACGACTTCACCGAC
1   D21   T000311_01                  Rv0311
                       GGTCTGCCTGCAAATGCACCTGCTGAATCTGTCGTTCGCCATTGCC
1   D23   T000312_01                  Rv0312
                       TGACGACCACTTCGACGATTCCAACGATTCCGACGACTACGACGAC
1   F01   T000313_01                  Rv0313
                       GTTTGGATTCGATCCCGACGAATTCGATCGGGTGATCCGGGAGGG
1   F03   T000314_01                  Rv0314c
                       GGTCACGTATCACTCGGGCTCGCCGAAGATCAGCAATGCCGGCGG
1   F05   T000315_01                  Rv0315
                       GCTTTGACCGGCCCCAGTTTTTTGGGCAGTACCGCGACAGTCGAC
1   F07   T000316_01                  Rv0316
                       TGCTGGCTGGATGACCATCGAGACCACGCCGCTGAGTCCGCATCC
1   F09   T000317_01                  Rv0317c
                       ACGTCGTTCAGATTGCCCATGAACAGCATGGGGGCGTTCCAGGAG
1   F11   T000318_01                  Rv0318c
                       GCGGCCATGGATGGCCGTGATGTTCTTTGCCGGATTTCTGATCTTG
1   F13   T000319_01                  Rv0319
                       TGGCATCGAGGCAGCCATTCGGCAGTCCGCAGATATCCGCGAACC
1   F15   T000320_01                  Rv0320
                       TCTCCTCACAGATATCCGGCGGTGAAATCGGGACGGGCCTTGCTG
1   F17   T000321_01                  Rv0321
                       GTCGAAATACCAGGGTCAGCGCGGGCCCACGCCGTCGCGCTCCT
1   F19   T000322_01                  Rv0322
                       CACGTGTACGATCCAAAGGCCTTGGACAACGCCCACCGACTGTTC
1   F21   T000323_01                  Rv0323c
                       AACTCGCCGCTGCGGCACAGGTCCTGGGTGTCGATCATGTGCAAC
1   F23   T000324_01                  Rv0324
                       TATCCCGATAGCCGAACTGGCCGACCGGCTCGCCGAACTAACTGG
1   H01   T000325_01                  Rv0325
                       GCCGAAGGGAAGTCTACGTTTGGTGAAGCGGCAGCCAGAACTGCT
1   H03   T000326_01                  Rv0326
                       TTCCGCCGTGAGCTGGTAGCGCGCCTGGCTACCGGTTGGGTACTC
1   H05   T000327_01                  Rv0327c
                       CGAAGGCAACCACATCCTTGGTTTTGTCATGGGCGAGCACTCGGT
1   H07   T000328_01                  Rv0328
                       CTCGCGCGACATCGCTCGTGCGGCAGGGGTGAACATCGCGTCGA
1   H09   T000329_01                  Rv0329c
                       TTGCGACATCGCTCGAGCCCTGCGGCCCGGGGGTCGACTCGTCC
1   H11   T000330_01                  Rv0330c
                       CGATGACGATGCGATCGCTGCGACCCTCGCCGAGTTTGTCGTTCG
1   H13   T000331_01                  Rv0331
                       GTCGCTGCCCGGTGTGGAAATGGTTACTGCAACCGTCGCCCACAT
1   H15   T000332_01                  Rv0332
                       GTAGCCTCGCCAAGGTGGACTACTCGTCGGCATACCTGGAGCAGA
1   H17   T000333_01                  Rv0333
                       TTTCCGGCACGAAGACTTGGCGTCGGCGCTGGCGGCCACCGAACT
1   H19   T000334_01                  Rv0334
                       TGATCTACTACCCGCTCACCACGCTGATGATGGCTGGGATCCGAG
1   H21   T000335_01                  Rv0335c
                       ACCACAAGGAAACCAGCCGCCAGCATCTCGGATCAGCAACTTCCC
1   H23   T000336_01                  Rv0336
                       GACATCGGCTATCTGATGTTTGCCACGATTGTGTATCGCACCGACT
1   J01   T000337_01                  Rv0337c
                       AGCAACTCGTGCTCGATCTGCTGCTGTCGGAGAAGATCCTGGTCA
1   J03   T000338_01                  Rv0338c
                       CCATGTGGGGCTTCTTCATCCTGCTCACCGTCTATATCGAGGCTTA
1   J05   T000339_01                  Rv0339c
                       CTGGACACCCTGCTCATGATGTCGCTAACCCACGAGCTAGGGGTC
1   J07   T000340_01                  Rv0340
                       CGAACCCCGAGCGGTCGATCGCCGAAGCTCACCTTACCGACGTGA
1   J09   T000341_01                  Rv0341
                       ACTGCCGTGATTGAGGCCGAGGTCGGCGCTCAGGTTGGTGCTGG
1   J11   T000342_01                  Rv0342
                       GAGCGGGACAATCGAATTCGGGAACTTCAGCGGCAATTGGGTATC
1   J13   T000343_01                  Rv0343
                       TCGACCCGTTGCTAGCCGACACCCACGCCTTCGAAGAACTCCGAA
1   J15   T000344_01                  Rv0344c
                       TGCAGTGGGTGTTGGGCAATCTGGGCGCCATCCCCACCGTCAGCA
1   J17   T000345_01                  Rv0345
                       ACACCGCGGTCGGGGCGTTGCGCGACGGTGGTTGTAACGACGTT
1   J19   T000346_01                  Rv0346c
                       CGTTCGTGACCTTCTTTTCCAAGATCGGTATCGACGCGGCGGGCA
1   J21   T000347_01                  Rv0347
                       TGCGCGCTGGGTACCCGGCCTCGATGGGTATCATTTTTGGTTATCG
1   J23   T000348_01                  Rv0348
                       CGTTGTAGACAACGCTTTCGAATCCTACACAGCCGAGGACGGCGT
1   L01   T000349_01                  Rv0349
                       CATCAATCTTGAACTCATCGATTCACCAACGCTTCCGACCTGTGAG
1   L03   T000350_01                  Rv0350
                       TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
1   L05   T000351_01                  Rv0351
                       CTGGAGTCAGTCGACGACGGCACTGCGGTCGCAGATACCGCCGAA
1   L07   T000352_01                  Rv0352
                       GTCGAAAAAGACTTCTACCAGGAGCTGGGCGTCTCCTCTGATGCC
1   L09   T000353_01                  Rv0353
                       ACTTGGCCGGCATCAAGCGCATTATTGAACTGACCAGTCAGGTCGA
1   L11   T000354_01                  Rv0354c
                       GTCTGCGTGATCTACATCCCTTTCAAGGGGTGTGTAAAGCATGTCT
1   L13   T000355_01                  Rv0355c
                       ACTGAACTTTAGCCTCAACATTCCGGTCAACATCCCCATCCATCTCG
1   L15   T000356_01                  Rv0356c
                       CGAGTCACCAATACCGAGGGCCGAAAGGCGTTTGTGTGCGCGGAA
1   L17   T000357_01                  Rv0357c
                       GCGCGTGATTATGTGCTGCGACTGGAACAGCTTGCCGGAGCACCG
1   L19   T000358_01                  Rv0358
                       TTGCCTACCCATCAAGACAACCTGGACACCGTCATCGGACGGTATT
1   L21   T000359_01                  Rv0359
                       ACCCGATCCACGCGGTGTTATGGGCCGGGGTGGCGTTCCTAGCAT
1   L23   T000360_01                  Rv0360c
                       ACTCCCATGACGTCGATGGGTGATCTCTTGGGACCTGAGCCAATCC
1   N01   T000361_01                  Rv0361
                       CTCGACCCGCAGCCTCGACCTACAGTTTCGCGACGATCAGTGGAA
1   N03   T000362_01                  Rv0362
                       GTGAGCTGATGGGTGACGACCTCATCGTCGTGTCGCCGTTGACTG
1   N05   T000363_01                  Rv0363c
                       GATGAACGTCGACACCGACACCCAGTACGCGTTCACCCGCCCGAT
1   N07   T000364_01                  Rv0364
                       ACGGGAAATGGACGATAATTCTGGCTCGATTCGTGCCGATCGCGC
1   N09   T000365_01                  Rv0365c
                       TTCTCGTGGCTCAACAGCTATTACGACGACATGGCGTGGCTAGCG
1   N11   T000366_01                  Rv0366c
                       CTTGCTGCCCGGCATCGTCTTCGTCAACGCCGACGAAATCGCCAA
1   N13   T000367_01                  Rv0367c
                       TGGTGTTCAACGCCGAGATCTCCGCAGCTATCGAGGAGCGCCTGT
1   N15   T000368_01                  Rv0368c
                       GTTTTCGCGTTTTCGACGTCGCTGACTCGACTTACCTCGGTGCTGT
1   N17   T000369_01                  Rv0369c
                       GTAAGGTCAAGGTCAAGGTTGGGCCGGTCACCAGCGAGTTCAGCG
1   N19   T000370_01                  Rv0370c
                       GATACCACGCTGATCCGGCTGCAATGCTATGAAGGGCTGACGGCC
1   N21   T000371_01                  Rv0371c
                       GATCATGGTGTGCCGCTACGCCGACGGCGTCGGGCATCCATTCTG
1   N23   T000372_01                  Rv0372c
                       GCCCCGCTGATCCAGATTTACGGCGAAACCCCGATCGCCGACGCG
1   P01   T000373_01                  Rv0373c
                       TGGTTGGGTGTACGACTCGGGCGACTACGAGACCACAATGCGTAA
1   P03   T000374_01                  Rv0374c
                       ACATGACGGTAAACGGCGAGCCCGTCACCGCCGAGGTCGAACCCC
1   P05   T000375_01                  Rv0375c
                       CCGTACGAAACCGCGCTCGCCCACAACGAGGTCCTAATTGAGGTG
1   P07   T000376_01                  Rv0376c
                       TATTGCCGGACGGATCCACCATGATGCGCAGGTAGCGGGCGAGTT
1   P09   T000377_01                  Rv0377
                       GAGCTCGATCGGTTCCGACGGCTCGATCTTTCTACGGCCCTTCCTG
1   P11   T000378_01                  Rv0378
                       TGGCGATGCTGGAGCAAGCGGGTCCATAAACGGCAACGCCGGCG
1   P13   T000379_01                  Rv0379
                       GATGACATCCGCGTCGCTCGGGTCATTGAGCAGGACATGGCCGTG
1   P15   T000380_01                  Rv0380c
                       ATACGCGCCGTCACCCCTTGCACGTGGCGATCGAGAACTTCGGAC
1   P17   T000381_01                  Rv0381c
                       CTACTGGACGCGGTCCACATTAGCGCGTCGCTGTGTACGCAGGGC
1   P19   T000382_01                  Rv0382c
                       ACCTTGCACCATCGGGCGTCCGCGCTGATCGGCCGGCTAATGCGC
1   P21   T000383_01                  Rv0383c
                       GAACGGGAATCCACCGAGATACTCAAGCGCTGGACGCGCGGCGTG
1   P23   T000384_01                  Rv0384c
                       ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
2   A01   T000385_01                  Rv0385
                       AATACGGTGTGCTGCCAACCCAGTACGACACGTTGCGCCGCGCGC
2   A03   T000386_01                  Rv0386
                       TCGAGGGTGAGGTGAGCTACCGGGTGCCGTCGCTGTCACTGAGC
2   A05   T000387_01                  Rv0387c
                       ACCCTGCAGTCCTTCCTACCGCCGCCCTTCGACGCCATTCCGAAC
2   A07   T000388_01                  Rv0388c
                       GGTAATCGCGGCCAACCGCCGCACAATGCTGTCACTGGTCCAGAC
2   A09   T000389_01                  Rv0389
                       GCGCCGAGTCGGTGGTCGAGATCGAGTTTTTGGTCACCATGATCG
2   A11   T000390_01                  Rv0390
                       AGCTACGCCGGAGATATCACGCCACTTCAGGCCTGGGAGATGCTC
2   A13   T000391_01                  Rv0391
                       GCGGGCCTTCGAGGTGCTCGACAAGATGCGGCTGATCGACATCTC
2   A15   T000392_01                  Rv0392c
                       CAAACACATGGTCAAGGGCAATGACGACCCAGCCAATCGCAAGCC
2   A17   T000393_01                  Rv0393
                       CGGGCAGGTGTTTGCTGCCGGGGAAATCGACTACCACATGTTTCA
2   A19   T000394_01                  Rv0394c
                       GATGACCAGAAGGTCGAGCCGGCATCACTCATCGTGGCCACGCTT
2   A21   T000395_01                  Rv0395
                       CGTAACCCTGACAAAGGGTTTCCCAACGTCGCCCTATTGCGGCTTC
2   A23   T000396_01                  Rv0396
                       AGAGGACCGCAAGCCGCTGCTGAATGCCAAATTGCTCGTGCTCGG
2   C01   T000397_01                  Rv0397
                       AACCACCAAGCCCGCCGGATTGCCCACGTGGTCACCCAAACCGCC
2   C03   T000398_01                  Rv0398c
                       CACAGCAGCTGTTTAGCTTCGGAGATCCCACCGTCCAGGAGGTTG
2   C05   T000399_01                  Rv0399c
                       GATCAAATCTCTTCACGGCCACTGCTTTACGACCCGGGCACCAACT
2   C07   T000400_01                  Rv0400c
                       CCCCGATCAGGTCAGCTTCGGCAAGCTCAACAACACCCGGGAAGC
2   C09   T000401_01                  Rv0401
                       GGGTGATCGTGTGGCTGTGCACCATCGTGGTCGGCATGGTGTTAC
2   C11   T000402_01                  Rv0402c
                       TGCCACCCATGATATGAACGCTCATACCAGGCAGATGCGAGACAAC
2   C13   T000403_01                  Rv0403c
                       ATGCGCCCGACACCGGCAACCTCGACCCGATCATCGCGTTTTACC
2   C15   T000404_01                  Rv0404
                       GATTAGCCGGGCGGCATGCGCAAAGCAGTACGGAGCAAATAAGTT
2   C17   T000405_01                  Rv0405
                       GCCTATTCTGTAGCCGAAGTACCCGGGGATCATTTCGGAATGATGA
2   C19   T000406_01                  Rv0406c
                       CGGGCCGATTCGCAAAGCTACCGATGAGGCCCTCGAACGAGCCCA
2   C21   T000407_01                  Rv0407
                       TCAAGATCTCCTACGACCCCGACCCGGAGCTGGCATTGAACAACAC
2   C23   T000408_01                  Rv0408
                       ATCATCAAGACCGTTCCGGGCATATCCACCGTGTCCAGCATTTTCC
2   E01   T000409_01                  Rv0409
                       GGAGCGGGATTTTCGCCGTCTACGACTAGTGATCGAAACCGGGGA
2   E03   T000410_01                  Rv0410c
                       GCCGGAAAACATCATGCTGACCGAGGAACAGCTCAAGCTGATCGA
2   E05   T000411_01                  Rv0411c
                       TTCGTCAACGGCACGCTCGAACGCATCCGCAATGACGGCACCTGG
2   E07   T000412_01                  Rv0412c
                       ACGAAGCACTGACCAAAGCCATGGGACAAAGCCGCACCCAACTGC
2   E09   T000413_01                  Rv0413
                       TTGCCCAGTTGCCCGCCTGCATATTCTGAACAGGTGCGGGGCGAC
2   E11   T000414_01                  Rv0414c
                       GCTGCATCTGGGTCAACGCGACCTGCCCGTGAACGTCGCACGACA
2   E13   T000415_01                  Rv0415
                       TATGCCCTTGCCGCAGAGAGTGATTCGTGCCCGTGTGCGTGGACG
2   E15   T000416_01                  Rv0416
                       CGGGGTATCGCTGTGGCGTTGAACTTTTCGGTGCTACCACGATCG
2   E17   T000417_01                  Rv0417
                       GAATTAGTCCGGGCTGCAGAACAATTGGTGGACGACGGATTTGTG
2   E19   T000418_01                  Rv0418
                       ACAGCGGTTTTGATGTGCAAACCCCGGAGTTCTCCGCTCGCGTGT
2   E21   T000419_01                  Rv0419
                       CAACGACCCAAGTAGTCCGATCGTCTGCCACATTGACACCTATCAG
2   E23   T000420_01                  Rv0420c
                       CGGGTTTTTGGTGATGTGGGTGCACAACGATCAACATCAGGGCCA
2   G01   T000421_01                  Rv0421c
                       GTCGTCCTTACCCACGGCGCGGGCGGTAGCCGCGAATCCACACTG
2   G03   T000422_01                  Rv0422c
                       CATCCATGCACGGAGACCCGCTGTTGGCACCGTCTGCCCTGGATT
2   G05   T000423_01                  Rv0423c
                       CGGAATGGCCGAAAAGTCACGTGAATTCGCAGAGCACGGCAATCG
2   G07   T000424_01                  Rv0424c
                       ACATATCTTGGCAAATAACCACCACAACCGGGTCCTCGAGGAACTC
2   G09   T000425_01                  Rv0425c
                       CGCCGACGCGCCACAGCACGGCGTAAAGCTCCAGTAAAGGCACCG
2   G11   T000426_01                  Rv0426c
                       GTGCCCGACAAGCCGGCTGCCGCAAAGGAAGCGCCAGCCAAAGC
2   G13   T000427_01                  Rv0427c
                       TCCGAACCCGAGCGCAAGGCGTTCAACGCCATTGTCGACGCGCAA
2   G15   T000428_01                  Rv0428c
                       ATCTCGGCACACACGAACACCATCACAGAAATCAGCGCATGGTATG
2   G17   T000429_01                  Rv0429c
                       CGCCCGCCGACGCGGTGTGGTCATCAATCCGGTGCTTGAGACCTC
2   G19   T000430_01                  Rv0430
                       GTTCGAACGTCAGTGGTGGAAGTTTGCCGGTGTCAAGGAAGAAGC
2   G21   T000431_01                  Rv0431
                       GTGCTGTTGTTTCTCGGCGTCGTCTTCCTGCTGCTCGTCTGGCAG
2   G23   T000432_01                  Rv0432
                       GCCAACATTCCGCCAGAACGCTACGTCCAGGTCAATGGGACTCCG
2   I01   T000433_01                  Rv0433
                       GGCGGAGTTCGAAGGTTTCGTGTACGACCAGAAGAAGACCGGCAT
2   I03   T000434_01                  Rv0434
                       TCGATTGGTCCGCTTGGGTGACGCGCTGGACTCGGTGGCCGCGA
2   I05   T000435_01                  Rv0435c
                       CCAAGCTCACCGAATGGCTCAAGCTTGCCCTCGATGAGCCGCACC
2   I07   T000436_01                  Rv0436c
                       AGTCCTGGCCCCCTACTTGTTGATCTGGGTGATCATCATCGCCTAC
2   I09   T000437_01                  Rv0437c
                       CCACCGGCCGAACTCAGCATGGGTGACACGCCGTTACCGCGAGTC
2   I11   T000438_01                  Rv0438c
                       CAATGGATGGCTATGCGGTGCGCGCCGAAGACACCTCAGGTGCCA
2   I13   T000439_01                  Rv0439c
                       ATAACGCCGGCGTGATGTGGACGCCGAAGCAGGTCACCAAGGACG
2   I15   T000440_01                  Rv0440
                       GCAACGTCGTCCTGGAAAAGAAGTGGGGTGCCCCCACGATCACCA
2   I17   T000441_01                  Rv0441c
                       AAAAAGGTAGACCTCAAACGGCTGGCCGCCGCCTTGCCCGACTAC
2   I19   T000442_01                  Rv0442c
                       TCGGCAAGAACGGCCAGATCAATCTGGGCTTCGGCAACACCGGCA
2   I21   T000443_01                  Rv0443
                       ATAAACTGACCCTGGAATACATCGCTGGCATGACCGCAGATGAGTT
2   I23   T000444_01                  Rv0444c
                       GTGGTGTTCTCCCGCGACCGCAACACAGGTCTGCTGGTGATGAAC
2   K01   T000445_01                  Rv0445c
                       ACACCAAGTCGCGGGTGTATGGACTGGTGATGCGGGTGCTGCGTG
2   K03   T000446_01                  Rv0446c
                       GCAAGGTCTTCGGATTACAGGGCCTCCTGACGTTGTTCGTCTCATT
2   K05   T000447_01                  Rv0447c
                       GGCTCTGGCGGGAACGATTTATGCAGCGGCGAGATGGGCTGGCG
2   K07   T000448_01                  Rv0448c
                       TTCAACCCGTTGAGCATCTTCTGGTGCCACGACCGCGACGGCCAA
2   K09   T000449_01                  Rv0449c
                       GATCGCCGAGATGACCTACAGCCATCCGCTGTACACACCGGAATC
2   K11   T000450_01                  Rv0450c
                       CTCTGTCTCATTTTTATCATCATGCTGATCATCACACGGGCCTTTAT
2   K13   T000451_01                  Rv0451c
                       CAAGGTCAGGGCCGAGAGGGTTTCCAACGAAGTCAACGCCTATAC
2   K15   T000452_01                  Rv0452
                       GTTTTGTGATCTGCTTGCCAATCTGCATCTGCATCTCGAGCAGGAG
2   K17   T000453_01                  Rv0453
                       CGGTGAAGGCTTTTCAGTTCCTTGTCGACCTCATCCTGTTCGACTG
2   K19   T000454_01                  Rv0454
                       AAGCAGGCAATGCACAGAATTTCGACGGTGTTCCCGAATGGGTCC
2   K21   T000455_01                  Rv0455c
                       ACGTTTGCCTGGGTCAATCACATGAAAATCTTCTTCAACAACAAGG
2   K23   T000456_01                  Rv0456c
                       CTCCGTATAGCCGCATGTGGGGAGCCTATTTGACCGGGATGTGGC
2   M01   T000457_01                  Rv0457c
                       GACTGGAAGTTCATCTCTGAATATTCGCCATACCAAAACATTTCGGC
2   M03   T000458_01                  Rv0458
                       GCTGCAGCACTACCAGCACACCAAGAACCTGCTGGTGTCCTACTCG
2   M05   T000459_01                  Rv0459
                       AGCCTACGAGTGCGGCGAACGACCGTTAGTGCGGGGTCTTGTCGT
2   M07   T000460_01                  Rv0460
                       GTTCATCCTGGCGTTGGCGCCGGGTTGGTTTGGTGTGCTGGTTGC
2   M09   T000461_01                  Rv0461
                       GGTGCTGGCGAGGTCGGCCTGAGCTTGTTCTACTGGTGGTATCAC
2   M11   T000462_01                  Rv0462
                       TGTCGACGACTACATGCGTACCAACGTGGGCCACATCTACGCTATC
2   M13   T000463_01                  Rv0463
                       GTTTGCTTTCAGTTTGCCGATTCCTCCCGTGGTGCTGACCGTGGCG
2   M15   T000464_01                  Rv0464c
                       CGGCGTCGATACCGAGTTGGTGATCCTTCGGGTCGCACACCTACG
2   M17   T000465_01                  Rv0465c
                       GCTGTGGAACGTCTACGAAACGTTTGCCAACCCGGGGAAGATCTT
2   M19   T000466_01                  Rv0466
                       TTGTTCGACCACATGAACAACGCTGTCTATTGGAGTGTGATCGAGG
2   M21   T000467_01                  Rv0467
                       GGATCAACAACGCACTGCAGCGCGCCGACCAGATCGCCAAGATCG
2   M23   T000468_01                  Rv0468
                       GCTGTTGCTGCGTATGGTTGAGGCGGGCCAGTTGGGAAAGAAATC
2   O01   T000469_01                  Rv0469
                       CGATCGAGAACTACGATGTGAACGTCATCGGTATCACGCTCAGTCG
2   O03   T000470_01                  Rv0470c
                       TGACGTTGACCCACGAACTGGTTCACTTCACCAAATTCATCCTGGC
2   O05   T000471_01                  Rv0471c
                       TCACATGCGCCGCACATCGCCAACAACCTTATGAACGATCTCTACG
2   O07   T000472_01                  Rv0472c
                       CCCACTCCTGGATGTCAGACCCGCGCATGAGCAGTGACGAACTGA
2   O09   T000473_01                  Rv0473
                       CAAGGTGCGCCGCAACCCCGATCACGAGTTGCGCCGTTCGGCTAC
2   O11   T000474_01                  Rv0474
                       GATACGGCGATCACCGAGCGTCAGAAGCAGATTCTGCTCGATATC
2   O13   T000475_01                  Rv0475
                       TGTCAACGAGTTGATCACGAACCTGCGTGAGCGTGCGGAGGAGAC
2   O15   T000476_01                  Rv0476
                       CTGTGCGTCCGGCGTGTATCTGGTCGACGTGCGGCCCAAGCTTCT
2   O17   T000477_01                  Rv0477
                       GCCGGTCGTCGACGACTCGGAGATGTTGGCTTCCGGCTGCAATCC
2   O19   T000478_01                  Rv0478
                       GTTGGTGGATGCGTGTCGTGCCGCCGAGGATGCCGGTGCCGACT
2   O21   T000479_01                  Rv0479c
                       GCTGCAGATCATCAATTTCAACACGCTCGGGTTCTCGCTGCCGAAA
2   O23   T000480_01                  Rv0480c
                       CGACCGCATTGCGGTGCTACGCAACCAGACAGACTTCGTTCAGAT
2   A02   T000481_01                  Rv0481c
                       CACCCAATTAAGCCAGCTAGTGACCATCGAACAGCGCTTCACCACG
2   A04   T000482_01                  Rv0482
                       GACCGACCATGACACCTGGAGCGTGGGATCGTTCTTCACAAACCC
2   A06   T000483_01                  Rv0483
                       CGCGCAACGTCACCCGCAACGGCATCCACGTCGTCACCGAGAAAT
2   A08   T000484_01                  Rv0484c
                       AGGTGCGGTCGAGACCGAATTTTCGCTGGTCCGCTTCGACGGCGA
2   A10   T000485_01                  Rv0485
                       GGTCCGGTCGGTCGGGACGTAATTGCTGGATCTACGTCGCTGAGC
2   A12   T000486_01                  Rv0486
                       CGAGGCGGATCGGTTGATCGTCAACACCGACGATGAAGCCAGGCA
2   A14   T000487_01                  Rv0487
                       ATTCGGACTTCAATGCGTTGTTGGAGTTGGGATTTCGGTCGTCGAT
2   A16   T000488_01                  Rv0488
                       TGATCGGCGTGGTGCAAATGTGCCTGGTGGTGACCTTTCTCAACC
2   A18   T000489_01                  Rv0489
                       TCGGCGGTGGCCCGCTCACCGAATGTCTGGCTGACGTGGTCGCC
2   A20   T000490_01                  Rv0490
                       ACCCGAGCAGGCGCGAGAGCCCGAACTGCGGTCAAACAGGTCACA
2   A22   T000491_01                  Rv0491
                       GATGTGGAGCGCCATGTCGTCTCGGTGAACGGTGACACCATCACG
2   A24   T000492_01                  Rv0492c
                       AAGTGAACCCGCAGCTGTCCATCATGGCGATGGCACTGGCCGTAG
2   C02   T000493_01                  Rv0493c
                       GCATCGACGGAAAGGATTGGCCCGCAAGTCCTTTACCGTCGCTGC
2   C04   T000494_01                  Rv0494
                       GCAGCCGATCTTGCCTACTTCCGGGTGCTCATCCACAGCACTCGC
2   C06   T000495_01                  Rv0495c
                       GCCGACGAACTCACCGAATTACTCGGGGAGAAGGCCTATGGGGAA
2   C08   T000496_01                  Rv0496
                       CCGAGGCCACCGACAGCTCGGGCAAGATCACCAAGCGCGGAGCC
2   C10   T000497_01                  Rv0497
                       CCTGGCCGTTGCCTTCGGTGCCGGGTTGTTCATCGCCTTCGACCA
2   C12   T000498_01                  Rv0498
                       TTCGGCCAATGAACGCGAATCCATGCTGGCCGAGTCGTTGCAGTT
2   C14   T000499_01                  Rv0499
                       GTGCTCTGCACCTGCGTCGAAATCGGGCAGGACTGGTTTGACGAG
2   C16   T000500_01                  Rv0500
                       CGGCCGAAAACGACAGTGCTGAGCAGGTGTTCGTCACCGTGGTAG
2   C18   T000501_01                  Rv0501
                       CCTGAGTTATGGCCGGGTTATGGACACCACCAGAATGCGCGTCGA
2   C20   T000502_01                  Rv0502
                       ACGAATTCGGGTTCGACCCGCACTTCAACAGCGCCATCGTACGAC
2   C22   T000503_01                  Rv0503c
                       CCTACGTGGCTGCTCAGACCTGTTCCGCGACAAGTACACGGACGT
2   C24   T000504_01                  Rv0504c
                       CCGCTTCCACCGGCCGATCCTGGCCAACGACAAGCTGTACTTCGA
2   E02   T000505_01                  Rv0505c
                       TCGCTGGCCATCCGGGAGGGACTCAATCTCAAACGCTGCACCGCC
2   E04   T000506_01                  Rv0506
                       CGGGGGGCTTGGTATCTATCGGCTGCACAGCATCTTCGGTGTTCA
2   E06   T000507_01                  Rv0507
                       GCACTCATGGGCGAGGTCATTGACAACACCGTCGACATGGATCAT
2   E08   T000508_01                  Rv0508
                       CGAGCACCGGCTGCGTGCGGATATAGCCCGCAGCACATTTGGTAG
2   E10   T000509_01                  Rv0509
                       TGCGGTGGCCAGATTACCGTGTGTGTGGGTCGTGGACGTGGATAG
2   E12   T000510_01                  Rv0510
                       CCGCCCCCTACGAGGCAACCTAGATACCAGGTTGAACAAGGTAAG
2   E14   T000511_01                  Rv0511
                       CCTCGCTTGGCTTGCTAGACGACTTCCCGCCCTACGACAGCGTTTT
2   E16   T000512_01                  Rv0512
                       TTGCGCAAACCTCGTTGGAGCCAAGGCATTTGGTGCTGCCGATGT
2   E18   T000513_01                  Rv0513
                       GTTGGGTTGATAACGCCGGCGATCTTTCTGGTGATGGTGTCGGCG
2   E20   T000514_01                  Rv0514
                       TGTCGGTGGTCTATCACCCGCAACCGTTGGTGCTGACCCTGCTGC
2   E22   T000515_01                  Rv0515
                       GACATCGGCTATCTGATGTTTGCCACGATTGTGTATCGCACCGACT
2   E24   T000516_01                  Rv0516c
                       TAGTCGCGAGCCCCGCAGTAGTCGAACAGCTAGGTGGCCGCTGTG
2   G02   T000517_01                  Rv0517
                       GCAGCTGTGGTTTCAGCCGTATTTCGATGGATCCAGTTGGGATGG
2   G04   T000518_01                  Rv0518
                       CGATGCACTGGTGGTGTTCTTTGGCTCCCGCAACGACCAAGGCAT
2   G06   T000519_01                  Rv0519c
                       CAATCCCGCTACGGGTGGATTGCGGCACCAGCGACCGCTTCTACT
2   G08   T000520_01                  Rv0520
                       TCTCCGAAGTGCCGAACGAGACCAACCGTAAGAAGAACCGTCAGG
2   G10   T000521_01                  Rv0521c
                       GCACCTCGAAACCGAGTGCCTGTGCGGCTTCACGCATAGAAGCGC
2   G12   T000522_01                  Rv0522
                       CATGGGTCTCACCCGCAACGGTATTCGTTTTCCTGCTCAACTCGTC
2   G14   T000523_01                  Rv0523c
                       GTTCAATCGATATGTCACCAACCCCATTCAGCGGCTATGGGCCGGC
2   G16   T000524_01                  Rv0524
                       GTTGTGCCACACCAGATTTCGCGGGCAGGCAATATGCTCAGTGTG
2   G18   T000525_01                  Rv0525
                       GGTGACGTCGTTGATCTACGACGGCGACCGCCTGGTTGACGTGGT
2   G20   T000526_01                  Rv0526
                       GTGCGCGACAACAACCGCCAGGCGCCCCAGGACTTCATCAACGAC
2   G22   T000527_01                  Rv0527
                       CGGGGTGTGGAACGACGTCGTGTCGTGGCTGCGCGACGCCTTCG
2   G24   T000528_01                  Rv0528
                       GCAAGCTGTTCGGCTACGAGGGCAACGTGATCGTGATAGCCGACG
2   I02   T000529_01                  Rv0529
                       CCTACTGGCTGCCCATTCATGTGTCGGTGGTCAGCCTCGGTTCTG
2   I04   T000530_01                  Rv0530
                       CTACAGCGACGTTCGCGGCTACACATCGAAGGGACCCAGCGGGCT
2   I06   T000531_01                  Rv0531
                       GATTTTCGGGGTCGCGCGACTGATCGGGTTGACCGAATTCCCCGT
2   I08   T000532_01                  Rv0532
                       AATCAAGGTTGCCACTGGTGGGCTGGGTGGTGATGGTGGCGATGC
2   I10   T000533_01                  Rv0533c
                       TCGCCAACGATATCGAGCACACCGGAAACACCTCGGCGGCCTCCA
2   I12   T000534_01                  Rv0534c
                       TGTGGTGGAAAGCGCTGTTGGCACTGGCTGTTGCGGTGGCGCTGG
2   I14   T000535_01                  Rv0535
                       GAGTGATCGGCGGCAGCGGCTTCTACACCTTCTTTGGGTCGGACA
2   I16   T000536_01                  Rv0536
                       CCGCTCGGCGGTTGAAAAAGGCAAGCCACCAAAGGTTTTCGAAGA
2   I18   T000537_01                  Rv0537c
                       TGCTCATCGGTGCGCTGTTTTTCCCATGGAACCTGTATTTCGGTTT
2   I20   T000538_01                  Rv0538
                       AAACCGGTAGAGGGACACCAAAACGCCCAGCCAGGGAAGTTCATG
2   I22   T000539_01                  Rv0539
                       ATCCAAGGTCAGCGGTTCGCTGCGGGGCAGCATCATCGCGATCCT
2   I24   T000540_01                  Rv0540
                       AGCCAGACACCGGCGAGCTCACCTTGAAGGCGTTGCGCGACAACG
2   K02   T000541_01                  Rv0541c
                       GCGGTGAGCTTCGCGGTTGCCGGATTCTCCTGGTTCGACGGTTAT
2   K04   T000542_01                  Rv0542c
                       TCGATGTCACCGAATTACCCAACGCGATAAAGAGATTGGGTTCTGG
2   K06   T000543_01                  Rv0543c
                       CTAACGAACTGATGCGACTCGGTGACTTCGACCAGATCGACATCGG
2   K08   T000544_01                  Rv0544c
                       GCTGTATATCGCCCGTGACTTCATCGCGCATCACACCGGCTGGGC
2   K10   T000545_01                  Rv0545c
                       TCGTGACGGCATTGGCGTTCGACTTCACCAACGGGTTCCACGACA
2   K12   T000546_01                  Rv0546c
                       TTTTTCGCCGGTCAGTCACTGCTCGAACTGGCCGGTTACGGCGAG
2   K14   T000547_01                  Rv0547c
                       CTGCGCTGGTTGACTGAACAAATCACATTGGCCGGCATGCGGCCA
2   K16   T000548_01                  Rv0548c
                       CGTCGAAGGCCGCGACGCCTTCCTACAGAAGCGTCCCCCCGACTG
2   K18   T000549_01                  Rv0549c
                       AGGTCTGGTGTTGTTGACCACCGACGAAAGATTGGCACGCGCCTG
2   K20   T000550_01                  Rv0550c
                       AAGCACCGGCGCTCGGCATGATGACGTGCTGGGTGCGATCGATGC
2   K22   T000551_01                  Rv0551c
                       GCGAAGTTCGACCCGGCCGAGGTACTCAGAATCATTGAGGAGCAA
2   K24   T000552_01                  Rv0552
                       ATTTGTTGAGGCACACGGCCATCCGCTACTGGAGGCGGTCGTGCT
2   M02   T000553_01                  Rv0553
                       GCAGCGGCGACAGTGGTGGATCGACCGGGTCAAGGCCTGCTACT
2   M04   T000554_01                  Rv0554
                       CGGGTTCTTCGAGCGGCCGGAAGCCGTCAACACCGCGATGCTGAA
2   M06   T000555_01                  Rv0555
                       TCCCAGGTTCTCCGACGTGTCATCGCGAATCTTCGGCACCCCACAC
2   M08   T000556_01                  Rv0556
                       TCCGTCCGAATTATCCACGGGCATGCGAATTTACGTTGAGTACAAC
2   M10   T000557_01                  Rv0557
                       ACGTCTTCGTACATTCCGGTGAGCACGAGACGTTCTGCCAAGTCGT
2   M12   T000558_01                  Rv0558
                       CGTGGCGTCGATGTTCGATGGCGTCGCCCGCAAGTATGACCTGAC
2   M14   T000559_01                  Rv0559c
                       GATCTACGGCCCGCAGGACTACAACGCTTGGCTTGCCAAGATCAG
2   M16   T000560_01                  Rv0560c
                       ACTGTGTTGACATATATCAGGGCCGTTGATATATATGAACACATGAC
2   M18   T000561_01                  Rv0561c
                       CGCATGCTACTTGGCGCTAAAGCCGTTGCTGTTCACCATGATTCAT
2   M20   T000562_01                  Rv0562
                       AGCAACTCATGGACACCGAGCTGCGCCAGGCCGACGAGGTGATGA
2   M22   T000563_01                  Rv0563
                       TACGTCTACTTCAATAGCGACAAGCTGGCGCTGCGGGCGATGCAT
2   M24   T000564_01                  Rv0564c
                       CCCTGGGTGCCAGTGGTGTCCCTGGTCAAGGGGCTCGAACAGGG
2   O02   T000565_01                  Rv0565c
                       GAAATGGCTGCTGCGCCGTACCGCGATCAAAAATCTGCCCGAGGG
2   O04   T000566_01                  Rv0566c
                       AGAAGATCACCAAGCTCATCCGCGACGCAGGCCCCAAGAACGTCA
2   O06   T000567_01                  Rv0567
                       AACCTCGACCGTAAACAGCAGTTGGTCGCTAAGGCCTACGAGGCC
2   O08   T000568_01                  Rv0568
                       CCGATGGCTAAGGCGTTCGCGGTGGCGCCCAAGATGTCTGAGATC
2   O10   T000569_01                  Rv0569
                       AGATCAACCGGACCACCGAGGGTTGATTATTGAGGTGCGCTCATC
2   O12   T000570_01                  Rv0570
                       TGGGACTGCTCGCCGGCTGTTTTGTTCTGCCGATTGAGGATTCGC
2   O14   T000571_01                  Rv0571c
                       ATTGTGGTTTTCGCACATGGCAGTGGCAGCAGCCGGCACAGTATC
2   O16   T000572_01                  Rv0572c
                       GTTGAGTACGACGCCGACGACCGCACATATGTCGTGCAGCTCACC
2   O18   T000573_01                  Rv0573c
                       GCCGAAAGAATGTCGGGCACAGCGGTTTTCGAGATATTCTTCCGCA
2   O20   T000574_01                  Rv0574c
                       ACACCGCGACCGACGTCTGTTTGATCAATCTGGAGACGACGATCAC
2   O22   T000575_01                  Rv0575c
                       GTTCTTGTTCGTCTTCCGCGCCGAACACGACAACCCCGGCGTGGC
2   O24   T000576_01                  Rv0576
                       GTACGGAATATGACGTTTCGCAACTGGCGGATCATTTGCTGCGCTC
2   B02   T000577_01                  Rv0577
                       CGAGACGGGCACGCTCATCTGGAACGAACTGCTCACGGACAAGCC
2   B04   T000578_01                  Rv0578c
                       TGTCGTTCGTAATCGCGACGCCGGAGATGCTGACCACGGCGGCAA
2   B06   T000579_01                  Rv0579
                       CCGCAGCCATCAGACGGTCAAAGATGTGCTGGAGGCGATGGGCAT
2   B08   T000580_01                  Rv0580c
                       TTTCTGAACTTTTCCTGCGCGCCGCACAGGCCTATGGCGTCAAGCG
2   B10   T000581_01                  Rv0581
                       ATGAACTCAAGGCGGCCGTGAAGCGCGCCGCTCGGCAGCGCGGA
2   B12   T000582_01                  Rv0582
                       CAGACGCGCTCGTCGTATCCCCTTATGTGGTAGCGGAACTCGACT
2   B14   T000583_01                  Rv0583c
                       CATACAGCAAGAACGGCAAGTTGCGGACCGTCGCGCAGAAGACGG
2   B16   T000584_01                  Rv0584
                       GCCTCGGTCACGCTGGAGTGGTCGGTCGATGACTTTGCCATCTCC
2   B18   T000585_01                  Rv0585c
                       CATCGCGAAGACTTACCAAATCCGCTGTGCCAAAACGAATCCGAGA
2   B20   T000586_01                  Rv0586
                       CTCGACTTTTGGGATCATGTGGTCGACAGCGCCGGTTCGATCGTA
2   B22   T000587_01                  Rv0587
                       GGTCACCGGTCTACCCGAGGTGATCATCTCGGTGGTCAAGTCGGC
2   B24   T000588_01                  Rv0588
                       CTCTCGACATGGCTTTCACCTCTGGTCAGGTGGTCACAACCGTGTT
2   D02   T000589_01                  Rv0589
                       GGCAACAAGTATGTTGCGCTGTCCGCGCCGAAAATTCCTCAACAGC
2   D04   T000590_01                  Rv0590
                       TGATCGACGGGGACAAGCAAGTATTGGTGGACTTCACCGTGGATC
2   D06   T000591_01                  Rv0591
                       TTGCGCAAAGCTTCACCAGCGTGCCGATGCTGTTCGCCACACCTAC
2   D08   T000592_01                  Rv0592
                       TGCACGTGTTGCCGACCTACGCCAGCAACTTCAACAACCTTTACTA
2   D10   T000593_01                  Rv0593
                       CGGCATCGTCAACCTCGACGTGATTCAAACCGAGATCCTCAACATC
2   D12   T000594_01                  Rv0594
                       CAAGGGCACCTACTGCAGGATTCCGATGGACGCGAGCAATGTGGT
2   D14   T000595_01                  Rv0595c
                       CGGTCTCCGAAGCATGGGCATTACTGGTGTCCAAGCTGCGCGCCG
2   D16   T000596_01                  Rv0596c
                       CGATACCACCAATCTGGGCGAGGAGCTGCGAGAGACGCTGACGCA
2   D18   T000597_01                  Rv0597c
                       CGCTACTGGAGACTTTCGTGGCGAACGAGATTCGCAAACAGCTCA
2   D20   T000598_01                  Rv0598c
                       GCTTCTTACCGAACGCTTTGCGGCACCGCTGTTGTTGAGTTCCCGC
2   D22   T000599_01                  Rv0599c
                       TGCAACCGGGGTCCACCGTGGAAATATCCCGCTATGGCGCTGGTC
2   D24   T000600_01                  Rv0600c
                       GGAGCTTCCGCGGATCACGTCATCAGATACAAAGGACCCGAATCG
2   F02   T000601_01                  Rv0601c
                       TCGCTTGGCTAGCAACGACTCTCAACACCATGCTCACCCGACTGCA
2   F04   T000602_01                  Rv0602c
                       TACATCCGCTACCTGCGCGACAAGATCGACCGGCCCTTCGGCGTC
2   F06   T000603_01                  Rv0603
                       TGTCGAGGTCCACCTGGACCGGGATTTCCGGGTTCTGGACACCGA
2   F08   T000604_01                  Rv0604
                       GCAAGCTGAACGATGGCAGCGTCTACAAAATCGGGTTTGCGCGCT
2   F10   T000605_01                  Rv0605
                       GTGCTGCGCGATCTGTCGGTCACGCGGATTGTGGTTGAGCATCGG
2   F12   T000606_01                  Rv0606
                       GCGTACTGGAACTGGCAGCAGAGGCGTGCTGGCAAGCGCGACGG
2   F14   T000607_01                  Rv0607
                       CGCCCGGGAGTGGCTCCGTGACAGGATATTTCAGCGCTTCTCGGA
2   F16   T000608_01                  Rv0608
                       GTTGAACATCAAAGATCCGTCGGTTCACCAGGCGGTCAAGCAGATC
2   F18   T000609_01                  Rv0609
                       CTTGACTCCCAGCGTGATCCGGTCATCAGCAGAGCACTGGATGAA
2   F20   T000610_01                  Rv0610c
                       CGAATATTCCGGCCTGGAACTGGTTCGCGACATCGCTCCGCTCGT
2   F22   T000611_01                  Rv0611c
                       GTACGCAGAACACGATGTTGTGGTGCTAACACGGGATGTTCCCGA
2   F24   T000612_01                  Rv0612
                       CAAAATAAAGCCGCCGGCCGATCCGGACATCGTGGGTTGGGAGGT
2   H02   T000613_01                  Rv0613c
                       GCGGTCGCGCTGTACACGCTGATCAAACTGCACGAGACGATGTCG
2   H04   T000614_01                  Rv0614
                       GCGATATCCGCCAGCGCGCCATACAGCTGGTCGTGTCCGAACAAG
2   H06   T000615_01                  Rv0615
                       GGCAAACATTGATGGCCATCTCGGTGGCCTTCCTTGTGGCGCTGG
2   H08   T000616_01                  Rv0616c
                       ATCCTAACATCGCTGCATCGTGATGCGCGCGCCGACGCTCACCGG
2   H10   T000617_01                  Rv0617
                       TGTCGTCAGTGCGGTCCAGTGCACGAGCCGCCACGAATTCTGGCC
2   H12   T000618_01                  Rv0618
                       GAACCGTGGTGAGGAGATCGGGGTGACCCTGCCCACCCGCACGG
2   H14   T000619_01                  Rv0619
                       GACGGGGAGTTGGATGAGTTCGCCCGGATCTATCTGGACGTGCTG
2   H16   T000620_01                  Rv0620
                       CTGCTGACCGCGTCGCATGAGTCCATGCGCGAGGACTTCGCCATC
2   H18   T000621_01                  Rv0621
                       GTCGAACCCTGGTCTTTCCGCCCGGAATGTATTGGCGAACGCCCG
2   H20   T000622_01                  Rv0622
                       CCCGCAGTTCAGCGATGGCTTCCATATCCTGGAAACCATAACTGTC
2   H22   T000623_01                  Rv0623
                       AGCGTTGCCGGTGGTCGACAACCGGTCCGCTGAGGCGATTCTCGG
2   H24   T000624_01                  Rv0624
                       CGGCCAGCCACTCCTGTTCAAGGGCGAAGATTTCCAACACACCGA
2   J02   T000625_01                  Rv0625c
                       TCGGCCAACGCTTTGTCCCCGGCATATCGGATGCGTTCGCCTCCT
2   J04   T000626_01                  Rv0626
                       TTGGCTGAGCAAAACGGAGTTCCTGTCGCGGTTGCGCGGCGCTCA
2   J06   T000627_01                  Rv0627
                       GGAATCCGTTGCCGATATGGAAACGTTGCCCGTCGACGACGATGC
2   J08   T000628_01                  Rv0628c
                       CGGACCCGTACTCGTTCCCGTCGAATCTGCTCATCGAGCACCTCAA
2   J10   T000629_01                  Rv0629c
                       TCGCCAGGATCGCCAGAACCGGTTGCCTCACAACGTGATCGTGGT
2   J12   T000630_01                  Rv0630c
                       CCGCCGACGTGGAGCTCAAGGAGAGCCTTACCGACCTGGTCACTG
2   J14   T000631_01                  Rv0631c
                       TGACATCCGTTCGGAGGACCGGCAATTGCTGCTGGACGCGATAGG
2   J16   T000632_01                  Rv0632c
                       TCCAGGCCAATGAGGTCGCGATCGGCATGACCATTCCGTACGCGG
2   J18   T000633_01                  Rv0633c
                       AAAGCAGAAGCTGGAGCTGTTACGTAGTCTGTTGACGTATTTTCAC
2   J20   T000634_01                  Rv0634c
                       GCGTCGGCGACATCGACATCGAGCTGCTGCACACACCCGGGCATA
2   J22   T000635_01                  Rv0635
                       GGTAGACCAAGTGCTGAAATTCGAGAAACCGATCGTGGCGGGCGA
2   J24   T000636_01                  Rv0636
                       TTCAACGGTCGGGTGAAATCGGTTGATCCTGAGAGCAAGTCGGTG
2   L02   T000637_01                  Rv0637
                       CGGTGGACGAGCGGTTCGGCGCAGACATCGTCGTTACCAGAAACC
2   L04   T000638_01                  Rv0638
                       AACCGCAAACAAATGCTTACCTACACGTCGGTGGTGCTGGCGTTTC
2   L06   T000639_01                  Rv0639
                       ACATTGCCGGCCACGATCAGCGAGGTCAACGCCGAACAGCAGAAA
2   L08   T000640_01                  Rv0640
                       AACGTCATCCCGGTGGAGATCACCGTTTATGAAGACCGTAGCTTCA
2   L10   T000641_01                  Rv0641
                       CCGGGTTGACAAGCAGGCCAACCTGCACTTCGTCATCGGGAAAGC
2   L12   T000642_01                  Rv0642c
                       GGATCTGGGGGGACACGCTGCAGTCCAATAAGGACAAGGCCATCG
2   L14   T000643_01                  Rv0643c
                       TCAACGGGCACCACAAAGTCTCGGTCCAATGTCGACGACGTCCAA
2   L16   T000644_01                  Rv0644c
                       ATCTTCCCGGGGGGCCAACCTCCGACGATTGAAATGGTTGAGGAA
2   L18   T000645_01                  Rv0645c
                       CCGTGGAGAAGTACGACGTCAATGTCATCGGCCTCACGCTCAGCC
2   L20   T000646_01                  Rv0646c
                       CGATTCCCGAAGACCAGGTACGAGCCGAGGCCGCCGAAAGCTACG
2   L22   T000647_01                  Rv0647c
                       AGCTGCCCCGCGAGCTGGTGCTGATCGGCAAGCAGTTCCTGTACG
2   L24   T000648_01                  Rv0648
                       ACACCAACCTCACCAGCCCGGAGACCACCATCCGAAACCTGGTGC
2   N02   T000649_01                  Rv0649
                       AGCGAGGGACGCCAACTGCGGCGCTGGCTCACCCAACTGATCGTG
2   N04   T000650_01                  Rv0650
                       GTCCTATCGACCTACACAGCGGCCGCGTCAGCCCGATCAACATCG
2   N06   T000651_01                  Rv0651
                       GCCAAGGCCATCAAGACCTTCGCCAAGGAGCACAAGGCGCTGGTC
2   N08   T000652_01                  Rv0652
                       ACTGCTGGACGCGTTCAAGGAAATGACCCTGTTGGAGCTCTCCGA
2   N10   T000653_01                  Rv0653c
                       GGCAATAGTTGCCACCGCGGCGCAGTTTTGGTCACAGATCCACGG
2   N12   T000654_01                  Rv0654
                       GGTTGAGGCCGGCGTGGTCAACTACGAACTCACCGATGAGCTGGA
2   N14   T000655_01                  Rv0655
                       CTCTACGACAACACCGCGTTCCCCCTGCGTGAGCACACCAAGAAA
2   N16   T000656_01                  Rv0656c
                       GCGGACGAGTTCGACCAGATGAGCCGGATGTTTGGTGACGTCTAC
2   N18   T000657_01                  Rv0657c
                       CTGGCCGATGTGATGCGCATCGCCGCCGTGCACACAAAGAAGGAA
2   N20   T000658_01                  Rv0658c
                       CTGGTCACGATTCCGGCGTCGCTGGTCTACACCGCTATCGTTGGG
2   N22   T000659_01                  Rv0659c
                       CGGAATTGGAGCTCACGGCCGTCGAAAACCGTGTTCCGAGCGACT
2   N24   T000660_01                  Rv0660c
                       AGGATGTCCAGGCCTACACCGAGCGACCGTTGACGGACGACGAGA
2   P02   T000661_01                  Rv0661c
                       CCGCTACTCACCATCAATCGAGGCCACCTCGAAGCGCGGCCTGAC
2   P04   T000662_01                  Rv0662c
                       GGGCCGTCCGCGGGTCAACGCGACCGCAATGGCAGCCGCCGCCC
2   P06   T000663_01                  Rv0663
                       AACACCCAGGTGCTGTTTTCGAACATGGGCCGGTTGTCGGAGAAC
2   P08   T000664_01                  Rv0664
                       TGCGAAATCGCACAAGTCAGGTGGTCGATGCGGTCAAGGCCGGGG
2   P10   T000665_01                  Rv0665
                       GCAATCGCGGACCTGCCTGAACGCGTGGCGCTTTCGGTTATGACG
2   P12   T000666_01                  Rv0666
                       ACGATGCCCGTGAAGCGTGGTGATGCCCGGGGAGCTTTGGGTGTG
2   P14   T000667_01                  Rv0667
                       TGCTGCTCAAAGAACTGCAGTCGCTGTGCCTCAACGTCGAGGTGC
2   P16   T000668_01                  Rv0668
                       TCTACAAGATCACCATCGTTCCTGACGACGGCGGTGAGGAAGTGG
2   P18   T000669_01                  Rv0669c
                       CATGCAAAACGTGAATGAGGAAGTGCTGCGCCGGTTGGCCGATTT
2   P20   T000670_01                  Rv0670
                       AAGCCGCGACCCTGCCCATCTACGTGCATGCGCCCTACCTGATCA
2   P22   T000671_01                  Rv0671
                       TACGTCACGGGCATGAGCAACGGTGCCATCATGTCCTACACGCTG
2   P24   T000672_01                  Rv0672
                       GCTGGGCGATCTTGACACGATCGGTTATCGAGCCCGCAAGATTGC
2   B01   T000673_01                  Rv0673
                       CGGTCGATTTCGACAACCTGAAGACGATGACCTATGAGGTCACCG
2   B03   T000674_01                  Rv0674
                       TCCCGCGTGGGCCACCGCAAGCGAATTGATCCAGCTGACAGCGGA
2   B05   T000675_01                  Rv0675
                       GAACCTTTTGTGCGGGAGCCGATTTGAAGGCCTTTGGCACACCGG
2   B07   T000676_01                  Rv0676c
                       TTGATGATCGCCGGAATCTCCGCACTCTGCCTGATCTTCATCATCA
2   B09   T000677_01                  Rv0677c
                       AAGGTGGTGGAGTACGAAGTTTCCGGCTCCGGTAGTTACGTCAAC
2   B11   T000678_01                  Rv0678
                       TGGGCGCCGAGCCCGACATCATGGAATTCGTCGAACAGATGGGCG
2   B13   T000679_01                  Rv0679c
                       GGTCACCTACAAAAACGGTGACCCCACAATCGATAACCTCGGCGC
2   B15   T000680_01                  Rv0680c
                       TGGTGATCCGTTCATCTGGGACCGTGGCCGGGAACTAGGAATGGT
2   B17   T000681_01                  Rv0681
                       CTTTCTACGCGGCGCTCGAGTTTTGGTCGGCACTGCATGGGTTTG
2   B19   T000682_01                  Rv0682
                       CGCGTGTACACCACCACTCCGAAGAAGCCGAACTCGGCGCTTCGG
2   B21   T000683_01                  Rv0683
                       TACGGATCGCAGTTGGTCACCCAGTTGGTGAACAAGGTTCTGTTGA
2   B23   T000684_01                  Rv0684
                       TCATCAATGCCACCAAGGGCAAGAAAGAACGGCTGGGCAAGCTGT
2   D01   T000685_01                  Rv0685
                       CAAGACCACCCTGACCGCGGCTATCACCAAGGTCCTGCACGACAA
2   D03   T000686_01                  Rv0686
                       CCCAATTCACCGTCGCCGAAGACAACAAGACCTACGACTTGAGTGG
2   D05   T000687_01                  Rv0687
                       TCGCCAAGCATCCCGGATATGTGCATAGCTTTCCACCAATGCCGTT
2   D07   T000688_01                  Rv0688
                       CTCGGGACCGATGTGCCCACGGGCGTGGTCGTCCCGTATTTCTGG
2   D09   T000689_01                  Rv0689c
                       CAGACGATATGTCCGCCGAATGCGCCGACGACCAGGGCGCCCGC
2   D11   T000690_01                  Rv0690c
                       GGCGTTGATCGGTGGACTTCTCATCGCCTGCCTCCAATTCGACTTG
2   D13   T000691_01                  Rv0691c
                       ATCCCCTGGGGTGACTTCAGCACCCACCTTGCACAGCTACAAGGT
2   D15   T000692_01                  Rv0692
                       GGAGCCTTTTGGCGCGCTGCTCTATCACTTCGGCACCCGTAAGTTG
2   D17   T000693_01                  Rv0693
                       CAATGCAAGGACATCATCGACGAACTGGAACGCATGCAGGTGTTCT
2   D19   T000694_01                  Rv0694
                       CGGGTCGACGATGCCAAAAGAGCTGTGGATGCCGGGGTTTCGGCG
2   D21   T000695_01                  Rv0695
                       CGATCTCTATCGGCACTGAAGCCCTGACGATGTTGCTCGTGGAGT
2   D23   T000696_01                  Rv0696
                       GTTCGGCGTGCCCGGTCGAGTCGGACGACTTTGTCGGCGCACATT
2   F01   T000697_01                  Rv0697
                       CACTGAAAGTTTCATGGCTGCCGCAGAGGACGCAGGGTTCGCTTG
2   F03   T000698_01                  Rv0698
                       TGGATTGGTGCAAGCAACCTTCATCATCGAAAACCTTGACCCCGGC
2   F05   T000699_01                  Rv0699
                       AGTTGGGCGAGTGATCGTTGCATCCGCTGTCGGGCGGCGATTCTG
2   F07   T000700_01                  Rv0700
                       AGAACGTGTATTGCGTCATCCGCTCACCGCATAAGTACAAGGACTC
2   F09   T000701_01                  Rv0701
                       GTATGACGCAGGTATTCGACGAAAGCAACAGAGTAGTACCGGTGA
2   F11   T000702_01                  Rv0702
                       GAGCTAGTGGAAGGTCAAAACCCGTCGACCAAGAGCGCCAGGGCA
2   F13   T000703_01                  Rv0703
                       GTACACGTTTTTGGTGCGCCCGGATTCCAACAAGACGCAGATCAAG
2   F15   T000704_01                  Rv0704
                       ATTGCGTTGCTCCACTATCTCGATGGGGAGAAGCGCTACATCATTG
2   F17   T000705_01                  Rv0705
                       TGGTGAGTTCGCGCCGACACGCACCTTCAAGGGCCACATTAAAGA
2   F19   T000706_01                  Rv0706
                       GAAAGCGCCCGCCAAGAAGGCGCCCGCCAAGGCTTCTGAGACTTC
2   F21   T000707_01                  Rv0707
                       CCTGGAGGTCAAAAACCCGGAGTCGCAAGCGCAATTAGTGGCCCA
2   F23   T000708_01                  Rv0708
                       GCGCGTATCGCCATCAACCGGCACATCAAGCGTGGCGGCAAGGTT
2   H01   T000709_01                  Rv0709
                       TGCGCGAGTCCAAGGAAGAGTTGTTCAACTTGCGTTTCCAGATGGC
2   H03   T000710_01                  Rv0710
                       GCATGCGGCACCCGCTATACGGCAAGATCATCCGGACCACTAAGA
2   H05   T000711_01                  Rv0711
                       CGTCGACGTGTCAGGCCGACCGTTCGAAGATGTGGAATCCGATCT
2   H07   T000712_01                  Rv0712
                       CTCGACATGATCGGAAACGTTTGGGAGTGGACCACCACCGAGTTC
2   H09   T000713_01                  Rv0713
                       CACAAACACATGTCGCGGCGAAAGCACCTCGTGCTCGATGTCTGC
2   H11   T000714_01                  Rv0714
                       ACCGGTCGGTCGCGAGCTGCGGGAGAAGCGGTTTATGAAGATCAT
2   H13   T000715_01                  Rv0715
                       AAAGGGGCCAAGGGCAAAGTCTTGCAGGCGTATCCGGACCGCAAC
2   H15   T000716_01                  Rv0716
                       GCCACGCATCCGTGACTTCCGTGGGCTTTCGCCCAAACAGTTCGA
2   H17   T000717_01                  Rv0717
                       AAGGCACTGGTCAACAAGGCCGCAGGCAAACCGAGGTTTGCCGTG
2   H19   T000718_01                  Rv0718
                       TGCCGCACTCCAAGCTCAAGGCCAACATCGCGCAGATTCTCAAGAA
2   H21   T000719_01                  Rv0719
                       TCTCGGTTAAGGGGCCCAAGGGCACCCTAGGACTGACGGTCGCCG
2   H23   T000720_01                  Rv0720
                       ATCCACGTGCAACTGGTGAACGACCTCAACGGCACCACCGTGGCC
2   J01   T000721_01                  Rv0721
                       CATCAACCGCGTCTCCAAGGTGGTCAAGGGTGGTCGGCGCTTCAG
2   J03   T000722_01                  Rv0722
                       GGCTTACGAAGGATTCGTCATTCGGTGATCCGCGAAGACAACGCA
2   J05   T000723_01                  Rv0723
                       ATGCGGCTGCCCAAGCTCAAGGGCTTCCGTAACCGGTTTCGCACC
2   J07   T000724_01                  Rv0724
                       TTCGCGACCAAGCCTACGCCCGTATGGCGGAATTGGTTGGTGTGG
2   J09   T000725_01                  Rv0725c
                       GAAATGGCGGATTCGTTTCGCAAGCACGGCGTGGACATCGACATG
2   J11   T000726_01                  Rv0726c
                       TCAGTGTGCCGGACAGCAGGTTTGCAACCGAGAGCATACGCAACT
2   J13   T000727_01                  Rv0727c
                       AACCTACACCTGGCGTGCTATCGCGCATTCGACGACATTGGCAGC
2   J15   T000728_01                  Rv0728c
                       TGGACCACTTCACCGGTGAATGGCTGCCGACCGATCACCCTTTGG
2   J17   T000729_01                  Rv0729
                       AAGAGCCAGATCGGAGGGGCCAGCAACGCTGGTGGGTTGTTCCTC
2   J19   T000730_01                  Rv0730
                       GCAAGAACTGGTGTGTCGTTCTACGCTTATGCAATGACAGATCACG
2   J21   T000731_01                  Rv0731c
                       CTGCGGCGGTTCGCCGACGCGATGGCCATTCGCACTCACTACTTC
2   J23   T000732_01                  Rv0732
                       CTACATCGGCATCTACTTCGGCCTCATCATCTTCTTCACCTACTTCT
2   L01   T000733_01                  Rv0733
                       ACGCGGCCAACGGATTCATCTTGGATGGCTATCCACGCTCGGTCG
2   L03   T000734_01                  Rv0734
                       AAAACGGTGGTGCTCGACGACAAATGGACGGTCACGACCGCCGAT
2   L05   T000735_01                  Rv0735
                       TGGTCGACCGCACAGATTGCCACCGACCTCGGAATTGCCGAAGGA
2   L07   T000736_01                  Rv0736
                       GATGTGGGATGCAGCTTACGTGTTGGGAGCATTGTCTGCGGCCGA
2   L09   T000737_01                  Rv0737
                       AGCTGCTGCGGCTGCTGGCGTTCAGCCGTATCGGAGCGCTACCGA
2   L11   T000738_01                  Rv0738
                       CATTCAAGCTGCCGTTGGGCGAGGTTCCCGGGCAGGTGTTCATCG
2   L13   T000739_01                  Rv0739
                       TCGGTGCCACACTGGCCTACCCGGAGCGAGTGGAGTACAACCAAG
2   L15   T000740_01                  Rv0740
                       GAAGAACACCAGACCCACCTCGGAAACCGCCGAAGAGTTCTGGGA
2   L17   T000741_01                  Rv0741
                       GCCTATGGCAAGGACTGATCGAATCCACCAACACCAAGATCCGACT
2   L19   T000742_01                  Rv0742
                       TTTTGGGGCGCACGGCCAGGCCTATCAGGCGCTCAGCGCGCAGG
2   L21   T000743_01                  Rv0743c
                       TCATGTCGACGTGGCAATCGGCGAGATGTCCGATTTTCACCGCAG
2   L23   T000744_01                  Rv0744c
                       GGACGGCATGGCGGGGTGGTATTTCACGAAGTGGCAGCGTGTCC
2   N01   T000745_01                  Rv0745
                       GATGCGGTGTACTTGTCATCAGAATCAGTGTCTATGGTCATCGGGG
2   N03   T000746_01                  Rv0746
                       TTCAACACCCCGGCCAGCGCCTCTCCGCTGCACACCCTGAAACAA
2   N05   T000747_01                  Rv0747
                       CAGCACCTCGCCCCTGCACACCCTGCAGCAGGACGTGATCAATAT
2   N07   T000748_01                  Rv0748
                       CGACCTGACCTCGAATAGAGCGTTGTCCGAAGTGCTCGACGAGGG
2   N09   T000749_01                  Rv0749
                       GACTTGATACCTGACGCGGTACTCGCGGCCATAGCAGTGGGGCAT
2   N11   T000750_01                  Rv0750
                       CATCCACATCATGCCGATGGGCACCGGGGTCGAGCTGAGCAAGTT
2   N13   T000751_01                  Rv0751c
                       GGTGCCCACCTCACCGGCCAACAACGACTTCAAGCCCGGGTTTTC
2   N15   T000752_01                  Rv0752c
                       TGAGCACCCGCGCCGTCAGGCACGGCTCAGGAAAAGGCGGCGAC
2   N17   T000753_01                  Rv0753c
                       CGGTTTATCGAACTGGTCAACGACACCATCGACGAGTTGGCCGAG
2   N19   T000754_01                  Rv0754
                       GCCCCTATGCCGGGATCTTCGACTCGCAGTTGATCAGAACGCAGC
2   N21   T000755_01                  Rv0755c
                       TTCGGTTAGTGTAACATCGGGTTTCGGGAACAAGGGAACCGGCCT
2   N23   T000756_01                  Rv0756c
                       CCAAACAAGCGTTGGGTGATGCCGGCGGCGCAAGCGGGTCGACC
2   P01   T000757_01                  Rv0757
                       TGCTGAGCAAGCCTAAGATTCTCGACCACGTTTGGCGCTACGACTT
2   P03   T000758_01                  Rv0758
                       GGTTCTACGTTCGGGTGATCAGCCCCGACGGCCAGAGCTATACGG
2   P05   T000759_01                  Rv0759c
                       GTGTTTCCCACCCGCAGCCTCAGTGATTTCGGCTTTGCCAACGTCG
2   P07   T000760_01                  Rv0760c
                       GGCGGCTTTACCAGTGAGGTCCGCGGCGTGTTCACCTACCGGGTG
2   P09   T000761_01                  Rv0761c
                       GACCCTGCTGCAAAAGAACATCCAGGGCACCATCTTCGGCGGCGG
2   P11   T000762_01                  Rv0762c
                       ACTGGCAACGCGATTTCTTCGACTTCGGTCATGTTTCCGCGCTCTA
2   P13   T000763_01                  Rv0763c
                       CGGCGTGATCAAGCATGCCGTGTGGGCCTGTCCCACCCAGGCACT
2   P15   T000764_01                  Rv0764c
                       CGCGAGTATGAGTTTGAGATGGCGCAACCGCCAGAAAGCTATCGT
2   P17   T000765_01                  Rv0765c
                       TCACCAACCTGCAGATGGAGTTGGAAGGCACCGGTGTTCGCGCAT
2   P19   T000766_01                  Rv0766c
                       AACCGAAAGTTTCGATTTCGTAGCAGAATTCGCTGGCAAGCTGCCG
2   P21   T000767_01                  Rv0767c
                       CCCGCGCCAAGGTAGCCCCGGCGACGGCCTACACATACTTCTCGT
2   P23   T000768_01                  Rv0768
                       TCACGCTTTGGGGGCGCTGTTGGCCAAAGACCCTCGGGTGGACAT
3   A01   T000769_01                  Rv0769
                       GTGGCATGAAGCTCGATCTGTTGTTGACCGTGCCGTTGGACTACTA
3   A03   T000770_01                  Rv0770
                       TGATGGTCGGCGCTGACGACGAGGCGTTCCAGCGGATTAAAGAGC
3   A05   T000771_01                  Rv0771
                       ATCGCGGTGCTGACCGCTCAAGGCCAGTCGGATCTGCTCGAGGTC
3   A07   T000772_01                  Rv0772
                       GCCGACTTGTCCGCAGCACGCGCACACGCGTATGAAATCCTCAGT
3   A09   T000773_01                  Rv0773c
                       CTGTGACGGCCCTCGGTTCCGCTGGGTGAACGGTATGCGGGTCAG
3   A11   T000774_01                  Rv0774c
                       GGGTCGATTGCGGCAACAGCGATCCGTTTTATGCCGCAACCAAGC
3   A13   T000775_01                  Rv0775
                       TGGGGGAAATGTCCAGTCCGGGGCTTGCCGAGCAGCTGATCTCAC
3   A15   T000776_01                  Rv0776c
                       ACCCCGCGCGCTGAAGTACAAGGCCAAGCCGGGACGCAGCGTTG
3   A17   T000777_01                  Rv0777
                       TCTTGGGCTTTGCAACTGTTTTCAACAGCGTGGGGCAGGTGTATCC
3   A19   T000778_01                  Rv0778
                       CTGCAAACGCTGCGAAGCGATTTTGAGTTGTTGCCGACTGCGATCG
3   A21   T000779_01                  Rv0779c
                       CAACTGATCAGCGATATCACTGTCGCGGTGTGGACGACGCTATGG
3   A23   T000780_01                  Rv0780
                       CCGTTATATTAATGCATACGAACGGATTTCCGAACTAAAATTCGACG
3   C01   T000781_01                  Rv0781
                       GCTGAAAACGACTACACCGAACGGACCACCGCGCACCTTGAGCCA
3   C03   T000782_01                  Rv0782
                       TGTGGTATGAAAACGGCAAGCTACTGGACAAGAAGAACACGTTCAC
3   C05   T000783_01                  Rv0783c
                       ACCTACCAGTTCAATCACAGCGAAATCATCGCTACTGCAAAGAAAG
3   C07   T000784_01                  Rv0784
                       TGCCGGCCAATGGATTTCGGCTGCTTGCGGATCTCCATGGAATCA
3   C09   T000785_01                  Rv0785
                       CATCACCAAGTCTGGACATGACTACACCTGGTTCGTGTTGAATGCC
3   C11   T000786_01                  Rv0786c
                       TCCACCCGGAAATCCCTGTGATAGAGAACATTTCGTATCTGGTGGG
3   C13   T000787_01                  Rv0787
                       ATGCGTGAGTTGCATGTTTACGATTGTGCCCTTATGGGGGCGTTTC
3   C15   T000788_01                  Rv0788
                       GAAGGTGCTTGACGAACTAGAAGGCGAAGGCCGGGTGGTGTTCCG
3   C17   T000789_01                  Rv0789c
                       GCTGCCCCGCGTCGCTCAGGGAATTCTCATCTTGTTCTTCGCAACC
3   C19   T000790_01                  Rv0790c
                       ACGGCAGCTACGCCGACTATCCCAGCGCGGTCGCGCAATGGTACG
3   C21   T000791_01                  Rv0791c
                       GTCCGATTATCTGCACATCATCGGCAGTGACATCATTCCGCGGGTC
3   C23   T000792_01                  Rv0792c
                       CTCCGTCACGTTACCCCGAACGTTGCCCGGATCAGGTGCCGGAAT
3   E01   T000793_01                  Rv0793
                       ATCGCGCTCGACGAGCACCGCGGTTCGCCGCACTATCTGAACTAC
3   E03   T000794_01                  Rv0794c
                       CCCGACCATCAGCGAACTGTGGCTGAGACTTCTTGAATCCTACCGA
3   E05   T000795_01                  Rv0795
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
3   E07   T000796_01                  Rv0796
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
3   E09   T000797_01                  Rv0797
                       CTCCGAACACACCCAACCCGCGGCCGCTTGCCATAGGAGCTATTG
3   E11   T000798_01                  Rv0798c
                       CGAGGATCCCCGTGAAATCCCTGATGTCATCTCCCAGGCATTGTCC
3   E13   T000799_01                  Rv0799c
                       CACGATCGGTGACGAGGATCGAAATTTCGCCGGCTCGTGTTATGT
3   E15   T000800_01                  Rv0800
                       CACGCTCGATCCGCAACGACACATCAACGCTGTATGGGGCGTGGG
3   E17   T000801_01                  Rv0801
                       CGGCGAGAGCTTTCGCTGGGTGGTGCTGGCTGACCCCGAAGGCA
3   E19   T000802_01                  Rv0802c
                       GAGCTCCAAGGATTTCCCAATCACCCGTCAGGTGGATTCTGGATCA
3   E21   T000803_01                  Rv0803
                       CCCGTGCTACGCCGGCAACCCCTTAGTGAACGCGTTGTGTGTCGG
3   E23   T000804_01                  Rv0804
                       GATGGTGCGGTTGTCGATGTCGGCTCGTGAGTTGCCGGCGTCGG
3   G01   T000805_01                  Rv0805
                       ATTACGTTCTCTTACATATCAGCGACACTCATCTCATCGGGGGGGA
3   G03   T000806_01                  Rv0806c
                       AACATCCTAAAATCACCATCGTTCGCGCCGAGGACCACTTTTCCGA
3   G05   T000807_01                  Rv0807
                       ATCGAGTCGATCCGGCGAAGACTCGGCAGGTCGTGTTGGCCCTCG
3   G07   T000808_01                  Rv0808
                       CTGGACCTGCTGCCCACAGTGCGGGGAGCGTTCTGTCTGACGTTC
3   G09   T000809_01                  Rv0809
                       CGCGATGGGCTCGTCGGGTCTGCATTCCAATGGGTACTCGCTGGT
3   G11   T000810_01                  Rv0810c
                       GGGCTAAGGCAAAGCAGACCAAGGTTGCTCGAGAATTGAAATACAG
3   G13   T000811_01                  Rv0811c
                       GCAAGATGGTTTTTTGGTCGATGGTCACTCCTCGTGCCGCTGATAT
3   G15   T000812_01                  Rv0812
                       ATTACCCCGCACCCCGATCGCTGAGGTGTTTGCCGAATTGGTGGA
3   G17   T000813_01                  Rv0813c
                       GATCCGAGCGAGTCTCAGGCGATCGAGTTGCTATTGGCGCATTCG
3   G19   T000814_01                  Rv0814c
                       ATGTGCTCTGGACCCAAGCAAGGACTGACATTGCCGGCCAGCGTC
3   G21   T000815_01                  Rv0815c
                       TCCTCGCACACCTGGTTCGTGTTGCGGGAATTACTCGGACACCAAA
3   G23   T000816_01                  Rv0816c
                       GATTTTCGGTGCTTTCGCTGCCCACCACGTTGATCTTCGATGTCGA
3   I01   T000817_01                  Rv0817c
                       AGGCGATGCGGGAACACTACGCGGAGCTAGAAATCAAGGCATTTG
3   I03   T000818_01                  Rv0818
                       GATCTGGCTGACCAGGAGAGTCTGGGCAAGGTGAGCCTGGGCGA
3   I05   T000819_01                  Rv0819
                       CACGTGAACGGCCTGGCCGGTTGCTGGGTTTCCATTGGACCAAAG
3   I07   T000820_01                  Rv0820
                       CATCGAAGACCTGATCAGCGAGCTCAAGCAGCAGTACACCATCGTC
3   I09   T000821_01                  Rv0821c
                       ATCCACAGCACGCGCTGCCCGAAGAGGTCAACGGTTATTTTGCCG
3   I11   T000822_01                  Rv0822c
                       TTCATCGGTAACAGCTACGTGGACAACGTCAAGACCAAAGACCTGG
3   I13   T000823_01                  Rv0823c
                       GCCACCGAAGGCACCGATATACCGGTGACGGTCAAGTTTCGCATT
3   I15   T000824_01                  Rv0824c
                       CACTATTTCGCGGAGAGCCTCACCGACTCCGTCCTCTATGTCAGTT
3   I17   T000825_01                  Rv0825c
                       GGCGCGGAGTGGATGCCCAACTTCATCGAGTTGCTGCAACGCAAG
3   I19   T000826_01                  Rv0826
                       TGAATCCCGACGTCTTCTACTGGGCGCACGCCACCTTCTTTGTCGG
3   I21   T000827_01                  Rv0827c
                       GCGATGGAACCACGATCTTTTACCGTCTGGAGAACGAGCACGTGC
3   I23   T000828_01                  Rv0828c
                       ATGTGCTATGGATCGCTGTACTACTGCTCACCCGATGAGGTTGTCT
3   K01   T000829_01                  Rv0829
                       TGCCATGCCTGCCGGCATGTGCAAGACATCGGCTGGGACGAAAAA
3   K03   T000830_01                  Rv0830
                       ACCACGGTCAGCGTGGTCACGTTCTCGACTATTTAACCCGCGATGG
3   K05   T000831_01                  Rv0831c
                       GCTTGATCCCAATTACCATCTGCGCCGAATAACACCCGCCCAAACC
3   K07   T000832_01                  Rv0832
                       TGTTTTCCGCCCACGGGCGGGATTTTCAGGCGCTCAGCGCGCGGG
3   K09   T000833_01                  Rv0833
                       TGTTGTTGGGTTTGGACGGCGCCAACGCCCCGGCCAGCACCAACC
3   K11   T000834_01                  Rv0834c
                       ATGTCTTTCGTGATTGCAGCGCCGGACTTGGTGGCGATGGCCACG
3   K13   T000835_01                  Rv0835
                       TGGAGTCATGTGTATCGCCTGAAATCGTCGGTATTCATATCCGTTG
3   K15   T000836_01                  Rv0836c
                       CTACCTGCGTGCCGATGTTCTGCCTCTCCCTGGCGGCCTGACAGT
3   K17   T000837_01                  Rv0837c
                       CACTAGACCTTGAGATCGACGCTCACCCCCTCACGATCACTGCCCT
3   K19   T000838_01                  Rv0838
                       ATTGTGCCTGGCCGACATGGGCACCGACTTCGACGACTTTTCTTCG
3   K21   T000839_01                  Rv0839
                       GAGGCCCAGCTGCACCGCCTGTCAAACATTTCGTTCACCACTTCCG
3   K23   T000840_01                  Rv0840c
                       GCCGTTCATCGAAGAGCCGGCGCGATTCGACCGGGTGATGCGTGA
3   M01   T000841_01                  Rv0841c
                       GACCACCGCGGCCAAGAGATGAGCACCATGAATCGGGCCGTAGGA
3   M03   T000842_01                  Rv0842
                       GTCCGGCCTTCGAGCTTGCACCGCCATGTCGAAAGTTGGCTATCG
3   M05   T000843_01                  Rv0843
                       TCGAAAACATTCGTGGTGCCCTAAGTGTGCACCTGGACAGGTACAC
3   M07   T000844_01                  Rv0844c
                       AGCTACGAGTTGCCAACCCGGGTGCTGCTTATTTCCGCGCACGAC
3   M09   T000845_01                  Rv0845
                       AAAACAGTTGGCGGCCTCTACCGCTCAGCGTTCGGGTATCAAGATC
3   M11   T000846_01                  Rv0846c
                       CCACTGCACGTGCGGCTAGGCCAACGGCCAACCCTGATGTTCGAT
3   M13   T000847_01                  Rv0847
                       ACGTCCGTAGGTAGCGAATTCGTCATCAACACCGACCACGGGCAC
3   M15   T000848_01                  Rv0848
                       ATCAAGTCACTCCTGGCCGGAATCGCCACCCGGGCACCATGGTTG
3   M17   T000849_01                  Rv0849
                       TATCTGGCTCTGCCCATGCAGGCGTCGATCCTCATGCCACGCAAC
3   M19   T000850_01                  Rv0850
                       TCAATCAGGATCTCGCTAACGTCGACCAGTACCTCGTTGTCAATCA
3   M21   T000851_01                  Rv0851c
                       ATGGTCGTCGAAACCAATCTGGTTGCCAACTCTGAACGAATCCGAG
3   M23   T000852_01                  Rv0852
                       CTCCGGCAAATATGGTGAAAGACCAGCTTCGGTGAGTACCGGCGA
3   O01   T000853_01                  Rv0853c
                       GTAGAGAAATAGATCGGGTGCTGTCCGAGGTACGGGAGCAGAAGC
3   O03   T000854_01                  Rv0854
                       ATAGTTATCGAAGCAAGTCCCGAGGAGATCCTGGATGTCATTGCCG
3   O05   T000855_01                  Rv0855
                       TGCTGCGATGGTCGACGGGGTTAGCGTGTTGGCGCAGATGATGTG
3   O07   T000856_01                  Rv0856
                       GCCGGCCGCACCATGTGAGGGCAACCGTCAAGATTCTGGGGCTCG
3   O09   T000857_01                  Rv0857
                       TTGCTAATTTGGTAGCAGTGGCTATCCGAGCATCGCGCGAAGTCG
3   O11   T000858_01                  Rv0858c
                       GCCTCACAACAAGCCGATGTGTGGAACCACCTGGTGCGCTTCACC
3   O13   T000859_01                  Rv0859
                       GTCGGTGGTGCTGAAGTTCCAGAAGGACCTCAACATTCCCGACGA
3   O15   T000860_01                  Rv0860
                       CTATGAGGTGGTACTCAAAGATGTCAGCCTTGAGGCCGCCGCTAA
3   O17   T000861_01                  Rv0861c
                       ACACCAAAATTGCTGTGGTCAAGTCGATTCTGGCGAAGCACCCGG
3   O19   T000862_01                  Rv0862c
                       GAACTACGCAGCGGCGGACTGGGGGTTCGTGAATTCAAGCGGCTG
3   O21   T000863_01                  Rv0863
                       GACCTGTCAGAATGGTTTCGTGGCTGACATTGCTGAAGGTAAGGC
3   O23   T000864_01                  Rv0864
                       CGCGCTTATCGATGACATCCGGGTGCTCCACAAAGAAGGCGGTCG
3   A02   T000865_01                  Rv0865
                       GATGATTGCGGGCCGATTATCGCTGGATGGCTTGAACAGCATGGG
3   A04   T000866_01                  Rv0866
                       GGCGCGGCTTCCCGTGTGGAAGCACCAGTTCTTCGAGGACGGTAC
3   A06   T000867_01                  Rv0867c
                       GAAACGCCCCAAGTCTCGAACATCGCCTATACGAAGAAGCTGTGG
3   A08   T000868_01                  Rv0868c
                       GGGATTGTCGTCCGAGATGACGCCGTCGCGTTATCCGCCGGCGAC
3   A10   T000869_01                  Rv0869c
                       TCTGCCTAGAGCGCGGTTATCAATTGCGAGTCATCGAGCAGATGCC
3   A12   T000870_01                  Rv0870c
                       GCAATGGCAGTCACGATCATCGGCATTCCGCTAGCACTGGCCAAC
3   A14   T000871_01                  Rv0871
                       CCGAGCACAAGCACAGCCCCGATGAGCTGCACGGCATGGTCGAGG
3   A16   T000872_01                  Rv0872c
                       TGTCGTATGTATTGGCGACGCCGGAGATGGTGGCAGCGGCAGCAA
3   A18   T000873_01                  Rv0873
                       CTTCGCCAAAGAACTCTTTCTGGGCCGCTTTCCCTTAGGGCTCATA
3   A20   T000874_01                  Rv0874c
                       GATCGCGGGCCGCAATGCCCTGCACGGATTCACCGCATCGATGGC
3   A22   T000875_01                  Rv0875c
                       TTACTCGCACGGGCACCTGACCCGCGTGGGGCCCTATTTGTACTG
3   A24   T000876_01                  Rv0876c
                       TCATTACCTCCCTGTGGGGTAACTGCACCATCAAGGTGATGGTCGG
3   C02   T000877_01                  Rv0877
                       TGTTCGGGGTATGTGGTAACGAACTGTCCGCTGACGGGCATGTTG
3   C04   T000878_01                  Rv0878c
                       CGACACTAGCTCCGGCTTCCAGAATGCAGGCACCGCGTTAACTCG
3   C06   T000879_01                  Rv0879c
                       GTCGAAAATAGTCAGATTCGCGAGCCGCCACCGCTACCACCCGTG
3   C08   T000880_01                  Rv0880
                       GCGATTCGTGAACGGGTCCGGCCACCGTCGATGACCAGGGTGATC
3   C10   T000881_01                  Rv0881
                       TGGTGCCATATGCACGCGCGGCCGACTGGCCCACCGAACTTATGA
3   C12   T000882_01                  Rv0882
                       TTGCGGTCGTGGTGCTGAGCCTCGGCCTGATCCGCGTGCATCCGC
3   C14   T000883_01                  Rv0883c
                       AAGCCCAGCTGGACATCGAGGTCACCAACGTGCTGAGCCCCAAGG
3   C16   T000884_01                  Rv0884c
                       CCGATCGCGGTCGAGAACAGCTTGAAGAACCAGACATACAACACAC
3   C18   T000885_01                  Rv0885
                       TCCATCCTGATTCGCGGCCTGATGAACTACACGTTCTGGATGCCCA
3   C20   T000886_01                  Rv0886
                       TTGACCGGATCGCCGGTCATCGCCGCTTCCGGTTCTATCTCAACG
3   C22   T000887_01                  Rv0887c
                       GGTCACCATTCATTTGACCGTCACCGATGTCGACGCCAAGTTCCAG
3   C24   T000888_01                  Rv0888
                       GACATGGTATGAGTGCACATCCGACAACTGCCTCACCTTGAAGGG
3   E02   T000889_01                  Rv0889c
                       GTCCCGCAGCGAATCATCGATGAATGCTCGACGGTCACAGCACGT
3   E04   T000890_01                  Rv0890c
                       ACCGGTTCGTCTCACGTCACTGCAGCTTGTGGCTTAGTTTGGCGC
3   E06   T000891_01                  Rv0891c
                       CGTCTCCGCGATTTGGCACACGGGGGTCAGGTTGTCCTGTCAGCT
3   E08   T000892_01                  Rv0892
                       TTTTCCGTGTCTGGGTTCGCTGGCCTATAAGGCATATAGCCTTTCC
3   E10   T000893_01                  Rv0893c
                       TGTCGATCTGCGCGATGAGTGGCAGATAGCCTTGTGTAACAACGG
3   E12   T000894_01                  Rv0894
                       TGCTGGTGTTGGACCATTGTGAGCATTTGCTGGACGCGTGTGCCG
3   E14   T000895_01                  Rv0895
                       GGGCTGCTATGTGTGCCGGAAAGGTTCCGTGCAATGGATCTTCCG
3   E16   T000896_01                  Rv0896
                       CGTACGCCTACAAGAAATCGGTCGGCCAGCCCTTCCTCTACCCAG
3   E18   T000897_01                  Rv0897c
                       GCTGATGCAGAACATCTGCTTCCTGTATCACCTGGTCGGTGGGGG
3   E20   T000898_01                  Rv0898c
                       ACGGTGGCATCAGCGAGTCCGAGGAGCAGCAGCAACTGCGCCGC
3   E22   T000899_01                  Rv0899
                       GCGGAACCAGTTTTCACCGCCAGCGTGCCGATTCCTGATTTTGGC
3   E24   T000900_01                  Rv0900
                       GGATTTTGTGATCCAGTGGTCGTGCTACCTGCTGGCGTTCCTGGG
3   G02   T000901_01                  Rv0901
                       CGTCGACGCTGATGGTCCGGCCCGTCGAACATCAAGTGCTGGTAA
3   G04   T000902_01                  Rv0902c
                       AGTCGAATTCCGACATCACGCTGCCCAAACTGCAAGACGACTACGC
3   G06   T000903_01                  Rv0903c
                       TGCTCTCCCGAGCGCAACTCCTGGAATTGGTGTGGGGCTACGACT
3   G08   T000904_01                  Rv0904c
                       ACCACGGGTCTATGAGTTGCTCTATGGCGACCCCTTCCCATCCGG
3   G10   T000905_01                  Rv0905
                       TCCGACGTCGAAATACGGTCTGGCCCTGGATAACTGGAGCATCCG
3   G12   T000906_01                  Rv0906
                       ACTACGACCATCTCGATATCGACACCGTGGTTGCGCTGGTCGGCA
3   G14   T000907_01                  Rv0907
                       ACCATGCGGGCGATCTGTTGGAGGATTTGGGTTATGACCGTCGAC
3   G16   T000908_01                  Rv0908
                       GGCGACCATTGAGGCGATGTGGTGGATCCGAAGCAGGATGCTCGG
3   G18   T000909_01                  Rv0909
                       TGGACAAGGTAAAGAACCTGCTGTCGCAGAACGCCGACAAGGTCG
3   G20   T000910_01                  Rv0910
                       CGATCTGACTCGTTACCGAGAGTGGCTGACCATCCACAAGGTATGG
3   G22   T000911_01                  Rv0911
                       TCCGACACTGACGAATTCTGCTACACCACAGCATGGTTCGACGATC
3   G24   T000912_01                  Rv0912
                       TGGCACTCACGGTGTGGTACTACAAGCTCAACGTCAACCCACCCG
3   I02   T000913_01                  Rv0913c
                       TGGTTAAGCACGATCTGCTCACCGGCAACCACGAGTGTTACTCGTT
3   I04   T000914_01                  Rv0914c
                       CTCAGGTCGCCGACGAATACGACCGGCGATACGGTTTGGATGACA
3   I06   T000915_01                  Rv0915c
                       AACCCGCAAGTCGGATCCGCTCAGCCGATAGTGATCCCCACCCCG
3   I08   T000916_01                  Rv0916c
                       CCAATGACGTGTCGGTCCTGACGGCGGCCCGGTTCACCGCGCACA
3   I10   T000917_01                  Rv0917
                       TGTGCTGGTGATCGTGTTCTTCTTCGTTACGTCGTCGGACTCCGGT
3   I12   T000918_01                  Rv0918
                       GCGGCAGGCGGATCGCCAGAGCCTGGGTAGTAGCGGCTTGCCAG
3   I14   T000919_01                  Rv0919
                       GTCGCTGTGTCCAGGCTGCGGACTCGATCGGGCTGCGGGCGATT
3   I16   T000920_01                  Rv0920c
                       ATTCCGTTCCTGGACTATGATGTCGAAATACGGCGAGTCCCGTGTT
3   I18   T000921_01                  Rv0921
                       GATTGGGCGGAGTCGGTGGGGGTGAATCGACATACCGCTTATCGC
3   I20   T000922_01                  Rv0922
                       TGCGATGGGCGTGGAACCGAGCCAAAGATGACGTGGCGCCGTGG
3   I22   T000923_01                  Rv0923c
                       TGTTACCGTCATCGAGATCTGGGCCTGCGCCACAATCACTTTCGGA
3   I24   T000924_01                  Rv0924c
                       TACGCTGGGCTTCGACCCCACCCGCACATTGGTGCTCTCACAGGT
3   K02   T000925_01                  Rv0925c
                       GCGGTCCAGAGAACGACTTCACCAACCGCAACACCACATTCATGAC
3   K04   T000926_01                  Rv0926c
                       TGGCCTGGGGATCAGTGGTCCGACAACTTGCTGCGGGCCTTGGCA
3   K06   T000927_01                  Rv0927c
                       ATTGCAGCTGCGGCAGTGTATTTGGCCTCTCCGGCGGGCAGCTTC
3   K08   T000928_01                  Rv0928
                       CAACGGATACATCCCAATTCCGGACGAGTTCAAATCGAGGCTGTCG
3   K10   T000929_01                  Rv0929
                       CTGTCGGTGATGATCCTGCCTATCGTCACATCGATATCACGCGAAG
3   K12   T000930_01                  Rv0930
                       CAGGTTGGTGCCCGATGAACTGCGAGAAGCCAGCTACGCGTTAGG
3   K14   T000931_01                  Rv0931c
                       GTCAAGCTAGAGGCCGAGTCGAATAACCAGGTCGTGCTGCCATTC
3   K16   T000932_01                  Rv0932c
                       ATTAGCGTTATCTTCCGCAGCGACAAGTCCGGTACGTCGGACAACT
3   K18   T000933_01                  Rv0933
                       GACCAGGTGAGTATGGGCTTTCCCGCTCGTGCGGTGACGTCGTTG
3   K20   T000934_01                  Rv0934
                       TCAACAACCGGCAAAAGGACGCCGCCACCGCGCAGACCTTGCAGG
3   K22   T000935_01                  Rv0935
                       GAATCCCCAGCGTGGTCGTCGGTTTGTGGGGGGCAATGACGTTCG
3   K24   T000936_01                  Rv0936
                       CGCCGGTCGGCTACCTGACCTACCCAATTTGGACGTTCTACAACCA
3   M02   T000937_01                  Rv0937c
                       AGTTACAGGAGCTGATCGACACCAAACTCGAAGGTGGGCAGGCAT
3   M04   T000938_01                  Rv0938
                       CGAAAAACCTGCCCGACAACACATCGGTTAACCATCTAGCGATACA
3   M06   T000939_01                  Rv0939
                       TCGATCATCGGCTATACCATTTTCAACGACTGGTCCGCACGGGACC
3   M08   T000940_01                  Rv0940c
                       CCCGACGGCAACCGCGAATTCATGGACGGCAAGCCTTTCATCGAA
3   M10   T000941_01                  Rv0941c
                       CTGGGGCAGCAGTCCCACTTCGTCGGGCAAGACGGTCTGGGCAAT
3   M12   T000942_01                  Rv0942
                       TTACCCACAAAAACACGCGATCAACCTCCAGTCCGGGCTATGCCCA
3   M14   T000943_01                  Rv0943c
                       TCACCTCGATCCGATCGACGGCAACTACCACTGGCAGGGCACCGT
3   M16   T000944_01                  Rv0944
                       GTGTGCGGTGACACCGTGCGGGAGGTGTCCTTCGCGGACAAGTC
3   M18   T000945_01                  Rv0945
                       CATCAGGGTCACGGTGCTGGAGCCGGGTTATATCGAGTCGGAGAT
3   M20   T000946_01                  Rv0946c
                       ACAAGCGCCTGGTCGACGACTTCGGCATCAACACCGACAACATGT
3   M22   T000947_01                  Rv0947c
                       CTTGTCCGACGGCATACTCGCCCGAGACGACTACAACGGCCGGGA
3   M24   T000948_01                  Rv0948c
                       CGAAGAGATCGACCGGCTAGACGCCGAAATCCTCGCGTTAGTCAA
3   O02   T000949_01                  Rv0949
                       CAGAACCATTCTGCTGGAACAGAATTACCGCTCGACGCAGAACATC
3   O04   T000950_01                  Rv0950c
                       GAGGCGCGACTACAGCGCCCGCTGTATGTCATGCCGACGAAGGGC
3   O06   T000951_01                  Rv0951
                       ACAAGACGCGTACGAGCACGCCAAGAACATCCTCGGCCTGGACAT
3   O08   T000952_01                  Rv0952
                       CTCATCGTGATGATCGGCGAGATCGGTGGTGACGCCGAGGAGCGG
3   O10   T000953_01                  Rv0953c
                       GAGGCGATGCGGGCGTTGTGGACCCAAGAGGAGGCCTGCTATGA
3   O12   T000954_01                  Rv0954
                       TTGGGCATTGTGGGTTGTGTTGGCTTTCATCGTGTTCCAGGCGGTT
3   O14   T000955_01                  Rv0955
                       TGTACTTTCGGTGCTTTACGCACCCAACGTCATCGTCGGCACCTCG
3   O16   T000956_01                  Rv0956
                       CGTTTCTGCGGGCTTTATGAGAATCCTTGGACCGCAGTTCCTTTCA
3   O18   T000957_01                  Rv0957
                       GGCTTTCGAACTCGTTGTAGTCAACTTGTATCCGTTCAGCCAGACC
3   O20   T000958_01                  Rv0958
                       GCACAGGTGTCCGACTACCTGATGCAGGTGCTCGCGCGGTTTGCC
3   O22   T000959_01                  Rv0959
                       GTTGCGTTGTTGGTGGACACCTCGTTTTCGATGGTGATGGAGAATC
3   O24   T000960_01                  Rv0960
                       CGGTGGTGGGCCTTTTCGAGCGTATCTGGGAAATCCGCGCGAACC
3   B02   T000961_01                  Rv0961
                       GCCCTGGCTTTTGTCGGCGGGTTTGCGGTTTGGTTCTCCTTATTCT
3   B04   T000962_01                  Rv0962c
                       ACAAGAGGCAAGCGAGTTATTCTTTGGCCGTCCAGCGCCCACTCC
3   B06   T000963_01                  Rv0963c
                       GCCGTTGAACCGCTTCGACAAAGGCTTGGCCGCTACCACGAATGT
3   B08   T000964_01                  Rv0964c
                       TTGTCGTCGTATTCCCCGGCCGATCAGCAGGCCATCCTCAACACCG
3   B10   T000965_01                  Rv0965c
                       TTTGGTTCGTGTGGAAGCGAGTTGGTATGGCAGAACGTTGCGGGC
3   B12   T000966_01                  Rv0966c
                       CTGGCAACATTTGCAGTTTCGCCAACACCTCTTGAAGCAAATTCTTG
3   B14   T000967_01                  Rv0967
                       ACCGGCTGAAGACGGTTCGGGGCCATCTTGACGGAATCGTTCGGA
3   B16   T000968_01                  Rv0968
                       AAGCTCGACTGATGTTCGCCGACGTGCTAGCCGAAGCCAGCGAGC
3   B18   T000969_01                  Rv0969
                       GGACACGCTGATCGCGCTGGGTACGCTGACCGCGTTTGTCTACTC
3   B20   T000970_01                  Rv0970
                       GAATACGCCACCGAGCCGGATGGGTCAATGCCGGCTATGGACATG
3   B22   T000971_01                  Rv0971c
                       AGGCTGACACTGAACTCTCCGCACAACCGCAACGCGCTGTCGAGC
3   B24   T000972_01                  Rv0972c
                       ACAAGGCGCGCAAACACGAACACACCAGCGAGTTATGGGCCGAGG
3   D02   T000973_01                  Rv0973c
                       CGAAGTAGGCGCCATTCTCGCACGAGTAGAAGCACCTCAAAATGG
3   D04   T000974_01                  Rv0974c
                       TCGAGGGCCAGATCGAAGCCGAGTCGCTACCGTTGGTGCTGTCCG
3   D06   T000975_01                  Rv0975c
                       TACATGGCCGAATCCGAAGTCGAACGCCAATACCGGGACATGCGA
3   D08   T000976_01                  Rv0976c
                       GCCTGGTCGTCACCCGTCACGTGCTGCCGAATCTGCGGGCACTGA
3   D10   T000977_01                  Rv0977
                       TGACCTACAACTACAACACCTACTCAACGACGGTGGATTTCGGCAA
3   D12   T000978_01                  Rv0978c
                       GGTCAACCCCGTCACCGGCGAGGTTTATGTCACCAACTTCGCCGG
3   D14   T000979_01                  Rv0979c
                       GTATTCGAGCGCGACTTTCTGCGCTTGGGCACAGCCATGGTGGGC
3   D16   T000980_01                  Rv0980c
                       CGGCAACATCTACGTCACCAACCAGTTCAGCAACACGGTGTCGGTG
3   D18   T000981_01                  Rv0981
                       CGCGCAGCCGTATCCTGGAAGAGGTATGGGGATTCGACTTTCCCA
3   D20   T000982_01                  Rv0982
                       GCGGCGGCGCAACGATATCCTTTTCGACGTCGAGGTGATTGGGTG
3   D22   T000983_01                  Rv0983
                       GCTAACCTTTCAGGATCCCTCGGGCGGTAGCCGCACAGTGCAAGT
3   D24   T000984_01                  Rv0984
                       GCTCGGATATACGGTGGCACCCATGGAACAGCGTGCGGAGTTGGT
3   F02   T000985_01                  Rv0985c
                       TTTCCTGATCGCGTTCGCGGTGTACTTCCTAGTCGTGCTGCCCTAC
3   F04   T000986_01                  Rv0986
                       TTCCCGATAAACTCTCCGGCGGAGAACAACAACGGGTCGCTATTTC
3   F06   T000987_01                  Rv0987
                       CATTGGCAGGATGATGACGTGACGACCATGTTTCTTTTTTTGGCAT
3   F08   T000988_01                  Rv0988
                       AACGGATAGGTTTGACGCTGCGCGGGGCCGCATTAATGGCTAATC
3   F10   T000989_01                  Rv0989c
                       TTGCCCGGATTACAGAGCTGATCAATAGCGAACTCTCCCAGGCCG
3   F12   T000990_01                  Rv0990c
                       TGCGCCCCGGTACCGCATTGACTCCCGGTGATGTCAGGCTGGAAA
3   F14   T000991_01                  Rv0991c
                       GAGTGAAAGCAAGGCTTCGGGGTCAACCGAGAAGTCAACCAGCTC
3   F16   T000992_01                  Rv0992c
                       GCGACAGCACCGTCTGCGCGTATGTGCCGGTAGGCGGCGAGCCG
3   F18   T000993_01                  Rv0993
                       GGCCGCTACGTTCTAGACCGTGCCATCTTCGATGCGTTACGCCGC
3   F20   T000994_01                  Rv0994
                       AAGTCTTTGCCGACCACGGCGATCTTGACGGTCGCGACGTGCTGA
3   F22   T000995_01                  Rv0995
                       CGTTACCTTGAGGTTGACCGGGCATGGCGAGACCATCTGTTGATG
3   F24   T000996_01                  Rv0996
                       ACGGTGCTCTACCTGGCATATTTGCGTCGGCAAACCCGCATCGAG
3   H02   T000997_01                  Rv0997
                       CGGTTCGGGTGGTGATGCGGCTGGCAAGGTGGAAGGAGGCCGGA
3   H04   T000998_01                  Rv0998
                       GCGAGACGCTGTATCGACGGTTCATGTCGGCTCGTGTTCCCAGTC
3   H06   T000999_01                  Rv0999
                       GCGGGTCAGCGCGCACCGGCGAGCTCTATGACTATTCCGCTCGGT
3   H08   T001000_01                  Rv1000
                       GATGGTCAGGTCGTGAAAACTCACCAGCCGCGGCACATCGACCAC
3   H10   T001001_01                  Rv1001
                       GCGGCTGCCAAGGCGATGGGAATCGACAAGCTGCGGGTAATTCAT
3   H12   T001002_01                  Rv1002c
                       GGTGCTCACCGGTCTGCCAATCTCACAACAGACCTGGAACCTGGA
3   H14   T001003_01                  Rv1003
                       CCGAACTGTCGTCGCTGATAGCCCAAGTGGAGGAGTTCGTCGCGG
3   H16   T001004_01                  Rv1004c
                       GTGTCTATCTCGTGTCGAGTTCGAGAGGGGTTTGTAATGAGACTCG
3   H18   T001005_01                  Rv1005c
                       ATTTCACAATGGGAGCGATATCGCCGCGGGATATATTGCGGCACAG
3   H20   T001006_01                  Rv1006
                       ACCGGGGTGGTGCAGGTGGTGCCGAATTTCAACGATTCGACCTAT
3   H22   T001007_01                  Rv1007c
                       TCATCAGGTTTCATGCCGTCTATTGGCCGGCGTTTTTGATGTCAGC
3   H24   T001008_01                  Rv1008
                       GGAAGCCGTCCCGCTGATGCCGGTGGAGCAGCTTTTGGTGGAAAC
3   J02   T001009_01                  Rv1009
                       GATGAAATCGCGGGTGATCGACATCGTCGAAGAGAACGGGTTCTC
3   J04   T001010_01                  Rv1010
                       CAAGACTTCTCGCAACGCGTTTGTGCAGTGGGCGGGCTCGGGAAG
3   J06   T001011_01                  Rv1011
                       ATTTCATGCCGTCTCGCTGGTCGACGAGGTAACCGTTCGTAACGCT
3   J08   T001012_01                  Rv1012
                       CAACCCGTCGGCACGGGAATCCTCGCAGTTCACCGCGGGGAGTAC
3   J10   T001013_01                  Rv1013
                       TTGATGCAGCTGACGTCCGGATCTACCGGCTCCCCTAAAGCCGTC
3   J12   T001014_01                  Rv1014c
                       CGCCGGCCAACATCATCGTCATCCACGACGACCTTGACCTCGAGT
3   J14   T001015_01                  Rv1015c
                       GCACCAACGCGGTGTTGACCCTCGACATCGCCGGTAAGGAACAGC
3   J16   T001016_01                  Rv1016c
                       AGACTTCAACGGGTTTCCGTCCTCGATGATTCAGGGCAGTTATGAC
3   J18   T001017_01                  Rv1017c
                       CGGTCAGAACCTGCTGACCGGTTACATCAGAGACAACTACCCGGA
3   J20   T001018_01                  Rv1018c
                       CTCAAAAAGAGCCTCAGAAATGGCCTGCCAACAGCCCACACAACCA
3   J22   T001019_01                  Rv1019
                       ACCTGGCACCGCTGTATGCGCAAGCATTGGTGGGTTCGGTGTCGA
3   J24   T001020_01                  Rv1020
                       GCCGATTTGATAACCGCGCTCGCTGGGAAACCGCGCCAGCATATT
3   L02   T001021_01                  Rv1021
                       GCTCACCTGATCCCCGATGAGATCACTTCTGTTTCGGTTTCAGCTG
3   L04   T001022_01                  Rv1022
                       ACATCGATGATGCTGCCCTCTCGGCAGCGGGCTATTTATGCTGGC
3   L06   T001023_01                  Rv1023
                       TCGAACGGGGCGTGGCAAATGCGTTGCTGGTCAAGGTGAACCAGA
3   L08   T001024_01                  Rv1024
                       TATATTGCGGCTCAGGCCCGCGAACGGCTCGGCTTTGTGATGCCT
3   L10   T001025_01                  Rv1025
                       CAAGTGCCTGCATGTGCTGATCGCGCATTCGCTGGCCAAGGGCCC
3   L12   T001026_01                  Rv1026
                       CGGCATCGACCAGCTGACCGTCAGCGAACACGACATCTTGGACGG
3   L14   T001027_01                  Rv1027c
                       TGGTCGGCCGCGGGGAGCTTCTCAAAGAAGTGTGGGGACCGGCA
3   L16   T001028_01                  Rv1028c
                       TCGCCGATCTTTGCGCGATCTTTACGCCCTACCGGTGGATGATTGA
3   L18   T001029_01                  Rv1029
                       CCTATGCCCTGTCCGTGCTTGCGTTCAGTGTTATGTCCTTCCTGCT
3   L20   T001030_01                  Rv1030
                       CATCTGAAGGACATCGTCAAGGTGGGCATACGGGAACGCTTCGAC
3   L22   T001031_01                  Rv1031
                       ATGCGTCGTCAATTACTGCCCGCGCTCACCATGCTGTTGGTGTTCA
3   L24   T001032_01                  Rv1032c
                       TGAACGACGCCGAGCTAGTCGAATCCCTGCACGCGTTGAACCACT
3   N02   T001033_01                  Rv1033c
                       GGCCGCACCAGCATTGTCGACCTGTATATCTCCTATCTGAGGAAGA
3   N04   T001034_01                  Rv1034c
                       GTCGACCAGCAGCTCACCGAGGTGGGCGTCAAGAATGTGCTGATC
3   N06   T001035_01                  Rv1035c
                       ATTGATGAAGCTCACCACGCGTTGCGGATCGGCGGCGATCGACGG
3   N08   T001036_01                  Rv1036c
                       TGCTGAACTGGGAAGATGGCCTCAATGCCCTTGTTGCGGAAGGGA
3   N10   T001037_01                  Rv1037c
                       GTCGCTGGAGGCCGAGCATCAGGCCATCATTTCTGATGTGTTGAC
3   N12   T001038_01                  Rv1038c
                       ATGAATCAGGCGTTTCGCAACATCGTGAACATGCTGCACGGGGTG
3   N14   T001039_01                  Rv1039c
                       CCCTGCTCGCGACCCCGTTCGTGGCAAACATCATCAACAGCGCAG
3   N16   T001040_01                  Rv1040c
                       AGGCTATGCATGACATGTTTGTCAACACTCTGGGAATCAGCGCCGG
3   N18   T001041_01                  Rv1041c
                       ACACGCTCGCCACAGGGGGCACTGTCGGATTACAAGAAATCCGCC
3   N20   T001042_01                  Rv1042c
                       TTAGCGATCACCGGCTTATCCTGGAAGGGATCGCGTGGCGGTTCC
3   N22   T001043_01                  Rv1043c
                       ACGCTGGCAATCCGGTGGATAGTTGGGGAACCGGCCTCGTCGTCG
3   N24   T001044_01                  Rv1044
                       GTGCAAAACCGTATCTAATTGATACGATTGCGCACATGGCTATCTG
3   P02   T001045_01                  Rv1045
                       ATATCGAATTAATCCATGAACAGCTCGCTGACGCGGGCGAGACGG
3   P04   T001046_01                  Rv1046c
                       CGTACACCACACCCCTGGACGTAACTGCTGATATTATCGAGGCTCG
3   P06   T001047_01                  Rv1047
                       CTGCTGCACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTG
3   P08   T001048_01                  Rv1048c
                       GCCTGATCGTTGATCGCGATGCGCTGTTGGATGCATACGCTGAGG
3   P10   T001049_01                  Rv1049
                       ACGATGAGCGAGCTTGCCGCCCGCATCGGCGTTGAACGCACGACG
3   P12   T001050_01                  Rv1050
                       GCCGATCATGAAGCAGCAACGATCGGGACGGATCATGAACATGTC
3   P14   T001051_01                  Rv1051c
                       GCAGTCGCGCAAGCGAAATGGGCGACCGAACACGGACGCTGCCA
3   P16   T001052_01                  Rv1052
                       CAGGACCAGGTTTTCGATCTATTGATGCCGACGGCTGTTGAAGGC
3   P18   T001053_01                  Rv1053c
                       CGCGGACGAAATGGTCACTGAGAAGCTCATCAAGCGACAACGAGC
3   P20   T001054_01                  Rv1054
                       GCAAGGGCATCGTTGAGTCGACGACCAAGACGAAGCGGGATCGTC
3   P22   T001055_01                  Rv1055
                       CACGGCCATCTGCTCAACGACGATCTAGCGGTGTGGCCGATGCGC
3   P24   T001056_01                  Rv1056
                       CCCACAAGGTATTACATCGATCCGGCCGACATCGCTTTCGAGCATC
3   B01   T001057_01                  Rv1057
                       AGAGCCCGGACGGAAAGTACCTGTACATCGCCGACTACTCCGGCA
3   B03   T001058_01                  Rv1058
                       GTACGACAAGAAGGCCATCCGTTCTCGCTACGCCGAAGGTGCCTA
3   B05   T001059_01                  Rv1059
                       TCATCGGTTCACCACCATTGGGCGTGATCGCGACTAACAGCATCGA
3   B07   T001060_01                  Rv1060
                       CAAAGTCTGTCGTCGTCGAGCAATCGCGAGCGATTCCGGTGCAAT
3   B09   T001061_01                  Rv1061
                       ACCCAGACATCCGATTCGCCGGGAAGATCTCAGCGAGCCGGTACT
3   B11   T001062_01                  Rv1062
                       CCGGTGTCGACATCGATGCCATCACTGATCTTTTCCTGACTGCCGT
3   B13   T001063_01                  Rv1063c
                       GAAGCCGCTGACACACCCGGGCTACCCAAAATGGGCAGTTTCGAG
3   B15   T001064_01                  Rv1064c
                       GTCGTTAATCGAGCCGTATCTGGCGGTGGTCCAAGCATCGCCATC
3   B17   T001065_01                  Rv1065
                       GGATATCTGGCTGATTAGCTGGGTTCCCGGTCAACCGACCGAGCT
3   B19   T001066_01                  Rv1066
                       AGGTGCCAGGGGCGCTAGTGATCGAGCGCAACGTCTTGGAATGGC
3   B21   T001067_01                  Rv1067c
                       ACGCCGGCCAGTATCAACAGCTGGGCGCGCGTGCAGCGCTGTTTC
3   B23   T001068_01                  Rv1068c
                       CAGACATGCTCAGCTCGGCGGCTGGGGATTTGGCCAGCATCGGAT
3   D01   T001069_01                  Rv1069c
                       GCGATCGTGAGCATGCAGTATTCGTTCTTGCCGAGCTGGCTGTCT
3   D03   T001070_01                  Rv1070c
                       GACCGAAGACCAATCCGAAGGTATGGCAGCGTTCATCGAGAAACG
3   D05   T001071_01                  Rv1071c
                       GCGTCGCGCCGCCAAACTCGACACGCTAGAAGACGTGTTGATCCA
3   D07   T001072_01                  Rv1072
                       AATGCTGGGGTGCTGATCGGGGAGGCCATCTTAGGGACGATGGG
3   D09   T001073_01                  Rv1073
                       CCTTAGGTCAGGCGATAACCAGACTGGATGCGCTTGCCAATGCCA
3   D11   T001074_01                  Rv1074c
                       GCGCGCATCACCACCACGCTGTTGAACAACCTGCAGACCTACGAC
3   D13   T001075_01                  Rv1075c
                       TGTTGTTCCTTGCGCTGCGCGATGCGCTGACCGAAAAGCTCGATA
3   D15   T001076_01                  Rv1076
                       TCGCTGACTCGCCTGTTCTGGTGGTCGACTATCGGTTGATTCCCAA
3   D17   T001077_01                  Rv1077
                       CCTGTTGCCCGACGGCGGCCGGGGCTACATGTCGAAAATCTTCAA
3   D19   T001078_01                  Rv1078
                       TTGTCGGTGGGCGGATTGGCTTACCTGGTCTGGAACTACGGCTAT
3   D21   T001079_01                  Rv1079
                       CCCGGAGACCACGTCGTCATTCCCGATGACGCCTACGGCGGCACA
3   D23   T001080_01                  Rv1080c
                       GTTGGCGAGGCACCCAAGCAATCCGGCGTCGCATTACCCGGTTCT
3   F01   T001081_01                  Rv1081c
                       TCGTCATTGCCGTCATCGGCTACCAACGGATCAGCACCAGCGCCG
3   F03   T001082_01                  Rv1082
                       AGCGGATGCAGATGTTGCAGGATGAGTTCGCCCGGCACGGCCAAC
3   F05   T001083_01                  Rv1083
                       TGCTATTGGTGATCGCCACGTTGTTTCTGGTGCGTTCGATGAACCA
3   F07   T001084_01                  Rv1084
                       TTCCTGCAACTTCTTTCGGCCATATCCGAAACCTGGCGGGAACGCC
3   F09   T001085_01                  Rv1085c
                       GACGCTGGCCTACACCGCGGCCACGATCACCATGTTCACCGTCAG
3   F11   T001086_01                  Rv1086
                       ATTTGGTGATACGCACCTCCGGCGAGCAACGCTTGTCCGGGTTCT
3   F13   T001087_01                  Rv1087
                       CTCGGCGGCGCAGAGCGTGGAACAAGACCTGTTGGCCGCGATCAA
3   F15   T001088_01                  Rv1088
                       TGCTGGCCGCCGGTGGCGATGAAGTGTTGGCGGCCATCGCTAGG
3   F17   T001089_01                  Rv1089
                       CAATTACACGATCACCCAATTCGGGCGCGACTTCGATGACCGATTG
3   F19   T001090_01                  Rv1090
                       GGCCGGCTTGGAGCCCTGGAGCGACGGTGTGGGTCTGGGGGTCG
3   F21   T001091_01                  Rv1091
                       ACCAGCGGCTGCTCGATCTGATCAATGGGCCCACCCAGGCGTTGT
3   F23   T001092_01                  Rv1092c
                       GCGCCGGTGTATTCGCATTTGCACTACGACATCATCCCGGGGGCA
3   H01   T001093_01                  Rv1093
                       GCTCGCTGAGGTTGACCCCGATATCGCCGAGTTGCTGGCCAAGGA
3   H03   T001094_01                  Rv1094
                       AGATCCTGCTGATCCTCAAGGACAACCTGGCCGGTCATCACCGTG
3   H05   T001095_01                  Rv1095
                       GACCGCTTCCGCGGATATCGATGCGTTGTTCGCCGATGGCGAGAT
3   H07   T001096_01                  Rv1096
                       ACCTTTCGACTGGATCAACGACTCCAACACGGCAGCAACCCGGCA
3   H09   T001097_01                  Rv1097c
                       ATATCACAATCGCCGACAGTTCACGCAACGTCAAAGGTGATTCGGT
3   H11   T001098_01                  Rv1098c
                       CAACGGCGCATTCGAACTCAACGTCTACATCCCGATGATGGCCCG
3   H13   T001099_01                  Rv1099c
                       ATGCGCTCGAAGTCCGGCACCGTCCGGATGATCGAGGCCTACCAC
3   H15   T001100_01                  Rv1100
                       ACGCGGCGACCTCAATCGTGGGATTCATCAGCCCGACCGGGAGAT
3   H17   T001101_01                  Rv1101c
                       ACTATTTCGTTCTGATCGTGGTGGCAGCCGTCGGCGCCTATTTGTT
3   H19   T001102_01                  Rv1102c
                       TAGACGCGGTGAACGGGCTGAATCAACCGTCAGTCGTCAGCTGCG
3   H21   T001103_01                  Rv1103c
                       GCGGGTGCATACCAAACTGGTACCATCTGTGAAGTGAGTACACAG
3   H23   T001104_01                  Rv1104
                       CTCGGAGCGCTTGGCTTCCTGGACTTGTCGTCGTTCAACACGTCAC
3   J01   T001105_01                  Rv1105
                       CGCTGAAGGGCACAGCGGGGTGGCGCCGGTGTATCTGTATCGGT
3   J03   T001106_01                  Rv1106c
                       ACCTGGACAACTACTTTTCGATCGCTAAGGCACGCCGCGACCTGG
3   J05   T001107_01                  Rv1107c
                       AGCTGATGGAAGTCGTGCGGCTTCTGGAGCAGGGCGGATTGGACC
3   J07   T001108_01                  Rv1108c
                       GCCGAAGGCGTTCAGGTAGTGGTCTGCGGCAAGCCCTCGTTCTAC
3   J09   T001109_01                  Rv1109c
                       AAGCTGCCACGAACCATCCTGATGTACCCAATGACCCTGGCCAGC
3   J11   T001110_01                  Rv1110
                       GATCGTGCATAACCGCCACGTGGTTGACACCCTGGCTAAGGCCGG
3   J13   T001111_01                  Rv1111c
                       GTTCAAAGACCTCTTGATCAACTGCGGCTACTCGCTCATCGAACGT
3   J15   T001112_01                  Rv1112
                       GCTGGGTAACAAGTTCCTGGCTCATATCCGCGAATGCGACGCCAT
3   J17   T001113_01                  Rv1113
                       CCTTGTTAGCCAAAGCGGCCGAATTGACTGGGGTGAAAGAGAAGT
3   J19   T001114_01                  Rv1114
                       ATCGAGGAGCTGGCGCTTGGCTCGATCAAGCAGCGAGACGTTGTT
3   J21   T001115_01                  Rv1115
                       AAGCGGCTGCCGCGGGTTCAGCACGTCCCTCTTAGCAAAAAGAAA
3   J23   T001116_01                  Rv1116
                       GACAAGGCCCCCGAACTTCGTGCCACTCAGATGGACCATGTCCGG
3   L01   T001117_01                  Rv1117
                       TCTTCATCGTCGTCAAGTTCGAGACCAAACCCGAGTGGACCGAGC
3   L03   T001118_01                  Rv1118c
                       CGGCATATTGCGCGGAGACGGTGGCCATCACCTATGAGGAAATGG
3   L05   T001119_01                  Rv1119c
                       AACCGGTGCACGACGCCGTCAGCGACTGTGCCGATATCCGTTTCG
3   L07   T001120_01                  Rv1120c
                       TCTCCGACATCGAGGAGTCCACCGCGCTCGACGAACGAATCGGGG
3   L09   T001121_01                  Rv1121
                       GTCGTCGAGCTGGAGTACCTGAGGTTCGCCAATCAGGCGTTAGCC
3   L11   T001122_01                  Rv1122
                       TGAGGTCGCGCCATCGGAACAAGGCTATTTGCATTGTGGGCCTTG
3   L13   T001123_01                  Rv1123c
                       CGAGAACTTCGAACGGGCTGCCATGGGCCTGACGATCCCGGTCCT
3   L15   T001124_01                  Rv1124
                       ATGGCCACGACGATGGCTGTGCCACATCGGCATTCACTCATTGGA
3   L17   T001125_01                  Rv1125
                       CCATGGCCAAACCGGGTGTGCCACGGTCATATAACCACTTCGGCA
3   L19   T001126_01                  Rv1126c
                       CGCTTACCGCGATTTCCGTTCCGTCAACGCCGATTTCAAGAGGCTG
3   L21   T001127_01                  Rv1127c
                       CGGATCCACGATCGCCGCGATCTGGGATGACGTGCTGGATCGGAT
3   L23   T001128_01                  Rv1128c
                       TGTTGAAGTAATCCGTGCTTTCGTGCACCGCCTACCATCCTGGGTA
3   N01   T001129_01                  Rv1129c
                       GGATACCGTTCATCTTCGTCCGCACCGACAAGGCCGGAAACATCTC
3   N03   T001130_01                  Rv1130
                       CCTATGAGATCCACATCGACCTAACCCGCGGAATCTGCTTGCACGA
3   N05   T001131_01                  Rv1131
                       CGTACTACCTGATGGGATTCGACATCGCCAGCTTCACCCCGATCTT
3   N07   T001132_01                  Rv1132
                       TGTGATCTCCACGATGATGTCCAACAACCCGCTGTTTCGGCCGCGG
3   N09   T001133_01                  Rv1133c
                       GATGACGGTCGAGTGGATCACCTACGCGCAGTCGCTGACCGACAA
3   N11   T001134_01                  Rv1134
                       GCCATTCCCGATGGAGACGGTCTACCTGTGGGAGGACGGCCCGAA
3   N13   T001135_01                  Rv1135c
                       TTCGGGAACGCAGGCAACAACAACTTCGGGTTCGGCAACTCGGGA
3   N15   T001136_01                  Rv1136
                       CGGAAGCCCGCAATGCGGTCAATGGTGCCGTCAGCATCGTGGTTG
3   N17   T001137_01                  Rv1137c
                       ATGCTCGTTGTGCCCACCTCAGCGCGACACTGCGCCCCGGCATCG
3   N19   T001138_01                  Rv1138c
                       GGCGTCGCGATCTTGTCCCGCCAACGACCCGAACTTGCCTGGTTT
3   N21   T001139_01                  Rv1139c
                       CACCCTGGCCAATGCGACCTTGCTGACCGTTCGTCTGCGGGTGGA
3   N23   T001140_01                  Rv1140
                       ACCAGCCTGCACATCCTGACCACTCCAACCGCGAAAGTCCGGCCT
3   P01   T001141_01                  Rv1141c
                       TGGCGTTCGCCCAGGCCAAAAACGCCATCAATGCAGCCGCCCTCA
3   P03   T001142_01                  Rv1142c
                       TGGCTATCGCCAAGACGAAGAACGCGATCAATGCGGCCACGCTCA
3   P05   T001143_01                  Rv1143
                       GTATCGTGACCGCCGACCTGAAGTCCGATCAGGGACTCGAGCTTG
3   P07   T001144_01                  Rv1144
                       ACGGCGTGTTCCCGCTGGCCGCGTTCCGCAAGATCGTGGACATCA
3   P09   T001145_01                  Rv1145
                       GTGGGATCGATGGCCGTATTGCGACTCGTTACGTTTGCCACCGAG
3   P11   T001146_01                  Rv1146
                       TATGCCGGTCCTACTGTTTTGCATCGCATTCGGTTTGTCCATGGAC
3   P13   T001147_01                  Rv1147
                       GACGGACAAGACGGTCGAGGAGTTCCGCGACACCGAGACGTTTGA
3   P15   T001148_01                  Rv1148c
                       TTCCGAGCCTATGACGGCCCGGTTCTTGTCAGTGGTGCTTCGTAG
3   P17   T001149_01                  Rv1149
                       TTAGCGATCACCGGCTTATCCTGGAAGGGATCGCGTGGCGGTTCC
3   P19   T001150_01                  Rv1150
                       TCGCCGACAAGGCCTACTCACACCCAAGTACCCGTGCCGCATTAC
3   P21   T001151_01                  Rv1151c
                       CGGTGTACCGACGTTCCGCGATGACAAGAACGGATTGTGGGCCCG
3   P23   T001152_01                  Rv1152
                       TTGGTTACGGGTCGACGTGAAGGCGGGAAAGCCGTTGTTCGACCA
4   A01   T001153_01                  Rv1153c
                       CGAAGGATTACTGATGTACCTACAACCCGAACAGGCACTGGGGTTA
4   A03   T001154_01                  Rv1154c
                       TGGCAGGTACCCAAGGGCAGCACCCTGGACAGCACCATCGGCCAG
4   A05   T001155_01                  Rv1155
                       TAAGCACGACGGGCGCCCCCAGTTGTCCAACGTGCAATATCACTTC
4   A07   T001156_01                  Rv1156
                       TGCTATACACCGATTTCCGGGCTCGATGGCCAAACGCATCCAGGC
4   A09   T001157_01                  Rv1157c
                       CGAATCCAAGAACGTCGCTTCCTCGGTGAACCAGTTTGTGGCTGAG
4   A11   T001158_01                  Rv1158c
                       CCCAACATTCCGCAGCAGCTGATCAGCTCGGCCGCCAACGCACCG
4   A13   T001159_01                  Rv1159
                       GGCTGTGGTCTTCTACCCGTTGCATTTGGTGCCGTTCGGTCTGATC
4   A15   T001160_01                  Rv1160
                       TGCTGAATCAGATCGTGGTTGCCGGAGCCATCGTCCGCGGTTGCA
4   A17   T001161_01                  Rv1161
                       AATGTTACGTCCGTAACCAGGTTCCGTTCTTTGTCGACTATGTGCG
4   A19   T001162_01                  Rv1162
                       GGTCGGGATGACCGAGGAGCAGATCTACCAGATGTACCGACTGTT
4   A21   T001163_01                  Rv1163
                       AGTCACCCTATGAGTACACCGTGGCGGCGATCTGCGAGACACTGC
4   A23   T001164_01                  Rv1164
                       CATTTCGGCAGCTTGCTGGTGATCATGGGCCACGTGATGGGCCTG
4   C01   T001165_01                  Rv1165
                       GATCCGTCAGGTGGATGGTCAGCAGACCGTCACCACTGCCAAGAT
4   C03   T001166_01                  Rv1166
                       TGATCACCGCGGTCGAACCGCGACTGTGGAATATGTCGACCGTGT
4   C05   T001167_01                  Rv1167c
                       GGACCGTGAGCAGCTCACACGCATTATCGACGCCATGATCCTCAC
4   C07   T001168_01                  Rv1168c
                       CCGGAGTTCAACTCCCTCAACATCCAAGGTAGCGCTCGTCCGTTTC
4   C09   T001169_01                  Rv1169c
                       TACAAGGCGATCGCGCGCCAGGCCCATGTGATCCACGAGTCATTT
4   C11   T001170_01                  Rv1170
                       TGTCGTGGTGACCTATGACCCCAATGGCGGTTACGGTCATCCTGA
4   C13   T001171_01                  Rv1171
                       CGCTTGCCGGGGCTCTGCTGATGCCCTGGTATATCGGCTCGGCTC
4   C15   T001172_01                  Rv1172c
                       CTTCTTCTATTACCTCGGCGAGCCCATCGTGCAGGCAGTCCTGTTC
4   C17   T001173_01                  Rv1173
                       TCCGAGCGCGCCGATACGTTACATGCGATTCGCAAGTCGCACAAG
4   C19   T001174_01                  Rv1174c
                       AGCTGTGCCGGGGGCGGCACAGTACATCGGCCTTGTCGAGTCGG
4   C21   T001175_01                  Rv1175c
                       GCCGCATTCCCGGCAAAGAGGAATTCAGCGAAACCATCCGGTATTT
4   C23   T001176_01                  Rv1176c
                       GGGCTACGAGTTGGCCCGCCGATTCGATCGCTCCATCGGCTATTT
4   E01   T001177_01                  Rv1177
                       AAGCTATCTTCTACGAAGACGATGTGCCCGAACAGTGGAGCCATTA
4   E03   T001178_01                  Rv1178
                       TATCGGCACCAAGGAACTCATCGCCTGGTTGCCGACGTTGTTGGG
4   E05   T001179_01                  Rv1179c
                       GATCCCGACACCCGCTCTGGTTAGGGAAGGCGACCTGGCTCCCTA
4   E07   T001180_01                  Rv1180
                       AGCTGGCTGAGATTGACACTGAACTCTTTGTGCCGCAAGCGAATAC
4   E09   T001181_01                  Rv1181
                       CCGCCCATGAGTCCAGCATGAGCGGTGAGGAACTGCGAAAAATGT
4   E11   T001182_01                  Rv1182
                       ACGAAGTTCGCCGAAGGTACTAACGGTAGCTTTCCTGATTTTCCAC
4   E13   T001183_01                  Rv1183
                       AACAGTTTCGATTGGCTTGACTCTGTTGTCGCCGCTTTGGATACCA
4   E15   T001184_01                  Rv1184c
                       AATTTTTCCCCCCGGTAGCCACATTCCGATTCCCTTCATCGAATATA
4   E17   T001185_01                  Rv1185c
                       GCTCAGTAGATTCTGCAACCGGTTTGCACCGTACAATTTCCGCGAA
4   E19   T001186_01                  Rv1186c
                       GTACCACTTGGTGAATCATGTCTTGGAGCATCATGGTGACCGGGC
4   E21   T001187_01                  Rv1187
                       TATTTCGTGCGCCCCACGGTGTTGCTCTCCGACGACCCGACCGAC
4   E23   T001188_01                  Rv1188
                       ATTGTCGATATCGGGCGATTTGCGCGTCGACTTTCCTTGGCTGGG
4   G01   T001189_01                  Rv1189
                       CACAAAAATCCATGTCTTAGTGCAGCCTTCAACATTGGACCCGTTA
4   G03   T001190_01                  Rv1190
                       CGCCAACACTTGCCCAGGCGGCCGATGCAATCACCTCGGTCATTG
4   G05   T001191_01                  Rv1191
                       TGGGCTTGGCCGTGGTGAAGAGATTTTGAGCACCCTGATGCAGAT
4   G07   T001192_01                  Rv1192
                       GCCTGTGTTAGAGCCCGCTGACCGCCCCTGTGATGCCCCCGGATG
4   G09   T001193_01                  Rv1193
                       ACGACGGGGAAACCGTTGGAAAGCTTCAGGTTCGCGGTCCGACCC
4   G11   T001194_01                  Rv1194c
                       AGCGTTCAACATCTATCGAACCGGTGAGCACATCGGGTGGCGGTT
4   G13   T001195_01                  Rv1195
                       ATGTATCAGTCCGTGAGCGCTCGGGCTGCTGCGATTCATGACCAG
4   G15   T001196_01                  Rv1196
                       GCCTTCTTCCAAGCTGGGTGGCCTGTGGAAGACGGTCTCGCCGCA
4   G17   T001197_01                  Rv1197
                       ATGAATCAGGCGTTTCGCAACATCGTGAACATGCTGCACGGGGTG
4   G19   T001198_01                  Rv1198
                       GTTGCTGGAGGCCGAGCATCAGGCCATCATTCGTGATGTGTTGAC
4   G21   T001199_01                  Rv1199c
                       CTGCTGCACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTG
4   G23   T001200_01                  Rv1200
                       ATGTATGCCATCGGCGGATTCGGTTTCGGACCCACGGCATCGTTC
4   I01   T001201_01                  Rv1201c
                       CCTGGTGGCGCCCCATGGGTTGAACGCCGGCGGCTTGTTTGGGG
4   I03   T001202_01                  Rv1202
                       GCGACGCGGTCTTCCTTCATCTGGCCGCTACACTGGCCGAACCGA
4   I05   T001203_01                  Rv1203c
                       TGATGTTGTTGGCAACGGCCATCGCGCAGCAAGGCCATATCGCCG
4   I07   T001204_01                  Rv1204c
                       ACCCATCCGACCATGTCAGCGATCAGTTACGGCTGTCCTCACTGGC
4   I09   T001205_01                  Rv1205
                       CACGGCGATGGAACGGCTGGTGGTAGTCGATAACGTCAAGGACGC
4   I11   T001206_01                  Rv1206
                       TGTGCGAGTTCTACGCCGCCAGCGAAGGCAACTCGGCCTTTATCA
4   I13   T001207_01                  Rv1207
                       GCTGATGGCTTTGAGCAACAAGGACGTTGTCGGGGAGACTCTGGG
4   I15   T001208_01                  Rv1208
                       TGCTGACATCGCTGCCATTTGCCCCCGGCTACGGCGTGGAGATCG
4   I17   T001209_01                  Rv1209
                       TGGTGTTGGTGTACCTGGTGGTGCTGGTCCTGGTGGCGATCGTGC
4   I19   T001210_01                  Rv1210
                       TTCCGGCGCGCATTCTCTGGGTTCGACATCGACAAGATCGCTCGC
4   I21   T001211_01                  Rv1211
                       CCTGGTCGTCGAGCTGACACCCGACGAAGCCGCCGCACTGGGTG
4   I23   T001212_01                  Rv1212c
                       CCGGCTTACCATCGGACAACTACGAGAAATACTTTCGGCAGCAACA
4   K01   T001213_01                  Rv1213
                       ATACCGGCTCCGCCGATGCGATCTATCAATCGCTGAACTTGATCTA
4   K03   T001214_01                  Rv1214c
                       GGCGCAGAGCGTGCAGCAAGACGTGCTGAATGTGATCAACGCTCC
4   K05   T001215_01                  Rv1215c
                       CCAAACTCGCTCTCGGGCAGCAGCATTCAATTGGACGATCCCCGA
4   K07   T001216_01                  Rv1216c
                       CATTGGGCTGAAGATATTCATATGGGGCGTGTTAGGACTCGTCGTT
4   K09   T001217_01                  Rv1217c
                       ACAGCCTGGGTGCGGTCGGAATCTGGAAAGCCGGGATGTTTCACA
4   K11   T001218_01                  Rv1218c
                       CGGCACCTCAGCCGCACCTCGATCAAGGCCGAAATGATCGGTGAT
4   K13   T001219_01                  Rv1219c
                       AGCTGGCGAAGATGCTGTGGCAGAAGATGATCGACAACGCCGAGG
4   K15   T001220_01                  Rv1220c
                       TTGTCGGGCATGCGCGACGACGGCGTCTTGACCACCATCGATATC
4   K17   T001221_01                  Rv1221
                       AACTCCTCGGCGGACCCCGGGTTGGGAATACGGAATCGCAACTTT
4   K19   T001222_01                  Rv1222
                       TGCTCGGATTACTGTCCGAGATCCCGCGTTGTCCACCTGAAGGTC
4   K21   T001223_01                  Rv1223
                       AGATGAAATTGGTGGCAAATTCTCTGATCAAAGACGGAAAGATCGT
4   K23   T001224_01                  Rv1224
                       TATCTCAGCGGTGTGACCAGCCAGCTACGTGAGGACATTGGACCC
4   M01   T001225_01                  Rv1225c
                       GGTGGTGGCGATGCACCGCAATATGACCTGGAACACCACCGACGG
4   M03   T001226_01                  Rv1226c
                       GGTGGTGGCGGTCACTGTGCTGCTGGTGGTGGGTGTATCGGCAC
4   M05   T001227_01                  Rv1227c
                       TTGGACCATGCTCGAAATGTGCCAAGCGCAACCGGACCGCAGAGA
4   M07   T001228_01                  Rv1228
                       AACGTTCAACTCGGATATGGGTGGGGGCACCGAGTTCTTCTTGAC
4   M09   T001229_01                  Rv1229c
                       CGATGATCCTGCCGCCGATCGCCCACCAGGTGAAGGTCATCTCGA
4   M11   T001230_01                  Rv1230c
                       CTGGACGGCACCCTGCCAGGCAACGAGATCATCATCCAAAGCAGC
4   M13   T001231_01                  Rv1231c
                       GAACCTGTTTGCGGTCGGCTTGCGCTGGGATCCGTACCCCTTCAT
4   M15   T001232_01                  Rv1232c
                       CTGCTGGGAGCGGTGACCGTGGACGACCTGCTCGACCATCTATTG
4   M17   T001233_01                  Rv1233c
                       GCCATCAACCAGATCAAGCAGACACGCGAAGAAGGCTACGGCCTG
4   M19   T001234_01                  Rv1234
                       CTACGACGTACTTTGTGATCCGCAAAATGCGGAAAAGGCACGGGA
4   M21   T001235_01                  Rv1235
                       CTCCGATCCGCAATTCCAGGCGAAGTATCCGATGCACGCCATTATT
4   M23   T001236_01                  Rv1236
                       ACACCGGATCGGTGTCGATCTTGGGCTACGACAACCTGTTCAAGG
4   O01   T001237_01                  Rv1237
                       CATCGTCTTTGTTTTAATCTTCCAACGACGGATTGTCGCCGGGTTG
4   O03   T001238_01                  Rv1238
                       CAGGTGAAGGTCAACTTGGTCGAGTCTTTAGGCGCCGACAAATATC
4   O05   T001239_01                  Rv1239c
                       AGTGATCGGCGGGATGGTCCTTATCTGTCTGTTCCTCTACCACGTC
4   O07   T001240_01                  Rv1240
                       CGGCGGTCACCGACATCAAGAAGATGACGATCTGGGGCAATCACT
4   O09   T001241_01                  Rv1241
                       TATCGGTTGGAGCCGCATGAGTCGGCTGTGCGTTCCGGGTTGGAT
4   O11   T001242_01                  Rv1242
                       GATCCATTCCAGTGACACCGACTTTGCCCGATTCGCCGATCTGAAG
4   O13   T001243_01                  Rv1243c
                       GGAACGCCCAGGCCTATCAAGCGCTGAGCGCACAGGCGGCGGCA
4   O15   T001244_01                  Rv1244
                       CGAGGGCATAGCCGCAGGCGACTACACCACCGCCGCAGAAGACAA
4   O17   T001245_01                  Rv1245c
                       TAGCCTACGCCGATGCGGTCAACGAGCACTTCGGCACTGTGAACC
4   O19   T001246_01                  Rv1246c
                       CCGAGTCGAGATCATCCACATCGCTCGTCGCAGTGCCAGCTACCG
4   O21   T001247_01                  Rv1247c
                       ATGGCTGTTGTCCCACTGGGCGAAGTCCGCAATCGCCTCTCTGAG
4   O23   T001248_01                  Rv1248c
                       TGTTGCGTCACAAGGCCGCCGTCAGCGAAATCAAGGACTTCACCG
4   A02   T001249_01                  Rv1249c
                       GCGAATGCTCAAATACGTCGTCAAACGATTCGCGCTGAAACGCGG
4   A04   T001250_01                  Rv1250
                       CGGCGTCGGATTGTCTGGTGCGGGAATGTTTCTGATTGTCTTCGG
4   A06   T001251_01                  Rv1251c
                       ATACCCGTTGGTACGCAAGAGCATTCGGGTGGGCACCGACTCGTT
4   A08   T001252_01                  Rv1252c
                       CAGTGCACGGGAGACACGGTGGCATTGACGTATGCCAGCGGCATC
4   A10   T001253_01                  Rv1253
                       ATCTGCACGATCCGTTCGAAGTCACTTGTAAGGCGAAAACCGCTGT
4   A12   T001254_01                  Rv1254
                       GATCGGCGTTCCGATCTTTTTCGTGCTGTCGGGGTTCCTGCTATTC
4   A14   T001255_01                  Rv1255c
                       CTGATGTTCCCCGGCCGTGACGAAGCCGACGAACGAGCGATGATC
4   A16   T001256_01                  Rv1256c
                       TGGTGGTGGCGCACTATCTCGGTGTTCCCGAAGAGGATTGGACGC
4   A18   T001257_01                  Rv1257c
                       GGCTGTGCTGCGTGAAGTACGGCGTCACAGGCGACTACGTACTGG
4   A20   T001258_01                  Rv1258c
                       ATTGACCTGACCGTCACCGCGCTGTATCTGCCGATGGAGAGCGTG
4   A22   T001259_01                  Rv1259
                       CGGTAGGTTGACTCCTACGATGCTCGACGACATTTTCCGTGAGGC
4   A24   T001260_01                  Rv1260
                       CGAGCTGCTACGTGACGATCTTGTCGAATTGCTCTACGGGGCAAC
4   C02   T001261_01                  Rv1261c
                       CACGACCCGGACTACGCGCGGCTCTGGCAGATCGTCAACGAGAAC
4   C04   T001262_01                  Rv1262c
                       CCGCTTTTCAGACGGTGTTCCACGTTCACTTGCACGTATTACCGCC
4   C06   T001263_01                  Rv1263
                       TCCGATGGTGGCGGATCGATTCGTATCCCGTGTACCTGGTGCGGT
4   C08   T001264_01                  Rv1264
                       GCCATTGCTGGACACCGTGCTGAAGCTGGTCGAGGTCGTCGACAC
4   C10   T001265_01                  Rv1265
                       CGTGAAGAAATTACGGTGATTGGCAAGCTGCCTGGACTCGAGAGC
4   C12   T001266_01                  Rv1266c
                       CGGGTACCGGATCACCAATCAAGCAGGCCAGATCGCCGCCAAGAT
4   C14   T001267_01                  Rv1267c
                       CTCGATGACCTGCGCGACTTCCAGTTCGTCGAACCCTTTGCCACGG
4   C16   T001268_01                  Rv1268c
                       AACGGCATTGTTCACCTCAACGACAGCGGTACCCCCACGGGCCGC
4   C18   T001269_01                  Rv1269c
                       AACGATAGGGCATACCAGGGAGGAGTTGGACCCACCTTGGCCGCC
4   C20   T001270_01                  Rv1270c
                       ATCGCTTCGGATGGATCCTCGCACTTGGTCCAGATCCAGATCGCTC
4   C22   T001271_01                  Rv1271c
                       GGCACCGAGATCGCCGAGGAGGTCCTCAGCCAAACCAACCTGACC
4   C24   T001272_01                  Rv1272c
                       CTGCTCAACCTCACCGTGCAGAAAACGATGGTCAGGTTGCGGACC
4   E02   T001273_01                  Rv1273c
                       TTGTTACACAACGGATTTCGAATGCCGCTCAGGCCGACCAGGTCAT
4   E04   T001274_01                  Rv1274
                       GAAGCCGTTCCCGCTGCCGTGCGACATCGCCAAAGAACTGACCCG
4   E06   T001275_01                  Rv1275
                       AACTCCCAGGAGCGCTACCCCAACCTGCTCAAGGAATGTGAGGTC
4   E08   T001276_01                  Rv1276c
                       GATCGAGGAGATCAACCGGGTTGGCGACAACGTCACCACACTGCT
4   E10   T001277_01                  Rv1277
                       TCGCCGCACTCGACGACGCGCTGACTCGACAGGCGATTCATTATG
4   E12   T001278_01                  Rv1278
                       GCTCCGAGGTCATTGCCGAAATCAGCAGCGGCCCTTATCGTTTCG
4   E14   T001279_01                  Rv1279
                       AAAGGACAGCTTGTTTGCCGCCGAGAAGCCCGGCCAGTTGATCAG
4   E16   T001280_01                  Rv1280c
                       GGCGTCGTTTCAGGGGAAATCCAGACCCTGGACGCAGACTCGATA
4   E18   T001281_01                  Rv1281c
                       CCTGCTGCTCGACCTCCAAGAGCAGTTCGGGTTGTCATATTTATTT
4   E20   T001282_01                  Rv1282c
                       GATGAGCTTGCGAGAACGCGAATTCATCAGGGCCGCACGATATAT
4   E22   T001283_01                  Rv1283c
                       AGATCTTCGGCTGGCACGGCATGGGTGAATGGATGGTCCGCGGTA
4   E24   T001284_01                  Rv1284
                       TGGCCAACAACGTGGACTACGCGAGCGGTTTCAAGGGCCCGCTAC
4   G02   T001285_01                  Rv1285
                       TACCGGATTTATCAGGTATGAGGACGTGGAACAGGAAGCCATGAC
4   G04   T001286_01                  Rv1286
                       TACTTCGCCACTCCCAAGCGGAAATTCATCATTGCCGACACCCCGG
4   G06   T001287_01                  Rv1287
                       GAGATCAGCATCGCCGACGTATTGCGCTGCATCGACGGACCGCTG
4   G08   T001288_01                  Rv1288
                       TGCCTGACTTCACGCGATACACCGTTGTTGCCGGGGACACGCTGT
4   G10   T001289_01                  Rv1289
                       ATGCTGACGAATCCTCGGTTGAATTCGAAGTAAGCCCGTACGTGAA
4   G12   T001290_01                  Rv1290c
                       GCTGGCATTCGTCAGCATCGCCGCGCTGATCTACTTCCTGCACCA
4   G14   T001291_01                  Rv1291c
                       ATGTTCACTCGCCGTTTCGCCGCCTCCATGGTTGGCACCACCTTGA
4   G16   T001292_01                  Rv1292
                       AATCGGCGTCGACTTGATGTTCGACCACATCAAACAGTCTCTGCAC
4   G18   T001293_01                  Rv1293
                       GGCCCGGCGATCTGGTTGCGGTTGCCGCCACCGGCGCTTACTGC
4   G20   T001294_01                  Rv1294
                       GTGAGTCTAAATACGCTCAACTTCCGGTGGCACCAATGGGTTTCAT
4   G22   T001295_01                  Rv1295
                       GTGTGCACGGTAACCGGCAACGGTCTTAAGGATCCCGACACCGCG
4   G24   T001296_01                  Rv1296
                       ACCACAGTGGTGACCGGCCCAACTATTCGGCCGTATCACTGCGGC
4   I02   T001297_01                  Rv1297
                       GCAAGGCAAGGACGTCGTGGTGCTGCTCGATTCAATCACCCGGCT
4   I04   T001298_01                  Rv1298
                       GTAGCACCAAGCCGGGAGGTCGTATTGTGGTTGAGGTTTGTTCGC
4   I06   T001299_01                  Rv1299
                       TGGCGATCTTGACGCGTTGTTCGACGCTCTGTCCGCCGCGGACAA
4   I08   T001300_01                  Rv1300
                       CAACTGTCGATTTGGTCAGCAGCACAAAACTTTTCGTGGACGTACA
4   I10   T001301_01                  Rv1301
                       ATATGCCGGTAGGTGTGCTGGTCGGCTCTTGGCACACGATCGAGG
4   I12   T001302_01                  Rv1302
                       ACCATCGTCTTGGACCAGGCTTCCTCGATCCTGCTTACCCTGGCGC
4   I14   T001303_01                  Rv1303
                       ACCGGTCGCAACTTATTCTTCCAATGGCCAGACCGGGGGATCGGA
4   I16   T001304_01                  Rv1304
                       CTTCATTTTTGCGCTGCTGACAATTTTGTACTTCAGCCAAGCGATGG
4   I18   T001305_01                  Rv1305
                       CCCGAGGCGCAAGGGCGGCTGTTCACACCGTTCTTCATCACCGTC
4   I20   T001306_01                  Rv1306
                       GGTGCCGCCGATCTTGAAGGTCTTGCGGGAACGTGACGCTATGGT
4   I22   T001307_01                  Rv1307
                       CTGTTCGGGTTCGCGGTCATCGTTTATCTGGTGTGGCGATTTATCG
4   I24   T001308_01                  Rv1308
                       ATCCAGAGCGCAATCGAAGAGTACGTAAGCTCTTTCACCGCCGACA
4   K02   T001309_01                  Rv1309
                       GTCCGATCGTGGTTTGTGCGGCGCATACAACGCCAATATTTTCCGT
4   K04   T001310_01                  Rv1310
                       AGGAAGTCATCCGGATCCTGCAGCGTTACAAGGACCTTCAGGACA
4   K06   T001311_01                  Rv1311
                       CGAATTGAACGTTGAGATCGTCGCCGTCGACCGGAACATCTGGTC
4   K08   T001312_01                  Rv1312
                       GACAGCACCCAGGACCGAAGGGTAGGTTACGAGATCGCGCTCGAC
4   K10   T001313_01                  Rv1313c
                       GCCTATCCCAAGGCCTGATCGAATCCACCAACACCAAGATCCGCCT
4   K12   T001314_01                  Rv1314c
                       AGCGTACTGCCGGCGAAATACCTGAACCGGCTGTCGGATCTGCTG
4   K14   T001315_01                  Rv1315
                       TGGCGTCGATCGCCGACGGCACATCGATGATCACGGAGAACGTGT
4   K16   T001316_01                  Rv1316c
                       GCGAGCTCACCGAATTCGATGTGGAACTTGACCTCCGGGGAACCG
4   K18   T001317_01                  Rv1317c
                       CACCCAGCACCTGTGGACCACCCTGGAACATCCGGTAAACCAATG
4   K20   T001318_01                  Rv1318c
                       TTCGCGACGGGCGTGCTGATCATCTCGATGGTCACATTGGTGTTC
4   K22   T001319_01                  Rv1319c
                       GCGGCGTTTTGGTAGCCACCAATTGCTACTTGTTCACCGAGTTCGC
4   K24   T001320_01                  Rv1320c
                       ACGTGATCGGGCTCATTGTCGGTGCCATGCTACTGACGGTCGCCT
4   M02   T001321_01                  Rv1321
                       GATCCGTTGTTTGACATTGGATTACGACACAATGCGCGGGATGGAT
4   M04   T001322_01                  Rv1322
                       TCAAGACCTATCGCTGTCCGGGGTGTGATCACGAAATCCGTTCCG
4   M06   T001323_01                  Rv1323
                       TCAACGTCAACGGTGGTGCGATTGCCGTCGGGCATCCCCTCGGCA
4   M08   T001324_01                  Rv1324
                       TGGCGACTTTGTTGCCGCGCGCAAGTCATATCAGGCGATTTTGGAT
4   M10   T001325_01                  Rv1325c
                       GTGAGCGCTCAGATGTCGGCGTTTCATGCCCAGTTCGTTCAAACCT
4   M12   T001326_01                  Rv1326c
                       GTGAGTTGACGGATTACATTGTGGATCAAGGGTTTACCCATGTGGA
4   M14   T001327_01                  Rv1327c
                       GATACTAGGGTGGGTATCGGGCGCAAGAAGGACACACAAGGAACG
4   M16   T001328_01                  Rv1328
                       CGCTAGAGGCGTGTGGTACCTCGGGCATGAAAAGCGCGCTTAACG
4   M18   T001329_01                  Rv1329c
                       TCGCCCTGCTCAAAGGTCGACGGAACTACCTGTGCCTGAACAAGA
4   M20   T001330_01                  Rv1330c
                       CGGCAGCTTCGCCGAATGCGTCCTGCTCGAAACGCTGGTGCTGTC
4   M22   T001331_01                  Rv1331
                       TTGCAGGTGCACAACGAAGGTAAGGCGGTGGTGTCCGCGGGCAG
4   M24   T001332_01                  Rv1332
                       ACGGCTCCGAGAGCTTCAACGCTGCCCTGCGCAGCCTGCACGAAC
4   O02   T001333_01                  Rv1333
                       CCCGCTGGGAGCCTTCAACACCCCGTTCAATACGACGATCGGTGT
4   O04   T001334_01                  Rv1334
                       GCTACGCAGCTACCGCATCGTCGATGGCGCTGTCACCGAGGAACC
4   O06   T001335_01                  Rv1335
                       TTGCACCGCTTCGTGAACATCTACGTCAACGACGAGGACGTGCGG
4   O08   T001336_01                  Rv1336
                       ACCGCCAAAGAGCTGGCCGCGACCAACCCGTCATGGGTGATGCTG
4   O10   T001337_01                  Rv1337
                       ATCTTTGGCTGGCTGGCCTTCCTATTGGTGTTCGGGCTTTTTGTGC
4   O12   T001338_01                  Rv1338
                       CCGGCAACTCGGATATTTGAAGCTACGGGCGACCCCGAAGCGTTT
4   O14   T001339_01                  Rv1339
                       GCGTCGATGTATTCCGCATCGTTGTATCGGGCATGGCACAGTAGTG
4   O16   T001340_01                  Rv1340
                       TCGACCTGGCGGCGCTGGGGGAGAACACGATCGCTATCGATTGTG
4   O18   T001341_01                  Rv1341
                       GACGCTGTTGTCGCTGGGCGATGTGTCGCCGCTGCCTGAAACACC
4   O20   T001342_01                  Rv1342c
                       ACGGCTGGGTGTACTTCACGTATCTGCTTCTGACGTTGAACCTGGC
4   O22   T001343_01                  Rv1343c
                       GGCACCTTTCAAAATCTGGGTTACGCGTTGCAGTGGCCATTGTTTG
4   O24   T001344_01                  Rv1344
                       GGAGCTCTTGACGTGCGACACGGTCGGAGAACTGGAGGCAGCGA
4   B02   T001345_01                  Rv1345
                       GCCGTGAAATTGGCGAAATCGAGATTCGCGGTGCGTCGATGATGG
4   B04   T001346_01                  Rv1346
                       CGCCGCCCGGCTCGGTGAGGAAGTCATCTCCGAATGCATGCACAT
4   B06   T001347_01                  Rv1347c
                       ATCTCGAATTATACTGGGCAGCAAAGGATTTGATTTCTCACTACTAC
4   B08   T001348_01                  Rv1348
                       GTTGGTAGCCACGCATCGAATGGATCCGGTGAATTTGTTGCCGTTC
4   B10   T001349_01                  Rv1349
                       GGTCTGCAGTGTCGTGTTCCAACATCCTTACCTGTTCCACGGGACG
4   B12   T001350_01                  Rv1350
                       CCTCGGCATTCGGGTAAACGCAATAGCTCCGGGGTTGATCCGTTC
4   B14   T001351_01                  Rv1351
                       CACCGGCCCTCGAACGTGGCAACAGCTACCCGCAAGAAATCGTCG
4   B16   T001352_01                  Rv1352
                       AGTGGTGATCCCGCCGACCGTGGCAGCCTTCCAGACGCATAACTG
4   B18   T001353_01                  Rv1353c
                       GCCATTGCTCGGCAAACACCTTGGCGTCGGGGTCACCAGCATCTA
4   B20   T001354_01                  Rv1354c
                       AACGTTGTGGTGCAAGACCTACATACCGCCAGAGCCACCCTGGCT
4   B22   T001355_01                  Rv1355c
                       GCGACCGATCTTTCATGGGCTATTGGGCGACATCGACGCCGACAA
4   B24   T001356_01                  Rv1356c
                       TTAGATCTCGACGCCATCAGTGACGGTTCCGATACACAGTTGTTCT
4   D02   T001357_01                  Rv1357c
                       AAAGTTCATCGAGTGCCTCGATGGCGACATTCAAGCTCGGCTGGC
4   D04   T001358_01                  Rv1358
                       CAGTTGTTCACTGAACGTGCGCGCCTAGTCCAACCCAATTTTGAGA
4   D06   T001359_01                  Rv1359
                       CGCATGCGCATCGCCGATGCGAGCGGAATTCCTTATGTGGGGCGG
4   D08   T001360_01                  Rv1360
                       CGCGCGCAATCCGATGATTGTCGCCAACGTGGGCTGGGACCTACA
4   D10   T001361_01                  Rv1361c
                       CTGCAACAACTGGCCCAGCCCACGAAAAGCATCTGGCCGTTCGAC
4   D12   T001362_01                  Rv1362c
                       TTCCGGTGATTCTCATCCTGCTCATGTTGATCTCTGGGGGCGCGAC
4   D14   T001363_01                  Rv1363c
                       GCGGCTCAAAGTGACCGTGACCGAAGAGGGGGGACAGTACAAGAT
4   D16   T001364_01                  Rv1364c
                       GAACTGGAGGGTCAGCAGATCTACGAAATGTTGGACCGGGTCTAT
4   D18   T001365_01                  Rv1365c
                       AGGGTCATTCACTACTCCGGTGAGCAACGCGCTCAAGGCGACCAT
4   D20   T001366_01                  Rv1366
                       GCTTCGGTTACCTGCCGGTCGTGTCGAGATACAGATTCGCACCATT
4   D22   T001367_01                  Rv1367c
                       GGTGGCAGGCCGACCCGAGCGCCGACCTGATACTGCTGTATCTGA
4   D24   T001368_01                  Rv1368
                       CATTCCGTCCACGTGGTGGTGACGGTAAACAATCTCTCGACCCTCC
4   F02   T001369_01                  Rv1369c
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
4   F04   T001370_01                  Rv1370c
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
4   F06   T001371_01                  Rv1371
                       AATTCGTAGCGACGCTGTGGGTTAGTACCTTCTTGGTGGTGGCGA
4   F08   T001372_01                  Rv1372
                       TCGACGCCAAATTTGATGTCTTCAGGCGGGAACCTGCGACGATCC
4   F10   T001373_01                  Rv1373
                       GGATGGAGGGGCCGAATCAGCCTCCCCCTGGCATAGGTTTCACAC
4   F12   T001374_01                  Rv1374c
                       TCGTACAGACAGCAAAACAAGCTACACACAACTAAATCGCATATGC
4   F14   T001375_01                  Rv1375
                       GCATCGATGTCTGGGACGGTTACTACTGTTTTGCCGCCGAGCTCAC
4   F16   T001376_01                  Rv1376
                       TTGGAGGTCTTGTCGTTTTTGAGCGTGAGCTCGGTTGACTACTGGG
4   F18   T001377_01                  Rv1377c
                       CGGAGTCGATGTCAAGTTCGCAGTGGGTGACGCCACCAAGCTGAC
4   F20   T001378_01                  Rv1378c
                       CCTTGACCTCCTTCTCCGCCTCTCTGGACGGATCGTTAAAGGATGT
4   F22   T001379_01                  Rv1379
                       CGTCGGCCGCACGATTTCGCGCATCGCGCATCAGATTATCGAGAA
4   F24   T001380_01                  Rv1380
                       GCGGACTCGTCGCAATCGGCTGTGCTGCAACAGGTTTCCAATGGA
4   H02   T001381_01                  Rv1381
                       AGATCGCCCAGATAGGACCGGATCTGGCGATCCCCGATACGGCCG
4   H04   T001382_01                  Rv1382
                       CGAGATCGATGTCGGGTTTCGGGCAGACAACCGCGACGAATACCA
4   H06   T001383_01                  Rv1383
                       CTAGATCTTGGTATCAAGACCAACACTCCGCGTAACTTCGCCCGGC
4   H08   T001384_01                  Rv1384
                       TCATCGAGGAATCGATTTACGGCTGGAAGGAATTCGAACTCGAGCT
4   H10   T001385_01                  Rv1385
                       CGCTGATTTCGCGGTGGTCAAACCGCAGGTGGCGTTTTTTGAGTC
4   H12   T001386_01                  Rv1386
                       CGGTGTGCAACGCCGTTGAGTTCAGCGTTCACGGTAGTCAGCATG
4   H14   T001387_01                  Rv1387
                       ACTGTTGTTCACCAATCCGACTGGGGCTTTTCAGTTCCTCCTCTAC
4   H16   T001388_01                  Rv1388
                       CACGTGCTACTCCCACGCTGCACGTTTGTCCCCAAAACCAGGGGG
4   H18   T001389_01                  Rv1389
                       CAGGCGATTAGAGTCTGCGTGTGCGGAATTGGTATCCTTGCTGGT
4   H20   T001390_01                  Rv1390
                       GGCGAGGGCATCCTCGAATATGTCGGTCCGCTGGTTGAGCCGGG
4   H22   T001391_01                  Rv1391
                       CTCCAAGACACTGATGGCGAGCCGTATCGTTGATGCAATCGTCACG
4   H24   T001392_01                  Rv1392
                       GACGCAGGTCACTATCGCCTACGAGGACAACGTTCCGGTGCGGCT
4   J02   T001393_01                  Rv1393c
                       CCGAGATGGCGCCAATTGTCTCCCACCTCACCGTTTTTCAGCGCAC
4   J04   T001394_01                  Rv1394c
                       TTGTCTCGATCAGTCACCCCGACTACGTCGACCATGTGCTGCACGA
4   J06   T001395_01                  Rv1395
                       ATCGCGATGCGCTATTTCGCGTTGACCACCATGCACGTCGACATCA
4   J08   T001396_01                  Rv1396c
                       GTTTAGCGGCCACGCGCAGACCTATCAGGCGCTGAGAACTCAGGC
4   J10   T001397_01                  Rv1397c
                       ATAGCTGCTACCGCCGACGTCCAGGACCTGCAATTGGCAACCCTC
4   J12   T001398_01                  Rv1398c
                       GCATCGGACCTGCAGGCTATAAACGATTCGTTCGGCACGCTTCGC
4   J14   T001399_01                  Rv1399c
                       ACGACGGTGCTTGCTACGCCGAATTGCTCACGGCCGCAGGGGTTT
4   J16   T001400_01                  Rv1400c
                       ACCCCATCCTGCTGAAGGTACTGGATGCGGTTCCGTTTCGGCTATC
4   J18   T001401_01                  Rv1401
                       CGATCCCCTGGTGGACGTGGGCGTTCGTGTTCGGCTTGGGGGCA
4   J20   T001402_01                  Rv1402
                       CAGTGCGCGGCAAACCCGGCAAACCCGTAGCCTGGTTCGGGTACA
4   J22   T001403_01                  Rv1403c
                       TTGTCGCGAATACCTCTGCGACGGCGTGATGCAGTGGGAATACCT
4   J24   T001404_01                  Rv1404
                       CTGACGGCGTCCCGGTTGCTGGTAGCCATCTCGGCCCATTCAATC
4   L02   T001405_01                  Rv1405c
                       ACTACTTCAAGAACAACTATGGCCCGACGATCGAGGCCTACGCGC
4   L04   T001406_01                  Rv1406
                       ACGTTCCAGATTGAGCCAAGCCTGGACTCGGGACCGATATACGGT
4   L06   T001407_01                  Rv1407
                       ATCGAATTCGATTCGGCGCGAGCAGGTTTCGTCAACGGTGTACTAC
4   L08   T001408_01                  Rv1408
                       TGGAGCCATACCTGGACATCCTGCCCCATTTCGACACCCTGCTCGT
4   L10   T001409_01                  Rv1409
                       ACATACCGCCGGAAGCACGGGTCCTCAACGACGAGGCACGCACCA
4   L12   T001410_01                  Rv1410c
                       GGAGCTCGGCAGCGTTCTGGGCCCGTTGTACGGAATCTTCATCGT
4   L14   T001411_01                  Rv1411c
                       AATTTCGCCGACGCAAAAGCCGAAGGGCGGGATACCATCAACGGC
4   L16   T001412_01                  Rv1412
                       TGTCCCTCCGAGCACTGGGAAGTGGTGCGCATCGAGATGCCGGCT
4   L18   T001413_01                  Rv1413
                       ACGACGTATTCATCACCTACCCATTGTGGATCGGCACACGCCAAGC
4   L20   T001414_01                  Rv1414
                       CTGCGGGTGATTCCCAACCACGTGTGCCTGACCACCAACCTCGTA
4   L22   T001415_01                  Rv1415
                       ACGTTCGATGAGGCTGCTGACCAACAACCCGGCCAAGCGGGTGGG
4   L24   T001416_01                  Rv1416
                       AATCATGATGCCGTCGTCGCACTTGGCGTCGTGATCCGCGGTCAG
4   N02   T001417_01                  Rv1417
                       TTCGGTGCGGAATCTGTTGGGTGACAGGATCGTTGGGTGGTCTGA
4   N04   T001418_01                  Rv1418
                       TACGGATTGGCTGTGGTCCCGCACGCGGTGCTGGTGTTATCGGCG
4   N06   T001419_01                  Rv1419
                       GTCAAGAGTGATCTTGATGCCTGCCTCACGGTTCTCGGCGGTCCG
4   N08   T001420_01                  Rv1420
                       CGAGGTTGAGGCACTGCAGCTGGAATACACCTGGATCAAGGAGTT
4   N10   T001421_01                  Rv1421
                       TGGTTGTCGACGGCTACCGCCGAGAGGGGAAGCGCTATATGACAA
4   N12   T001422_01                  Rv1422
                       TCTCGGTGGAGCGTCATCTGCACGTGCTAGCCCAACACGCGCCCG
4   N14   T001423_01                  Rv1423
                       AAAGACGCTGTAGCCGGACGTATTCGGCGATTGTTGTCGATGGCG
4   N16   T001424_01                  Rv1424c
                       GTCTCGCGACCAAGTTATCGTCAATGTGTGCAAGCTTCGGCCCAAA
4   N18   T001425_01                  Rv1425
                       TCCTACCAGGATTATCTGGATTTCGGCCTGGTGACCACACCCGAGG
4   N20   T001426_01                  Rv1426c
                       CGACTGGTTTACGACCGATGCGCCGGGGCGTCGGGAATTCGTCGG
4   N22   T001427_01                  Rv1427c
                       TTCGATGGCTATACATCTGGCGCCGCAAAGGATTTCCATGCCGGG
4   N24   T001428_01                  Rv1428c
                       AATTCGACCCTGGCCTAACCCAGCGCCTGATAAGTGTGCTGCGTC
4   P02   T001429_01                  Rv1429
                       CCACGGCCGACGCGATGATCCTGCACCGCAACACCATTCAATACC
4   P04   T001430_01                  Rv1430
                       GGCTACGGTGCTCCCGCAGGCGTCACCAATGCCATTTTTATTGGG
4   P06   T001431_01                  Rv1431
                       CCATCCACGTTCAGAAGCAGTGGTATCGCATTGTCGACGCCAAGAC
4   P08   T001432_01                  Rv1432
                       TTCCGCGACCGCATCGTGGCAACCGTCAGCACCTCCACCACCGAA
4   P10   T001433_01                  Rv1433
                       GCCCTTCCAGCACTGGGACTTGAAAATGTCAGCCACGGCTGCATA
4   P12   T001434_01                  Rv1434
                       TACGCGGGTGCGGGGCCTCACACCCAGTCCGTCCTGGAAGAGGA
4   P14   T001435_01                  Rv1435c
                       GTAATTGCCGGCGCTGGGTTGTTTGCAGCTGCTATAGCGTTAAGC
4   P16   T001436_01                  Rv1436
                       CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
4   P18   T001437_01                  Rv1437
                       CCTTGAGGGCAAGACGCTTCCCGGCATCGAGGTACTGAGCCGTGA
4   P20   T001438_01                  Rv1438
                       TGATAGCCGGCAACTGGAAGATGAACCTCAACCACTACGAGGCGA
4   P22   T001439_01                  Rv1439c
                       TTCACTCGGATTCTGGGTTTGCTGCCTGACCTGCACGGGGAAGTT
4   P24   T001440_01                  Rv1440
                       GACGCTGTTCGTTACCGGCATCTGGCTGGTGTCCATCATCGGCGT
4   B01   T001441_01                  Rv1441c
                       TCGTTGTTTTCTGGCTACGCCCGCGACTATCAGGCGCTCAGTGCC
4   B03   T001442_01                  Rv1442
                       CCGACATTGTGGTGCCAACCACCACCAGTTTCGAGCGCGACGACT
4   B05   T001443_01                  Rv1443c
                       ACGAACGCACCGTGACGCCCGAGGGTGACACGAAAACGATTGTCC
4   B07   T001444_01                  Rv1444c
                       GGACGGTCTGGACCATCTCGAAGGTACCCTGCACAGCCTGGACGA
4   B09   T001445_01                  Rv1445c
                       TCCCGAAGACGATGACGAGCGCAATCTCAAGCAGGCCCGGCGGG
4   B11   T001446_01                  Rv1446c
                       GGTACTCACGCTCATCATTGCGCCGGACAGCGAAGCCATGCTGGA
4   B13   T001447_01                  Rv1447c
                       GCAAAGAGACGGTGCAGAACATCCTGGCGCTGCGGTTCGCCAACC
4   B15   T001448_01                  Rv1448c
                       CACACGAAACCGAAAAAACGATCCAACAGGCAATCGAGCTGTGGAA
4   B17   T001449_01                  Rv1449c
                       AGCAACTGGGCAACCTCATCGTGTTCTACGACCGCAACCAGATCTC
4   B19   T001450_01                  Rv1450c
                       CCATGCTCGGGAGTATCAGGCGATCAGCACGCAGGTGGCGGCGT
4   B21   T001451_01                  Rv1451
                       CGTTGGCACTCGGGTTGACGTTGACGGTGATCTCGTTCTTCTGGC
4   B23   T001452_01                  Rv1452c
                       TTTTCTCGTGCCTTGATTGTCGCTGGGGATAACGGCGGTGATGGTG
4   D01   T001453_01                  Rv1453
                       GCAGTGGCGGGAGAAGCCAACCAGCGATCCTCCGGCAAAGAAAGA
4   D03   T001454_01                  Rv1454c
                       AACTTCATCGACACCTACTTCCGCTCCGGGCAATATCCGCGCGAAC
4   D05   T001455_01                  Rv1455
                       CTGGGCTGGCAGTGGCTGGACCCAGACATCCGCAATCTTGCCCAG
4   D07   T001456_01                  Rv1456c
                       CCGTGCCGCGGCTGAAAGTCGAAATCACCACCTTGGTGCATATGC
4   D09   T001457_01                  Rv1457c
                       ACGCAACGGCGAGCAACTGCTGTTGACCATGTTCATCCCGATCACC
4   D11   T001458_01                  Rv1458c
                       CATGCGGGTCGAGCAACGCAGCCTCGAAGACGTGTTCCTGGATCT
4   D13   T001459_01                  Rv1459c
                       GCTCTGGATGCTGCCGCTATTGATCGCACCACCGATGTACAGCAAG
4   D15   T001460_01                  Rv1460
                       GCAAATCTGCCAGCACCATTGCCCGGTATCCCATGTCGCCGAGGA
4   D17   T001461_01                  Rv1461
                       ATGCGCGACAACGTCGGCATTGGATCGTCGAATAAGAAGCTGTCG
4   D19   T001462_01                  Rv1462
                       GCGCCTGACCGCAGCCATCGAACACGAGCTGGAAATCACGGAATC
4   D21   T001463_01                  Rv1463
                       TCCTGCAGCTAGAACTGCTCAAGCCCAAGATCGCCATCCTGGACG
4   D23   T001464_01                  Rv1464
                       ACCTGGACTCGCTGTATCTGGACGACCGTGTCAAAGTCGTTGCGT
4   F01   T001465_01                  Rv1465
                       AGATCTATCAGGACGTGATCCTCGATCACTACAAGCATCCGCAGCA
4   F03   T001466_01                  Rv1466
                       CTGGGGATCAACGTCGTTGACCTGGGCCTGGTCTACGGCTTGGAC
4   F05   T001467_01                  Rv1467c
                       CACTGGACTTCTTCTTCCGCAAGATCGTGCGCGATCACGGCAAGG
4   F07   T001468_01                  Rv1468c
                       TTCGTGGTCGCGAATACGGAGTTCGTGTCGGGAGCGGCGGGGAA
4   F09   T001469_01                  Rv1469
                       CCTTGACCGCTTGTGAAGTAACTGCCGCGGAGGCTCCTTTCGACC
4   F11   T001470_01                  Rv1470
                       TTCACACCGACCTACGAGGCGTCGTCGCGGAAACACTTTGACGTC
4   F13   T001471_01                  Rv1471
                       GACTACCCGAGACCTCACTGCCGCACAGTTCAACGAAACCATCCAA
4   F15   T001472_01                  Rv1472
                       AGGATCGGGCTGGTATCCCGTCAGGTACCCGATGAACAGCTGCTA
4   F17   T001473_01                  Rv1473
                       TGGCCAACGGTCTGGGCAAGACGTATGGCTCGCTGGAAGTCTTCA
4   F19   T001474_01                  Rv1474c
                       TTTCACCACTTCCGCGACAAGGACGCGCTGTTTTTCGCGCTGGCG
4   F21   T001475_01                  Rv1475c
                       TCTGTGAACTCATTCGGAGCCCACGACACCCTGAAGGTCGGCGAA
4   F23   T001476_01                  Rv1476
                       TCGGGGCCGACTACTCGGATGCCACCGTCTTGGTGCTCAGCCCGA
4   H01   T001477_01                  Rv1477
                       TCAGGCCTGGTGTTGTACTCGTTTGCTGGGGTGGGCATCAAGCTG
4   H03   T001478_01                  Rv1478
                       CAAAGTCACGGTGAGCCCGGTGCGAAAGGCCGGAATGACGCCGTT
4   H05   T001479_01                  Rv1479
                       TGACTATGTCATCCCGCAAGACGTCATCGAGGTCATTCCTGATGTG
4   H07   T001480_01                  Rv1480
                       TCGCGGGATGGCGGTGATCATCAGCGATTTTCTGGGCCCGATCAA
4   H09   T001481_01                  Rv1481
                       CTTCGCGCATTCATGGTTCTTCCTATTCCTGTTTGTCGTGGCCGGA
4   H11   T001482_01                  Rv1482c
                       AGTATGACGGCGACCACCATCTGACCAGTCGCTACCACTACCGGA
4   H13   T001483_01                  Rv1483
                       CCGCGGACGCATTCCTCATGCGGATGACCGAGGAAAAGTTCGAGA
4   H15   T001484_01                  Rv1484
                       AAGTACGGTGTGCGTTCGAATCTCGTTGCCGCAGGCCCTATCCGG
4   H17   T001485_01                  Rv1485
                       ACGCGGTGGCCGAGCACTACCTGCATTTCGGTGGGGTATCACCGA
4   H19   T001486_01                  Rv1486c
                       ATCATGTGGTGTCCCAGTGTTTCGCTGTCGATCTGGGCTAACGCTT
4   H21   T001487_01                  Rv1487
                       CGAACCTGGTGACTCGGTGACCGTGGTGCAAATCGACGGCGCCAC
4   H23   T001488_01                  Rv1488
                       GTCTACTTCCAGGTGACCGTTCCGCAGGCGGCGGTGTACGAGATC
4   J01   T001489_01                  Rv1489c
                       GGAATCGCATTAACAACGCGATCTCGCACCCGGACATGTGCCCCC
4   J03   T001490_01                  Rv1490
                       AGCGCAGGATAATGCTTGCCCTCCTCGTTCCGGTGCTACCCTTTGC
4   J05   T001491_01                  Rv1491c
                       TCGGTATGCACGGGCGCGCTAGGTCTGACTGGGCTCGTCTATGAG
4   J07   T001492_01                  Rv1492
                       GCTTTGCGCGCCGGATCGCTCGCAACACCCAACTGCTGCTTTTAG
4   J09   T001493_01                  Rv1493
                       GCGCCAAGATGCCCAAGTTCAACTCCATCTCCATTTCCGGCTATCA
4   J11   T001494_01                  Rv1494
                       CCAGCGCCTGCAAGACATTGTGAAAGGCGGATACCGGAGCGCTAA
4   J13   T001495_01                  Rv1495
                       GACAACATCGAGACCCTCGGCAAAGACGAGCTCGGTGACTACCTC
4   J15   T001496_01                  Rv1496
                       CGCCGGCGAACTGACCCCGGCCCTGGCGGCTCAGCAAATACTGG
4   J17   T001497_01                  Rv1497
                       AAGTTCTGCCGGATCGAAATCTATTGGTGCCCTTAAATTTTCATCTT
4   J19   T001498_01                  Rv1498c
                       GGTGTTTCTTACCTCGGTGTTCACCCACATGTTTCCGCCGGACGTG
4   J21   T001499_01                  Rv1499
                       TGATTGCTCATCGTGTCCCCTCACATTCTTTTACCCGCTCTTACCGG
4   J23   T001500_01                  Rv1500
                       ACCAGGTGCCCATGTCCGTAAACAAGGCATGGAAAGGAACGACCA
4   L01   T001501_01                  Rv1501
                       GGTTACATTGCCTCCGTCAATATTATGTTCGCCATCGATCCCTTTAC
4   L03   T001502_01                  Rv1502
                       TCGCGGTGCGAAATATCGGATTTACTGCGCTACATCGGAGGATGG
4   L05   T001503_01                  Rv1503c
                       GGAAAAGGGCACCAATCGCAGCCGCTTCCTTCGCAACGAGGTCGA
4   L07   T001504_01                  Rv1504c
                       GCCGCGCTGGAAATGATGGCGCTGCTTCTGGACATAGAGGAGGGG
4   L09   T001505_01                  Rv1505c
                       TCGCACATTACTACTTCACAAGGGATTCGGAATATGAGGTCGTCGC
4   L11   T001506_01                  Rv1506c
                       CGAAGCGACGCTCGACATGCTGAATGCCGCGAGTCGCCGTGGCTT
4   L13   T001507_01                  Rv1507c
                       CGATTTGCAGTTATCTCGGTATCAGCACGCGACTGGCAAATTCGTG
4   L15   T001508_01                  Rv1508c
                       TCCCGGGGACGATCGCACAGTCGATCCACGGCATCATCAAGTTCA
4   L17   T001509_01                  Rv1509
                       GTACGAACCGCATTTCAATATCCCAACATTCTTCACCAAAGAGCTG
4   L19   T001510_01                  Rv1510
                       GTTGCTCAAAGTGACCTCCGACCAGTTAGGGGCAAAGGGCGGAGC
4   L21   T001511_01                  Rv1511
                       CCGTATGGCGCCGCCAAGGTCTATTCGTACTGGGCGACCCGCAAT
4   L23   T001512_01                  Rv1512
                       ATAGCGGCGAAACCCGCTGGGATCCAAGCAAACCGGACGGAACAC
4   N01   T001513_01                  Rv1513
                       GCGCTCGATCTCGTGGATTCGTTGGGCTTTACGCTCTCGGGATTG
4   N03   T001514_01                  Rv1514c
                       TCTCGGTGATAACGATCTCGTTCAACGACCTCGACGGGTTGCAGCG
4   N05   T001515_01                  Rv1515c
                       TCTTCTACCACCTGGAGAATCCGAAGCAATACCTGGAAACCCTCTC
4   N07   T001516_01                  Rv1516c
                       CACTCACAACCAGGCGGGCTACGCCCGTCAGGCCTTCGACAGCTT
4   N09   T001517_01                  Rv1517
                       ACCCAGCAGGTTATGCTGCGGTTTCAGGATTGGGTACGGTCCAAT
4   N11   T001518_01                  Rv1518
                       TCGCACCGATATCTACCAGCTCGTCGATGTGGACTTCTGGCTTCGG
4   N13   T001519_01                  Rv1519
                       AGGTCGTCCGAGAAGGCCAGCCTTGACCTGTACAGCTGTGGCGAC
4   N15   T001520_01                  Rv1520
                       GACCGGCATCCGGAGACGACGGTGTGTTTTCATCCTGTGCGAGTG
4   N17   T001521_01                  Rv1521
                       AATTTCGAACAAATTATGACCAGTTACTACGGCGTCTATGGCAAGG
4   N19   T001522_01                  Rv1522c
                       TGGTTGCCATCGGCGCTGACTACAACATGCTGCTCATTTCACGCAT
4   N21   T001523_01                  Rv1523
                       CCAATCGGTATTGCATCCAGCTCTACCACCAGACGGCCAGTCAGG
4   N23   T001524_01                  Rv1524
                       GACGCTTTTCAAGCGCCACCAAAGAATCGCTGATTGCCGACCTTCG
4   P01   T001525_01                  Rv1525
                       CTCGACCTGGATCTCGCGTTACGGGCTCGAAAGTCCGGGTATGGC
4   P03   T001526_01                  Rv1526c
                       GCCAACTCCACCCGCATTCGTCATGCCGACCACGTGAAACGTGTC
4   P05   T001527_01                  Rv1527c
                       TCATCGAAATCGGCAAACGCGACATCTACTCCAATACCCGACTGGA
4   P07   T001528_01                  Rv1528c
                       GCGCTTCTGCTGTCTGCGGTCATCGCAATACAACTGGACCGGATG
4   P09   T001529_01                  Rv1529
                       CGTAATGTGAACGAACCACCAGAAATCGTCGACTTCGAATCCGAGA
4   P11   T001530_01                  Rv1530
                       TCAACCCGCTGGGGGCGGGAATACGTTGGGGAGTAACGATTCCCG
4   P13   T001531_01                  Rv1531
                       AGAGCTGGTCGGCTTGCGAGCGGGAATTACATTGCGACAAAGTGG
4   P15   T001532_01                  Rv1532c
                       TTGCTCTGTCATGCGCGCACTGCCCGACGCCGCAAGGAACTCACC
4   P17   T001533_01                  Rv1533
                       CAGAGTCGCCGAGCTGCTCGGTGCTGAGTTTCCAATATGCGCGTT
4   P19   T001534_01                  Rv1534
                       CGCGGTACAGGCCACGTTCGAGTTCTTCGAAACCGACAAGGCTAC
4   P21   T001535_01                  Rv1535
                       ATGACCGCTGCTCTGCACAATGACGTAGTAACCGTAGCTTCGGCCC
4   P23   T001536_01                  Rv1536
                       TTCAAAACCTGTGTGGCGCATGGGATTGTCCTTGGTTTCGATGGCC
5   A01   T001537_01                  Rv1537
                       ATCGGGCCAATTCGTCTTCTGGGTGTTGGGTTTTCGGGTTTGAGCG
5   A03   T001538_01                  Rv1538c
                       CCACGTGCGCAATGATCCCATCATGGCCCGCCTCACCGTCATCAC
5   A05   T001539_01                  Rv1539
                       TCGGTAGTCGGTGGCGCCATCCTGCTGGTCATCCTGTCGATCTTTG
5   A07   T001540_01                  Rv1540
                       TTTACGGAGCTGATCCCAAGCTAGCGAAGAGGCTCGGGTTGGACC
5   A09   T001541_01                  Rv1541c
                       TCGACCCGAAGACGGCCGTGCTCAACTGGAAAGGCGACCAAGTGA
5   A11   T001542_01                  Rv1542c
                       CATCTACGACAAGATCGGCGGGCATGAGGCCATCGAAGTCGTCGT
5   A13   T001543_01                  Rv1543
                       AACCGACACATCAGAACTCGACAAGCGAAGCGAGACGTTTGTGCG
5   A15   T001544_01                  Rv1544
                       CGGCACCAGTGGGCGTTTTTGGGAGTTGCCGTTCGCACGCGAAAG
5   A17   T001545_01                  Rv1545
                       CATCCTTGCCGGCAGAGACGAATGCGGCGTGTGTGACAAGACAGC
5   A19   T001546_01                  Rv1546
                       TTCGGAGCTGTCAGAGTTGGGGGAGTGGCTCGTCATCCATGAGGG
5   A21   T001547_01                  Rv1547
                       TCCTGGCGTCGGTGAACCGGAGGGTCAACAAAAACGGAATGCCAT
5   A23   T001548_01                  Rv1548c
                       GTAACGTCAACTTTGGTAACGGAAACACCGGCGACACCAACTTTGG
5   C01   T001549_01                  Rv1549
                       GGCCCCGTGCTTCCGCGTCCTTCGATTGTGGACGTACGCTCACCG
5   C03   T001550_01                  Rv1550
                       AAACTCAAGCGCCGTCGAATCGCCGCGAAATATTCCGCGGAGATC
5   C05   T001551_01                  Rv1551
                       GCCCATGAAGACGACTCTTTCGACGAGGAAGGGTTTCTGGCCGAG
5   C07   T001552_01                  Rv1552
                       CCGACAAGACGGGATTTCACCTCCTGCACACGTTGTTTCAACGGCT
5   C09   T001553_01                  Rv1553
                       CATTCAAGCAGTTCAGCATGTGTATCAACTGCATGTTGTGCTACTC
5   C11   T001554_01                  Rv1554
                       GCGGTTTTTGGACTTCAGCGCCAATCCGGTTGTCGTAGTGCTGAAC
5   C13   T001555_01                  Rv1555
                       CGCCCTGTGGTGTTACGGCATGGCCGTGTTGGGCTCGGCGACGG
5   C15   T001556_01                  Rv1556
                       GTTCGTCGACCACCGTAAGGCCCTGATCCAGTACATCTTGCAGCAG
5   C17   T001557_01                  Rv1557
                       GCTGTCGTTGGGCGCTTCTTTTGGCCTGTCCGTGCTGGTGTGGCA
5   C19   T001558_01                  Rv1558
                       AAATCCGGTCTGGTACCACAACGTCGTGAAGAACCCACGGGTCGA
5   C21   T001559_01                  Rv1559
                       TGCGCTGCGCCGGTTTCTCGACGACGTGCTCGGACCCAACGACGA
5   C23   T001560_01                  Rv1560
                       ACCAACATCGACATCGATGACGAACTTGCCGCCGAGGTCATGCGC
5   E01   T001561_01                  Rv1561
                       CGTCCACCGTGACGCCGACTTTGATGTGATTGCCCGGATTACCAAC
5   E03   T001562_01                  Rv1562c
                       TCGATCTCGGAATCGACTTCGTCGAGCTGATGCCGGTCAATTCCTT
5   E05   T001563_01                  Rv1563c
                       AGCGCCAAGGCCGTCGAAGACTGTATGTTCTACCGTGATGCCCGG
5   E07   T001564_01                  Rv1564c
                       ATACGGCAACAACAACGTCTACTGCCAGGACTCCGAATTATCTTGG
5   E09   T001565_01                  Rv1565c
                       CGATGGCCAAGTTGGTCGCTGACCACCCCGACTACGTTTTCACAAC
5   E11   T001566_01                  Rv1566c
                       GCATCAACACCGTCGGGTTCGACGCCTCCGGTTTGATCCAGTACG
5   E13   T001567_01                  Rv1567c
                       TGCTTGCCCGCTGGTACCGTTCGGCGTCAACTATTACATCTACCCG
5   E15   T001568_01                  Rv1568
                       CTGCGCCCGTTTCGCAACCTGGTCTACGCCATGCCGCCCTATATCT
5   E17   T001569_01                  Rv1569
                       ACGCGGGCTGCTCTACGAGTTAGGTCTAGCGGGTGCGCCCGACG
5   E19   T001570_01                  Rv1570
                       GTGGTCACCGCGGACCTGGGCACCCTCAACCACACCAAGTTGACG
5   E21   T001571_01                  Rv1571
                       ATGGTGCATTCGATCGAGCTGGTCTTCGACAGCGATACCGAGGCG
5   E23   T001572_01                  Rv1572c
                       CACCAACACCTTCCACCACCACGAGAAGCTGCTACGCCACAACGAC
5   G01   T001573_01                  Rv1573
                       ACACCAGCACGTTTCAACCACTTGGTGACGGTAACCGACCTGGAAA
5   G03   T001574_01                  Rv1574
                       GCTCAAACGAATCGACAACGCAACCCACAGCGACGACAAAGAAATC
5   G05   T001575_01                  Rv1575
                       GGCCCTATCCTACCTACGCGGTAGTCTCCACCTTCAGAACTCGAAA
5   G07   T001576_01                  Rv1576c
                       GACCGAATTCGACGACATCAAAAACCTCTCTTTACCTGAAACCCGT
5   G09   T001577_01                  Rv1577c
                       GCGCGCGGAATCGCTTACAGTCGTTTCCCGTTCGACAGCCGAAGC
5   G11   T001578_01                  Rv1578c
                       ACTTTGGAGCGGCTTGACCTGCTCAAACCTGAGGATCGGGCGCTC
5   G13   T001579_01                  Rv1579c
                       CGATGCGGCGGTCGAAGCACTCGAATCCTTCGCGAAAGACGGAAC
5   G15   T001580_01                  Rv1580c
                       TGCCGTACATCATCCTGCCGAACCTGCAGACCGGCGAACCCGTCA
5   G17   T001581_01                  Rv1581c
                       CCCAACCGGATGCCCGATACTGCAACAGCAGCTCAATGCCGCCAG
5   G19   T001582_01                  Rv1582c
                       CGTGGAATTCACGCCGTCACATACCCCACTGCTCATCACCAACCAC
5   G21   T001583_01                  Rv1583c
                       ACTGGGCTCTGAGGGTAGAGACGTGCCAGGAGGCGATGGCGCAG
5   G23   T001584_01                  Rv1584c
                       GCGCATCCGACGATCCCGAGTTCATCGCCGCGAAAACCGATCTCG
5   I01   T001585_01                  Rv1585c
                       AACATTACTCGACGACGACAACCAGCCGCGAGCCGTTATTGGCTTG
5   I03   T001586_01                  Rv1586c
                       GGGCTACTGACCGCGCGCCAGGTGAAGATCAGCACCGACATCGTC
5   I05   T001587_01                  Rv1587c
                       AAAAGGCTGGACCACCCACAACAACACCCACGGCCACACCGAATG
5   I07   T001588_01                  Rv1588c
                       GCAACCAGCAATACGACGGCATGTCACGGCTAAGTGGCTACCTGA
5   I09   T001589_01                  Rv1589
                       CATCAGCCTGAAAACCGGTGGCTGCCCGGAGGATTGCCATTTCTG
5   I11   T001590_01                  Rv1590
                       TGGAAATCGTGGCTGGAAAACAACGCGCTCCGGTCGCTGCCGGCG
5   I13   T001591_01                  Rv1591
                       ATCTGGGCAGCGAATCCCAGAACTTCTTCATCGCGCCATTTATGCT
5   I15   T001592_01                  Rv1592c
                       TTCCTCGACGAACCCCTTGAGGACATTCTGTCGACGCCGGAAATTT
5   I17   T001593_01                  Rv1593c
                       ATGTCCTATACAAACATCGGATTCGCTTTGGCCCCAAAAGAATTCG
5   I19   T001594_01                  Rv1594
                       TCAACGACCGCGCCTCATGCAAGTACATGAAGATGATCACCCCCGC
5   I21   T001595_01                  Rv1595
                       TCGATCGTCGCCGACGGCTACCGAGCGGTTACCGATTTGGTCGGA
5   I23   T001596_01                  Rv1596
                       GATCCGTGGTAGACGCGCTACGTGCGGTGCGAAATGCTGCACCCG
5   K01   T001597_01                  Rv1597
                       CGAAGAACGCCCGTCATGGGGCTATCAACGACAACTCAGTCAGCG
5   K03   T001598_01                  Rv1598c
                       CACCGCGGTCGCAAGTCTGGAAAGCCATACCAAACGATTGTGACC
5   K05   T001599_01                  Rv1599
                       CGTCCTGGTCGACGACGTGGACGCCGCCGTCTTGGTGGTGAACG
5   K07   T001600_01                  Rv1600
                       CGCGAACGCGTAACAACCTCATTGAACGACATGGGTTTTCGAGTCA
5   K09   T001601_01                  Rv1601
                       GCAGGCCCTAGGTGACAAGAGGGGCATCCGCCGGTTTGGCGATG
5   K11   T001602_01                  Rv1602
                       TGACAGCAAAATCGGTTGTAGTCCTTGACTACGGCTCAGGAAACCT
5   K13   T001603_01                  Rv1603
                       GAACGCCTAGACAGTGAAGGATGTTCGCGGTTCGTCGTGACCGAT
5   K15   T001604_01                  Rv1604
                       CGTCGCTGACGGGATACTCGGTGGTGCAATAAGTTTCGGAGGTCA
5   K17   T001605_01                  Rv1605
                       GTCAAGGGAGTCAACTTCGAGAACCTCCGCGACGCCGGTGATCCC
5   K19   T001606_01                  Rv1606
                       CCGTACCCTGCAAACCCGTGAGGCCACTTACTATTCGCGATCCCG
5   K21   T001607_01                  Rv1607
                       CTGGGACTCTACGTGTTGTTCCTGTTCACCCAGACTGTCCGGCATC
5   K23   T001608_01                  Rv1608c
                       CGCACGACCTTTGTCATCGACACCGACCGTAAGGTGCTCGACGTG
5   M01   T001609_01                  Rv1609
                       TCGAGATGGACACCGATGTCGATCCCATCGACGTGTACCGAATTCT
5   M03   T001610_01                  Rv1610
                       CCGCAAGACGACGGGCCGGATATGGGGCCGCGGATGTCGGAGCG
5   M05   T001611_01                  Rv1611
                       GGATTGCTTCGCGCGAATAGCTCCTGGTTTGCCGAGCAGTGTGAT
5   M07   T001612_01                  Rv1612
                       TCTGAAGCGAGAAGACCTGAACCATACTGGTTCTCACAAGATCAAC
5   M09   T001613_01                  Rv1613
                       ATCCGAAGAGCATCGGTTGGATCGCATTTTCTTGGTCGCGCCGTCC
5   M11   T001614_01                  Rv1614
                       AAACTACTTCAATCAAGAGCTCTACGGCCGGGAAACCACTATGCCG
5   M13   T001615_01                  Rv1615
                       TGACGCCCTGCTGATATTGACCGACAAAGTCGGCGACCCTTGGGG
5   M15   T001616_01                  Rv1616
                       GACTTGTCGACCCGCACAACTCGAATTCGCTATATCCACCGTGCCT
5   M17   T001617_01                  Rv1617
                       CCAAGCTGGAGAAGCCGGAAGCCATCGACAATCTCGAAGCGATCG
5   M19   T001618_01                  Rv1618
                       CGTGGGTTGGGTTCGGGGCACTTTTTTGATCGCTCGGGGAAGCTC
5   M21   T001619_01                  Rv1619
                       CGTCATCGACGTGTCTAACTTTGAGATGACCGGGCGTAGGTTTCGC
5   M23   T001620_01                  Rv1620c
                       ACCCACCACCTGCCCAACGACATTCAATGCGCCGAGCTGTCCATAG
5   O01   T001621_01                  Rv1621c
                       TTGAAGTCAATGGCCATTGTGGTGATCACACTGCCCCTGATACCGA
5   O03   T001622_01                  Rv1622c
                       GTACCCGAACCTGGTGCCCTCAACCCTGAACCCGCAGTGGAGCCT
5   O05   T001623_01                  Rv1623c
                       ATCGTTGTGCGATACCCAGACAGATCCAAACTTCTCTGTCCTGACG
5   O07   T001624_01                  Rv1624c
                       CCTCACTCATCCTGGCTGTGCTGGCCTTTCGCCATTTCGGTGACGC
5   O09   T001625_01                  Rv1625c
                       TGCCAGACGAGGTTTACGAGCGTCTCAAGGACGACTTCGTGTTGC
5   O11   T001626_01                  Rv1626
                       TCGAACGTGCGCGTGATGCCGGGGCGATGGCATACCTGGTAAAGC
5   O13   T001627_01                  Rv1627c
                       ACAGTCGAGGACTTCGCTCAAGTGAAGGTCAAGAACTCCCGGCAC
5   O15   T001628_01                  Rv1628c
                       AACCGGCAATCGATGGATGGTTCACCACCGATAAGGCCGGCAACC
5   O17   T001629_01                  Rv1629
                       GTGCGGAAACACCGCAGCAGCAACAACTTTCACTGCTCGATGACG
5   O19   T001630_01                  Rv1630
                       TAGACAAAACGATCAAGTACTTCAACGATGGCGACATCGTCGAAGG
5   O21   T001631_01                  Rv1631
                       TTTCGGGGGACGCGGTTGTGGTCGAAGATATTCCACTGCTGGTGG
5   O23   T001632_01                  Rv1632c
                       CTGTCTTTCACTTCAATCCCAGCCACAAACGCGATCACGACTACTA
5   A02   T001633_01                  Rv1633
                       CGTACTACGACTACTACCAGCCGGAGGCGTATATCGCGCAGACCG
5   A04   T001634_01                  Rv1634
                       TGCCGCCCAGCGTATTTGGCTCCGGACCGTTGAAATGGATTTACCT
5   A06   T001635_01                  Rv1635c
                       TTCATACTGTTCGCCCACGGCCAGGTTTGGCAGGTCGGGTGGATC
5   A08   T001636_01                  Rv1636
                       TACCTCAGCACGAGGACGCTCGCGCCGCCGACATTCTGAAGGACG
5   A10   T001637_01                  Rv1637c
                       AACAACGCCTACCTGGTGACGTGTTCAGCGACCGGAGAAACCCTG
5   A12   T001638_01                  Rv1638
                       CACCAGCGCGACAACCGTCGTCTTATCGAAACCCTCACCCGGTTAC
5   A14   T001639_01                  Rv1639c
                       CGTTTGTCGACATCGCCGGTGATTTCTACCCGAACGCTGGCAACAA
5   A16   T001640_01                  Rv1640c
                       GGTGGTCATGCTGATCACTGGGCGCAGCATTCGCGAAACACTGCC
5   A18   T001641_01                  Rv1641
                       GGATCGAAGGTCAAGGTCACCATTATGTTCCGTGGACGTGAGCAG
5   A20   T001642_01                  Rv1642
                       TGGACGGCCGCACCGTGGTGGCAGCCAACGACACCAAACGGGTC
5   A22   T001643_01                  Rv1643
                       ATCGCGGCCAGCGATCGCGGCTTTACCGCAAAGCCAAAGAGCAGC
5   A24   T001644_01                  Rv1644
                       TCTGCCGGCGACCCGACTTGAGGATGTATTGGCCGGCTCACCTCA
5   C02   T001645_01                  Rv1645c
                       GGTTTGTACTCATGCCAACGCCGATCTGGGATCAGCTGTTCAAGCC
5   C04   T001646_01                  Rv1646
                       CCACCCCATTCGGTCCAGTAACGATGACGCTCAACGGGTCGTTTG
5   C06   T001647_01                  Rv1647
                       CGTGCTCGTCGCCCAAGATGCTGTGAAGTCGCTTGAAGTGCAAGG
5   C08   T001648_01                  Rv1648
                       GGTTCTGCTTGGTGCTGCTAGCCCATAGCTGGTGGAGCTTGGTGA
5   C10   T001649_01                  Rv1649
                       CACTTCTTCCCCTTCACCGAACCGTCCGCCGAGGTCGATGTGTGG
5   C12   T001650_01                  Rv1650
                       GCGATCGGCAGTATCGCGAGATTATTTGTGGTGCAACCAATTTCGC
5   C14   T001651_01                  Rv1651c
                       CGGTCACGGACACAACCATCGCCTTTTCGATCGATACCACGAACTT
5   C16   T001652_01                  Rv1652
                       CAGCTGCGGGCAGCCTACGAAAAGGCCTACCATGCAGAGCCTTTC
5   C18   T001653_01                  Rv1653
                       GCAGGCGAGGATCCGAACCACTGATCTGTCGCATGCCTACGTCGA
5   C20   T001654_01                  Rv1654
                       GCCGAAAAGCTGTTGATGCTCACCGATATCGACGGCCTGTACACC
5   C22   T001655_01                  Rv1655
                       ATGACCGGCGCTTCGACCACGACGGCGACCATGCGGCAGCGGTG
5   C24   T001656_01                  Rv1656
                       GGACACCGCAAAGGTGTTGTCCCGCTACGTCGATGCCATCGTCTG
5   E02   T001657_01                  Rv1657
                       CGAGGGCATCGAGGTCACCCAAGCCACACTGTCACGCGATCTGGA
5   E04   T001658_01                  Rv1658
                       TGTGGAATGCCCCAACCAAGGACATCTACGCCTACACCGAAGACC
5   E06   T001659_01                  Rv1659
                       GCTCGACGGAATTCGGCTACGTCACGTTGCATGACTCGTGGTCCA
5   E08   T001660_01                  Rv1660
                       CGCTATTCACAACGCGAGCTCACCGACTCGTTTGTCAGCATCCCGG
5   E10   T001661_01                  Rv1661
                       GATACATTGCGGGCGATGGGTTTTGACGATATCCATATCTCCGACT
5   E12   T001662_01                  Rv1662
                       TGTTGGTCGATTCGGACGGCTCGATGGATGTTGGAGATGTCATTG
5   E14   T001663_01                  Rv1663
                       GAGTTAGTCGAGTTGTTCAAAACTGAAGCGCTGCATCGGCTTCCAG
5   E16   T001664_01                  Rv1664
                       GGGATTTGATTCAATGAGCGGGGTCGAACTACGCAATCGTCTCCAG
5   E18   T001665_01                  Rv1665
                       CGCTATAGCCAAAGTGAGATCACTGATTCGTTTGTCGAGTTTCCCG
5   E20   T001666_01                  Rv1666c
                       GATTAGTGGCTGCTCTGAAGAGGGTACTACGTTAAGCGACAACGAG
5   E22   T001667_01                  Rv1667c
                       ACGTGTCCTGCAAGACCACGTCGCGGCGATGGAGAATCGCTGGCT
5   E24   T001668_01                  Rv1668c
                       TGGTTCCTCGACGAGGTCGCCACCACAACATGGGAAGTGCACGAC
5   G02   T001669_01                  Rv1669
                       ATCAGTGCCTGGTGGGCGAATGGCAGCGTGAAGCAATACGCCGGT
5   G04   T001670_01                  Rv1670
                       GATATGCCCATGGAAGGGTCTGGCCCATTACTACAACGTCGTCGTG
5   G06   T001671_01                  Rv1671
                       CCGACCATCCTGGCGTTGGTTGGGATTATTAGTGCGGCAACGGCT
5   G08   T001672_01                  Rv1672c
                       GGGATCTTGTCCTTTTCGCTGTCGTCTACGGGGGCCTGTATTTCGC
5   G10   T001673_01                  Rv1673c
                       CCACGCATTGTTCGTCTCGCTGTGCCGATCGGTCGACATCCCCGC
5   G12   T001674_01                  Rv1674c
                       TACTGCGTGTATGCCTATGACGCGCTAGAACTGTTGCGCCCCAACG
5   G14   T001675_01                  Rv1675c
                       TCGATGCCCGTATCGAACTTGCCCAACGCACCCTCGCCGCAATGC
5   G16   T001676_01                  Rv1676
                       GCGTCGGATTCGGTGACGGCACAACGCATCTGGGATTGCCCGCCG
5   G18   T001677_01                  Rv1677
                       CCTGGATCAAGTACCCGCAATGCAGGAGTTCGTCAACAAATACCCG
5   G20   T001678_01                  Rv1678
                       TCTGCGGCTGTTGGCTGGGTTGATCTGGCTCTACAACGTGGTCTG
5   G22   T001679_01                  Rv1679
                       CATGGCTTCCGGAAAACAACTTGGCACCTTGGCATTCAGTGAACCG
5   G24   T001680_01                  Rv1680
                       CGATTTGGGAAGGCATCCGCGGCTACTTCCAAGACTCCGAAAGCC
5   I02   T001681_01                  Rv1681
                       ACGATCATCGCGACCTGTGTGAAGCAGTTGCCCACCACCGTCCTC
5   I04   T001682_01                  Rv1682
                       GGCGAACGTTGGAAGAGATCAGCCAGCGGCGAGTCGGCATCCTCG
5   I06   T001683_01                  Rv1683
                       CAACCGAATGATGACGGGTGGTTTCGCCATCAGCGGCCAGATGGT
5   I08   T001684_01                  Rv1684
                       TCCTGGTGTGCCCGGCGGATCGAGGTCCGCTCGTCTTGGTCGAGG
5   I10   T001685_01                  Rv1685c
                       CGCTACATCGTCAGAATCGAACCGTTTGCTTCGTTGCCGGCCGAAC
5   I12   T001686_01                  Rv1686c
                       CTGGGCCTGTTCCCACTCTTTGTGATGTTTGTGATCACGGCGATCA
5   I14   T001687_01                  Rv1687c
                       GTCCGTCCGGGTCGGGCAAGACAACACTGATTCGCTGCATCGTTG
5   I16   T001688_01                  Rv1688
                       TGCCCTCGGAATCACCATGGCCGACAACGGGATTGACTTGTTTGAT
5   I18   T001689_01                  Rv1689
                       AACAACATTCGGGTTGATAACGAGGAATGGGTGCCGCAAAGTTCG
5   I20   T001690_01                  Rv1690
                       ATCCAGGCCGACATGATGGGTAACGCATTCCTGACAGCGTTGACC
5   I22   T001691_01                  Rv1691
                       GGCGGACATCGACGGCGTCACCGACGCCGAAGATCGGGTAGACG
5   I24   T001692_01                  Rv1692
                       GTCGTTGAGTCAGGTGCGCAGCCGCAAGCTGTTTGTCACCAACAA
5   K02   T001693_01                  Rv1693
                       AACGGACCGTCTCTGGCCGAACTCGAAGGCATCGCACGTCGTCTT
5   K04   T001694_01                  Rv1694
                       TCGCGTCGACCTGGTAGTGGCCGACCTGTCGTTCATCTCGTTGGC
5   K06   T001695_01                  Rv1695
                       AGACTCGAGGTCACCCGCTGTGTCACGTCCGTCAAATGGGCACGG
5   K08   T001696_01                  Rv1696
                       TTACTCTGCACGGGCAGAACGACCAGCTGCGGTTGATGCGCCCGG
5   K10   T001697_01                  Rv1697
                       CGTGGTCCTGCATTGGATCATCGACTACTGGAACCGATTCTCACTT
5   K12   T001698_01                  Rv1698
                       TCCGGCTTTTTCTCCGATACTTTGCTGTCCAGCTTGCGTAGCGAGA
5   K14   T001699_01                  Rv1699
                       CCACATGAGACAGTGCGAATTGCTTTGGTGGGCAAGTACGTCGAA
5   K16   T001700_01                  Rv1700
                       TTGCCGAAGCGGCTCGCCGGGTGCTGCGTGGCGAAATCGTCAATT
5   K18   T001701_01                  Rv1701
                       GCAAACACATTGAGCTCCTACCGACGTGATCTGCGCCGCTACTCCA
5   K20   T001702_01                  Rv1702c
                       CCCGACCAACTACACAAACTAGCCACCAAACTCGCCGACTGTTTGA
5   K22   T001703_01                  Rv1703c
                       GGATTCGCAACTGGCACACTCGATTTTGTGTTCCTCGACCATGACA
5   K24   T001704_01                  Rv1704c
                       ACAACGGGTTCTTCCCAACGGGTTTCCTGGGCGTGGTCAGTGGCT
5   M02   T001705_01                  Rv1705c
                       GGTGGCTGGAATGGTTCATCAACTGGTATCTGCCGATATCACAGCT
5   M04   T001706_01                  Rv1706c
                       GAAGGGTTCATTTACGACAGCGGTGGGTTAACGCTGAATGCTCTG
5   M06   T001707_01                  Rv1707
                       AAGCCAACTCACCGCACTCGCCGACAACGAGCAACGTGACAAGCT
5   M08   T001708_01                  Rv1708
                       AAGGTGCGCGACCGGCTTAATCCGAAGCTGGATATCAGCGGAATC
5   M10   T001709_01                  Rv1709
                       CACCGACGACTTCATCGCCTACACCAAAGCGATCGGCGCTCGGCT
5   M12   T001710_01                  Rv1710
                       CCCGACGTCGACACAATTGACGACCTGAGCGAATCCCTGGACAGT
5   M14   T001711_01                  Rv1711
                       GCGACTTGATCGAACGAAAGGTCCGGGGCACCAAGAAGCTTTTTC
5   M16   T001712_01                  Rv1712
                       ATCCCGACGGAGACAGCTGTTACCTTGCCGGAGAAGACGTTTCGG
5   M18   T001713_01                  Rv1713
                       TGGACGAAAGCGATTGGCAACTAGACGATTCGGAGATCGCGGAGT
5   M20   T001714_01                  Rv1714
                       GCTCAGCGACGCCTCGAGCTTCTACACCGGCCAGGTGATGTATCT
5   M22   T001715_01                  Rv1715
                       TCTGCGACCCGAAGACGGTAGATCTCGTGGTACGCAACACCATTG
5   M24   T001716_01                  Rv1716
                       ACCGGCGTCGTCGTCTCGATCCCGAAGGGCAAATGGGGGATGGTC
5   O02   T001717_01                  Rv1717
                       TTGGGCTGGCTCGACAGCGTGCACCTCGCCAAAGGCGAACTGCGA
5   O04   T001718_01                  Rv1718
                       CTGGACATCAAACCGGAACTGGAAATCTATGACACCGGGCATTTGG
5   O06   T001719_01                  Rv1719
                       GGCCGGTGCTCTGCTGGCCTGGGTTTCGAAGGTAGACGCGTGGTT
5   O08   T001720_01                  Rv1720c
                       TGAAGGACTCGTCGTGGTTGTCAACTTCCTTAGCCTGCCCGTTCGG
5   O10   T001721_01                  Rv1721c
                       ATGAGCCTGAGCGATTTCCTCCTAGCACGGCTTGCCGAGATCGCG
5   O12   T001722_01                  Rv1722
                       CGCCGTTCAACCTGCTGGGCATCTATCGCTGGATCCGAAACTTCTT
5   O14   T001723_01                  Rv1723
                       ATGTTAGACACCCTGCGCGCATTCGATGCGGTGGCACACGAATTG
5   O16   T001724_01                  Rv1724c
                       AAAGATCGACATTTCGCTGCTCGACGACCGTATTCGGTTCTCGGTT
5   O18   T001725_01                  Rv1725c
                       GTGTTGGAACCTGGGGACATCTCGGTGTGCCTGCACGATCCATGC
5   O20   T001726_01                  Rv1726
                       CCGATGCACGTCGAAACACTTTACAGCACAACGGAGTTCAGTCGTT
5   O22   T001727_01                  Rv1727
                       ATGGACCTCTATTCAAACCTCGTCGAAGCCGAACAACGCCTGGTCG
5   O24   T001728_01                  Rv1728c
                       CCGTGCCGTCTCTGTGCTATTTCCTCAGATCACCAACATCTTTGGC
5   B02   T001729_01                  Rv1729c
                       GTGGCGCAGGCAATGGTGTACGGAAACGCGGTCCGCACCAAATAC
5   B04   T001730_01                  Rv1730c
                       CAGAGGCTGTTGCTTGACCCGCTGCAGCTTGCTCACACGCGCTAC
5   B06   T001731_01                  Rv1731
                       TGCTTCTCGAACGCCGGCCAGCTGTGCATCTCCATTGAGCGGATC
5   B08   T001732_01                  Rv1732c
                       ATCAAGGCGTCCCGATGGTCGGTATCTCCAGTAACGACGTCGTCA
5   B10   T001733_01                  Rv1733c
                       ATAGAACGCAGCGGTGAGGTCAACGCGAAGCCGGGAACCAAATCC
5   B12   T001734_01                  Rv1734c
                       GGTTGACGCGGTCTTCGGGGTGATCTACCCACCTCAGGTCGCGCT
5   B14   T001735_01                  Rv1735c
                       CATCGTCGAAAGCATCGGCGAATTCGAAGGTTGGGTCGCGTTGGC
5   B16   T001736_01                  Rv1736c
                       TGTATTACCAGATCCATGTGCTGATCGGGTTGGCGTTGTTCGCGTT
5   B18   T001737_01                  Rv1737c
                       GTGACCTGGGAGATGTCGTTTCTGTACGCGATCGTGTTCGGCGGG
5   B20   T001738_01                  Rv1738
                       CGAAGGATTGACTCGGGCGAAGGCACGGCTGCGTTGGCGGGAAA
5   B22   T001739_01                  Rv1739c
                       TCGGCACTATCACCGGCACCTCGGTCGAAGGCAACGAATTCTTCAG
5   B24   T001740_01                  Rv1740
                       ATGGAATTGGCGGCTCGAATGGGCGAGACTTTGACACAAGCGGTC
5   D02   T001741_01                  Rv1741
                       CGGCCAGCCTCTCCTCTATAAGGGTGACGATTTCGCATGTATCGAT
5   D04   T001742_01                  Rv1742
                       GTGAGCTTCCCGCCGGATATCGACACCCACTCGCCTCGCCAGACC
5   D06   T001743_01                  Rv1743
                       GTGTAGCGGGGCAAAACGACCCGAAACTCTACGCCAGCTTCTACT
5   D08   T001744_01                  Rv1744c
                       GGCTGCGTGCGCTGCACCGACTGTGTGGGGTGTTTGTGGTGCGTG
5   D10   T001745_01                  Rv1745c
                       GCTGGTTGTCCTGGGAACAATTCGTGCGCGATGTTACCGCCGGCG
5   D12   T001746_01                  Rv1746
                       GAACAGCTTATGGGCAACGAGCTCGATGGACGGGCCGACCAATAC
5   D14   T001747_01                  Rv1747
                       CATGCTGGTAGCGCTCAGCGTTATCTACGTCGGCTTTGTGCGCTG
5   D16   T001748_01                  Rv1748
                       TCGGAGTGCTATATGTCGGCATCAAAGCGCTGTCGTCCTTCACGCG
5   D18   T001749_01                  Rv1749c
                       GACCCTAAAGCTAGGGAAGGGTGTTGGAATGTTCACCATTGTCGG
5   D20   T001750_01                  Rv1750c
                       GAACCTGACAGCGGCACCAATCGAGCGAATTCTATTACGATACAAG
5   D22   T001751_01                  Rv1751
                       GGACTGAAGGCGCGTGAATTCCCGGTGAACTTTGACGTGTGGTGG
5   D24   T001752_01                  Rv1752
                       CAATCCGGTTGTGCCCCAACTCTTCCACCGATTGCCGCCCCTCGC
5   F02   T001753_01                  Rv1753c
                       TTGGTGGTTCACCCATACACATTGACCGGCCCTATTGTCATCGGTT
5   F04   T001754_01                  Rv1754c
                       AGACGTCTACTTTAACCTGTCTTTGTGGTCGGCATACAACGTGATG
5   F06   T001755_01                  Rv1755c
                       AGCCAATAGACTGCCGCGGGTCTCCTGGGTGATTCCCAATGTTCTC
5   F08   T001756_01                  Rv1756c
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
5   F10   T001757_01                  Rv1757c
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
5   F12   T001758_01                  Rv1758
                       GGGGCGGTTCAGAGAGGACTTCATCGATGCGCTGCGTTCCAAGAT
5   F14   T001759_01                  Rv1759c
                       ACAACCTGCAGCAGGACATTCTCAGTTTCATCAACGAACCCACCGA
5   F16   T001760_01                  Rv1760
                       ATCCTGTCGAATGTGCCCGGACCCCAGGCCCAGTTGTACTTTCTGG
5   F18   T001761_01                  Rv1761c
                       ACCCCCGCACGACGTGGCTTTTTTCGGTCTAATCCCGAGCGAATCC
5   F20   T001762_01                  Rv1762c
                       ATCCAGTAGCCAGCGAACGGCTGTCGCACGCTGAGAAGTCATTCA
5   F22   T001763_01                  Rv1763
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
5   F24   T001764_01                  Rv1764
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
5   H02   T001765_01                  Rv1765c
                       TCAGCGAGTCCGAACGCCGATATCTGCTCTGTGATGCCACCTTTGA
5   H04   T001766_01                  Rv1766
                       GCGGTATCGCGCGCACTCGACCGCGCCGGATTCAAGATCGTTGCG
5   H06   T001767_01                  Rv1767
                       ACCGGCCACCATCCACGGTGCTCGTGCCTACGCGGCATTTTGCGA
5   H08   T001768_01                  Rv1768
                       AAGCGTTGAGTGCCCAGGCGGCGATGTTTCATGAACAGTTTGTCC
5   H10   T001769_01                  Rv1769
                       TACGAGGAGGCGTTCGCTGACTACGATGCACCGTTTGCGTTCGTA
5   H12   T001770_01                  Rv1770
                       ACGCCGCGCACAGCGGCAAGTTTTTCGAGGCTCATATTGAGGAGG
5   H14   T001771_01                  Rv1771
                       CCATTTCGAGTTTTTCGTATTCCCTTACGCAGATAAGGCGTTGACG
5   H16   T001772_01                  Rv1772
                       TCGACGAGTTGCACAACGCCGCTCAACGGCACAGATTGCCGGTCT
5   H18   T001773_01                  Rv1773c
                       GTCGACCTGTCGGTACTGCGCGGCCAGCGAATGTGGTTTGTCGAC
5   H20   T001774_01                  Rv1774
                       CTTATATGCCAACCGATTTGCCTGCCTGGTATGACGTCGCGATGAC
5   H22   T001775_01                  Rv1775
                       CGTTCGGCAAGTTCTTCAAACCCGAGATGGCCCCGCTGCCACAGC
5   H24   T001776_01                  Rv1776c
                       GGCGCGAAATGGGTGGTACGCGTGGTGCTCTCACTGATGTATTGG
5   J02   T001777_01                  Rv1777
                       AACTAATGACAATTGCCAAGGATGCCAACACGTTCTTTGGTGCCGA
5   J04   T001778_01                  Rv1778c
                       ACATCGACTGGGATGAGACCAATAAGCAGCACCAGCTGAAATGCC
5   J06   T001779_01                  Rv1779c
                       AAGAGGTCGAGGAGATCGCGTTTTCGTTCAAGCGCACCCACAAGG
5   J08   T001780_01                  Rv1780
                       GCGAAAGCTGGGTGACCTGATCACGTTTGTCATCCATATCCCGCTG
5   J10   T001781_01                  Rv1781c
                       CACGACACGTGCCGAGGTGGTGCAGGTCGACAATTTCACCCCGCC
5   J12   T001782_01                  Rv1782
                       GGACGCGTTGGTGGAGCACGACACGCTCCCAATGGACATGACCCC
5   J14   T001783_01                  Rv1783
                       GCGACACCTGGATGGTGATCGACGACAAGGCTTGGTTCTTCGCTC
5   J16   T001784_01                  Rv1784
                       ACTACATTCGCCCGCAATTGTTTACCAACTCGTTCACACCGCTGGA
5   J18   T001785_01                  Rv1785c
                       CGCGCCATGCTGCGCGACAATCCCAAGCAGATCAGGGTTTTCATC
5   J20   T001786_01                  Rv1786
                       GTCATGCGCAGTGCTATGCCGTCGATCCGGACCTGTTCCCGATCG
5   J22   T001787_01                  Rv1787
                       GCAACGACTTTCGTCGGCTGCATCGGTCAGCTGGTCGAATCCCAA
5   J24   T001788_01                  Rv1788
                       ATCTATCAGGCCGTCAGCGCCCAGGCCGCGGCGATTCACGAGATG
5   L02   T001789_01                  Rv1789
                       GTGCCTCCGCCGTTGATCGCGGCCAACCGGGCTTCGTTGATGCAG
5   L04   T001790_01                  Rv1790
                       ATCGTTCGTTTGCTCGGTCAGTCGTACTTGGCGACGGGCATGGCG
5   L06   T001791_01                  Rv1791
                       ATGTACCAAACGGTCAGCGCCCAGGCCGCGGCCATTCACGAAATG
5   L08   T001792_01                  Rv1792
                       CGGGCTGGTTCGCGACGCCAACAACTACGAACAGCAAGAGCAGGC
5   L10   T001793_01                  Rv1793
                       GTGACTTTTGGGGCGGCGCCGGTTCGGTGGCTTGCCAGGAGTTCA
5   L12   T001794_01                  Rv1794
                       GCAAGTAGGAGTGAAGACCGTTTTGGATACACTGCCCTACGGCGA
5   L14   T001795_01                  Rv1795
                       ACCCGCTGCTGAAAGTGGTTAATAGTCGGCTCAGAGAGCTCGGTG
5   L16   T001796_01                  Rv1796
                       GTGCTAAGTTCCCCGAATTGTCGGCGTACCAAATCATCAATCGGCT
5   L18   T001797_01                  Rv1797
                       TGGTTATGCGACCAGTTTTTGGGTTACGCCGTCAGACATCACGTCG
5   L20   T001798_01                  Rv1798
                       GCCAAGAAGGAGATCAAGCTCATCAAGTCGACGACGAAGGTGAAT
5   L22   T001799_01                  Rv1799
                       GTCAAGAGTAAGAACGGTCGTCTCGCCGCTCGGGTACTGGTGGCA
5   L24   T001800_01                  Rv1800
                       CAATGCGGCGTTGACGATCGTGCCGTCGTACAACATCCACCTTTTT
5   N02   T001801_01                  Rv1801
                       ATCGGGGGGAAACCAATCACCGGAGCGTTGGCTCCGCTGGCCGAA
5   N04   T001802_01                  Rv1802
                       TGGCTTCGCTGAGTCAAAAATGGTCCTGCCGGCTAACGACACCGT
5   N06   T001803_01                  Rv1803c
                       AAAGGACCTAGCAACTATTGGTTCGGCGATTAGCCGGGCCAACGC
5   N08   T001804_01                  Rv1804c
                       AACGAGCTGCGGACCCGCAATCCCGGGTTTTCGATGGACGGTTGT
5   N10   T001805_01                  Rv1805c
                       GTGAACGTCACTCACACAAGGCCGCGAAGCAACGAGCTTGCGAAA
5   N12   T001806_01                  Rv1806
                       CTGACGAAGTATCAGCTTTGACTGCAACACAATTCAACTTCCATGC
5   N14   T001807_01                  Rv1807
                       TCTGGGCGTTACTGGACCCCAACTCCAATTTCTGGAACACGATAGC
5   N16   T001808_01                  Rv1808
                       ACCGCGACGTCGGCCAGCGCTGGTTGGGACACCGTCCTGCAAAGC
5   N18   T001809_01                  Rv1809
                       ACCCAACTCATGGGCCAACTCATTAACGCCATCTTCGGGCCGACGG
5   N20   T001810_01                  Rv1810
                       CGCGGCCAAGTTCGCTGCCATCGCATCAGGCGCGTACTGCCCCGA
5   N22   T001811_01                  Rv1811
                       CTGCAGCCCTACCAGGTACGGGTGATTTGTCGGCCCAAAGCAGAG
5   N24   T001812_01                  Rv1812c
                       CGTCCTAGCGGGCACGGTCGACGTCATGGTGGTGAGCAACAAACC
5   P02   T001813_01                  Rv1813c
                       CGATGTCGGAAGTCATGATGTCGGAAATTGCCGGGTTGCCTATCC
5   P04   T001814_01                  Rv1814
                       AAGAACTATGGCGGCATCCTCATCATCTGGGACCGCCTGTTCGGTA
5   P06   T001815_01                  Rv1815
                       TTCCCCGGCATGGAAATCCGTCAGGACAACCACGTCTGCACCCTG
5   P08   T001816_01                  Rv1816
                       CTGGGCATGGTGTCCTCGGCCGTATACCGCTATGTGTCCAGTCGT
5   P10   T001817_01                  Rv1817
                       AGGCTGTGATTCAACCCAACACCGAGGGCTTGATGTTCACCGGAA
5   P12   T001818_01                  Rv1818c
                       ATGTCATTTGTGGTCACGATCCCGGAGGCGCTAGCGGCGGTGGCG
5   P14   T001819_01                  Rv1819c
                       GGCCGTGCAGTCGATCATTTCGGTGATTTCTTTCACAGCGATCCTG
5   P16   T001820_01                  Rv1820
                       CCGTCGGGTGTGGCATTCGTCGACTTCCCGATGGATCACGCGTTC
5   P18   T001821_01                  Rv1821
                       GTTTTTCTCAAGCTGGGAAGACGATGTCGTTGCGGCCAACCTCGAC
5   P20   T001822_01                  Rv1822
                       GCCATGTGCTGCTGGCCTGTGGTTGGGCATTCTTGATCTGGGGTA
5   P22   T001823_01                  Rv1823
                       CTTGGTCGACAATAATCCCACGAGTAGTCCCTACACCATCTTGGCG
5   P24   T001824_01                  Rv1824
                       AGGTCTTCGTGGTTTCGTTCGTGTTCAACGTTTTGGTGGCTGCCCT
5   B01   T001825_01                  Rv1825
                       GACGCTTGCGATCTTGTTGTGCTTGGTTCTGGGGGTTGCCATAGTC
5   B03   T001826_01                  Rv1826
                       CTGAGGTCAACAGCGATCTGGACGGCACTCCGCAATTGGTGAATT
5   B05   T001827_01                  Rv1827
                       ATATTGAGAAGGACCAGACCTCCGATGAAGTCACGGTAGAGACGA
5   B07   T001828_01                  Rv1828
                       CTGGCCGGGATGTCGATCGGGGCGGTCCTCGACCTGCTACGACC
5   B09   T001829_01                  Rv1829
                       GGTCTGCTGATTCCCGACGAAAGTGACGAGGAGGCCACCACCGCT
5   B11   T001830_01                  Rv1830
                       GCGGCTGTACTCGTTCAAGGACATCTTGGTTCTCAAGATCGTCAAA
5   B13   T001831_01                  Rv1831
                       ATGGGGAAAGGCGATTCACCTGACGGTGGACAGAGTCGCCGAATC
5   B15   T001832_01                  Rv1832
                       GCCGCCGAGATGGAGTCGATTACCTGGCCTGAATTCGGGCGTCAG
5   B17   T001833_01                  Rv1833c
                       TTCCTGTATCGGGACATCATCGTCGCACTGCGGGACCGTTTCCGTT
5   B19   T001834_01                  Rv1834
                       CAACAATGCTCCTGCTGCATGGCTATCCGTCCAGTTCGTTCGACTT
5   B21   T001835_01                  Rv1835c
                       GAGGTGACCGGTCATGTGGTGGTCACGCTGTTTATCACGTCGACG
5   B23   T001836_01                  Rv1836c
                       GCGCGGTGTCGTTCACCACTCTGCGCTTGATCTATCAGGAGATGC
5   D01   T001837_01                  Rv1837c
                       CGATCGACAAAACGCGGGCGACGTGGCATACCGACCGATGGCACC
5   D03   T001838_01                  Rv1838c
                       GTGCTGCAGGAGATATGCCACCGGTATGTGGCAATCAAACGCCGT
5   D05   T001839_01                  Rv1839c
                       TGAGTAAGCGCCTGCAGGTTCTGCTGGACCCCGACGAGTGGGAAG
5   D07   T001840_01                  Rv1840c
                       AGGCCTATCAGGCATTGAGTGCGCAGGCGGCGCTGTTTCACGAGC
5   D09   T001841_01                  Rv1841c
                       CATCGCCGTCTCCACTGCGGAACTGTCCGAGATGATCGCCGAATC
5   D11   T001842_01                  Rv1842c
                       GCCATGGTTGTGGACGAGTACGGCGGCACCGCGGGCATGGTAAC
5   D13   T001843_01                  Rv1843c
                       CCGACCGCGGAGGTGTGGAGGACCTAATTGACCACATCACTTCTG
5   D15   T001844_01                  Rv1844c
                       CGGCCGGATCGACGAACCAGGCAAGTTCCACACACTATGGAGTTC
5   D17   T001845_01                  Rv1845c
                       ATCCTTACCCATGAGCGGGCTCATCTACGCGCCCGCCACGATCTTG
5   D19   T001846_01                  Rv1846c
                       CAACGGTTGGCAAAGAAGAACCTCGTGCTGCAGATCCGCGACGAT
5   D21   T001847_01                  Rv1847
                       GGCGGTGTCTACTGCGCGATGATCGAGAGCATCGCCAGCATGGCA
5   D23   T001848_01                  Rv1848
                       CGAGGTACAGGTGGAGGCGACGTTTCCGGACGGCACCAAGTTGG
5   F01   T001849_01                  Rv1849
                       TCTTTTACGGCAGTGGTGATATCGAGATGAACGCCGCGGCACTCTC
5   F03   T001850_01                  Rv1850
                       TTTGCCGAAAGCCGGATCCGACCGTCCACCATTGCGGCAGAAGAT
5   F05   T001851_01                  Rv1851
                       TGCTGGCGCTAGATCCCGCCGAAGTGACCGTGGTGACCTTCCAGC
5   F07   T001852_01                  Rv1852
                       GCCGCGCAAGGGCGGGCCGGGGGTGACCTATTCGGATTTGTTGG
5   F09   T001853_01                  Rv1853
                       GTCGACCGTTTTGGCGTTGGCGGGTGGCGGAACACTGAGTACCTG
5   F11   T001854_01                  Rv1854c
                       CGCCTGGCTGATTTGGCTGGTGCTGCACCTGGCGTACCTGATCGG
5   F13   T001855_01                  Rv1855c
                       TGGTTACGACTCCCTGTTTGTGATGGACCACTTCTACCAACTGCCC
5   F15   T001856_01                  Rv1856c
                       GGATCACCATCAATACAGTCGCTTGCGGCCGCAGCGTGCAGACCG
5   F17   T001857_01                  Rv1857
                       TCGGTGAGCAGTTCAAAGCCGGCAACCCAGGGGTTAACGTCAACT
5   F19   T001858_01                  Rv1858
                       AGCATCGCATTCAGTACCGCGGCTGTGGTGCTGGCGCAGACCTTT
5   F21   T001859_01                  Rv1859
                       TTGCGTAGTGTCGTCGCGAGGAGCGGTTGCGCGGTAGTCCTGACG
5   F23   T001860_01                  Rv1860
                       CCGGATCAACCAGGAAACCGTCTCGCTCGACGCCAACGGGGTGTC
5   H01   T001861_01                  Rv1861
                       AACCTCGACGGCAAGACGGGTATAGGTTGGCTCGGCTACATCGTC
5   H03   T001862_01                  Rv1862
                       AGATATTCCGGACCTGAACTACCAGCAGCACTTGTTCCAGGAGCGT
5   H05   T001863_01                  Rv1863c
                       TGTCTGACCACTTGACTGCTTGCGCAGCCGTTCATCCAGGTCCACT
5   H07   T001864_01                  Rv1864c
                       CCCGAAGCTCCATGGCGGTGATGATCAGGCCGTCTATGCGTATGC
5   H09   T001865_01                  Rv1865c
                       GTTCGGCCGGCGTGAAGTTCTCGATGGTGTTGCCGTCGTTTGTCA
5   H11   T001866_01                  Rv1866
                       GGCCGTACTGGTCGCCTATTTCAACCGATTACGTTGTGGTACTGGG
5   H13   T001867_01                  Rv1867
                       GCCCGGCCCACAGAACCGGATGGTCAGCTGGCCCTACACCAAGCT
5   H15   T001868_01                  Rv1868
                       CGGATGTGATAGACGTCGTTGACGACGTGTTCTACCTGACCTGCG
5   H17   T001869_01                  Rv1869c
                       AAAAGTCGCTGAGCGACTTCACCATCCAGACCTCCGATTGGTACCG
5   H19   T001870_01                  Rv1870c
                       GGTGATTTGCGGGAACTCGCCCAGCGCACACGACCCGACGTTTCG
5   H21   T001871_01                  Rv1871c
                       CAAGCGGGAATTCGTCCATCGCGTGCAACGGTTCGTGGTCAATCC
5   H23   T001872_01                  Rv1872c
                       CCTTCGACGATTTGGCCTGGATCAAGTCGCAGTGGCCGGGCAAGC
5   J01   T001873_01                  Rv1873
                       TCGTCGATGACCCTGTTCGCCCGTGCCACCGACGCCAACCAGGAC
5   J03   T001874_01                  Rv1874
                       CGGTGCCAACCAGAACATCGACACCGTGCCAACCAGCCGCTACGT
5   J05   T001875_01                  Rv1875
                       CTGTCAGCGGCGAACCATCTCTGGGATTCACCACCTATGGCAAGG
5   J07   T001876_01                  Rv1876
                       ATCCCGATGTTCTGCGCCTGCTCAACGAACAATTGACCAGCGAGCT
5   J09   T001877_01                  Rv1877
                       CGTTCAACGAGACTGGTATGAAGATCTGGGCGACCTGTCGGAATC
5   J11   T001878_01                  Rv1878
                       ATCAGGCGGATGCAATTGCTGTACTGGATAGTTCGAAACTGCTTCG
5   J13   T001879_01                  Rv1879
                       AAGCCGGTTATCTGGCACAAGCCTTCAACAACGTCTATCTTGACGG
5   J15   T001880_01                  Rv1880c
                       CTCCGGGTGACGACCTGATGAGTCAGTTGATCCAGATCGCCGAAA
5   J17   T001881_01                  Rv1881c
                       CTACGGCATCAGCAGCAAAAAACCCAACACGGTGGTGTCAACAGAC
5   J19   T001882_01                  Rv1882c
                       TTGCATTGGTATGTGCCCCGAAGCATTCGCTGGATTGATCGGCTCA
5   J21   T001883_01                  Rv1883c
                       GTTTGCTGTGCTGCTCGGCGACAGACCGGTGAACAATTGGCATTA
5   J23   T001884_01                  Rv1884c
                       CGCGCAGGGCATCAAGCAAATCATCAACGAGATCATTTGGGCAGG
5   L01   T001885_01                  Rv1885c
                       GCCGGATCTATCGGCATCGCGATCGGCGATCGACTCCCTGAATAA
5   L03   T001886_01                  Rv1886c
                       CGGCACCCCGAACGAGTTGGGCGGTGCCAACATACCCGCCGAGTT
5   L05   T001887_01                  Rv1887
                       CGAGACACTGGCGCAGGCTATCGCACCCGTTATCGGCTACGAGCA
5   L07   T001888_01                  Rv1888c
                       CGATCCTGCGTTGTCACGTTGGCAGTGGCTAGTCAAGTGGTTTTTG
5   L09   T001889_01                  Rv1889c
                       GAGAGCCGTGGGGATTGACTTCTTCACTCGCTGGGCCGCCGGAAA
5   L11   T001890_01                  Rv1890c
                       GATGGGTTCAATACGGGTCGCCGACGAAGTGAGCGTGGCATTCAC
5   L13   T001891_01                  Rv1891
                       AGCCTGTCATTTTCCGCCTCCTAACCAGTTCCCGCCGGCCGAAACC
5   L15   T001892_01                  Rv1892
                       GCGTTCCGGCGCCGAAATACCGGAAGCCTACTGGCGCACGCTGGT
5   L17   T001893_01                  Rv1893
                       CGACATCGCCACCCACGCGGTCGACAGAACGAAAGAAGTGTTCAC
5   L19   T001894_01                  Rv1894c
                       CTGAAGCACCCCAAGATGACGATGGTCGCCAACGCGCTTGGCACC
5   L21   T001895_01                  Rv1895
                       CGCGCTCGGGTGAGGAGCTAAGGTTCTGCTTACGCCCTGACAGCC
5   L23   T001896_01                  Rv1896c
                       TATCGCCTTGACTGGCAGCCCGGGACAACGGTTTTCGAGATCGAT
5   N01   T001897_01                  Rv1897c
                       TTGCGGGTTCTCGCCGACGAGAAATCCGCCTCCGACATGCACGCA
5   N03   T001898_01                  Rv1898
                       TGATTCCGGCCTGCCGAACCAGACAGATGCCATGTTCACCGTGATC
5   N05   T001899_01                  Rv1899c
                       ATCGGTCTGTGTCCTTGCCAGCCGCTTGATTGTCCTCGTTCACCTC
5   N07   T001900_01                  Rv1900c
                       GCCGATCGACTCGATCGACGACGAGCCATCGCTGTACCGTTTCCA
5   N09   T001901_01                  Rv1901
                       CAAGAAGCTGATGGGGCGAAATCCCGCTATTGAACCCGCCAACTTC
5   N11   T001902_01                  Rv1902c
                       GGATGCCACCGGAATCCGCTTTGGTACTACGGAAACTGCTTTTCTT
5   N13   T001903_01                  Rv1903
                       GATCCCGTTGTACATCCTGACTCTCGGTCTTTTCCATGTAGTCGTT
5   N15   T001904_01                  Rv1904
                       GTTCGTCATCGACATTCGGGACCTCGACTTCATGGGATCATGTGCA
5   N17   T001905_01                  Rv1905c
                       CCTCACCAATCCAGGTCTAGAGCAACTGTTTATCGAGCGCACCGGC
5   N19   T001906_01                  Rv1906c
                       CATCGATAACGCACTCAGCAAGAAACCACAGGTAGTGACGATTGAG
5   N21   T001907_01                  Rv1907c
                       GCAGACCACCCTCCCAGCCGGCCCTCTTGTCGAAACGGTCCAGGT
5   N23   T001908_01                  Rv1908c
                       GAAGCCGAGATTGCCAGCCTTAAGAGCCAGATCCGGGCATCGGGA
5   P01   T001909_01                  Rv1909c
                       GGCGGAGGTCATCTACTGGGGTCTATGTCCTGATTGTTCGATATCC
5   P03   T001910_01                  Rv1910c
                       CGCTCGGTCGGAGTATGCCCGAAACGCCTACCGGCGATGTACTGA
5   P05   T001911_01                  Rv1911c
                       ATGGTCAGACTCCTGCTGGTGGGCACAGCGTGCCGAATTCTGGTG
5   P07   T001912_01                  Rv1912c
                       TTGGCTACGGGATTTCGAATATGCAGCACGGCGAGAAACGATCGA
5   P09   T001913_01                  Rv1913
                       ACCGGCCATGCAGACGGCCCAACGGTGGTCTTCACGGGTGATCTT
5   P11   T001914_01                  Rv1914c
                       GCACTGACGATCGATCCGCCCGAACAGGCAAAGATGTGGAAGAAG
5   P13   T001915_01                  Rv1915
                       CTCGACGTACCGTCCTACAAGTCCTGTTTCCTGGCAATGGTGCGG
5   P15   T001916_01                  Rv1916
                       CCGACGACAACCTCTACCAGACCTCGAAGATGAAGTCGCATGGAA
5   P17   T001917_01                  Rv1917c
                       CTGGCATCCAGGGATTCAGTGTTAATCCGTTCGGTTTGAATATTCC
5   P19   T001918_01                  Rv1918c
                       GGCACCACTGTCGGCGGATTTACGCTACCCACGATACACACCCCG
5   P21   T001919_01                  Rv1919c
                       GTGTTCGTGCAGGAAGAGACCGTCGAGTATGAGCAGGACCGTCGC
5   P23   T001920_01                  Rv1920
                       CTGGTGTGGAAAAATCGGCTGGGGTTCGCGCGCTTGGCAATTCAG
6   A01   T001921_01                  Rv1921c
                       CAGCTCGACGCGTTTCTGAAGTGGCACCACGGAGTTCGTGAATTC
6   A03   T001922_01                  Rv1922
                       CTGCAATTCAAGCCTGGCACCAGGTTCGATTACTCCAACTCCAACT
6   A05   T001923_01                  Rv1923
                       CGGACCTTAATCTCGGTCTTCCTTTTACCTACCACCAGGGTTACCA
6   A07   T001924_01                  Rv1924c
                       CGCGGCTATCCTGGTTGGTCTGTTCTTGGCGGCCGTCGCTCTCGT
6   A09   T001925_01                  Rv1925
                       GATGCGGTGACCACGTTCAACAAAGCGTTCGCGCCCTATGGTTTAC
6   A11   T001926_01                  Rv1926c
                       GCCACTATCCCCCAAGGCGAACAATCGACCGGCAAAATCTACTTCG
6   A13   T001927_01                  Rv1927
                       CGGCATCCCGTACGCCTGGTCGAGGATGCGGATGATGCGCTCTGG
6   A15   T001928_01                  Rv1928c
                       AAGGCGGCGGTCATTCATCTAACCAAAGCCATGGCCGTGGAGTTG
6   A17   T001929_01                  Rv1929c
                       CCTTCCAGCGGTTTGCCGAACGCCGTAGAGCGAGATTGGCTCAGA
6   A19   T001930_01                  Rv1930c
                       CAAGGCATTCGGCGCTATCCCGGTCGCCGACGAGCGGATTGTGCA
6   A21   T001931_01                  Rv1931c
                       AACCATGCGCCGCAGCTTCATTCGCCGCGTCGGGATATCACCCGA
6   A23   T001932_01                  Rv1932
                       TTCACCCTGACCGGGGGCGATCTGGGGGTGATCAGCAGCGACCAG
6   C01   T001933_01                  Rv1933c
                       TTGTGTTATGCGCCGGCTCCGCTCTTCAGATCCACGGTGCCATCG
6   C03   T001934_01                  Rv1934c
                       CGTGACCGCGGATTACACACCGATCCACGGGTACGAGACGGCTTG
6   C05   T001935_01                  Rv1935c
                       TACTTCGAAAACACCAAGCGGTGGCGCAACCTGCGCAAGATCACC
6   C07   T001936_01                  Rv1936
                       CGAACGGGGTTACATCCCCATGAGTCTGGACCTCAACACCGAATAC
6   C09   T001937_01                  Rv1937
                       AGCCGCGTCCTCGGCAAATGGGCACGAACCCGATTGTCGGGCCAG
6   C11   T001938_01                  Rv1938
                       TTCGCCGTGCAGGACGGCATCATCACCGAGATCGAGGAAGACTTG
6   C13   T001939_01                  Rv1939
                       GTTCACGTCGGTTTCAGTTGACCCGCCGCTGGTATCGATCTGTGTG
6   C15   T001940_01                  Rv1940
                       GGCGCCTCGCGTGTCATCGGCTTTCGTGACGTTTACGACCTCGGC
6   C17   T001941_01                  Rv1941
                       CAAGTTGGTCGCCAACGCCGGTGTCGTTCATCTGGCTTCGCTCATC
6   C19   T001942_01                  Rv1942c
                       CGCACTTGTCGCGCCCTGCACCACGACCATCCGAGGGCTAGCCAG
6   C21   T001943_01                  Rv1943c
                       GATCCACGCCCCGGAGTGTGGCATAGTAGTGGCATGAATCGCATA
6   C23   T001944_01                  Rv1944c
                       CGGCTCGGGGCACAAGTACAAAAAGTGTTGTGCCGCAGCGTCGTT
6   E01   T001945_01                  Rv1945
                       ACCACGCATCAATCGATACCACCACCCCGAGAAAATCCTGTGCGAA
6   E03   T001946_01                  Rv1946c
                       TCTACCGTGCGGTCACAGCGCTGAGACAGAATGGTCCACGTCCAC
6   E05   T001947_01                  Rv1947
                       AGCGCTCATCGAGATCCGGTTGTGCAACGAACGTGCCACGCCGAT
6   E07   T001948_01                  Rv1948c
                       CATAGATGGTGTACAGCAACGGATAGTTCGAGAAAGCGGAACTGC
6   E09   T001949_01                  Rv1949c
                       GAGTGGCGATATTTTCCGGGAGACAATTACCGCTATCCGCATTGGG
6   E11   T001950_01                  Rv1950c
                       AAGGTCGCCGATCAGTGGGAAGACGTGTTCCTAGAGATGCGTAAC
6   E13   T001951_01                  Rv1951c
                       ATCCAACAGGTAGCGGCTACGGCCAGCCAATGGAGCGGGCGAAG
6   E15   T001952_01                  Rv1952
                       ATTGTTGGGCGAAGAAGTCCCCATGCCGGTACTGCTGGCCGCCGA
6   E17   T001953_01                  Rv1953
                       AAACCTCATCATGCAGCCCCTAGCTGGGCATATAGGTTACAGCCTA
6   E19   T001954_01                  Rv1954c
                       CCCTGCCCCTGGCCATCAGACCCCGAGGTGGGGTCCTTTTCGTCT
6   E21   T001955_01                  Rv1955
                       CCCGTAGCGCTGACAGCGTTCTACAAGAACCAGCAGAAGACTCCC
6   E23   T001956_01                  Rv1956
                       CAAACTGTCTACGCTGCAACGTTATGCCCGTGCATTGGACGCCCG
6   G01   T001957_01                  Rv1957
                       GCATTCAAAACCAGGCGGCAGACGACGACGTCAAGGAAGGCGATA
6   G03   T001958_01                  Rv1958c
                       ATCTGGCGGTAGGTGTGGAAACCATGGTCGTCGGGCAGCTTGATT
6   G05   T001959_01                  Rv1959c
                       GGGTGTCGATCAGGCCGAGCAGTACCTGCGCGAACTTCAACACGC
6   G07   T001960_01                  Rv1960c
                       TGGGTAAGAACACGTCCTTCGTCCTCGACGAGCACTACAGCGCCT
6   G09   T001961_01                  Rv1961
                       ACCAATTGTTGGTAGTAGGTGTTAGCCCCTGGGACACCCCAAGCC
6   G11   T001962_01                  Rv1962c
                       TCGGATCGAGGTCGAATCTGACGCTTTAGCTGATTGGCTCGATGAC
6   G13   T001963_01                  Rv1963c
                       CAGATTTTGGATCAGGCCGTTGGACTGTTCATCGAACGTGGCTTCC
6   G15   T001964_01                  Rv1964
                       TTCGCGATGACGCTCGACACGTCCGTGTGCATGTTCAAGCCGCCT
6   G17   T001965_01                  Rv1965
                       GTCGATCGCAATCCTTGTCATGACGCTGGCCATCTACGGCCAGTCG
6   G19   T001966_01                  Rv1966
                       ACCGTCGTGAATCATTCGACGCAGCTGGATGCCTTGCTACTCAACG
6   G21   T001967_01                  Rv1967
                       TCTTCGTCCCGGTCACACGATTCCGTTGGCGCGCACCCAACCGGC
6   G23   T001968_01                  Rv1968
                       CCGACTCGGAAACCGCACCGAAGTGGCAATCAAAACCAAGGGCTT
6   I01   T001969_01                  Rv1969
                       CAAGCGATTTCGGCTCTCGGTGACCACAGCAAAGACATCTTCTCCA
6   I03   T001970_01                  Rv1970
                       TCCCTGCTGGCCACGTTCCCGTTCCCGAACGAGACGTTCCAAAATT
6   I05   T001971_01                  Rv1971
                       CCTATCACAACGACATCGAACAGCTGCTGGTGGTGTTCCCCATGGC
6   I07   T001972_01                  Rv1972
                       GCCACAGGCGAGTTTTACAACGACTTCGCCCAGCGGTCCCAGCCC
6   I09   T001973_01                  Rv1973
                       TTCCAGCGTTCGGGTGACCCTCGACAACATCAACGGGCGTTGGCT
6   I11   T001974_01                  Rv1974
                       CAACGAACTCTGCCCCGCGCTGATCTGGCAGTTGCGAAACTCCGC
6   I13   T001975_01                  Rv1975
                       AGTTGATAAACCAGTGGTACTACAACCCCGCGTTTTTCGCGATCAT
6   I15   T001976_01                  Rv1976c
                       ACATCGGACAAAGCGTTGACCGACCGGGTCCGAGACTTGGGTGCG
6   I17   T001977_01                  Rv1977
                       GCTGGACGAATGCGTGGATGTGCTGGACGCGTCGGCGAAACCCG
6   I19   T001978_01                  Rv1978
                       CAACCTGCACGAGAAGTACGCCCGGATAGCCCTGAAACTTGTTTCT
6   I21   T001979_01                  Rv1979c
                       TTGGGCTGGCAGTGTCCTACGACTACCGCTGCATCTTTCTAGTGCG
6   I23   T001980_01                  Rv1980c
                       AGTCGTCTTCCCCATTGTGCAAGGTGAACTGAGCAAGCAGACCGG
6   K01   T001981_01                  Rv1981c
                       GCTCAAGCGCAAAGCATCGTCGGTAATGCTGGAGTCCTTCCTGTTC
6   K03   T001982_01                  Rv1982c
                       GGCCCCGTTGCGCGCACGATCTTCGAACGACTTCGCAGCGAAATC
6   K05   T001983_01                  Rv1983
                       CCGACCGTCATTTCATCCGGCCTGATGAATACCGGGTTCTTGCCCT
6   K07   T001984_01                  Rv1984c
                       TGCCGACAATCGGTCCGCTGTATAGCTCTAAGACCATAAACTTGTG
6   K09   T001985_01                  Rv1985c
                       CGCTTGCCGATGGATCGTTCGTACGGGTCTGCGACATACACCTCG
6   K11   T001986_01                  Rv1986
                       CTGGTGACCTGTGCGGCATTCACGTTCCTCAACCCACACGTCTACC
6   K13   T001987_01                  Rv1987
                       GGAATAGCACCGTTGCACGATCTGGCACGCACTACGTTCTCAGCC
6   K15   T001988_01                  Rv1988
                       TCGTGCTGCAGCGAGCCCTCGTATGTAAATTCGCTTCTCGCAACGC
6   K17   T001989_01                  Rv1989c
                       TGGAATCCGCCGCTGCTCTTTCCGGCGATCTATCTTGCTGATTCCG
6   K19   T001990_01                  Rv1990c
                       TCAGGTGGTTCCCCAACGCCTCAACAAGCAACGACTTATCGAGCTG
6   K21   T001991_01                  Rv1991c
                       CCGGTGCTCGTAATCCAGTCAGATCCGTACAACGCAAGTCGCCTTG
6   K23   T001992_01                  Rv1992c
                       CCGGCGCTCGCGGCAGATCATGGTGCAAAACGTCGGATTGTCCCT
6   M01   T001993_01                  Rv1993c
                       TACGCATGAGCTATTGGTTAAGGCGGCCGGGGCGGTGCTCACCGG
6   M03   T001994_01                  Rv1994c
                       GACCCGATCGAATGTGTCCAACCATCTGTCGTGTTTGCGGGGCTG
6   M05   T001995_01                  Rv1995
                       GGTCGACAAGGTCGCCGATATCGAAAAAAGCCTTGGCATCTACGAC
6   M07   T001996_01                  Rv1996
                       TCGACTTTCCTAGGCTCAATTGGGCGCCGATCGAATGGAGAAACCT
6   M09   T001997_01                  Rv1997
                       TTGGCCGCCATCGCTGTTGGCGTCGCCTTGCCGATTCTGCCCACC
6   M11   T001998_01                  Rv1998c
                       ACGGTCCGTACCGTACGCCGAACTGCAGGCACGCTTGGTTGACTA
6   M13   T001999_01                  Rv1999c
                       CATCACTCGTCGAGCACGACAGACTGATTCTGGTGATACCCAACGA
6   M15   T002000_01                  Rv2000
                       ACGTCGAATTCGCCTACGAGGACGACGCGGTGAAAAACGAACTCT
6   M17   T002001_01                  Rv2001
                       GATGGTACCGAGACACCATTTCCCTTGCGTCGCACGGATATTGACC
6   M19   T002002_01                  Rv2002
                       GCTGTCGTCAAGCCAATGAAAGAGGCTGGTCGCGGCTCCATCATC
6   M21   T002003_01                  Rv2003c
                       TTTGCCCAGCCACGCTTGGAAATCGGTGTCGGTACAGGACGTTTC
6   M23   T002004_01                  Rv2004c
                       GATGACATCTTCTTGGTGGATGGCGAACCGGCGCTGCTGGATTGC
6   O01   T002005_01                  Rv2005c
                       CAGCTTGTCGTCGTTGGCAGTCATGGCCGAGGTGGCTTGACCGGC
6   O03   T002006_01                  Rv2006
                       ACGAATTCCATTCGGGGTATCCCGGCAACGAGTACGACGGAATAG
6   O05   T002007_01                  Rv2007c
                       GCGTGGATGTGATGGACAAGTCCTGTGTGCAGGAGTGTCCGGTCG
6   O07   T002008_01                  Rv2008c
                       CTGTATTACTGGCGCACCCAGCAAGACGCCGAACTCGATCTCTATG
6   O09   T002009_01                  Rv2009
                       TTTCGACTTCAGCAACGATGAGATCGAATCGTTCTCGGATACGGAC
6   O11   T002010_01                  Rv2010
                       TTGCCGCTGACTCGACGGTGATCGTGCCCGAGGTGGTGATGATGG
6   O13   T002011_01                  Rv2011c
                       CACCACTGCTGGTGCTAACCGAGAATGGTCGCCGCGTTCTCCAGG
6   O15   T002012_01                  Rv2012
                       CCAATACCTGGTGGCTACCGGCGATGCAAAGCCTGTACGAGACTG
6   O17   T002013_01                  Rv2013
                       TGCTCGAGGCCGGGATCACGGTGGTGGTGATCAGCCCCAACCAGC
6   O19   T002014_01                  Rv2014
                       CGACCCAGATCAAGACGCTCGACGCGCAGATCGCCGAACAGCTCT
6   O21   T002015_01                  Rv2015c
                       CCGAACGCCGATATCTGCTCTGTGATGCCACCTTTGAGGCCTGGT
6   O23   T002016_01                  Rv2016
                       CCATGCATAGCCGGTGTCTGTCCAACCTCATCCACGACAGAATCTG
6   A02   T002017_01                  Rv2017
                       AGCCAGGCATCGAGTCCATCGTGCGAGAAAAACCGAGCCTACCCG
6   A04   T002018_01                  Rv2018
                       TTCAAGGAGATCGTCGAGCACTACCTGCAACAAATCAGCTTTGCCG
6   A06   T002019_01                  Rv2019
                       CCGTGCCGCACGATTTCCGGGACCATTCATCTACACGGTTCACCCG
6   A08   T002020_01                  Rv2020c
                       TCATCGAGCGCTACCGCGTCACCACCGACAAAGCGTCGGGCATCG
6   A10   T002021_01                  Rv2021c
                       CGTGTCCGCTCTTGGCGGAGAACTGGATATCACCGTCCGCCTGGG
6   A12   T002022_01                  Rv2022c
                       GGATGTGGAGCGCATCTCCGCCTGGCTCAACGGCTTGGACCGAGA
6   A14   T002023_01                  Rv2023c
                       CCCATTCCCGCTTCAGTTCGAGCAACTTGCCGAAATCGAGCCGGC
6   A16   T002024_01                  Rv2024c
                       ATCCAGTGCAAGTTCTACGAGCCGACGCACACACTGGCCAAGGGG
6   A18   T002025_01                  Rv2025c
                       CCGACAGCGTCGACGACACCCTGGAATCCACTGCGGCAGGGATCC
6   A20   T002026_01                  Rv2026c
                       CGCAGGTGCATACCGAGTTGGTCTTTTCCAATGTTGTGCCGACGCT
6   A22   T002027_01                  Rv2027c
                       TCCGGGAATCCATCTACAGCAGCATCGACGATCTCCAGGAAATCAT
6   A24   T002028_01                  Rv2028c
                       TGCACGGCGAGCTGCTGGATTATCTGGCTGGGCTGGGTCGATCGG
6   C02   T002029_01                  Rv2029c
                       CGAACCCACCGAAGTCGGGCAGGATCAATACGTTTGGCACCCGAT
6   C04   T002030_01                  Rv2030c
                       CTCGGCCAGATAGTCCGTGAGCGATACGGTGACGAGTCGCGCAGC
6   C06   T002031_01                  Rv2031c
                       TACTGTGTCGGTGGCGGTTTCGGAAGGGAAGCCAACCGAAAAGCA
6   C08   T002032_01                  Rv2032
                       ATTCGTCGTATCATGCCGAACTCTTTTGGTGGACAGGGGCTTTTGA
6   C10   T002033_01                  Rv2033c
                       AGAGCCGGCGTTGATCGGCCGGGTGGAAGAACTGATCGACTTCGT
6   C12   T002034_01                  Rv2034
                       CGACCGGTTCTGGACACGCGCCCTGACTGGCTACGCGCAGCTCAT
6   C14   T002035_01                  Rv2035
                       GCCGTGTTCACCACGCGGTTCGGCGACTTCAAGCCTCGCGAGCAC
6   C16   T002036_01                  Rv2036
                       ATCTCGGCGTTTTCGGGTTGCTCAAGCGCTTTGCCAAAGGCCGGA
6   C18   T002037_01                  Rv2037c
                       GCCGAACAACGCGAGGCTCTTTACCAACGCGGATTTCAGGCGGGT
6   C20   T002038_01                  Rv2038c
                       ACGCCTACTTGTATGGCCGAATCGTGTCGGGCGGCTGCGAAATGG
6   C22   T002039_01                  Rv2039c
                       GGTCATCCTTTATGCGGTCGCACAACGTTCCTTTGTCCGTGGTATC
6   C24   T002040_01                  Rv2040c
                       CTACCTATGTTTTGGGCATCATGCTGTTCCAGCACGCGTTTTCGTT
6   E02   T002041_01                  Rv2041c
                       CCCTGTATGAGACTTTCACGTTCAACGGAGGCCAGTACGCCTTTCC
6   E04   T002042_01                  Rv2042c
                       TGTGACGGTGTTCATTCCCGCCTTCCTACGCTATGACCTACGACCG
6   E06   T002043_01                  Rv2043c
                       GCCACTGCTGAATTGGCTGCGGCAACGCGGCGTCGATGAGGTCGA
6   E08   T002044_01                  Rv2044c
                       GCTGGGCTCGCACCAAGGCCGCGATGACACCTCTGTCACCGGACG
6   E10   T002045_01                  Rv2045c
                       GTGCCGCATCGAGTTCGATCCGCATCAGCACCGCCGGATCGCATG
6   E12   T002046_01                  Rv2046
                       ACACGCTGTCGATCGGGGACTACCGCTGCCGCTCCTATCAAGCGG
6   E14   T002047_01                  Rv2047c
                       GGAAATTCATGTGGTTGAGCTGGCGTCCGAAGATGGGCCGGCGCT
6   E16   T002048_01                  Rv2048c
                       GTACGACCGGATTTTGTCATGGGCCACTCGATCGGTGAGTTGTCTG
6   E18   T002049_01                  Rv2049c
                       TGTTGTCAGCCGACGACGCGGCCGATCTGTCGGATCGTGTTTACC
6   E20   T002050_01                  Rv2050
                       TTCCATCGAAGAACTCGAAGAGTTACTTAAGGAGCGCCTCGAGCTC
6   E22   T002051_01                  Rv2051c
                       TCGGTGTGTCCAAGATGAGCGGGTCCAACATTCGTGAGGCGCTGG
6   E24   T002052_01                  Rv2052c
                       CTTGACGTAGACGGCATCGAAGCGCACGTACGAGCATGCACCAAG
6   G02   T002053_01                  Rv2053c
                       AGATGTCGAGCCGTTGACCCTTCAGCCCCCTCGGGTAGCCGCAGA
6   G04   T002054_01                  Rv2054
                       AGCCAATCGACTACGTAAAGTGACCGCGGCCAAAAACATCCCCGC
6   G06   T002055_01                  Rv2055c
                       CCTGCTCGATAGCCTCGGCGTCGAGAGCGTCGATTACAAAGACAC
6   G08   T002056_01                  Rv2056c
                       TTACGCATCGCGTCGCACCGCGCTCAAAGACATCATCCGATCCCCA
6   G10   T002057_01                  Rv2057c
                       CGACCGTCTCATCTTGCGCAAATACGACCCGATCCTGCGGCGTCA
6   G12   T002058_01                  Rv2058c
                       AACGTATTACCTGCCCTCCGAGGGCCGTCGCATTCGGCTGCGGGT
6   G14   T002059_01                  Rv2059
                       CCCCGTCGTCTTCCACGGTGCCCGGTCCTCCGCCGCGACCAAGTT
6   G16   T002060_01                  Rv2060
                       GTCGGTGTTCGTGGCCACCATCTCGTTTGTGATCTACCTGATTTGC
6   G18   T002061_01                  Rv2061c
                       TAAGCTGCGCGGCGGCATGCGGAACAACATTGGCCTAGAGCTCAA
6   G20   T002062_01                  Rv2062c
                       CAAGAATACCGACACCCGTGAACACGACATCGCCGACTCCGACGA
6   G22   T002063_01                  Rv2063c
                       ACAACGAGTTCGTCGTCGATTCCGGTGAGTAGCTCGTCCACGGAA
6   G24   T002064_01                  Rv2064
                       GATGTCGCCGAGACCCTGATCGAGGTCGCGTTGCGTTTCGTCAAG
6   I02   T002065_01                  Rv2065
                       TGGTGGTTCGGTTGATTCACACCTGCGGGCAGGTCGACGTCGCCG
6   I04   T002066_01                  Rv2066
                       AGTTGGCCGACCTGAACCCCGCCGAAATCGACATGCGCTGCCTAT
6   I06   T002067_01                  Rv2067c
                       TATCAGTCGACCGGCACTGGACCATCAGCAATATCTGAAAGACAAG
6   I08   T002068_01                  Rv2068c
                       ATCTGGACAAACTGATCACCTACACCAGTGACGACATTCGGTCGAT
6   I10   T002069_01                  Rv2069
                       CCATGCCCGCGGATTCGAAGACCTCGTCGAGGTAACCACGATGAT
6   I12   T002070_01                  Rv2070c
                       TGGTCACCAAGAACAGCGGTGGCAAGATGACCCGAGCGAAGCTGG
6   I14   T002071_01                  Rv2071c
                       GCTGACCGCTGAGGGCTTTACCGACAGCTACCTATATTCGGTGGC
6   I16   T002072_01                  Rv2072c
                       TTCTCGCTCCGAATTGCGCAGGGCCACAGTAATTTACGGCTCGAAA
6   I18   T002073_01                  Rv2073c
                       TAAGCGCGTGGTGTGGATTCCGTGGGCGCTGCGGCCAATGTTTGT
6   I20   T002074_01                  Rv2074
                       ACAACTCGCCGCACGTGGTGGCGGTAGGTTTCACCTTCGACCCCA
6   I22   T002075_01                  Rv2075c
                       GGAAACTCAGTGGCTCGGCACGCACAACTCGTTCAACAGCCTCAG
6   I24   T002076_01                  Rv2076c
                       CCTCATCCCCGCGGTTGTGTACGGGAAAATGCGCAGGAGCCGTCG
6   K02   T002077_01                  Rv2077c
                       ACTATCGACGCGGCACAACGAAGAGTTATGTATGCTGTAGAGGACG
6   K04   T002078_01                  Rv2078
                       GGGGTTCACCGACATGGACGACGGCAACGCCGCTGAGTTGAAAGC
6   K06   T002079_01                  Rv2079
                       GACCGCGGCGCTGGGTGTGCAGTCTTTGCAATTGCCCAAGATCGG
6   K08   T002080_01                  Rv2080
                       CCGCAATACGACCGACCACCACCATGACGACGAGACCACCAACAT
6   K10   T002081_01                  Rv2081c
                       GGTGGGTTGGTGTCCATTGTCCTGTGGTGGGTGGGGGGGGTGTT
6   K12   T002082_01                  Rv2082
                       TTTGCGGGATCGGCTGACCGAGATCGCACAATCCGGCAATCAGCA
6   K14   T002083_01                  Rv2083
                       CATCCTGCTGCCCGAGCACAAGGACTTCGGACGCATAGCTCCCGA
6   K16   T002084_01                  Rv2084
                       CACTCCACGAGGGGGGAAATGCGGCCCGTAAATCGGTCTATCGAC
6   K18   T002085_01                  Rv2085
                       GCCGGCGTGTCCGCCAGCAGAAGTGGGAGCGTAAAGACCAGCGA
6   K20   T002086_01                  Rv2086
                       TTCTTCGCGCGGAAGTGCGACCCGCGACACCGCTGATCTGTGCGT
6   K22   T002087_01                  Rv2087
                       AGACTCACCTAGGTCACCCGTTTGGCGGAGCTATTCATCATCGCGA
6   K24   T002088_01                  Rv2088
                       CGCCGGAAGTTCTTGCAGGGCAAGGTTTTGATGGCCGGGCCGATT
6   M02   T002089_01                  Rv2089c
                       CCTGGATACCACTCCGACTCCACCCGAACCTACAGCATCGGCGAG
6   M04   T002090_01                  Rv2090
                       GGCGACCCGATTCGGGGTTGAATCCTCGATCGCGCGACTACAAAA
6   M06   T002091_01                  Rv2091c
                       GGTACGGCGCCAAGAACGTCAAAGACGTCAAGTGCAACAACGGTT
6   M08   T002092_01                  Rv2092c
                       ACGGCAGCGGATCACCGTTATTGGCAGGGGATTTCGTGCGTTGGT
6   M10   T002093_01                  Rv2093c
                       CTACTTTGGCTTTCTGCTCAACCTGCTGGTGGTGTTCGGGGTCAGC
6   M12   T002094_01                  Rv2094c
                       GAACTGCAGAACGAGAACAAAGCGGAAGCGTCTATCGAGACCCCC
6   M14   T002095_01                  Rv2095c
                       ATGACACCCTCACCACTCGGATCGTGGATCCCATCCGGGTGCTGT
6   M16   T002096_01                  Rv2096c
                       AGATCAGGTCCAGCGTGGCAGGCTATTCGGACAGCCCCAGCGTTG
6   M18   T002097_01                  Rv2097c
                       GATTTCACCGTCGACTGGGTACATCTCAAACTCAACGACCAGGCGC
6   M20   T002098_01                  Rv2098c
                       GGCGTTTCATGACCGGTTCGTCCAACTGCTTAACGCCGGTGGAGG
6   M22   T002099_01                  Rv2099c
                       TTGTGATTGCGAGCCCGGAGGCATTGCTGGCTGCGGCCACGGATT
6   M24   T002100_01                  Rv2100
                       GGCGCCCTGGCCGTTGGGGCCGACGCATCCATCAAATCTGAAGTG
6   O02   T002101_01                  Rv2101
                       ACCGAGCAGGCGTCGCTGTATCAGGCCGTCGTCGCCGACATGATG
6   O04   T002102_01                  Rv2102
                       GGCCGAAAACGCTTGGTACGCAGCAAAATTGCTGTCCGGCGAAAT
6   O06   T002103_01                  Rv2103c
                       GCGAACGTCTTGCTCTACGCCGTGAACACCACAAGTGAGCACCAC
6   O08   T002104_01                  Rv2104c
                       GCAGTTGGTAAGGCGCCGGATGGCCGAGCGGCAAGTGTCCTTCAA
6   O10   T002105_01                  Rv2105
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
6   O12   T002106_01                  Rv2106
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
6   O14   T002107_01                  Rv2107
                       CCGCCGACTACGTATCAAAAAAGTTATCGCTGTTCTTTAGTAGCCA
6   O16   T002108_01                  Rv2108
                       CCGACTACGAACAGATGTGGTTCCAAGACGCGCTAGTGATGGAGA
6   O18   T002109_01                  Rv2109c
                       ACGTCACGGGTCGGCAGTTGGCCAATGTCTACGCGCAGACTCTAG
6   O20   T002110_01                  Rv2110c
                       TGTCATGGCGGGTGACCGGCGTTCGACGCAGGGCAACATGATTTC
6   O22   T002111_01                  Rv2111c
                       CAGGAGCGTCGCGAAAAGCTGACCGAGGAGACCGACGATCTGCTC
6   O24   T002112_01                  Rv2112c
                       TGGTGCGTTGCTGGATTCGGTGGACAGTGCCGTGGAGCTGGTAGA
6   B02   T002113_01                  Rv2113
                       GGTCCGGGCCCTGCCGATCGTGCTACTGACGGCATTGGTGTTCTT
6   B04   T002114_01                  Rv2114
                       TGTCATCGATGAACCCTGCCCCATACACCGTCAGCCAGGTCAGCC
6   B06   T002115_01                  Rv2115c
                       TCCAAATTAATGGAAACTCTTAAAGAAGCCCGTCAACAACTGCTGG
6   B08   T002116_01                  Rv2116
                       ATCCGGACAACCGCGAGTTCACGTTTCCCATGGAATTCGTGTCCTT
6   B10   T002117_01                  Rv2117
                       ATGTGGATTGGCTGGCTGGAATTCGACGTGCTGCTGGGCGACGTG
6   B12   T002118_01                  Rv2118c
                       CGATGCCGCGCGGCCCGCAGGTGATCTATCCCAAAGATGCGGCCC
6   B14   T002119_01                  Rv2119
                       AAAAGACGTTGATGGCGATTTGGCGTGCTATCCAATCCGCAGGCG
6   B16   T002120_01                  Rv2120c
                       CCTGCATGGAACCTGGGCATCCTGGATGGGCAATTTCGTGACCGT
6   B18   T002121_01                  Rv2121c
                       CCGATTCCAAAGACTTGACCGTCATCGATCCGGTCAACAACGTCGA
6   B20   T002122_01                  Rv2122c
                       GCTGCCGAGCACGAATCCAACGACGCACTGGCGGAGGAGATCAGC
6   B22   T002123_01                  Rv2123
                       GCGGCTAGCAGCAGCTTCCCCGACCCGACCAAATTGATCCTGCAG
6   B24   T002124_01                  Rv2124c
                       GCTGCATCCCGAACAGTCGACCGACGCGTTCGTCCTGCACCATCC
6   D02   T002125_01                  Rv2125
                       GAGGCCTACTACGACTACCAGGTCAATCGGCCGGTCATCCGCCAA
6   D04   T002126_01                  Rv2126c
                       TTCGCCGACGAATTCACTGGGGGCTTTGCCCAAGGTGGCCGCGGT
6   D06   T002127_01                  Rv2127
                       CGCAATGGATTCTTGCCCTGATCGCCTTGACGGTGGTGTTGTCGA
6   D08   T002128_01                  Rv2128
                       GTTACGCCAGTAAGCCACCACTGTACGGAATGGCAATGGTCTTCTT
6   D10   T002129_01                  Rv2129c
                       GATGGATGCCGAGGTCGCCGCGCTCGGCCGCTTTGCCAGCGCCT
6   D12   T002130_01                  Rv2130c
                       ACCAGGACATCTACTTCCGCGCTGACGCCACCCTGCAGTTCGGCT
6   D14   T002131_01                  Rv2131c
                       CGACTCGATGGCTCGCCGCTGCGATACAACCAACTGGACCCCTAC
6   D16   T002132_01                  Rv2132
                       CTCACGAAACGACAGGTCGCAAATCGGTTCCAGCAGCAGACGTAC
6   D18   T002133_01                  Rv2133c
                       TACGGGGTCGACCATGGATTGTGTCTGCACGTCGAGAACAAGCTG
6   D20   T002134_01                  Rv2134c
                       AAACCGCACGTTCTACCTACAGGCGGTGCACGACTCCCGGGTGGT
6   D22   T002135_01                  Rv2135c
                       CGGTATGCATCTGGACAGCTTTCAGCGAATCACCGCCGACCCGGG
6   D24   T002136_01                  Rv2136c
                       TGCACGGCCTGGTCGTGAAGGCACATCGAAACACCGATTATCGGC
6   F02   T002137_01                  Rv2137c
                       TGGGCAAGTCGGCGATGGACGCAGTTTCTCCTTCCACATCGAGCA
6   F04   T002138_01                  Rv2138
                       CCGTCATTGGTTACGATCTGACCACCGGAATACCCGTAGAGAAGG
6   F06   T002139_01                  Rv2139
                       CTGGCGTCGTATCTGGTGGTCAACGTCAGCTCTCCGAACACACCG
6   F08   T002140_01                  Rv2140c
                       GCGGTGAAGGTCGAAAAGCTCGACCTCCCCGAGGACGCGAGTCCT
6   F10   T002141_01                  Rv2141c
                       TGAAGGCAGTGCTACATGACACCGCGAACCCTACGATGCTCAAGG
6   F12   T002142_01                  Rv2142c
                       ACGCGTTTGCGCCGTTATTCAAGCACTATCGACACATCTACCTCCG
6   F14   T002143_01                  Rv2143
                       CGTTTGCGGCGCTCGTTTCAGCCAGCCGATCTACTGCCGGAACTG
6   F16   T002144_01                  Rv2144c
                       GTATGCATCGGGGCCAGCGTGCTGGGTGTGGCGTTGCTGATCGTC
6   F18   T002145_01                  Rv2145c
                       GCTGACCCGCCTGATCGAAGAGAACTCCGATCTGCGTCAGAGGAT
6   F20   T002146_01                  Rv2146c
                       CCTGTCGATCATGGTGCTGCTGCTGGTTGCGTTCATCGGTATGCAA
6   F22   T002147_01                  Rv2147c
                       AAGGGGTCACGCAATGAGCACACTGCACAAGGTCAAGGCCTACTT
6   F24   T002148_01                  Rv2148c
                       ATGTTGCGATTTTGTTTCGATTGGGTTGTCGGTCCGTTGGCGAATC
6   H02   T002149_01                  Rv2149c
                       GATTTGGGTGTTGAGTCTATCGACGTCGATCCCCGCTGCACGGTG
6   H04   T002150_01                  Rv2150c
                       TCAACCGAATGATCGAGCAGGGCCTCAAAGGCGTGGAATTCATCG
6   H06   T002151_01                  Rv2151c
                       TTGCCTTATTTCGATGTGGACAATCCCGGTCCTAGCGATCCGACGA
6   H08   T002152_01                  Rv2152c
                       GGGCGACGGTGGCCGCTGCATGGTTGTGTTTCAACCCCATTTGTA
6   H10   T002153_01                  Rv2153c
                       GCCATCTACGTGCCGCTGCCGATCGGCAACGGTGAACAGCGGCTG
6   H12   T002154_01                  Rv2154c
                       GCGGCTGCTGACCGCCACCACGACACTGTGGGTGCTGGGACAGG
6   H14   T002155_01                  Rv2155c
                       GTCGTTCAGGTTGTGGCAGGCGAGGATACTGGTATGCCTGCGACT
6   H16   T002156_01                  Rv2156c
                       AACCGCTGGCGCCTGCATCGGTTTTTTGTGGTGGAACGCCGCGCC
6   H18   T002157_01                  Rv2157c
                       TAGATGTGTCTCGACTCGTTGTCGTGGGAACCGGGAGGTCGATCA
6   H20   T002158_01                  Rv2158c
                       GACCACCTGGATTTCCACCCCAGCATGGCCGACTACTTCGAGGCC
6   H22   T002159_01                  Rv2159c
                       ATGTCGCCGCCGAATACCTGGGCACCGCGGTGCAATTCCACTTCA
6   H24   T002160_01                  Rv2160c
                       AGATCCGGGCGGATATCGAAGTGCGCCAACTCGCGTTCGAGCTGC
6   J02   T002161_01                  Rv2161c
                       TGCATGATCCGATCCTGCTGGCCAAACAGATCGCCTCGCTGTGCG
6   J04   T002162_01                  Rv2162c
                       CGTTGTTCGGGTCGCACGCCCAGGGCTATCAGACGTTGAGCGCTC
6   J06   T002163_01                  Rv2163c
                       GGAAACGCGGTCATCTTGGTGTTGATGTTGGTCGCGGCAACACAA
6   J08   T002164_01                  Rv2164c
                       CCTGCGGCCGCGCACGTTGGCAAACAAGGTTCCGTTTGTGGTGCT
6   J10   T002165_01                  Rv2165c
                       GACATTGTCAACACTTACGACGAGGCGGCACTAGCCGACATCCTG
6   J12   T002166_01                  Rv2166c
                       GAACTACCAACAAATCCATGAAGAGAACTTCTCCGCGGCCAGCGAT
6   J14   T002167_01                  Rv2167c
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
6   J16   T002168_01                  Rv2168c
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
6   J18   T002169_01                  Rv2169c
                       CAAAGAGACCATGATCGGAAGTTTCCCGATACTCAGCGTTTTCGGT
6   J20   T002170_01                  Rv2170
                       GCCCGACTGATGACCAGCTACTTCGAGTTGACTGAATTGCACATCC
6   J22   T002171_01                  Rv2171
                       TCTCGAACTACGACAGCGACGGCTACGTGGGGTCGCAAGCAGTGT
6   J24   T002172_01                  Rv2172c
                       CCGAGATTCTGCTGTCGTTCGGCTTTGTCCCGAAGGTCGAGACCC
6   L02   T002173_01                  Rv2173
                       CGCTCTTCGCCTATTGGGGCTGGCACGCCGTTGCCAGTCGGGAAC
6   L04   T002174_01                  Rv2174
                       TCTCGACTTGGGTGATGGTGATCTTCAAACCCGACGGATCGCACG
6   L06   T002175_01                  Rv2175c
                       TCTACACTTGCGCGGGTGGGCAGCATTCCCGCTGGCGATGACGTT
6   L08   T002176_01                  Rv2176
                       CTGCTAACGGGGCACACACCGTTCACCGGCGACTCGGCCTTGTCG
6   L10   T002177_01                  Rv2177c
                       CGGTGGCTTCCGCAGTCCCGCTGCCAACAAGAAGGCGATCATCGC
6   L12   T002178_01                  Rv2178c
                       GAGTCGTCCACGGGGTTCAAGACCCGTCACTTCGATCGCATTGTC
6   L14   T002179_01                  Rv2179c
                       GACGGCACGGATTCGATCGAGTTGTGGGCCTGGGTGGGGGCCTA
6   L16   T002180_01                  Rv2180c
                       GAGAACCCGAATTCACCATAGCGGCGAGCATTTTCGGAGTCGGGG
6   L18   T002181_01                  Rv2181
                       GCTGGAGCCGATCAGCTCGAACTTCGCTTTCGGTCAGATCAATGTG
6   L20   T002182_01                  Rv2182c
                       ATTTTCATGGGTCCGCTCTTTACGTTGCTTGGTCGCCCGAAAGTTG
6   L22   T002183_01                  Rv2183c
                       CGAGAATACCAACGGCGAGGGCAGCATGAAATCCCACTACCAGGC
6   L24   T002184_01                  Rv2184c
                       GGACGCGCATCTGCGGGGTGGTGAGTTAACAGTTCGTTTCCGACC
6   N02   T002185_01                  Rv2185c
                       CGCCGACATCGAAGCCTACCCGCAATGGATTTCGGAGTATAAGGA
6   N04   T002186_01                  Rv2186c
                       AAAAATGGCCTTCGAGGTCAAGACAGTGCTAGAACGGTCACGCCC
6   N06   T002187_01                  Rv2187
                       CCTTCCACTCCAAAGTCACCGTGGGATTCACCAGCGACATCAAGAA
6   N08   T002188_01                  Rv2188c
                       CGTTGGTGATTGTCGGCGGCGGTCCATATCTAGAGACGTTGCGCA
6   N10   T002189_01                  Rv2189c
                       ATCTTTGTGGTTGCCGCCGGTAGCGACGAGCAGTTTCATGCCGCC
6   N12   T002190_01                  Rv2190c
                       AGAAGCTTGCGGACAACAGAACGGCCTTGGATGCTGCGAGAGCAC
6   N14   T002191_01                  Rv2191
                       GTATAACCGCAGGTCGAAGTTCCCATACCGGTGGTGGTGGGTGGC
6   N16   T002192_01                  Rv2192c
                       ATAAGTTGACGTTTGATCCCGCCGGATTCGGGTTTGCGCGCGCCC
6   N18   T002193_01                  Rv2193
                       GTGGCTATCCAGTGAATTAATGTTCTTTGCTGGGCTGTTCGCGTTC
6   N20   T002194_01                  Rv2194
                       TACGCACCCGACCTTGCGCCCGCCAATGAACAGCAAATCCTCACC
6   N22   T002195_01                  Rv2195
                       TCAGAAAAGGTTTATTCCCGAAGAGATTTCAATCCAGGAACGTCAC
6   N24   T002196_01                  Rv2196
                       ACCGGCGTGTATTTGACGCTGTTTTTCGATCCGTCCATGGTCGACG
6   P02   T002197_01                  Rv2197c
                       ACCCGCACACCACGTGGGTGCTGTACGCCGTAATTGTGGTCTCCG
6   P04   T002198_01                  Rv2198c
                       CTCGATCACCACGAGCGACGGAACGGTGCTCTCATCGAACTCCAA
6   P06   T002199_01                  Rv2199c
                       TGTGGCATTCATCCTCGCCTCGGCGGCCGGATTGGTCTTCGAATA
6   P08   T002200_01                  Rv2200c
                       GCGTATCGAATTCCAAATGGCCTCAGCCGATGTGATACACGCATTC
6   P10   T002201_01                  Rv2201
                       TCCGGACCGCTACGTGCTGGTGTTCAACGGCGAGATCTACAACTA
6   P12   T002202_01                  Rv2202c
                       GTCAACGGTGCTGCTTACTTGTTCACCAACGACTACGAATGGGATC
6   P14   T002203_01                  Rv2203
                       CGACGCGTTCCGCAAGCAGTTCTCCCAGGTCGAAGTGACCTCGAT
6   P16   T002204_01                  Rv2204c
                       AGCGCGCCGTATGTGGAAGGCGCGTCGATCGATTTCGTCGACACT
6   P18   T002205_01                  Rv2205c
                       TCAGCTCATGGGCTTGGCGTCTCAGGTAGCGGCGCGACTCGGGAA
6   P20   T002206_01                  Rv2206
                       TCGACGCGATCATCTTGGGTCGCAAAGTTGGCCGGCTGGTTGACA
6   P22   T002207_01                  Rv2207
                       CCGACGAAGAGGTTGATGCCGGCGCCGACTTGCTCATAGCCGGCG
6   P24   T002208_01                  Rv2208
                       TGCGTTCGCTGGCAACAGCTTTCGCATTCGCAACGGTGATACCCAC
6   B01   T002209_01                  Rv2209
                       ATTGGATTGGTCGTCGGTTCGATGCTGTGGCGACAGATAAACCGC
6   B03   T002210_01                  Rv2210c
                       GCTATTGATGCCGGATTCGCGGTCGAGGAACGCAGGATTGATATC
6   B05   T002211_01                  Rv2211c
                       ATCCGGCGGTGTGATCGACGACCTGATCGCCTACTACGTCAGCGA
6   B07   T002212_01                  Rv2212
                       TCGACCATGATCCGCGCCGGGTCACCGAACATCCAAATGACGCAC
6   B09   T002213_01                  Rv2213
                       CCAAAGACGCCGGACTCCGCAAAATCACCGTGCTCTGCTGTGCAA
6   B11   T002214_01                  Rv2214c
                       TCCGCGGTCAAGAAGAAGAAGCCGATCAGACCGGTCGCGCCGGAA
6   B13   T002215_01                  Rv2215
                       GACCCGCGAATCTTTGCAGGCAACGGCACAGCTGACACAAACCCA
6   B15   T002216_01                  Rv2216
                       GCGGTGGGCTACTACGGAAACACCAAGGACCGGGTGGTCGACGA
6   B17   T002217_01                  Rv2217
                       CCGATCATCGGGCTGGCCGAACCCCTCGACGTGGTCAATTACGTT
6   B19   T002218_01                  Rv2218
                       AGGAGGCCGGCTGCCCCAACATCTTCGAATGCTGGGAGGACCGAG
6   B21   T002219_01                  Rv2219
                       GTGTCATCTTCGTCGGCGAGGGATCAGCGGCCCGCGTCAAACCAC
6   B23   T002220_01                  Rv2220
                       GACGACATGCAGTTGTACAAGTACATCATCAAGAACACCGCCTGGC
6   D01   T002221_01                  Rv2221c
                       AAACTCGGCAGCGGCGGATTGCGCGACGTGGAGTTCGCCGTACAG
6   D03   T002222_01                  Rv2222c
                       GTTCTTCGTACCCTGGAAGAACGCGACATCCGCTTCGTCCGGCTG
6   D05   T002223_01                  Rv2223c
                       TCGAGGAAAGCATCAGCCAAATGGCGGGATTTCAGACCGCTTTCAA
6   D07   T002224_01                  Rv2224c
                       AGCCGCAGGTTGACTACAGCCGGGAGGGTGTGGCGCACATCGAG
6   D09   T002225_01                  Rv2225
                       AAGACCGCCCGCTTCGTCAAACGGTATGCCGATGTCGGTGGTGAA
6   D11   T002226_01                  Rv2226
                       AGCCAAGGTCATCCAGACGTTGCTAGGCGATCATCAAGACAGCGT
6   D13   T002227_01                  Rv2227
                       GGCAGTATCGATATTTCCATGCCCCCTATCCCGAGTGATCGAGCGT
6   D15   T002228_01                  Rv2228c
                       TCAACTACGAGTGGGTTCCGCGTGCCCGGAACACGTATGCAGACC
6   D17   T002229_01                  Rv2229c
                       GCCGAAATCGACCAAGCCCGGCACCAACATTCATCGCAACGCGAC
6   D19   T002230_01                  Rv2230c
                       TTCTCGACCCGGTGCCCGGAGCGGCCGATCTCGACAAGTGGGTCA
6   D21   T002231_01                  Rv2231c
                       CCGATGCTGACGGATTACGAAACTATTTGCAGAGCAAAGGAATTGC
6   D23   T002232_01                  Rv2232
                       CGTCGACCACCTGCTCACCAAACTTCGCGATCATCGCCTGATACCA
6   F01   T002233_01                  Rv2233
                       CAAGACCTCCACCACCGTCGTGACGCATGCCGCCACGATTGACGA
6   F03   T002234_01                  Rv2234
                       GGATGCTGCGGTCATTCGACCCACGCTCGGGAACCCATGCGCTCG
6   F05   T002235_01                  Rv2235
                       TGGCAGCTGGGCAAGAATGCCAAAACGTCACGAGAGAACCAGCAG
6   F07   T002236_01                  Rv2236c
                       AACACCCTGGACTCGATGATCGGCTACCGCTCGCCGCGTTATCTC
6   F09   T002237_01                  Rv2237
                       GCCGTTCAACCTGTTTGCGACGACGGGATTCTTGGCACCGGAGTT
6   F11   T002238_01                  Rv2238c
                       AGCTGGACCAGTTGCGTGATCACCTGCCCGAGTTTGAGAACGACG
6   F13   T002239_01                  Rv2239c
                       AGACCAACTTATCCAGGAATGGGGCTGGGACGAAGACACCGACGA
6   F15   T002240_01                  Rv2240c
                       GTGGTCAACGCACTACTCCTGTAGGTGGCGGGCTTCCGCTTGCGT
6   F17   T002241_01                  Rv2241
                       AATTTAATGAATACAACACCCGATGGCGATTACCAGACCTATAAGG
6   F19   T002242_01                  Rv2242
                       GCGCGATTGAAGCTTGTGCCAGAAAGTTGTTCGTTCATCCAAACAC
6   F21   T002243_01                  Rv2243
                       CGAACTTCGGGGGGTTCCGGCACGCGCCGTCAAGTCACCCGCAG
6   F23   T002244_01                  Rv2244
                       ATCCAGAAGCTCGAGGAAGAAAACCCGGAGGCGGCTCAGGCGTTG
6   H01   T002245_01                  Rv2245
                       GCGGTCACCTCAAGGATCCGGTCGACAGCCACATGGGCCGACTCG
6   H03   T002246_01                  Rv2246
                       AACGTTCGCAAGACCAATGACGGAGCTGGTTACCGGGAAAGCCTT
6   H05   T002247_01                  Rv2247
                       TGGGCGTCGAGGGGTGCACGCACATCGTCAACGCCTACGACACTG
6   H07   T002248_01                  Rv2248
                       CCCGAACTTCAATACCCGATACACGGCCACGGTGGTGAAATGTGG
6   H09   T002249_01                  Rv2249c
                       TCTTCGACGCGAAGTCGTTTGCCAATCCGACTGCCGCGCTGACCA
6   H11   T002250_01                  Rv2250c
                       CATCGGTGGAAGGAGTTCCTCGCGGTGAGTCACGCGTTACAGTAT
6   H13   T002251_01                  Rv2251
                       ACGACATGATTCTTGGGCTGCGCATGATCACTCCGGTGGGGGTGC
6   H15   T002252_01                  Rv2252
                       GATATCGTTGTTGACGGCTGGACGGAAACCATTGACCTGGGCCGG
6   H17   T002253_01                  Rv2253
                       GAAAACCGGCACCAGCATGGCGGCCAACCGGCCAGAGTATCCACA
6   H19   T002254_01                  Rv2254c
                       ACGATCAACGTGTTGAGGGTTTGGCCCGAAATCGTCGGTGCGATC
6   H21   T002255_01                  Rv2255c
                       TCCGTGCTCGACCATGCCAGAAAGTCGTCGCTGTCCTCCGCCGGT
6   H23   T002256_01                  Rv2256c
                       TTCGAGGTCACCGAAGACCCTAGCCCTGGAGTCGACGGCCAGCGA
6   J01   T002257_01                  Rv2257c
                       GGGGCTGGGCTTTGAGATCAGGAATTCGAAATCGCCCCACTGGAC
6   J03   T002258_01                  Rv2258c
                       ACTGGAAGACAATGTCGGCGTTCCGCTGAGCACCTACCTGTACAC
6   J05   T002259_01                  Rv2259
                       CGAAGACGTCGAGGAGGCGTTCCACAAGATGCATGGCGGCAAGGT
6   J07   T002260_01                  Rv2260
                       GCGTCATCACCCACGGCACCTTCGAACTCGATGGCGGCAGTTGGG
6   J09   T002261_01                  Rv2261c
                       ACGCTCTACCTTCGGTTGGGTGACTGGGTGCCAGTGACGGCATTT
6   J11   T002262_01                  Rv2262c
                       TTGGTTCCGTTTGGCGAATATGTGCTCCGCTGCGCCCGCTTTTCGG
6   J13   T002263_01                  Rv2263
                       CTGATGGAACGCTTGTACAAGACGTCCTGGCGTTTCGCACCGTTCC
6   J15   T002264_01                  Rv2264c
                       CTAAGCTGCGGATCGAATGTCGCAAAGCCAAGGAACGGCTTTCGT
6   J17   T002265_01                  Rv2265
                       CGATTCTGGTGGTGCTATTCGCCTTCACGGACAACGTCACAATGGT
6   J19   T002266_01                  Rv2266
                       TGCAGATTATCTGTGACATGATGGGGATTCCCAAGGCGGACCATCA
6   J21   T002267_01                  Rv2267c
                       CTCTATACGTTTCTCAGCATGGTCAATTCCTGTCTGGGGTTGTGGC
6   J23   T002268_01                  Rv2268c
                       CTTCGCGGTGTTGCTGCTGGTTGCGGGCTATGAGAGCACTGCTCA
6   L01   T002269_01                  Rv2269c
                       AACGCTTTGCGAAACTGCGCAATTATTGCGATGCCCGCCGTTACCC
6   L03   T002270_01                  Rv2270
                       GGTGGCCGTCGATGCCGCCGTCGTTTCCATGGCCAATCGTGATTG
6   L05   T002271_01                  Rv2271
                       ACAAGAGTTTGGTGGCTACTGCGATTGTGAGATCGTAATGAATGTC
6   L07   T002272_01                  Rv2272
                       ATGACTCAAACGACACCGCGACCGATGTCGAACCCGACTACCGGT
6   L09   T002273_01                  Rv2273
                       CCAGGTCCACATCCTCGCGACAGCGGTGCTGGTGCTTATGGTCGT
6   L11   T002274_01                  Rv2274c
                       ATTTTGCGTATCAGCCTGGACCGGTCTTGTGGTTGACTTGCAGGCT
6   L13   T002275_01                  Rv2275
                       GCCATTCACCCAACAATGTCAGATCATCCACACCGAAGGAGATCAT
6   L15   T002276_01                  Rv2276
                       TCCTCACCACCGCGCTGATATCGCTGATACAACGCCCGCAACTTCG
6   L17   T002277_01                  Rv2277c
                       GGCATGAAGGTCATGGGTTTCGCGGTGAAAACTGTCGACGACTAC
6   L19   T002278_01                  Rv2278
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
6   L21   T002279_01                  Rv2279
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
6   L23   T002280_01                  Rv2280
                       CAAGGATCCGGAGAAAAAGAAGAAGCTCATGACCGACATCTTTGCT
6   N01   T002281_01                  Rv2281
                       CGGCGTCATCAAACGGCACATCCTGCTGTACAACGAACAGGCCGA
6   N03   T002282_01                  Rv2282c
                       TGAGCCGGCTAGCGATAGCCGATGACCTGGCGTTCGGTCGATTAC
6   N05   T002283_01                  Rv2283
                       TGCTCGAAAAATGCCCCCACGCGAGCGTCGACTGCGGTGCCTCGA
6   N07   T002284_01                  Rv2284
                       GCTAGGCTGGATCTGCGTGGCGATCAACTACCGACACAGCCCGCG
6   N09   T002285_01                  Rv2285
                       CTCGAAGGACCCGTTGTATCTTTCGGGCGCCAAGCTGGATGTGAT
6   N11   T002286_01                  Rv2286c
                       CTATGGCTGGTCGTTGATGCGGATCGGTGCGCTGCTGCGTCGAAC
6   N13   T002287_01                  Rv2287
                       ATTCCCCGTTTCGGTGACGTTCAGATCGATGGCGAGGTGGTGCTG
6   N15   T002288_01                  Rv2288
                       GCGCCGCCCGCTGATCGAACCAGCAACGGTTCAGGTTTTGGCCAT
6   N17   T002289_01                  Rv2289
                       CAACCCGAAGAACGCGCGCACTCAGGATCAGCTGCACATCCACAT
6   N19   T002290_01                  Rv2290
                       GTCCGACTCCACGCCCCCAGACGTCAATGGTTTTGGTATCTCCCTT
6   N21   T002291_01                  Rv2291
                       TACGACGACTGGAATCGAGCCGGTTCCGCGCGAGCGTGGTGGGT
6   N23   T002292_01                  Rv2292c
                       CCCGGCGACCCGCTGCATCTGCCGGGCTTCCCCGTCCAGTTCTTC
6   P01   T002293_01                  Rv2293c
                       CAGACGCTTTCTGTTGTACTGGACAACATCAACACGCTCGGCAATC
6   P03   T002294_01                  Rv2294
                       CCCTATCTGAGCGTCCCCGGTGCGGAAAACGCATTCGCACTAATG
6   P05   T002295_01                  Rv2295
                       CATGAGATGCCTGTCGAAGAGACCTCCACCCCCCAGAAGCTGCCC
6   P07   T002296_01                  Rv2296
                       ACTACACCTACCTGCGGCACGTCGAGTGGGTGACGTCCTGGTTCG
6   P09   T002297_01                  Rv2297
                       ACCGCTTACGAAGTCCGTTGCGATAACCCAACTCTCATGGTGCTTT
6   P11   T002298_01                  Rv2298
                       GCAAGGACTATTGGGTGGCAAGTACGGACTCGAGAATCGTCCCGG
6   P13   T002299_01                  Rv2299c
                       ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
6   P15   T002300_01                  Rv2300c
                       ACCTCAACTGCGGCACCATGAATGCATTTGGCATCGCTCTGTTATG
6   P17   T002301_01                  Rv2301
                       CGCCGGGGCCTATGTCTCGTCGGGCATGGTCAACCAGGCGGCTG
6   P19   T002302_01                  Rv2302
                       CCTCGTGGTGAAGGGCACAACCACGGAACGGCATGATCAACATGC
6   P21   T002303_01                  Rv2303c
                       CTGATCGCCTGGAAACACCCGAACGTCTACCTGGAATTGGCCGCG
6   P23   T002304_01                  Rv2304c
                       ATGAGCCACGACATTGCTACCGAGGAAGCCGACGACGGCGCGCTG
7   A01   T002305_01                  Rv2305
                       CTTCTCCCCTTGGTCGAAGATCGGTTCGTCGAAAGCGTCTGTCTGT
7   A03   T002306_01                  Rv2306c
                       TGGCGCCGACCCGATGAACGACCCAACGACCATCTGCCACAACGG
7   A05   T002307_01                  Rv2307c
                       TCTGGTCGCAGCAGCGTCGGCTAATCTACTTCCCGTCTGCGGGTC
7   A07   T002308_01                  Rv2308
                       CGACAAGGCCTTTCCCGAAATCGTCATCAACCCAAGCCGATATAGC
7   A09   T002309_01                  Rv2309c
                       TGCTGCGGCATCACTGCGGTATTCCGACCCTGATTCAGTCGCGGT
7   A11   T002310_01                  Rv2310
                       CTTGCCGAGAGCGCAATGGACATCGACGCCGACGAGGATCCCGAG
7   A13   T002311_01                  Rv2311
                       GGATGGGACCTTTGGGTGAGTGGGAAAGCTGAGGCAATGAGTGAC
7   A15   T002312_01                  Rv2312
                       AGACATCGACGGCGGGATCGACCTAACTGACGATGAATTCCAGGC
7   A17   T002313_01                  Rv2313c
                       CCGCGCTTGATGCGGGCGGTTCGGAGACGTTGTATGGCGAGATCG
7   A19   T002314_01                  Rv2314c
                       ACTGCGTTGGGCGGGCAATTCGATGACCACCAACGGCGTTTCCCA
7   A21   T002315_01                  Rv2315c
                       CCATGGCTGTCCGTCGGCGTTGTTCCGGGGCGTCAATGTGCTCAA
7   A23   T002316_01                  Rv2316
                       CATCCTGGTCGGTGCCACCGTGGTGCAGCATCTGTATTTCCGGCG
7   C01   T002317_01                  Rv2317
                       GCTGATTGCGCTCTTCGTGACCTTCCAGCGGCACATCGTCGCATC
7   C03   T002318_01                  Rv2318
                       CAACGACAACGGCGATTTCTCCCGTAACCAGTTTCTGGCTGGCAAG
7   C05   T002319_01                  Rv2319c
                       ATTCCTCGGCTCCTGGAGTGGCAAGATCATTCGCTACAGCCCGGT
7   C07   T002320_01                  Rv2320c
                       TTCCAGCTGACCATGTTCGGGGTTGGCGCGACGATAGGTACCGGC
7   C09   T002321_01                  Rv2321c
                       CCGTGGTTTCCATGGTCGTCTGGGGAGAATGTCAAGCTCGCTCCG
7   C11   T002322_01                  Rv2322c
                       GCGGGCCGGCACGATATCATTTTGGCAAACAACAACTTTCATGGCC
7   C13   T002323_01                  Rv2323c
                       AGAGCCAAATATCGTTGGTTTATGACGGATTCCTACGTCGCTGCTG
7   C15   T002324_01                  Rv2324
                       CAGCGCTGACGTCGAACGCAGCGAAAGCACCGTCGTGCTGTCAAA
7   C17   T002325_01                  Rv2325c
                       GACGCTTGCGATCACTGCCATGGCCAGCGGGACAGCGGTGGCGA
7   C19   T002326_01                  Rv2326c
                       CGCCTTGGTGCACATCACGCACTACGACAACGAAGCCGATTCCGC
7   C21   T002327_01                  Rv2327
                       ATCACTGCTCGCAACCAACGATGACCACGCAGGTACGACGACTCG
7   C23   T002328_01                  Rv2328
                       GCCGCTCAGCTCGGTGCCCCTGGGATAGCTGTCTTACAGACCGCC
7   E01   T002329_01                  Rv2329c
                       ATGCCCCAGGACGTCTACGGCTTTTCAACCAGTGACAAGTTTCTGC
7   E03   T002330_01                  Rv2330c
                       GCTCCAAATGGGTCGAAATCACCCGAGGACATACCCGCAACTGCC
7   E05   T002331_01                  Rv2331
                       TGCTCGCTCATCGGCCAGCCCAACACGATGGGCGACGAAATGGGT
7   E07   T002332_01                  Rv2332
                       GGCCGGCGAACGCGCGGAAGATCCTAGACACATACGGCACGGATT
7   E09   T002333_01                  Rv2333c
                       AGCGATGACCGTCGAGTGCGCGGTTAGTCATATGCCGGGAGCCAC
7   E11   T002334_01                  Rv2334
                       CGTCGTAGTGCTCCCCGACTTCGGCGAACGATATCTGAGCACACC
7   E13   T002335_01                  Rv2335
                       CGAATTCACTCGCATCCTGACCGGTGTAGATATCCACCCCGGTGCC
7   E15   T002336_01                  Rv2336
                       GCTTTACTTCGCAAAGGCAAACAACTGGTGTGGGAACCACCACTGT
7   E17   T002337_01                  Rv2337c
                       AACAGATCCTTCGGTTGGTCAGATTGGCCGAAACTGAGCGCTTTCG
7   E19   T002338_01                  Rv2338c
                       GGTGTTGAAGATTCTGCTCGGACATGGGCGCGTTTACGCTGCTCC
7   E21   T002339_01                  Rv2339
                       GGTATAGCCGCGGTATGCCTGGTATTTATTGTCATGCTCATGATTA
7   E23   T002340_01                  Rv2340c
                       CGTTGACGAGTCTTCGGGGGTTGCGCCACACGCTAAAGAAGTTGT
7   G01   T002341_01                  Rv2341
                       CACGCCACAGTGCGGTTCACGGTCGACGAAGGCCAGATCTCGGGC
7   G03   T002342_01                  Rv2342
                       CGTCGCAAGATCGCCAATCGGATCTCACCCGATGCTGGGTTTGTG
7   G05   T002343_01                  Rv2343c
                       CTCATTGACAAAACATCTGCAGCGCAAGGGTTTTGAGTTCGAGGAA
7   G07   T002344_01                  Rv2344c
                       GACCTTGATCTGGTCGAATTGGCCGGTCTAGCCCATGACATCGGG
7   G09   T002345_01                  Rv2345
                       AACGGCAGCTGGAAGCCGCACATGACCGGAAATCGAGCAACCCGA
7   G11   T002346_01                  Rv2346c
                       GTGACTTTTGGGGCGGCGCCGGTTCGGTGGCTTGCCAGGAGTTCA
7   G13   T002347_01                  Rv2347c
                       ATGAATCAGGCGTTTCGCAACATCGTGAACATGCTGCACGGGGTG
7   G15   T002348_01                  Rv2348c
                       ATGGACGAGTGGGATGAGTGGCAGGCGTGGAACGAGTGGGTGGC
7   G17   T002349_01                  Rv2349c
                       ATTACGCACGTCCTGACATACCGATCCACTACTTGTTGGCCGATAC
7   G19   T002350_01                  Rv2350c
                       AAACAAATTGCTGGGGGCTCTCAACAACACCGTCGTCGGCTACAAC
7   G21   T002351_01                  Rv2351c
                       CACCCGCGCAGGACCATATGTCCCTTTGACCATGGGTTACTACACG
7   G23   T002352_01                  Rv2352c
                       CGGCGTATCCGGCCAGTATGTTGATTGGGCCGATGATGCAGTTGG
7   I01   T002353_01                  Rv2353c
                       TCAACACGGGCTACGGCAACTCAGGTTTCTATAACGCGGCCGTCA
7   I03   T002354_01                  Rv2354
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
7   I05   T002355_01                  Rv2355
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
7   I07   T002356_01                  Rv2356c
                       GGTAAATTCGGGTAGCCAGAACTCCGGTGCTTTCAATGCGGGTGT
7   I09   T002357_01                  Rv2357c
                       TATCGACCTGGGTATTCGTCGGGAGAACCTGCGGTTGTGGGAGCA
7   I11   T002358_01                  Rv2358
                       AGATGTGGGTGCCGACGAAGTAGGCGGTCACCAGCATCCCGCGG
7   I13   T002359_01                  Rv2359
                       CAAACATGGATTCTCTGACGTCAGCCACACCATCGAGATCTTCGGC
7   I15   T002360_01                  Rv2360c
                       ATCCTGGCGTGGGATCTGCCGTTGACCAAGAGGCTCGCCGAGCAA
7   I17   T002361_01                  Rv2361c
                       ATCGAACTTGGGATCAAGTGGCTCAGCCTCTACGCCTTCTCCACGG
7   I19   T002362_01                  Rv2362c
                       CAATGGCATCTGGAACGGCAGCTGAAAACGTTGCCGCTGGTGGAG
7   I21   T002363_01                  Rv2363
                       CGGTGATCGTCGGCAAGACGAATACTTGTGAATTGGGCCAGTGGC
7   I23   T002364_01                  Rv2364c
                       ACCGCGGCCCGTAGCCAGATCGAAAACCTGCTGGGCACCAAGGTC
7   K01   T002365_01                  Rv2365c
                       ATGATGAGGAGGCCGATCACCCTGGCTGAGCAGCTAGATGCCGAG
7   K03   T002366_01                  Rv2366c
                       TTTTCATCCGATACCACTTCAGCATGGTGTGGGGGTTGTATCTTGC
7   K05   T002367_01                  Rv2367c
                       AGCCAACGAGTCAGGCATCGACGTCTCGGAAGCGGAACTAGTCAG
7   K07   T002368_01                  Rv2368c
                       GCGAAAAGATCGATCCGTACCTACGACCGCTCTATGACGCGCTGT
7   K09   T002369_01                  Rv2369c
                       CCGTCCCTGACCGGCGTTAGAATGAAACTTCAACACTCGTCAGTTC
7   K11   T002370_01                  Rv2370c
                       TCGGGGACCTCGAATCGGCCAGCCCTCAACTGCTCACCACCGTAT
7   K13   T002371_01                  Rv2371
                       GCCGATGAGGTGTCGGCGGACGTCGTGGCGCTCTTTGGCTGGGT
7   K15   T002372_01                  Rv2372c
                       CGGTGTGCTCACATCTCGTTGGGATGCATCAGCGAGCGACTGTGA
7   K17   T002373_01                  Rv2373c
                       AAATTCAAAGAAATCAGCGTCGCCTACGAGGTGCTCAGTGACCCGG
7   K19   T002374_01                  Rv2374c
                       CTATCCGGGAACTATCGCCAGCGTGGCTGCGGTTGCTCTTTATATC
7   K21   T002375_01                  Rv2375
                       CTGTCCTATAGGGACTGGTCTCAGATACCGCCGCAACAGATCCGG
7   K23   T002376_01                  Rv2376c
                       CGTGAATCAAGGCGGCTGGATGCTGTCACGCGCATCGGCGATGGA
7   M01   T002377_01                  Rv2377c
                       GGACTACGTGGAAAAGAACTGGACCGATCTGCGGCCGAAGAGCCT
7   M03   T002378_01                  Rv2378c
                       TCACCGTCATCTCCCCGCAGGTAACCCTGTTCACCCGCGGCGAGG
7   M05   T002379_01                  Rv2379c
                       GCGTTCGCCGATGTCATGGAAACCTCGAACGTCGATGTCACCGCG
7   M07   T002380_01                  Rv2380c
                       CAGTGCGATTGTCGTCGTCTCAAATGCGTAGCTGGTTCAACTATCG
7   M09   T002381_01                  Rv2381c
                       ATTCCATGCTGGCACTGGACTTGCGTAACCGACTCAAACGATCAAT
7   M11   T002382_01                  Rv2382c
                       CTGTTATGTCGGTGCCTCGGCGCTCGAATACGGTCCCGCTTTGAC
7   M13   T002383_01                  Rv2383c
                       ACCAGTTGGGAGACTCACACCTCCGGTCGCTTCACGCTGTCGCAC
7   M15   T002384_01                  Rv2384
                       AAAAATCTGCGCTGCAGTCGTTTTCGCTGGAGCTCCGATTACGCTT
7   M17   T002385_01                  Rv2385
                       CGAAGCGGCCAAAGCCATGACCTATGTTGCCCAGTTCATCCGCAG
7   M19   T002386_01                  Rv2386c
                       AGAGCGCGAATTCGAGGAGACTTGCGAAAAGCTATCCACATTGACG
7   M21   T002387_01                  Rv2387
                       AGATCAAGCCGTCCAACGTCGGCGCCATCGTTGGGTTCATGGTGG
7   M23   T002388_01                  Rv2388c
                       GATAGCGGAGGGCTTCACACACGTCAACCTCGACCTGATCTATGG
7   O01   T002389_01                  Rv2389c
                       CCCAGCAACAGATCGAGGTCGCAGACAACATTATGAAAACCCAAGG
7   O03   T002390_01                  Rv2390c
                       CCACCATGGACTGTGAGCGGATCGACCACAACATGAGGGACATTC
7   O05   T002391_01                  Rv2391
                       GCAATACCACTGGATCGAAGTGGAAAACGTCCCTGAAATCTGGCGA
7   O07   T002392_01                  Rv2392
                       CGTACCGGTCATCTTTCTTGATACCGGCTACCACTTCGTCGAAACA
7   O09   T002393_01                  Rv2393
                       TTCTGTGAGCTCAACTCGCCCAACCTGGTCGACGTGCTCAACCGC
7   O11   T002394_01                  Rv2394
                       GCTCCATGATCATCCAGTTCGTCGTGAAAACACTTGTGGCGATGCT
7   O13   T002395_01                  Rv2395
                       AATCTGCAGGACCTCAAAACCGGCCAACTCGTCGGCGCTACCCCA
7   O15   T002396_01                  Rv2396
                       CTTCGCCGGAGGCGCTAGCGGCGACAGCCACATATTTGACAGGTA
7   O17   T002397_01                  Rv2397c
                       ACGTGGCGTTCGGGTTGAAGATCCGTAAGCGCCCCAAGGCCGAGA
7   O19   T002398_01                  Rv2398c
                       CGCTCGAACCCTCGGCGAATATGGGGCGGTCATCATCGTCTCGTC
7   O21   T002399_01                  Rv2399c
                       TATCGATCTGCCGTTTGCGTTGCCCACCATCGTCGCCAGCCTGGTG
7   O23   T002400_01                  Rv2400c
                       GGTATTGAGGTCATCACGCCCAGTCCGCTGAGTTCGGGTTCTGCC
7   A02   T002401_01                  Rv2401
                       GAAAAACCCGATGCTGCGTGCACGTGGCGAAGCCTAACAGAATTC
7   A04   T002402_01                  Rv2402
                       GGTACCGGGTGCATGAGACCGACGACGGGCTTTCCGGCGAGGAA
7   A06   T002403_01                  Rv2403c
                       CAGGCCCTTCCACCTTTCCCGCCGGTGTTCGGGGGCAGCGACAGT
7   A08   T002404_01                  Rv2404c
                       TCGTGCACAAGGACACGGCGTATGCCTACGGCAACAAGATGACCA
7   A10   T002405_01                  Rv2405
                       TTGCAGCGCTTCGCGGAGAACCTGGTGTTCACTGAGGCTCCTAAG
7   A12   T002406_01                  Rv2406c
                       GGTGAAATCGCGCATGGGAGAACTCGAGGCCGAGCAGCAGCAGC
7   A14   T002407_01                  Rv2407
                       GCGTTGGTACACACGGTGATCCGCAAAGACATCGTCACGCAGATC
7   A16   T002408_01                  Rv2408
                       GGGGAAACGTCGGTGTAGTCGCGGCCTACACCCACACTGATGTAT
7   A18   T002409_01                  Rv2409c
                       CAATACATCAGTGTGGGTGTAGGCCGCGACTACACCGACGTTTCC
7   A20   T002410_01                  Rv2410c
                       TGGCTTTCAGCACCAATAGCCAGGGTGGTTCTTCCATTGTCGACGC
7   A22   T002411_01                  Rv2411c
                       GTCCGGGTATGAACCGCACGACCAACAACCGCAACAGCAGCAGCA
7   A24   T002412_01                  Rv2412
                       GGGCGTGATCCACAAAAACCAGGCCGCCAACAAGAAGTCGGCACT
7   C02   T002413_01                  Rv2413c
                       ATGAGGTTGGTGGCCGAACTCAATGCTAACGTCAAGGGCGCCGTC
7   C04   T002414_01                  Rv2414c
                       CAAAACGATGGCGGTGGCCGTCATATGTCTGCTTGCCTGGTCGCT
7   C06   T002415_01                  Rv2415c
                       AGGCCCTAAGACAGCTCCTAAGACAGCTGAGGTGCTCGACCTCAA
7   C08   T002416_01                  Rv2416c
                       CGAATCAGCATCATCACCCATCCACAGGACCCGTTACCCCACCTGC
7   C10   T002417_01                  Rv2417c
                       AGGTCCCGCTGCATATCTTGCTTGACGGCCTCGACCTGCGCGACG
7   C12   T002418_01                  Rv2418c
                       AGTGGATATGGTAATCGTGATGGCATTCACTGGAATTTTGAAGCCC
7   C14   T002419_01                  Rv2419c
                       CTTCGAGAGCATCCGGTGGCGCCTTGATGTGTGGAATGCTTCGGC
7   C16   T002420_01                  Rv2420c
                       GACATCGTGGTGCACATCCAGCATCAGGACGACCGCAATTTCTACG
7   C18   T002421_01                  Rv2421c
                       GGCGGACCCACCTACACCAAGGACACGCTGGCCGATCTGCATGCT
7   C20   T002422_01                  Rv2422
                       TTTTGAACGCAGGACGCTGGCGACCGTGGCGAAGCTGCTTGCACA
7   C22   T002423_01                  Rv2423
                       ACGAGTACGTGACAATGTGCGCCGGCCTTTTTGCGGGTGTGGGCA
7   C24   T002424_01                  Rv2424c
                       CACCAGGATCTCGGCGCCGACTACTTCACCACCCGCATGGATCCC
7   E02   T002425_01                  Rv2425c
                       AGCACGTCCAGATGTACGGAATTCCACAGCTTTCCGAGAACGTCGA
7   E04   T002426_01                  Rv2426c
                       TGCAGCTTAAGAAGGTGCCATCGATCGCCGAGACCATCGACTGGG
7   E06   T002427_01                  Rv2427c
                       TTCGGCGCCGAGATCGGCATCTCCACCCAGAAACTGCATGCCCGC
7   E08   T002428_01                  Rv2428
                       GTGACGAACACCCAGGCAAGTGGCGGGTGGTGTTCTTTTGGCCGA
7   E10   T002429_01                  Rv2429
                       GCTCAAGGCCGCGCTCCCCGAGTACGCCAAAGACATCAAGCTGAA
7   E12   T002430_01                  Rv2430c
                       ATGACGACTTCTGGGACGAGGACGGAGAGGTGATGAGGGACTACA
7   E14   T002431_01                  Rv2431c
                       GCACGCCTTGACCACTGGCGCCGATAAGTATGCGACCGCCGAGGC
7   E16   T002432_01                  Rv2432c
                       GGTAAGCTACATCCCTACTGCTTTGAACGTCAGCATGGGGGGTATC
7   E18   T002433_01                  Rv2433c
                       ACGTGGGTACGGATGGTGATCAATTATTTGGTCCCGTTCCTGGTGG
7   E20   T002434_01                  Rv2434c
                       CAGGCAAGTCTGCTGCGAAACTACCTGCTACCCCTGGGCGCGGTT
7   E22   T002435_01                  Rv2435c
                       GAGTCGGAATCTGCAAACCAAAGAGGAGCTGCTCAACGAGCAACG
7   E24   T002436_01                  Rv2436
                       CTCGGCCGTCGCCAACTGCGATGTACTGTTGACCCAGTTGGAGAT
7   G02   T002437_01                  Rv2437
                       TCACCCCATCTACACGGCCATGATGGCGTTTGGCCTCGGGCTGTT
7   G04   T002438_01                  Rv2438c
                       CGAGGCCAAGGTCGGACCTTTCGCCCTACAGGACTTTTCGCTTTTT
7   G06   T002439_01                  Rv2439c
                       GTGGCGATTGTCAACGAGAACGACACCGTGGCCACCAACGAGATC
7   G08   T002440_01                  Rv2440c
                       GGTCGTCATCCACACCAGAGCGGGTTCGGGCGGTAACGGCTGCG
7   G10   T002441_01                  Rv2441c
                       CGGGGCGGTCGAGTTCGGCATCAAACGCGGACGTAAGACGGTGA
7   G12   T002442_01                  Rv2442c
                       AAAGTCGCTGTCGGAGATGTGGTCAAGGTCGAAAAGCTGGAATCC
7   G14   T002443_01                  Rv2443
                       AAAGACCATTGACCTGTCCAAAGCCGACGAGGTGTTGCGCGGTCG
7   G16   T002444_01                  Rv2444c
                       CAAGCGATCGAAAAAGAGCCGGTCCGAAGAGTCCAGTGATAGGAG
7   G18   T002445_01                  Rv2445c
                       CGAAAGGCAGCTGATCGGCGAGATCATCAGCCGCATCGAGCGCAA
7   G20   T002446_01                  Rv2446c
                       GTTGTGGGTCCTGATCGCGTATTTGCGTGCCGAGGTGCGGCGGCG
7   G22   T002447_01                  Rv2447c
                       GATCGTCATCACCGGCTCGGTTGTCACCGCAGGGGCGGCTCGGAC
7   G24   T002448_01                  Rv2448c
                       TTCGGGCCGAAGTTGATTCGGCCTTCGACGGATACGAGTTCAGCC
7   I02   T002449_01                  Rv2449c
                       AGGCGACGTCGGTGTTGTTGGGGGAGTGTGGTCTGGCGCTGGCA
7   I04   T002450_01                  Rv2450c
                       CTGGGACGCGATCGCGCAGTGCGAGTCCGGTGGAAACTGGTCGA
7   I06   T002451_01                  Rv2451
                       GTACGATAACGATTTGGATTCGTCATCTCCGGCAAACCGAGATATC
7   I08   T002452_01                  Rv2452c
                       TTTTCAATGAAGACGTTATTAACATTGGCCATGGCCGCCGCTTCTA
7   I10   T002453_01                  Rv2453c
                       CCGGTGTCCGGCTCGCGTTTGTCTGTGCGGTCGACATGCCTTATC
7   I12   T002454_01                  Rv2454c
                       ATCAGCGGTATCGGATGCTCCAGCCGGTTCCCCTATTACCTGGAAA
7   I14   T002455_01                  Rv2455c
                       GATTACTCCGGCGTCGGACATCCTGCACGAACTGTCCAAGCACAAG
7   I16   T002456_01                  Rv2456c
                       TGTCTTGACCGCTCGCGGGTTCCTCTACACGTTGTCGGATAACTCC
7   I18   T002457_01                  Rv2457c
                       CGTTGGTCAAGATCCTGTCCGAGCCGAAGAACGCTTTGGTCAAGC
7   I20   T002458_01                  Rv2458
                       CCGGCGCTGACATGCTCGCCCTGGAAACCATCCCCGATATCGACG
7   I22   T002459_01                  Rv2459
                       TTCGTGGACGTCAACATCGTCAATGTCGCATTGCCCAGCATCCAAA
7   I24   T002460_01                  Rv2460c
                       GGGGTCAAGGAGTCCAATCCATACAACAAGCTGTTCGAGGAACGC
7   K02   T002461_01                  Rv2461c
                       CATCATCTTCCTGGGCTCGGAGGTGAACGACGAGATCGCCAACCG
7   K04   T002462_01                  Rv2462c
                       CCGATGAGCTGCAGGTCCAAGTTGGCCAGGATGATCTGACCGAAC
7   K06   T002463_01                  Rv2463
                       CAAGGCACTAACGGCCACGTGTGTGCATCAGCTCGTCGATCGCGG
7   K08   T002464_01                  Rv2464c
                       GTGTTGGCAACGTCTACCGTAATGAGTTGCTTTTTCGGCACCGGAT
7   K10   T002465_01                  Rv2465c
                       ACCTGGGGGCCGACCACGCCGGATATGAGCTCAAGCAGCGGATCA
7   K12   T002466_01                  Rv2466c
                       CCGCGACATCGAGGTGAACTTCCACGTCATGAGCCTGGCAATACT
7   K14   T002467_01                  Rv2467
                       CTTCTACCACAAGCACTTTGGCCTGCCATACGCGTTCGGCAAGTAC
7   K16   T002468_01                  Rv2468c
                       ACAATGCTGTGCTGCTCGCGGTCTCGCCCAACCAGTGCGCCATCG
7   K18   T002469_01                  Rv2469c
                       TTACCGCGTTGTCGATGCGGCGGGCGATTGTCATGGTGATCTGTG
7   K20   T002470_01                  Rv2470
                       GACTTAGCCGGCGCCGAGGAACGATTGCGGATGTTCCTCGAGCAG
7   K22   T002471_01                  Rv2471
                       AACCCGGAAATCCTTGACGACTTCGAGAAAACACTGCGCTTCTGGC
7   K24   T002472_01                  Rv2472
                       GCCGGACAGGCCGCAAAGCTAGCACCAACATCGATTGATGCGGCT
7   M02   T002473_01                  Rv2473
                       GCCAACGCTCTACAAGAGCTTGCAGTGAACTATCTCGCTGGAGCTC
7   M04   T002474_01                  Rv2474c
                       GATGCCGCCGTTATCCGTATTCGCGCGCGGTCTACCGGATTGCTA
7   M06   T002475_01                  Rv2475c
                       CGACATGTATCAGCACGTCAACCACGCCACCATGGTCACGATTCTC
7   M08   T002476_01                  Rv2476c
                       TGGCGCTGAAACTCAATGCCCAGTTGATCGACGAACTTCCGCTGCC
7   M10   T002477_01                  Rv2477c
                       CTATGAGGGCAACTACTCGACCTATCTGGAGAAAAAAGCCGAGCG
7   M12   T002478_01                  Rv2478c
                       TCAACGATTTGCAGCGCCGCAAAGTCGGTGATCAAGAGGTCGTCA
7   M14   T002479_01                  Rv2479c
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
7   M16   T002480_01                  Rv2480c
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
7   M18   T002481_01                  Rv2481c
                       CGTTGCGTAGACGCCATGAGCCAGACGGCTGGCCATTTTCCCAGC
7   M20   T002482_01                  Rv2482c
                       GGATCTGCTGAAGTTCGACTTCTATTTCGCGGATTCCACGGCGTTT
7   M22   T002483_01                  Rv2483c
                       TTTTCTGGGGATCAACAACATGCTCACCAACAAGTTCGAGACCAAC
7   M24   T002484_01                  Rv2484c
                       GCCGGCGCGAAGATACTGCGGCAGTACGGTATTGGACCGTTGCCC
7   O02   T002485_01                  Rv2485c
                       GCTCCGCCGTTCTTCGTGTTGCACGGTGAGAAGGATCCGATGGTG
7   O04   T002486_01                  Rv2486
                       CCCGGATCGCTGGACCTTGAGCAACACGAACTCGCCAAACGCTTA
7   O06   T002487_01                  Rv2487c
                       GGGGCCCATGCTCGGCAGTATCAGGCGCTCAGCGTACAGGTGGC
7   O08   T002488_01                  Rv2488c
                       GTGAGGGACTCAGCAACAAGGAGATCGGCGTCCGCCTATTCATCT
7   O10   T002489_01                  Rv2489c
                       GTCGCCGAATGCATCGACTAAAGCGCGTAGAACACATGGACCGGC
7   O12   T002490_01                  Rv2490c
                       CCGGTGGTAACGGAGCTCACGGTTTCAATGCTGTGCTCGTATCTG
7   O14   T002491_01                  Rv2491
                       CATGTGAGTCTTAGTAAGCACCCCTACCAGATTGGAGTTTTCGGGT
7   O16   T002492_01                  Rv2492
                       CGCCTGGCAAAAAGGTCACGGCAATCTTTTGTCTATCGCCAAGCTA
7   O18   T002493_01                  Rv2493
                       CGAACGACACTTGACCTTGACGACGATGTGATCGCCGCGGCACGT
7   O20   T002494_01                  Rv2494
                       CGACGCCGGTGTCTTCACCCTCGCCCAACAACGCCCCAAGACGCC
7   O22   T002495_01                  Rv2495c
                       GACGCTGCGGCTGCTGGTTATTGCATTGAAACACAACGTAATTCTC
7   O24   T002496_01                  Rv2496c
                       ATACTGCAGAGCAGCAACATGATTGGAGTCTGGAGGTTATCGATCT
7   B02   T002497_01                  Rv2497c
                       GTTGTTCCCCCAATACCGAGAATTGGGCGTCTACCTAGTGCGTGG
7   B04   T002498_01                  Rv2498c
                       GGGCTTTGACGTGACCGTGTGCATTCACCCGAGTCAGATCCCGGT
7   B06   T002499_01                  Rv2499c
                       AACGAGGCTTGTGGTTTGAAGAGTTCCAGATCGGCACCACATACCT
7   B08   T002500_01                  Rv2500c
                       ACAACGATTTCTGGGGGGATATTACCCAAGGAATACCAAGATCTTC
7   B10   T002501_01                  Rv2501c
                       GGTACAGGTGTTGGTGTCCGTTGGCGATCAGGTGAAAGTCGAACA
7   B12   T002502_01                  Rv2502c
                       GTGTTGTTCAGCGAATCCGCGCTCAAGGGAGCGCATTTCATCGAG
7   B14   T002503_01                  Rv2503c
                       CCGGTGACCTAGCCAACTGGATGATCCCCGGCAAGATGGTCAAGG
7   B16   T002504_01                  Rv2504c
                       GTGTCACCGACCTGGAAACAGTCTCGAACAACTGCGGAATCGACG
7   B18   T002505_01                  Rv2505c
                       CTCACGCATGCATATGCCCGGGGTCTCGATCTGCTATGGAATGACC
7   B20   T002506_01                  Rv2506
                       CCGCAGCGCTAACTTGGCCGCGGCACTGGATGGCCTCATCGAGTT
7   B22   T002507_01                  Rv2507
                       GGCGCGATGCAAACCGTTGTCTACGACGTCACGGGGGAAGGCCG
7   B24   T002508_01                  Rv2508c
                       GGTTGGGCGTCGGGCTATGTCGGCAGCGTCGCGCTCTTGCTGGT
7   D02   T002509_01                  Rv2509
                       TGCAGTTGAATGCCGTGGCGGTGCACGACCTTACGTTGGCGGTGT
7   D04   T002510_01                  Rv2510c
                       TGCTGGACCTGAAGGATCTGCGGGCGGTCATTACCCATCTGACCA
7   D06   T002511_01                  Rv2511
                       ACCGCGCGTTCATCGCCCGCGACATGCCCACGCTGGACTCGTTTC
7   D08   T002512_01                  Rv2512c
                       CTGCTGCACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTG
7   D10   T002513_01                  Rv2513
                       CATCACCTGCACGGGGCCAGACGACGATGAGGAGCTGGAATTCTT
7   D12   T002514_01                  Rv2514c
                       CTGCGACGCTCTTGGCGTGCCGTGGCTAACTCTGATGGGCTATAT
7   D14   T002515_01                  Rv2515c
                       GCGGTATGTGTCTGTATTTCGACGAATTGCCGGTGATCGTGCTCAA
7   D16   T002516_01                  Rv2516c
                       ATGGCTGGCGAGGTTATGCCGGTAGTTCAAGCCAAGAGTCCCATT
7   D18   T002517_01                  Rv2517c
                       GCTTCTACAACCCCCAGGGCGTCTATATTGCTCGGTTTCCGGCAAC
7   D20   T002518_01                  Rv2518c
                       TGATCGCGACCGCCGACGACAACACCAAGATACTGACCGTGCGGG
7   D22   T002519_01                  Rv2519
                       GACAACCGGTTACGCCCCGCCGGGCACGGTTATCTCAATCTCAAT
7   D24   T002520_01                  Rv2520c
                       CCGCGATCCCAATACCATCAAGCAGGAGATCGACCAAACCCGCGA
7   F02   T002521_01                  Rv2521
                       TGTTGACGGCCTGGGGTGCCTACGGGGAGAAGCAGATGTATGGCA
7   F04   T002522_01                  Rv2522c
                       GGACAATTGGAGCACCGACATCCCGGCTTTGACGGTGTCGCTACG
7   F06   T002523_01                  Rv2523c
                       CTGACCGGGGCCATCGCTGAGTATTTGGCCGACGTGACGATCCAT
7   F08   T002524_01                  Rv2524c
                       TCTTGCCACCAACACCCTCAAACTGCCCGAATACGCCCACAGCACA
7   F10   T002525_01                  Rv2525c
                       CGAGCGCCCCGATCTACGCCTCGATCGACGACAACCCATCATATG
7   F12   T002526_01                  Rv2526
                       AAAGAGGACCACGATTGAGCTGGACGAAGATCTTGTGCGGGCAGC
7   F14   T002527_01                  Rv2527
                       ACCTCGCCATCTGCGATATCGGCGAACTTGAATGGCTGTATTCAGC
7   F16   T002528_01                  Rv2528c
                       TTTGAAGATCTGGTTATCAGACTTTTGGAGGCGATGGGTTACGGGC
7   F18   T002529_01                  Rv2529
                       TTGCAGATCGGCTTTCCCAACGTGCCGATCGTGTTCTGCCAAACCC
7   F20   T002530_01                  Rv2530c
                       AGCAATCGCAGTGTGATGCAGGTGTCGACCACGCCGGCTATCGCG
7   F22   T002531_01                  Rv2531c
                       CGCATCTACCAGATTTCAGCGAGTTCGACCTTGCCTTCCGCCCCGA
7   F24   T002532_01                  Rv2532c
                       GCGCTGGGTGGACAACTCCGGGAATCGGGCTAATCGGCGGATCG
7   H02   T002533_01                  Rv2533c
                       TACATCCGTACACGGCCGCGGTGGCTCGAGGGGTCAGTGAACACG
7   H04   T002534_01                  Rv2534c
                       CGACCGGCGCGATACCACCTACCTTTACCGCGACGGCTCGGACTT
7   H06   T002535_01                  Rv2535c
                       AATGCCTGAAACCGCCGGGCAGACCCCGGAATTGTTGACCCGGTT
7   H08   T002536_01                  Rv2536
                       GAACGTGAGGCACCCACCGAGGTGATCCGCACCACCGAAAGCGAT
7   H10   T002537_01                  Rv2537c
                       CCGAGCTCGGACTCAAAGCCGTTGTGCGGCAAAGTGATAGCGAAG
7   H12   T002538_01                  Rv2538c
                       GCGATCACCGTCAAGGCCGAGGTGGTCGCCGCCGACGAAAAGGA
7   H14   T002539_01                  Rv2539c
                       ACGCAGCATCGCCGACATCTTCGCCACCGACGGGGAGCAGGAGTT
7   H16   T002540_01                  Rv2540c
                       TGGAAAAATTCGGCGGGGATTCGCTGGCCGAAACCCAGCGCAACA
7   H18   T002541_01                  Rv2541
                       TGATGTGCGGCCCCCCGGATGCCCCGCTAGCATCCCTGGCGTGG
7   H20   T002542_01                  Rv2542
                       GAACCACCCGTCAGACCATCGCCACCATGACCCAAGAAACCCGTG
7   H22   T002543_01                  Rv2543
                       ATATCGCGCGGCGGCCGATCGCCAACAGCGTAATGTTCGGCGCCA
7   H24   T002544_01                  Rv2544
                       CCAAGACTTCTATAGAAATGGATCGTTGTGTAAGGAACTCAGTGCC
7   J02   T002545_01                  Rv2545
                       AAACGCTCCAATGCATATATCTCAGTATCGAATACCTATATGTTTGC
7   J04   T002546_01                  Rv2546
                       AGTCGGTGCCGAAACCTTTACGCGCGCATGCCAAGTCCAGCGTGA
7   J06   T002547_01                  Rv2547
                       ATCGCGGTCCGAACTCATCCGACGCGCAATTCACCGTGCCTACGG
7   J08   T002548_01                  Rv2548
                       CCGTGCTGCTCGCCGAACTGATAAACAACGGTGAGGAGATCGCGG
7   J10   T002549_01                  Rv2549c
                       CATCCAAAATGCGTATGCCTTCGATGGTGACTTCAGCGCGGCCGG
7   J12   T002550_01                  Rv2550c
                       CGGATCGTTCGTGGGGGAAGCCGACTTGTCCGCGTCCGTCGACG
7   J14   T002551_01                  Rv2551c
                       GTGTTGGCCTGGATGGGAGTGTTGTGCGTTTGCGACGTCCGGCAG
7   J16   T002552_01                  Rv2552c
                       AGTTGCCCGTCGTGGTCGGTGGTTTCGGACCGGAGTGGGTCGGT
7   J18   T002553_01                  Rv2553c
                       GTCAGCTCGACGACACCACCGACATGAAGACCAACGTGGTGAATC
7   J20   T002554_01                  Rv2554c
                       AATACTGCAGAGCTGGCTGGATGAACGTCTCGCGGCGATGGCCGG
7   J22   T002555_01                  Rv2555c
                       ATCCGTACCCCCGATATCGACGAGGTGGGCATAACCACCCGGCAC
7   J24   T002556_01                  Rv2556c
                       CCCATGATGATGGCCTGTGCAACGTGTTCGTCCCGCACGCTACGG
7   L02   T002557_01                  Rv2557
                       GGAATTGCGCACGTTCGCGATGTGGTTATGCCCGCACTGCAGGGG
7   L04   T002558_01                  Rv2558
                       ATCGCGCATGTTCGTGACGTCGTCATGCCCGCTTTGCAGGAGATC
7   L06   T002559_01                  Rv2559c
                       GCACCGATTTTCCAAGACCCAACAAGACGCCCTGCTGTCGGCGGT
7   L08   T002560_01                  Rv2560
                       ACCCGACGCATCTGCAATCGTCGGGTTTTAGCGTGGGCGACGCGA
7   L10   T002561_01                  Rv2561
                       CTCATTGCCGACATCGGCGGATACACAAATTACATGCACTGGAACC
7   L12   T002562_01                  Rv2562
                       TGGGCGGATGTGAAGTTCGAATGGCACGCGTTACCGTACCTGTTA
7   L14   T002563_01                  Rv2563
                       ATCGTGCCCGAGTCAACCGCGCTGGCAAAGATTCCCAACATCTTCC
7   L16   T002564_01                  Rv2564
                       AGGACCTGCTGATCCGAGTCAATCTCGGCGAACGAATGAAACACC
7   L18   T002565_01                  Rv2565
                       CTATATCGTCGACTCGGGGCGGTTCGTCGCTGTTGCCCCAGAGGG
7   L20   T002566_01                  Rv2566
                       CTGCGTATTACCGTCGGGCTTATCGCCGACCTCAAGGTGATCAACC
7   L22   T002567_01                  Rv2567
                       GCCACCAACTTTTCATGCACGCCTGTGATCTCAGCCGGTTGCCCG
7   L24   T002568_01                  Rv2568c
                       GCTTGGGCACTTCCGCCACGAGATCGGGCACTACTACTTCTATCGA
7   N02   T002569_01                  Rv2569c
                       TCGGGTTCCACGACGATTTCCACAGGAGTCAACGAGGTGCTGCTG
7   N04   T002570_01                  Rv2570
                       GATCACCGAGGCCTGGCTGATGCAGGCGCCGAAGCAGCTGGTGC
7   N06   T002571_01                  Rv2571c
                       TCGATCAACAGGCCGTCTACCTGGCCCTGCTGGTCAGTTCGGTGT
7   N08   T002572_01                  Rv2572c
                       ATGGGCCTGGACAAGGCCGAGGCGGAGGAAAAGTTCGGATTCCTG
7   N10   T002573_01                  Rv2573
                       CTGGCGCAAACTACTGGTCAACGCGCTGGCGGGATTTATGGTGCT
7   N12   T002574_01                  Rv2574
                       GCTGCGCCGGTTTCTAAGGAATCTGCGCAGGTATACCGACGCTCG
7   N14   T002575_01                  Rv2575
                       GGGGTGTGGGCATACTACGCGTCCACCGTCAAGCAGGAGAGCACC
7   N16   T002576_01                  Rv2576c
                       ATTCGGTACATGAGCGCCGATCCGCCCAGCATGGCGGCTTTCAAT
7   N18   T002577_01                  Rv2577
                       AACATCGGATCCCCCTTCGCCGGTGACATCACGATTGCGATCGAG
7   N20   T002578_01                  Rv2578c
                       CACAATTCGACGGCATCACCTTCCACGAGGTGTTGTGCAAATCAGC
7   N22   T002579_01                  Rv2579
                       CCCAACCAGACCGAAATCACAGTGCCCGGCGTGCATTTCGTTCAG
7   N24   T002580_01                  Rv2580c
                       GACGGGTGAGCAAGTTTCGGTCTCGATGGATTCGGTTGTGGCCGA
7   P02   T002581_01                  Rv2581c
                       TGCGGGTGCGTTCTTTCGTGAGCCTAAACAGGTTGTGGAGCTGGA
7   P04   T002582_01                  Rv2582
                       AATGCTCAGCGACGTGCCACAGCCAAACGCAAACTCGAACGACAA
7   P06   T002583_01                  Rv2583c
                       ACCCCGGTGAGTTCTTGGAATCATTGCGCTACGACCTTGCGGTGC
7   P08   T002584_01                  Rv2584c
                       GTGCCATGGCGGTACATGGGCTGGTGACTACGTGTTGAACGTGAT
7   P10   T002585_01                  Rv2585c
                       TTGCCGTTGTACCGGCAGCAGCGCACGTTGTTGATGTCGACGAAA
7   P12   T002586_01                  Rv2586c
                       CTCTACATTACCGTGCGCTACGAGCGCTACATGACCATCTCGGCGA
7   P14   T002587_01                  Rv2587c
                       CTTCTGGCTCAATGGTTTTTGCGATCCTGGTGCTCTTGGGCCGATA
7   P16   T002588_01                  Rv2588c
                       TCCTGCTCATCATGGGTGGGTTCATGTACTTCGCGTCGCGCCGCC
7   P18   T002589_01                  Rv2589
                       TCCTACCTGCCCTCCTCGATTGGTGCCGCAAGAACCATGTGGTGTT
7   P20   T002590_01                  Rv2590
                       TTCGTCGCAGAAGCCATTTGCACCCTTGGGACACATAGCCCGGAC
7   P22   T002591_01                  Rv2591
                       ACAGTCGTTGGACTTGGTGGCAATGGCGGTGACGGCGGTGACGG
7   P24   T002592_01                  Rv2592c
                       CGCCGAGGAGATGCTGTATCTGGCGATGGAAGACTTCCGCGTCGA
7   B01   T002593_01                  Rv2593c
                       ACTCGATGACGCTGTACGGGTTTCCCGACGGGGAAACCCGCGACC
7   B03   T002594_01                  Rv2594c
                       GTGCATTTCCATACCCCCAGCGAGGTCAAGGCGGCGGTCACTGGC
7   B05   T002595_01                  Rv2595
                       ACGTCTGGTGATTCCCAAGCGGATTCGCGAGCGCCTTGGCTTGCG
7   B07   T002596_01                  Rv2596
                       CTTGGCGGACATCACCTCCAGCAACTACCTGGCACTGGATGCCTG
7   B09   T002597_01                  Rv2597
                       GTCCGCGGATCAGTCACCTTTCGCGAGGGTCCCTTCGTGTGGTGG
7   B11   T002598_01                  Rv2598
                       CCACTTCATCAGCTCGCCATAGCGCCGGTGGACGTATCAGGGGCA
7   B13   T002599_01                  Rv2599
                       GATCTCTGGAATCACGCTGCTGAACAGGGACGTTGGCTCGTATATC
7   B15   T002600_01                  Rv2600
                       GCGATCTGCGTCGCCTAGTGTTCATCGACCGCCGCCCCAACGCCG
7   B17   T002601_01                  Rv2601
                       CATTCCCACGACATTGAGACCACCGGCCGCCAACAGCTCTACGCC
7   B19   T002602_01                  Rv2602
                       AAGGTTTGGATGGATGCCTACCTAGCTGCTTTCGCACTTACCGGTG
7   B21   T002603_01                  Rv2603c
                       GTCGGTGTCCTACCTGTTCTCCCGCAAAGGCGTGGTGACCCTGGA
7   B23   T002604_01                  Rv2604c
                       ACGGTGCGGCGCAATGCTTTTGGAAGTCAGGTTGACTCGTTTGAAG
7   D01   T002605_01                  Rv2605c
                       GTCCAGCACGGGGAAACCATATTCAGCATGGCGGCGTCGTTCCAG
7   D03   T002606_01                  Rv2606c
                       GTGCTGACGCCCGCTGACTACGCCCACCATATCGACAAGTGGAAC
7   D05   T002607_01                  Rv2607
                       CCGACGGAAAACCGGTGACCCGTTCGGTACTTTGCAAAATCCTGG
7   D07   T002608_01                  Rv2608
                       ATTACGCGTTCCAGTACGACGGCGTCAACGACTTCCCCAAATACCC
7   D09   T002609_01                  Rv2609c
                       TGCGGCTTGGTGGAACCGCTGTGCTGCCAACCTATTTCGAGATCG
7   D11   T002610_01                  Rv2610c
                       GAACATTGCCGAGGGCCCGATTGTGGCGACATTTCACACCTCGAC
7   D13   T002611_01                  Rv2611c
                       GCCTAAAACCCGAATCGCTGTACCAGCGCTTTATCGACTACCGCGA
7   D15   T002612_01                  Rv2612c
                       GCTGACGCTGTTCCCGATGGGCAAGCTGTTCGCGGGTGCGTGTGT
7   D17   T002613_01                  Rv2613c
                       GGCACTTGATGGTGGTGCCCTATCGTCGGGTATCCGAACTCGAGG
7   D19   T002614_01                  Rv2614c
                       CGCCTGGATCGCTGACCGCGAAAATGCGGTTCCTACAGCGGAACT
7   D21   T002615_01                  Rv2615c
                       ATTTCTCAGAACGGTCCAGCGTCCGGATTCGGGGGTAACGGTGGT
7   D23   T002616_01                  Rv2616
                       TTGGTGGGAATCGCTTTCCTGCGTGCGCCGTGCCGAGTGGTGTAT
7   F01   T002617_01                  Rv2617c
                       AGCCCTGCTCTCGCAGACCAGCTGAAGGATCCGGCATACTCTGCA
7   F03   T002618_01                  Rv2618
                       TCGGTTGGCACCCGGACCGGCCCGGTGTTGTGTAGTACTCAAGCG
7   F05   T002619_01                  Rv2619c
                       CGCCGTCGAGGATTCGGTGATCATGCTGACCGTGCTGAAATCCCT
7   F07   T002620_01                  Rv2620c
                       CTATGTCGGTTTGGAGATAGTCAAGGTGGTTGCGTTGCTCGTCGC
7   F09   T002621_01                  Rv2621c
                       TGGAACTCGCCGAAACTCAAGCCGGTGTCGTCTGCCCCGTCCACT
7   F11   T002622_01                  Rv2622
                       ATTCCGCAGGCATCGTGAACGCTTGACAGCCGTCGCCATTGTCGC
7   F13   T002623_01                  Rv2623
                       ACAGTGAAATCGTTCCGGCGGCAGCCGTTCCCACATTGGTCGACA
7   F15   T002624_01                  Rv2624c
                       CAACTGGATCGTGGTGCGCATGACCGACGCACCGGATAACGAGGC
7   F17   T002625_01                  Rv2625c
                       GCCGAGTTTGTGGCTGGTGGCCTCGTCGGTGGGGTCTGGTTAGCC
7   F19   T002626_01                  Rv2626c
                       CGCGACATCATGAACGCAGGTGTGACCTGTGTTGGCGAACACGAG
7   F21   T002627_01                  Rv2627c
                       CGAAAGGTCAAGGACCGCAGACGCTCCTTTTATCGCATCTTCTTCG
7   F23   T002628_01                  Rv2628
                       CACCAGGAGGCGATGATGAATCTAGCGATATGGCACCCGCGCAAG
7   H01   T002629_01                  Rv2629
                       AATCACCAATGTCGCACAACAATTTGAGGCGGAGATCGGACGCGG
7   H03   T002630_01                  Rv2630
                       GGTGCTCGAGGAGGTCATTTATTTGCTGGACACCGTCGGTGAAAC
7   H05   T002631_01                  Rv2631
                       ATGCCCGATGTGCACTGGGGATATGGTTTCCCAATCGGCGGCGTG
7   H07   T002632_01                  Rv2632c
                       GAGCACGTTGGAAAAACCTGCCAAATTGATGTGCTGATTGAGGAAC
7   H09   T002633_01                  Rv2633c
                       CATCGAGCTGGACATTCACTTCCGCATCGAGGATGACCTGTACTAC
7   H11   T002634_01                  Rv2634c
                       GGTGCCGGAAGCATTGACGATGGCGGCTTCGGATCTGGCCAACAT
7   H13   T002635_01                  Rv2635
                       ACCGGATTCGACCGCCGCATGAGCCAAACTGTTACCGGTGTGGGT
7   H15   T002636_01                  Rv2636
                       ACGTCGCTCGCCTTGGCGTTTCAGGATCTTGCCGCCGAGTGTTGG
7   H17   T002637_01                  Rv2637
                       GTCATGTCGCGCTTGCTGAACGGTTGTTCAACCGATGGGGAGTCC
7   H19   T002638_01                  Rv2638
                       TTGTTGATCCACGCGGGCGGCGAGATCGATGGCCGCAACGAGCAT
7   H21   T002639_01                  Rv2639c
                       CGGAGTTATTGCGCTTGGGGTCTATGGGTTCTTCGCCACATTGCAG
7   H23   T002640_01                  Rv2640c
                       CTTCCATCGGGTACATCCTGAAGCCCTGCAAGCGCTGTGTACCGTG
7   J01   T002641_01                  Rv2641
                       GAGGCCGCAATCACGTTCTACTCCAGGCTGTTCAACGCCGAGCCC
7   J03   T002642_01                  Rv2642
                       GGAGTCGAGGTGAGCCAGCCCACGATTTCGCATCATCTCAAGGTG
7   J05   T002643_01                  Rv2643
                       CACGATGCCGACAAACCCAGCGTCCTATTCGTCTGTGTGCACAACG
7   J07   T002644_01                  Rv2644c
                       ATATCGTCGCACGCGATCTCGGGCAGCCGCTTTGTCGAGACTACG
7   J09   T002645_01                  Rv2645
                       GAACCCATCTGGGAGCAGCTCACCGAACGATACGGCGGCGTCACA
7   J11   T002646_01                  Rv2646
                       GGCTCCCACAACTTGCGAGCTGTACAACAACTTCTCGGTCACGCCT
7   J13   T002647_01                  Rv2647
                       CAAACGAATCGACAACGCAACCCGCAGCGAAGCTGGCTACCGGGA
7   J15   T002648_01                  Rv2648
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
7   J17   T002649_01                  Rv2649
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
7   J19   T002650_01                  Rv2650c
                       CGCTGACGATGGCGACATCAAACAGCTCAGCCTCGACGAAACCCG
7   J21   T002651_01                  Rv2651c
                       GCGCGCGGAATCGCTTGCAGTCGTTTCCCGTTCGCTAGCCGAAGC
7   J23   T002652_01                  Rv2652c
                       GTGCTGACCTCCTTCTGCGTCGCCTGGGATCAGCTCATGCAGGCT
7   L01   T002653_01                  Rv2653c
                       GCCGAGCGTACGCCGAGATGGTGGCGACATCACACGAAATCGACG
7   L03   T002654_01                  Rv2654c
                       GAGCGTTGGTCCGCGCTGTGGCGGAGTCGCACGGCGTCGCGGCC
7   L05   T002655_01                  Rv2655c
                       CCGTCCTGTACGACGAGTGTGACACCCTGTTTGGCCCGAAAGCTA
7   L07   T002656_01                  Rv2656c
                       ACACCGTCTAGCACCGATCCTACCGCGTCCCGCGCCGTGTCGTGG
7   L09   T002657_01                  Rv2657c
                       TCACGAGACCGAAAGGCCCGGCATGGCAGACGCTCCCCCGTTGTC
7   L11   T002658_01                  Rv2658c
                       AATAGCAGAGGCGCGACACGTAATTCCGTTCAGCGCATTATGCTTG
7   L13   T002659_01                  Rv2659c
                       CGACATAAGTATCCCGCCACATCTGATACCCGCCATCGAAGACCAC
7   L15   T002660_01                  Rv2660c
                       AGGAACCTTTCGGTGGTTGCACCGAGTCAGTTCACATTTAGTTCAC
7   L17   T002661_01                  Rv2661c
                       CGAATCGGTCCAGAAGCTCGCGCCGGAGCCGCGTCAGGTCATCCA
7   L19   T002662_01                  Rv2662
                       GGAGGGCCTCGACTCCGACTCGTGCGATTAACCACCAACCCATCC
7   L21   T002663_01                  Rv2663
                       AGCAGACGAACCACCCCGGATTATCCACGCCAACGTACTACGCCC
7   L23   T002664_01                  Rv2664
                       GCATCATCGCCGCGAAAGAAGCGGTCCAAACAGCCGAATCTGAGT
7   N01   T002665_01                  Rv2665
                       TGATCGATGTGCGGCCCCAGCGGGTGCGTTGCCGCAGATGCGAAA
7   N03   T002666_01                  Rv2666
                       CCTGCCCGCAGCGGCCTGGCAGCGCTGCAGAACCCACTACGCAG
7   N05   T002667_01                  Rv2667
                       GACGAGCTCATCAACGCCATCAAACGGGTGCACAGCGACGTGTTG
7   N07   T002668_01                  Rv2668
                       CGACCCGGTGTCGGTTGTCGTGCTGCTGGACGAGAAAACCGGCCA
7   N09   T002669_01                  Rv2669
                       AAAAACCAACGCGCACAACGCTTCTACGCGAAGACTGGTTTCAAGA
7   N11   T002670_01                  Rv2670c
                       AGGACTTTCTACGCGAGATCAACACCCTGGCAAGCATTTTCACCAC
7   N13   T002671_01                  Rv2671
                       GTGCATTACCTCACCGACGGCGAACTCCCCCAGCTTTACGACTATC
7   N15   T002672_01                  Rv2672
                       TGTCGAGCCCAATCGACTGCCGCGATCACTTTGACCGCGACGAGA
7   N17   T002673_01                  Rv2673
                       GATGGGGCCGCGCGCTGGAATACCTCAAGATCACCTACGGTTGGT
7   N19   T002674_01                  Rv2674
                       TCCCACGCCAACCGACAAGCGCTATTGCATCAACTCCATTTCGCTG
7   N21   T002675_01                  Rv2675c
                       CCAGCAAGCCGGGTGCACGGCTGTACATGTTCGAATTCGGCGAGC
7   N23   T002676_01                  Rv2676c
                       CCGGCGCCTACATCTGCGTCTATCCGTTTGTGCGGTCTTACGAGTG
7   P01   T002677_01                  Rv2677c
                       GACCATCACCTTGTTCGAACCGGCCGATAGGCTCGGCGGGGTATT
7   P03   T002678_01                  Rv2678c
                       GACCGACCTCACCATCGCGTTTCTGGTCGGCCAAATCGACGCGGG
7   P05   T002679_01                  Rv2679
                       AACGCAGCCTCAATCACTGGTATCGCATGTTCGGTCCCGCCTTCGA
7   P07   T002680_01                  Rv2680
                       CGTACAGCTATGCGCTGGGAGCCGAGATCAAGCATCCCGAACTCG
7   P09   T002681_01                  Rv2681
                       GTGCTGGCCGAGCAAGGCAAAACCGATTGGGCTGCGCAGGAATTC
7   P11   T002682_01                  Rv2682c
                       TGGTGGCGATCTACTCGACGTTCCTGAACCGGGCGTTCGACCAGA
7   P13   T002683_01                  Rv2683
                       AACAGTATGCGGTACTCCCTGCCTCACAGGTCGTGCGCTTCATCGT
7   P15   T002684_01                  Rv2684
                       TATTGGTGTGCGACCGGTTAAACATCAACACGACGTCGTTCCTGAT
7   P17   T002685_01                  Rv2685
                       GTCGGATCGGACGACGTGTTCTACTCGCACGAAGCCGGAATCGAT
7   P19   T002686_01                  Rv2686c
                       TCACGCCGCTGTTCACCGAGATGCTGGCGCGGCGTTATGGATTCG
7   P21   T002687_01                  Rv2687c
                       TATGTCCTGGTGGGTGATATCGCGATCATCGGGTTCTTCTTCGTCG
7   P23   T002688_01                  Rv2688c
                       TCTCCTTCGAGCTGCCCAACCACTACCAAAAGCTCACCGGGTATGA
8   A01   T002689_01                  Rv2689c
                       CAAGGTGTTCGACGCGTTCCCGCTGACTCACTACGTCGAGTGCGT
8   A03   T002690_01                  Rv2690c
                       GCGATCGTCGCCATGGGAGGGTTCTTCATGATGATGAAGCTCATC
8   A05   T002691_01                  Rv2691
                       TAGGCCATGAAGTCGCGATCATCGACCGTGACAGCGCCGCCTTCA
8   A07   T002692_01                  Rv2692
                       TCACCCGCGAACTCGTGGAAAACGGACACGACATCACCCTGATCG
8   A09   T002693_01                  Rv2693c
                       GTGGGACAGTCCAAGGGGTACTTCCTGCTGGGCATCTGGATGTCG
8   A11   T002694_01                  Rv2694c
                       CGGCCGGCTGGGCAAGCTGGAAAATGGGACGAAGGCTATCTACAA
8   A13   T002695_01                  Rv2695
                       TTTGGATGGGGTCACAACCGTGTTGTTGCCGGGAACCGGATCGGA
8   A15   T002696_01                  Rv2696c
                       CAAAGTTTCGATCAAGGATGGCCCGTGGGGTCGCGAAGTGATCGG
8   A17   T002697_01                  Rv2697c
                       CAGCCGCGCCCATCGTGGTACATCGCGGTGACCGAATCGCCCAGT
8   A19   T002698_01                  Rv2698
                       TGGTGGCCATTGGCTTTCGCGCTAGCGGCGCTTATCGCGTTTGAA
8   A21   T002699_01                  Rv2699c
                       GAGACCGATGATGTCTCGGAGGACTCGCTTGAAGAGCTCAAAGCA
8   A23   T002700_01                  Rv2700
                       ACGGACATGACCGATGTCGCACCCGCCAAACTGAGCGACACCAAA
8   C01   T002701_01                  Rv2701c
                       TGTCGACGAGTTGTCGATGGCGTTGCTGGGTACCGGCTTCGGGTA
8   C03   T002702_01                  Rv2702
                       ACGGGACGTTGATACCCAACACCGAGTTCGGACATCTTGAGGTCG
8   C05   T002703_01                  Rv2703
                       GACGAGATCGGCCAGGTCTACGGCGTGACCCGGGAACGCATCCG
8   C07   T002704_01                  Rv2704
                       CCGCATCTATGTGACCGATATTTCCCGCTGGCGCGAGGTCGGCGA
8   C09   T002705_01                  Rv2705c
                       AACGCGGTGGGATCTATCCCGAGTCCGACAAGACGGGGTATATCC
8   C11   T002706_01                  Rv2706c
                       CAGCGGTCTGCTCTAGTCAGCTCAGGACTGGTCAGAGTTGCGTTC
8   C13   T002707_01                  Rv2707
                       GGACTTTGTCCAAAAGCTGGGACGACTCGATCTTCTCGGAGTCAGC
8   C15   T002708_01                  Rv2708c
                       CGAAATACTTCCACTACGTCAAGAAAGACAAGATCGCTGAGAGCGC
8   C17   T002709_01                  Rv2709
                       TGGAGCATCGCACACGGGTGCGTAAGTACCTGACCCTGATGGCAT
8   C19   T002710_01                  Rv2710
                       CTGGGTCGCGAAGCCACCGATGAGGAGCTCGCCGCCGAATCCGG
8   C21   T002711_01                  Rv2711
                       CATCCCGGGCCATGAGAACGTCACCCTGCCACACGAGATGGCCCA
8   C23   T002712_01                  Rv2712c
                       CTGCAGTCTGGTCTGCGACCTGAGCACATCCGTGACATCGCGGTC
8   E01   T002713_01                  Rv2713
                       CACGATCCCATCCAAAACGTTGCGTGAGGCTGTGCTCTACCTCACC
8   E03   T002714_01                  Rv2714
                       CCATTAATGACTTTCAAGACCGATCATTTCACCCACTCCGATGATCC
8   E05   T002715_01                  Rv2715
                       CCATCCCGGTACAGATCATCTGGGGCACAAAGGATGTCGTGCTGC
8   E07   T002716_01                  Rv2716
                       GCCCAATCGGGCTACAGCGAAACCATATTCGTCGATCTTCCCAGCC
8   E09   T002717_01                  Rv2717c
                       CCATGTGGGTAAACCGTTTCTGACGTACACACAGCAGACCAGGGC
8   E11   T002718_01                  Rv2718c
                       TCAAGCGCAGTGGCGTTACCGAACCCTTCAGCAGGGAAAAGGTGA
8   E13   T002719_01                  Rv2719c
                       TGCTTGCCGCGGCGATTACTCTCTGGCTTGGTTTGGTGGCGCAGT
8   E15   T002720_01                  Rv2720
                       GAGGGCACCCTGTTCCTGCTCAAGGTGATCGGTGACTCGATGGTC
8   E17   T002721_01                  Rv2721c
                       GTCGACGGCGATGTTGTCTCACAGAAATTCACCGGCGGCATGATT
8   E19   T002722_01                  Rv2722
                       GCATAACATTGCTCCAGCGAACGACGATTGCGAAGTCCAATCGCAA
8   E21   T002723_01                  Rv2723
                       GACATACTATTTGCGTTCGATTCGATTCCAGCACTTTTCGGCCTGA
8   E23   T002724_01                  Rv2724c
                       GAGGCCACTGTGGTGCGCATCATGGTCGACGAATTCATTAAGCTG
8   G01   T002725_01                  Rv2725c
                       TTGGAAAAGGCTGTGCAGGTTAAGGTTATTGACCGCACCGCGCTG
8   G03   T002726_01                  Rv2726c
                       ATGATCTTCGCGAAGGGCCACGGTACCCAGAACGACTTCGTGTTG
8   G05   T002727_01                  Rv2727c
                       GCACCGACCTGATGTTTGATCAGGGCCTGGTTGAAGAGGTACGCA
8   G07   T002728_01                  Rv2728c
                       ACGGTGACGGAGTTGCCGTTCCGGTGGAATTACCCCTGTGTGCGC
8   G09   T002729_01                  Rv2729c
                       GCGACAGGTCACCGCTGAAGAATATGTCGGCCATTTCACGTTGTTC
8   G11   T002730_01                  Rv2730
                       CCCACGATCGGCAAATATCGCGACGAACAGTCTGTCAAGCGGCCT
8   G13   T002731_01                  Rv2731
                       ACCGGCTGCGGGCAATCCTCGATGAATGGAAGACGATTAGCGGTG
8   G15   T002732_01                  Rv2732c
                       CGCGAGGGCTTTGGTTGTCGCAATCCTGGTGTTCGTGCTGTTGGG
8   G17   T002733_01                  Rv2733c
                       CTCGACGGACAGCTGCCGAAAGCCGTTGTGCAGGAACGCTATGAA
8   G19   T002734_01                  Rv2734
                       CGCTGATGTCCCATTCTTCTTCAAGCAATGGGGCGGTAGAACACCA
8   G21   T002735_01                  Rv2735c
                       CAGCCCGAGAACATAGACCGCGACATGGGAGAGAAATTTGATGGC
8   G23   T002736_01                  Rv2736c
                       ATTGGATCGGCTGGCCGCCGTTGGCCTGGTGGATGACACCGACTT
8   I01   T002737_01                  Rv2737c
                       AAGTGTTCGAGGTCCGGATCTCGGGTATGGATAACGTCACGGCAT
8   I03   T002738_01                  Rv2738c
                       TTCCACGAGCGGGTAGCCCTGCATTTCGGGGCGGCTTATGGCTCG
8   I05   T002739_01                  Rv2739c
                       AGCCGAACTGCTAGGGATCCCGTGGGTGGAACTCAACCCGCATCC
8   I07   T002740_01                  Rv2740
                       GAGGTGGACGATGGGCGGATCACCCTGTGGCGGGACTACTTCGAT
8   I09   T002741_01                  Rv2741
                       TGTGATCGCGGCACCGGAGTTTTTAACGGCGGCAGCAATGGACTT
8   I11   T002742_01                  Rv2742c
                       GCGGCGTACCGGGCTTTTGGTGCTGGTTGGACCATGTGCTGACCG
8   I13   T002743_01                  Rv2743c
                       TGCAGCGCGGCGTGGATACCGCCGGTGATTTGGCCGACCTGGTAG
8   I15   T002744_01                  Rv2744c
                       TGTTCAGCTCGAAGATCGACGAGCATGCCGACCCCAAGGTGCAGA
8   I17   T002745_01                  Rv2745c
                       TGCTCAGTGCGATTTGTACGGCTCTGCAGCTCCCGTTGTCGGTGG
8   I19   T002746_01                  Rv2746c
                       TATTAGGCGCGGTGTCATTCCCGCGAGCTGGGGCGGCAAGCTGAA
8   I21   T002747_01                  Rv2747
                       ATGTGCCCGCGATCAAACAACTCGTCGACACCTATGCCGGAAAGAT
8   I23   T002748_01                  Rv2748c
                       AACGAGGCGAGCAGATCGCCGTTACCAGTGTGGCGGATGGTGTAG
8   K01   T002749_01                  Rv2749
                       CGAACCCGGCTGCCAGTTGTACGCGCTCCACGAAACCGGCGAGAC
8   K03   T002750_01                  Rv2750
                       TTGCGGGGTCGATACGCCGATGATCAACAATGAGTTCTTCCAGCAG
8   K05   T002751_01                  Rv2751
                       CAACCTCAACGCATCACAAATCGAGTGGTCTGCCTACGCCGAGAAG
8   K07   T002752_01                  Rv2752c
                       ATGCACTGTCCAAGATCGGCGCCAGAGTCGTCACCAACGCCCAAG
8   K09   T002753_01                  Rv2753c
                       AGCGTGATTGCCCACCTGGCAGCCGGGCAGCTTCGAGAGTTGTTG
8   K11   T002754_01                  Rv2754c
                       CGGCACATCATCGACGTCGGACATTTCTCGGTGCTAGAGCATGCC
8   K13   T002755_01                  Rv2755c
                       TGCGGGTCCGATCTGGCCGCTGGACACTTGCCTATTTGTTCGCGA
8   K15   T002756_01                  Rv2756c
                       TTGTGCAGACCGAGAAGTTCATCTACGAACACGACGGCGATCCGA
8   K17   T002757_01                  Rv2757c
                       CGTCAACACCCCCGACACCGTGTGGGTTCGTGCATGGGAGATCCA
8   K19   T002758_01                  Rv2758c
                       CACCGGAACCCAGGACGAAGCTCTGGTCAACGCAATGTGGCGAGA
8   K21   T002759_01                  Rv2759c
                       GCGATCATGCAGCGGCGGGACCGGCCGGAGATCTCTCGATTGGTG
8   K23   T002760_01                  Rv2760c
                       ACAAGCTGCTCAGCGACGACGACAAGCGCCTGATTCGGCGACACG
8   M01   T002761_01                  Rv2761c
                       GTCGTGTCGCAGCCGTGTGTGTTGTTCCCGAAACTGAATCCAAGAA
8   M03   T002762_01                  Rv2762c
                       TGATCTCGCGAATCCAAGTGCGGCAGCTGGATTCGGCGGCAGTGG
8   M05   T002763_01                  Rv2763c
                       AATGTCGTACTGAGCCGCCAAGCTGACTTTATGGCCAGCGGGGCT
8   M07   T002764_01                  Rv2764c
                       TTTCCCGCTGCTCACTACCAAGAAAGTCCATTTCAAATCGGTAGCC
8   M09   T002765_01                  Rv2765
                       CGATATGAAGACCGCGTTCGGCGATCCGCAAGAACGCGCACGGAT
8   M11   T002766_01                  Rv2766c
                       GTCGCGTTCCTGGTTTCGGATGCCGCAAGCTGGATCACCGGCGAA
8   M13   T002767_01                  Rv2767c
                       CCGTTCGGAATCATTCGGAATCATGAGGCTGTAAGGCCTCGCCGT
8   M15   T002768_01                  Rv2768c
                       CGACGCGGCGGGATTAGGCGGAATCATTCAGGACATTGAGGAGCT
8   M17   T002769_01                  Rv2769c
                       ACCACGGGCGTGATTCCCGCCGCCGCTGATGAGATATCAGTGCTA
8   M19   T002770_01                  Rv2770c
                       AGGCGGTCAGGCAGTTCCTCAATCTCGATGTTCCGCTGTTCGTAGA
8   M21   T002771_01                  Rv2771c
                       ACCGGCCTGGGTTGGGTGCAAGCCGCTGAGACTGTAGTGGTGATG
8   M23   T002772_01                  Rv2772c
                       CCAGGCGCACCCTGTATGTCCAGTTGATAATCGCGTTCATGTGCGT
8   O01   T002773_01                  Rv2773c
                       GGCTCGTCGCAAAACCCAACACATCGGTGTTGATAGCGCCAAACTT
8   O03   T002774_01                  Rv2774c
                       CTGCGGTTTGGCCGTTGGGGAGCTTCGTTGTGCACCAGCCGTTTC
8   O05   T002775_01                  Rv2775
                       GGCTTCTACGAGAAGAAGGACTTTCACATTGACGGCCGCACTTTCA
8   O07   T002776_01                  Rv2776c
                       CGAAGGCGATAACGAGATGCTGGTCTGTGTGTCGCGGGCCGTGAG
8   O09   T002777_01                  Rv2777c
                       CGACTGGACAAACCTGCCATTTCACTATGTGCCCAACGAGCCGATG
8   O11   T002778_01                  Rv2778c
                       GCTGGCCGAGGAAGTGGTGGCGATGCAGTTGCGCAAAGGCGACG
8   O13   T002779_01                  Rv2779c
                       GGTTTGCCGTTGCAGGCGATGATCTCGGTCAACTTGCAGTCGTCC
8   O15   T002780_01                  Rv2780
                       GTCACGTGCTTGCACCGATGCGTTGTTGGATTCCGGCACCACGTC
8   O17   T002781_01                  Rv2781c
                       CCAGAGTTCGATGCCACCCTGGTCACTCGGGCGTTCTCGGGTAGG
8   O19   T002782_01                  Rv2782c
                       TGCTGCCGTTCTTGGCCCACACGGATCGAAACGATCACTGCCGCA
8   O21   T002783_01                  Rv2783c
                       ACGGTGGGCGAACGGTTCCTCGGAACCGTGGTCAAGACCACCGAT
8   O23   T002784_01                  Rv2784c
                       ACCACGCGGAATGCCCGGCGGACGTCGACTCCACCTATTCGATGC
8   A02   T002785_01                  Rv2785c
                       CAAGTACATTTCCCAGATCGATGTGGAGCGTTATCGTTCACTCATC
8   A04   T002786_01                  Rv2786c
                       ATCGAAGTGTTCCTGGTGATGCCGTTCACCACCGATTTCATGAAGC
8   A06   T002787_01                  Rv2787
                       AAACCCACTGCAACGTCATACTGCTTGATTGCGGCACACCGGTCAA
8   A08   T002788_01                  Rv2788
                       GCCTGGCGATCTTAGCGCGGTTGCGCAGGACTATCTGAAGGTCAT
8   A10   T002789_01                  Rv2789c
                       CTCATGTCGTTGGGCATCATCAACGAATGCCACCGGCTGTGTGTG
8   A12   T002790_01                  Rv2790c
                       ACGAATACACCCTGGACGACATCTTGGCCTCAAAGATGATTTCCGA
8   A14   T002791_01                  Rv2791c
                       TGCCACGTCTGCGGGCATGTCCAAGAGATCGGATGGGCCGAGCAC
8   A16   T002792_01                  Rv2792c
                       AAGGCCGCGAGCTGGTCGTGGTCGACTCGGCCGAGGTTGATGAC
8   A18   T002793_01                  Rv2793c
                       GGGTCAGACCACTTCCACCGAGGACGCCGAAGGTCAAGTGCTGCA
8   A20   T002794_01                  Rv2794c
                       CAAGGAAGCAACGTACAAGGCGTGGTTTCCGCTGACCAAGAGGTG
8   A22   T002795_01                  Rv2795c
                       CGCTACAACGCCGTGTGTTCGGTCTACGGACACTTACACATTCCCC
8   A24   T002796_01                  Rv2796c
                       GTGGCTGCAGGCCGTGCAGATCGTCAAGGACGGTGTCGAACAGTT
8   C02   T002797_01                  Rv2797c
                       AGCGGTTACAGGCGGAGTATGACCAACTGAGTGTGCGGGCCGCCC
8   C04   T002798_01                  Rv2798c
                       AGATGGACGACTGGTTGGACGCGTCGAGGGCGCTGCTGACCAGG
8   C06   T002799_01                  Rv2799
                       CGTATCACAACAGCTTCTGGTACTCCTCTTGCATGGTGACCTTCAA
8   C08   T002800_01                  Rv2800
                       CCGGTTTCCGTTTTCGCTGGTGTTTGCCAGGATTTACGCCGCCCG
8   C10   T002801_01                  Rv2801c
                       CACCGTCGTGCCGGTGACGAGCAACATCGCCAAGGTCTATCCGTT
8   C12   T002802_01                  Rv2802c
                       CATATCGACACTTCGTTCGACGAACTGCTGATGTCGGGTGTCGACC
8   C14   T002803_01                  Rv2803c
                       GAGACAGGCGGAAGTTGAGGCGACCAGTCAGAGTCTCGGGCATGT
8   C16   T002804_01                  Rv2804c
                       GCCGTTGCCCCTCCCCATCACCGACGACAACAACAACGAGGCCAT
8   C18   T002805_01                  Rv2805
                       CTTGATGGGCATGCCGTGCGGCAAGTACCTGGTGGTCATGCATGA
8   C20   T002806_01                  Rv2806
                       GCCCGGCGTTCTACTCAGTGATGACGGTGTTGTTCCTGGCGCTGT
8   C22   T002807_01                  Rv2807
                       GGCCACCGCCCGCCACATCGACCTGCAATCATTGCAACCGTCAAT
8   C24   T002808_01                  Rv2808
                       GACGTGCTTTCCGACGCCTTGATGAAGACCTTTGGACCTGATTGGG
8   E02   T002809_01                  Rv2809
                       CGGCTATGTCGGCGTTTGGCTGACCAGGCGGTGCGTCAGTGGGG
8   E04   T002810_01                  Rv2810c
                       CCTCACCCACTACCGAATCCGTTCACTACTGCACTGCGGCAACCTG
8   E06   T002811_01                  Rv2811
                       GTCACCGTAGAAGCAGATGTCGATCAAGTCGAGCGTCGGCTGGCG
8   E08   T002812_01                  Rv2812
                       TGTGGACCGGGGATGTGTTGCACGGCATACGGATTGATCTCCGCA
8   E10   T002813_01                  Rv2813
                       GAGGAAGCGCACCTGCTCGGCTATGACCAACTGGAGGCGTTGCGG
8   E12   T002814_01                  Rv2814c
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
8   E14   T002815_01                  Rv2815c
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
8   E16   T002816_01                  Rv2816c
                       AGGTGTTGCGGCAGTTACGTTCTACGGAAGGGGACGGCTTGTCAG
8   E18   T002817_01                  Rv2817c
                       CGATACACCTTTCAGTACGCCCTCGACTTGCAACTGCAAAGCCTCG
8   E20   T002818_01                  Rv2818c
                       TGATTTGACGCTCTATGACCGGTTGAACGACGAGATCATCCGGCAG
8   E22   T002819_01                  Rv2819c
                       TCAACGAGATTCACGCTTTCATCAAAGACCCTCTTGGAAGGCCCTA
8   E24   T002820_01                  Rv2820c
                       CATACGCTGACATGCCCCTGCGCAAACGCGACATCTACAAATTCGC
8   G02   T002821_01                  Rv2821c
                       CCGCGGCGCTAAGACTCTCACCGAGGTGAAATTCGAGAACGCCAT
8   G04   T002822_01                  Rv2822c
                       GCTGCGATTCTGCCGGTACATGGAAGCCCTAGCCGCATACAAGAA
8   G06   T002823_01                  Rv2823c
                       CCTTTTCAGCAGTTTGCTAACCGGCTACACCAATGGTTCCAAGATC
8   G08   T002824_01                  Rv2824c
                       GCGAGTGCGGCGGAATCAGGCTTGACCTGGATTTCACCAACGCTT
8   G10   T002825_01                  Rv2825c
                       AAAGTTGTTGCCGCACTGCCGGTTAACCGGCCAGAGGGTCTGGAC
8   G12   T002826_01                  Rv2826c
                       AGCTGCTCGCATTCATCCAGTTGCCGATCCATAAGGCTTACGGTTT
8   G14   T002827_01                  Rv2827c
                       TCGCGATCGGCCCGTAGTCGTCACGAAAGAGGATCTGACGCAACG
8   G16   T002828_01                  Rv2828c
                       AAAGTTGTTGCCGCACTGCCGGTTAACCGGCCAGAGGGTCTGGAC
8   G18   T002829_01                  Rv2829c
                       TGGTTCGAGCTGGCTTGGCTTGCCGAACAGGAACGCATCCAACTG
8   G20   T002830_01                  Rv2830c
                       GGGTGTGGCGATGGCGGCCGCGGATGACGACGAACTCTTCACCA
8   G22   T002831_01                  Rv2831
                       ATCGTCGGCAACAACCAGAACGCGGTGCGGGCATTGCTGGCGTCC
8   G24   T002832_01                  Rv2832c
                       GACAACTTGGACCTCGACATCGCCGACGGGGAGTTTCTGGTTCTG
8   I02   T002833_01                  Rv2833c
                       GCTCTCCGAGGAGCGAAAAGTCAACGCGCTCAAGTTCATCGCATTC
8   I04   T002834_01                  Rv2834c
                       ACCTTTGCCGGCATCATCCTGCCTCTGGCGGGGGTGGCGTTTGGA
8   I06   T002835_01                  Rv2835c
                       CGTTCTTCGACTGGAACGTCTCCGATCCGTCGGCCCGATTTGTGG
8   I08   T002836_01                  Rv2836c
                       TGGTGGTTCATGGTAGTCCAATTGCCTTTTGCGGGAATTGTTTTCG
8   I10   T002837_01                  Rv2837c
                       GATGTCGATTTGGTTGTGACTGTTGACATTCCGAGTGTTGATCGGC
8   I12   T002838_01                  Rv2838c
                       ATCCTGGATTGGCCGGGGTGACCATCACCGATGCGAAGGTGACCG
8   I14   T002839_01                  Rv2839c
                       GACAAGGAGGGTGCCGACCCGGCCAAGATTCGCGGGCAGCTTAC
8   I16   T002840_01                  Rv2840c
                       GGTCGAGTACCTGGAGTCTCTAGGCGAGCTCGAACCACCGGGCAA
8   I18   T002841_01                  Rv2841c
                       CATGCCATCGAGGTGGACCGGGGTATCTCGGTCAATGAACTGCTC
8   I20   T002842_01                  Rv2842c
                       CTTGCTGAGATTGTGAAAGCTGTTGTCCAGGTTGAGTTTTCGCCAC
8   I22   T002843_01                  Rv2843
                       GTGCTTAGAGCAGCACCAGTCATCAACCGGCTCACGAATCGACCC
8   I24   T002844_01                  Rv2844
                       GTGTCAACTTCTTGGTGGCGGACGCGTTGAAGCAGCACCGCCACC
8   K02   T002845_01                  Rv2845c
                       ACTACGCGTTGCTCGACGACGATGATTTCGCCAAGCACCCGTTCCT
8   K04   T002846_01                  Rv2846c
                       GCGGCGGATATCTGCTATTCGGCGCCATGCTGTACGGCTCATTTTT
8   K06   T002847_01                  Rv2847c
                       CATCGAGCTTTTCGTTGACGTTCTGCTAAAGGGTGGCCGAACTGCG
8   K08   T002848_01                  Rv2848c
                       CGCACTGCTGCACGGCTTTTCCACGTTCGACACCGCAACTCGGAT
8   K10   T002849_01                  Rv2849c
                       ACATCGCGGTGTTTCAGTTTGTCAAGAGCGCTAAGTGGAAAGTGGG
8   K12   T002850_01                  Rv2850c
                       TGCGCCGGTGGTTCGGTTGGAGCAGTTGCACGCGGATTATCTAGT
8   K14   T002851_01                  Rv2851c
                       CTTTACGAGCTGCTCAAGTTGAGGGTGGAGGTGTTCGTTGTCGAA
8   K16   T002852_01                  Rv2852c
                       AACAACTCATCGGCTATTGCGTGCAAAATGGCACTACCGCGTTGTT
8   K18   T002853_01                  Rv2853
                       CATCGGCACCGCAGCGCCTGGCAGCGACGGCGTAAATCAGATTGG
8   K20   T002854_01                  Rv2854
                       GACACCGAACTCGAGCACTCCCTGTCCATCATCAACGAGCAGAACC
8   K22   T002855_01                  Rv2855
                       AGATCGCTGCCGTCGGACTCACTGAAAACCAAGCTGTGGCAAAGG
8   K24   T002856_01                  Rv2856
                       GTTCCTCGGCCGCTTCACCAAGTCACTCACCAAGTCCTGGCATATG
8   M02   T002857_01                  Rv2857c
                       ATCATTCATCACCGCTTCGACGTTCCTGGTCGACGGTGGGATCAGC
8   M04   T002858_01                  Rv2858c
                       AGGGCCGGACGCTCCGCTGCAGTTCACCGAAACCAAAAATGTGTT
8   M06   T002859_01                  Rv2859c
                       TTCGTACTAGCGGTGCAGTGGCATCCGGAGAAGTCGTTGGACGAT
8   M08   T002860_01                  Rv2860c
                       CGTTGCGCGAATTCACGCTGTGCTATGCGCCGACCATTAACTCCTA
8   M10   T002861_01                  Rv2861c
                       TGTCCGTTATCGGTCGTGTCATCGAGTCGTATGCAAATCGGTTCGG
8   M12   T002862_01                  Rv2862c
                       ATCGAACTCGACCTCGTCAAGGCCCGTTTCGCGGGGCCGGTGGTG
8   M14   T002863_01                  Rv2863
                       CTGCCAGCGTCGCGGTGTCACGCGGATCAAGACGTTCGACCACAC
8   M16   T002864_01                  Rv2864c
                       TAGCTCGGAATACGCGGTGCGGATGACCAAGGTGATGTTCGAATC
8   M18   T002865_01                  Rv2865
                       CCGATTTCGACGATCAAGGGCAAGCTCAATGAGTTCGTCGACGCG
8   M20   T002866_01                  Rv2866
                       GATTGACGACGAGCACACAACGGTAGTGATCCTGCGCGTCGATCA
8   M22   T002867_01                  Rv2867c
                       GCCCGATTCGAGCACGGTCAAGTGATCTTCAAGGCCGAAGTGGGA
8   M24   T002868_01                  Rv2868c
                       GGTTCGCTGGACAAACGGTTCATGGAGAAGTATGGCAAAGCCACG
8   O02   T002869_01                  Rv2869c
                       GCACCGGTGAATTACCTCAAACTCTTGCCGGCGACCTATGTGGTCT
8   O04   T002870_01                  Rv2870c
                       TGAACACGCTGAATTCGGCGTCGCTGGTCAACAAGGGACTTGAGG
8   O06   T002871_01                  Rv2871
                       CGATCTATCGTCCAACGCCGCACTTGCCGAAGCGATGAACGACGG
8   O08   T002872_01                  Rv2872
                       CGACCGCGGCTTTGCCCGTTTCCGTCGACTGCGCTGGCGTCATCC
8   O10   T002873_01                  Rv2873
                       CAGCCATCGCGATTGCGTTCTTAGCGGGTTGTTCGAGCACCAAACC
8   O12   T002874_01                  Rv2874
                       GCTGGCGTCCGAAACACTTGAGGTGCGGCCCAGCAAGGGGCTACA
8   O14   T002875_01                  Rv2875
                       GCATTTAGCAAGCTGCCGGCATCCACGATCGACGAGCTCAAGACC
8   O16   T002876_01                  Rv2876
                       ATGCTGCGGGGCAACCACGTCGGCCACGTCGAGGACTGGTTCCTG
8   O18   T002877_01                  Rv2877c
                       GCTACGGCATCAGCTATGCGGTTGCTTCGCTGTCATGCACCATCG
8   O20   T002878_01                  Rv2878c
                       TCACCAACCTCAATGACGCCGATGGTGTGATCTGGGCCCGCTACA
8   O22   T002879_01                  Rv2879c
                       TGATCCCGCTGAACCCGACTCCGGGCAGTGATTGGGATGCCAGCC
8   O24   T002880_01                  Rv2880c
                       CATGTTCGAATCGGTGCTGATGCGCTATCCGCGGCGCAACACGGT
8   B02   T002881_01                  Rv2881c
                       ATGCTGGTCTACCCGGAAAATGGCTCGGGATGGGTGTTCTGCATG
8   B04   T002882_01                  Rv2882c
                       GGTCAAACAGGCAAAGCATAAGGGGGAGGAGGCCAAGGTTTCGGT
8   B06   T002883_01                  Rv2883c
                       CGGTATGGAGCGCACCAGGTCGGACTATATGGGAATGCTCGGCAC
8   B08   T002884_01                  Rv2884
                       TTATATGGCGGTGACGCCACCGCAGCCGCGCTGGATCATCAGCGA
8   B10   T002885_01                  Rv2885c
                       GGTGTCGACGTTGGTGTGCGGCGTTTGGCCACTGTTGCAGACGCT
8   B12   T002886_01                  Rv2886c
                       GCTGCCGATGCCCGGAAGGGGCTGTCAGCTGTTGCGTTTGGGTGG
8   B14   T002887_01                  Rv2887
                       CGCTGCCTGAGTTCGTCTGCCTGAGAATGCTTTCGCAGTCACCGG
8   B16   T002888_01                  Rv2888c
                       CGGGCCAGGAAGCGTTCTTCAGTGGAGTGCCGACCTTCATCAAGG
8   B18   T002889_01                  Rv2889c
                       AGCAGGCGCTGCCCAAGATTGTCGAGGGCCGGCTGAACGGCTTCT
8   B20   T002890_01                  Rv2890c
                       CACGAACAAAGAGCACATTGCCGTCGGTGAGGCCCGCAAACTGGG
8   B22   T002891_01                  Rv2891
                       ATCCAGCGAAGGGCGGACGCTGCATTACCGCCAAGCGGAACCCGT
8   B24   T002892_01                  Rv2892c
                       CAGCAATGGCTCGCGGAGAATCTTCTCGGTCTCACGCCTGACAAC
8   D02   T002893_01                  Rv2893
                       ACACCGGCACATTGGTGCTCAACAACGACTTTCGCCATCCCGTGG
8   D04   T002894_01                  Rv2894c
                       CCTGGGCGATCTAAGATCGCTCTTCGCGTTTCTCGCCGATCGCGG
8   D06   T002895_01                  Rv2895c
                       GTGAGGCGCAAGCCGTCATGCATAACTTGCGGCCATACGTTCGCA
8   D08   T002896_01                  Rv2896c
                       GATTTGACATCCCGTATCCGGCGGGCCATTCGGCGTTGCTACATC
8   D10   T002897_01                  Rv2897c
                       ATGCTGACTGGTCCACCGGGTGTCGGCAAAACAATGCTGGCGCAA
8   D12   T002898_01                  Rv2898c
                       ACCTGACCAGCATGGGGTTGCGGATCTTGAACCGCAACTGGCGTT
8   D14   T002899_01                  Rv2899c
                       CGATGTCGATGTCACCCGCACCTTCTACACCACCTCGTCGTGCGG
8   D16   T002900_01                  Rv2900c
                       GGTTGATTCGGTTCAAAGATCCGCAGAAGGTGAACGGGGTTGTGG
8   D18   T002901_01                  Rv2901c
                       CTACGTCGTAGAAACCGAGCGACGTTTCTATTTGGCAAACAGTGTG
8   D20   T002902_01                  Rv2902c
                       CGGTGATCCGTAAATCTGGGGGTTTGCGGGGAATGCGCACCCTGG
8   D22   T002903_01                  Rv2903c
                       GGTGATTGCTGTGGTGCTCTACTACGTCATGCTGACGTTTGTCGCG
8   D24   T002904_01                  Rv2904c
                       ATCAACGTGCATGTCAAGGTGATCGAGGGCGCCAAGGAACGTCTC
8   F02   T002905_01                  Rv2905
                       GACGATCTGCTGCTGGCCGAGGCCGAGGGCAAAGTCACATTGTCC
8   F04   T002906_01                  Rv2906c
                       AATGGTGATGAAGGCGCCGGTGTGGGGTGAAGCGCTTGACGAAAT
8   F06   T002907_01                  Rv2907c
                       CACGTCGGTGTCATTGGACGACGGCATCGTTGAGATTGATCCGCC
8   F08   T002908_01                  Rv2908c
                       TAGACCTGATAACCAGTCGGCGGGGGCGCACCGTCGAAGTCCACG
8   F10   T002909_01                  Rv2909c
                       CTGAAGATCACCGGGGATTGGCAGAAGTTTAAGGGCCTACCTGGC
8   F12   T002910_01                  Rv2910c
                       CGTGCGCACCCCCGATGGCTGGCGGATCATCAGGCGGGTCGAAA
8   F14   T002911_01                  Rv2911
                       GTGATCGCCATGATGTACGGGCTGGTCAAAGAGGGCGGACCGACG
8   F16   T002912_01                  Rv2912c
                       GTGCTCTGCCGGGTGCCGAGAGCTTTCCGGAGGAGACATTTCCGG
8   F18   T002913_01                  Rv2913c
                       AACTCAACGATCTGGAGGAAACGGTGACCTACGACGTGATCATTCG
8   F20   T002914_01                  Rv2914c
                       GGTGATCTTCCCCCGGCAGTCACCGTGCCGGACCCAGCAACGATT
8   F22   T002915_01                  Rv2915c
                       ACCGTCAAATCGGCGATCTTGCCCCGTTGTGGTCCGATGACGTGC
8   F24   T002916_01                  Rv2916c
                       CGGCTCAACAGGTCGTCAAGATCGTCAACGAGGAACTGATAAGCA
8   H02   T002917_01                  Rv2917
                       ACTACTCCGTTACCACACTGTCGAGCAGGTCACCGTCGTCGTGCC
8   H04   T002918_01                  Rv2918c
                       TGTGGGATGCCAACATTCGGCTCGATCACAGTGTGCGAACGGTTA
8   H06   T002919_01                  Rv2919c
                       GGAGTGCTGGGGATGACGGTCAGTGAAATCCAGGGATACGGACGG
8   H08   T002920_01                  Rv2920c
                       CACCGTGGAGGATAGCCGCAACGGCATTCAGGAGCGTATAGGCCA
8   H10   T002921_01                  Rv2921c
                       ATTGTGTTCCGCGTTCAACAGGAACTTGGGGTGCCGGTGAAGCTG
8   H12   T002922_01                  Rv2922c
                       TCACCCGAAGAATGTTTCGCGACGGTGCCAGCGAATACGAAATCAA
8   H14   T002923_01                  Rv2923c
                       ATCCCCTGATCGAGGAGACCATGGAGCTCGACTTGTCGGGCCTCA
8   H16   T002924_01                  Rv2924c
                       GCGCGGATCAACGGAACCGATCGGCGCGGCAAGTACCTGTGGTTG
8   H18   T002925_01                  Rv2925c
                       GGGCTGACCATCACCGACGCGCTGTTCCATCGTCATCCTGATCGG
8   H20   T002926_01                  Rv2926c
                       ATCTGGGTGGCGTGCGCCGTAGGATTTCTCTTATGGCCAGGCAGC
8   H22   T002927_01                  Rv2927c
                       TCCTACGAGAAAGCCGTGCAGGAGGGCATCAAAGAGCAGCAGCGC
8   H24   T002928_01                  Rv2928
                       ACGACGGAAGAGTTCTCTATCCGTGTATTCCCTGGGGATCACTTCT
8   J02   T002929_01                  Rv2929
                       TCCAACTGGCCGAAGGGCTCGGGGGTCAACACCTGGACAGCCATT
8   J04   T002930_01                  Rv2930
                       CAGGTCTACAGTCGTGCATGCATCATTGCTGAAGAACTCAAGTTAT
8   J06   T002931_01                  Rv2931
                       CGAGGCCGAGCAGTTTGTCGGCATCGAGTTGTCTGCCACCATGTT
8   J08   T002932_01                  Rv2932
                       CTCCTACCACGAACTGACCGAAGCCGAGTTGTTGGAACAACTTTCG
8   J10   T002933_01                  Rv2933
                       AACTCCTGCAACACATCCTGCAGCACGTGGCGGATGGCAAACTCG
8   J12   T002934_01                  Rv2934
                       TGCACGCCGCCGCGGTCATCGAAGACAGCCTGGTGTTCTCTATGA
8   J14   T002935_01                  Rv2935
                       GACCAGTTCAGCCTGTTCTTGCAGAATGACAAGGACTTTCTGGCAA
8   J16   T002936_01                  Rv2936
                       GGTTAACGGGGTTCGCAAGACCTACGGCAAGGGCAAGATTGTGGC
8   J18   T002937_01                  Rv2937
                       CTGCCGCTGCTGAGCTTGCCCATTTTGATCTTCGGACTGCTGTCCA
8   J20   T002938_01                  Rv2938
                       CTAACTCGATGGGCACGTGACTATATCACCGTTATCGGAGCGATCG
8   J22   T002939_01                  Rv2939
                       TGCTGGCACAGCGGGGTATCAGGAAGCAAGGGCTTTCGGGAGCTG
8   J24   T002940_01                  Rv2940c
                       CCAGCATCAACTTCGCCGACGTTTTGATCGCGTTTGGACGATTCCC
8   L02   T002941_01                  Rv2941
                       TTCGAACAGCTGATGTCTGGCTACTTTGCGGATACCGACGGGATTC
8   L04   T002942_01                  Rv2942
                       CGCCGCCGCGCGGAACCTCAAAAACAAAACCACCGAACTGTCGGA
8   L06   T002943_01                  Rv2943
                       CGTCGCGCACCACGTATGTGGCAGGCGAAATTGCCCAGTGCGACT
8   L08   T002944_01                  Rv2944
                       TCTACGCCGAACTCACCCGGCTTTGCCGCTATCCGCTCCTGGTGG
8   L10   T002945_01                  Rv2945c
                       TACCGAAGTGATAGACGGAATTTCGACCACCAAAATCACCGGGACC
8   L12   T002946_01                  Rv2946c
                       CGCGACGTTATTTGGGGTGCCGATGCGGATTTGCTTGACAGCACC
8   L14   T002947_01                  Rv2947c
                       ATGAGCGTTGAAGGTGCCGACCAGCAGAGCGAAAAGCTTTTTCAC
8   L16   T002948_01                  Rv2948c
                       TTCACCGCGGATTGCTCAACCGATTGTCTGCGTTCAAGGTGCCGC
8   L18   T002949_01                  Rv2949c
                       ATTTCGAGATGCTCCGCATGAAGAACCTGATCGCTGGCAGTTTTCA
8   L20   T002950_01                  Rv2950c
                       GTGCCACAATTCGGCATTCACGACGAACGAATATCTTCGGCATTAC
8   L22   T002951_01                  Rv2951c
                       AATTGCGGCGAAATTCGTGCCCAAGATCGATGCCAATTACGAACCG
8   L24   T002952_01                  Rv2952
                       CGCGGACTCGGTAACGACGAAATCGTGTTCATCAACTGGGCCTATG
8   N02   T002953_01                  Rv2953
                       CATTACAGGAGTGGGCTTATGGCCGGCGGTTCCGCTACTCGGAAA
8   N04   T002954_01                  Rv2954c
                       ATGTCACAGTCGACCACCTAGATCTCGACGGCGATCTCCCAGCAG
8   N06   T002955_01                  Rv2955c
                       ACCACTGGTTGTTTCGAGAACCTCGGAGCTCAACGGCCGACCTAC
8   N08   T002956_01                  Rv2956
                       AGGCGTCCATACATCGACTTGATTCCGTGGCGCCAGAATTTCTAGG
8   N10   T002957_01                  Rv2957
                       CTGCCGATGTCCACGAGACTCGGCATAAGGCTGGTCATAGTTCTG
8   N12   T002958_01                  Rv2958c
                       TTTTGGGCCCGCTCCCGTTCCCACATCACCCGATTCACACCGTCCC
8   N14   T002959_01                  Rv2959c
                       CGGCGATTGCCGAACAAATTCAACGCCTCAAAAACGAATACCCTGG
8   N16   T002960_01                  Rv2960c
                       GGCAGTCCATAACCCGCGGTTTGAGGGTAACCCCAATCTGTTGCTA
8   N18   T002961_01                  Rv2961
                       CTCAAACGAAACTACGGTTGGAACCGCTCCTGCATCGACGGCACC
8   N20   T002962_01                  Rv2962c
                       ATGCGATTCACACCATCCCCAGCGAGCGGTTTTTCGGCAATCTGAC
8   N22   T002963_01                  Rv2963
                       TACGCATCGATGGTCGTCGCTGGCTATCTCATCGAACTTCTCTTCG
8   N24   T002964_01                  Rv2964
                       CGGCAATGTGGATTTAGTAGTGCTGGCACGCTACATGCAGATACTC
8   P02   T002965_01                  Rv2965c
                       GCCCAGGGTCATTTGACCCGGTGACGTTAGGCCACGTCGACATTT
8   P04   T002966_01                  Rv2966c
                       CCGATGGCCCCAGCGTGTTTACGGCGACACCCGTTTGGAACTGGC
8   P06   T002967_01                  Rv2967c
                       TTACCGATCCGGGTGAACAGCTGTACACGCTGGACTACTACCTGAA
8   P08   T002968_01                  Rv2968c
                       GCTCTGGTTCACGACAGTATTCCTGCTGATCATGGTCCGCTTTTGG
8   P10   T002969_01                  Rv2969c
                       CGCCAAGATCAAAGAAATTGTGGGTGATGTGCCGGGCATTGACTC
8   P12   T002970_01                  Rv2970c
                       CGCACAGACTCGCTCAATGGGCCTGTTCGGCAATGGCTTCCTGCT
8   P14   T002971_01                  Rv2971
                       CAGGAAGCATGTAGAGCCAGTTTGGACCGCCTCGGCCTCGACTAC
8   P16   T002972_01                  Rv2972c
                       GCGGCGCCAGTGTTGGCCAATCGGTCCAGATCGACCACATCGTTC
8   P18   T002973_01                  Rv2973c
                       GATCACCGATACGTATTCGTTTCCGATGAAAAAGAAGCCGAATCGG
8   P20   T002974_01                  Rv2974c
                       GTAACCGAAGACGTGGCTGTCGTCCTGGAACGGCATGTGCACGAC
8   P22   T002975_01                  Rv2975c
                       GTCAACATGCTGTTCACCATGCGTGCCGCGGTCGTAGAAGCTGAT
8   P24   T002976_01                  Rv2976c
                       GGGCGCAGATACCTGCCCGCCGGATCGAATGTGTTGCGCGCCTTC
8   B01   T002977_01                  Rv2977c
                       CGAGGAGTGGACTGGATACGCGGGCTGGCAATCGTTTGGGGAGC
8   B03   T002978_01                  Rv2978c
                       CGCGCCGGTAAACGGGTCGGGTTTCCCCGTTTCAAACGCAAAGGC
8   B05   T002979_01                  Rv2979c
                       TGACCGAGGTCGGTTCCGCGTTCAACGAGCACCGCCGTAAGTTCC
8   B07   T002980_01                  Rv2980
                       CCGGTGTATGTGGCGCTGACACTCCCCTCGGGATCGGGGCCCACC
8   B09   T002981_01                  Rv2981c
                       ACTTCTTCCTCACCGACGACGGTCCGGTGATCAACGAGATCAACAC
8   B11   T002982_01                  Rv2982c
                       ACCACCCGATATAACCCCGACTATCTGCCCGGTGCGCTGTTACCAC
8   B13   T002983_01                  Rv2983
                       ACATCGTTGTGCTGCAAGGCGATTTGCCGGCATTACAGACACAGG
8   B15   T002984_01                  Rv2984
                       GGGTATGGAAATCGTCGAGCACCACGCATTTCGCATCACTCGCAAC
8   B17   T002985_01                  Rv2985
                       AGACGATGGAGCCACTCGCCGCGGAACTGAACGTGACCATACACA
8   B19   T002986_01                  Rv2986c
                       GTGCAGCCAAGAAGGTAGCGAAGAAGGCACCTGCCAAGAAGGCGA
8   B21   T002987_01                  Rv2987c
                       CATTGAGCAGAGTCCGGGCCTGGAAATCACTGCCAATCTTCAAGAT
8   B23   T002988_01                  Rv2988c
                       GGCCTTGCAGACCGGCGAGCCACGCACACTGGCCGAGAAGATTTG
8   D01   T002989_01                  Rv2989
                       AGACAGCATAGCGGTATCGGTGTCCTCGACAAAGCCGTTGGCGTG
8   D03   T002990_01                  Rv2990c
                       CATCTCGCCGATCATGGTCGTCTTTACCTAGTCGGCTTGGAGCCCT
8   D05   T002991_01                  Rv2991
                       GCGTGTGGGAACGCTACACCGGCCCCTACACCGACGAGTGCAAAC
8   D07   T002992_01                  Rv2992c
                       TCGGGGTAGCTGAGCGGATTCCGAAATTCGCGCACCTCCCAACGG
8   D09   T002993_01                  Rv2993c
                       GCGCCATCGTGGAATGGATCTCGGCGATAATGACCTTGCTGCCAG
8   D11   T002994_01                  Rv2994
                       CGACGTTGTTTCTGCTCGCGGCGGTCGATAACGAGGGCTCGAGAT
8   D13   T002995_01                  Rv2995c
                       GCGGGCTCGACGGCGTCGCAAGCATCTGACATTGGTGCACAAAAC
8   D15   T002996_01                  Rv2996c
                       GTTGATCGCCGACAAACTTGCCCCATCAACGGTTGCCGCCTTGGG
8   D17   T002997_01                  Rv2997
                       CGCACTCGGAGACGGTCGTGGAGTTCATGCTCTCCGACAAGCGGT
8   D19   T002998_01                  Rv2998
                       CGAGTTCGAGTTCGGTGGTCAGGAGGCTAAGGGGGTGCGAAGTTC
8   D21   T002999_01                  Rv2999
                       ACAACAACACCGCGTATCGGATCAACCTGCCGCGCAATGACCTTCA
8   D23   T003000_01                  Rv3000
                       GCTGCGGTTGCTGAACCGGCTCATCGATCCGACGTCCGGAAAAGT
8   F01   T003001_01                  Rv3001c
                       AGACGACGTTCAAAGACGAGACCGAAACCGACCTGTTCGGTGAGC
8   F03   T003002_01                  Rv3002c
                       CGACGCCGGCAGCCGCAGCCAAGTGATCGAAGCGGTGAATCTGTT
8   F05   T003003_01                  Rv3003c
                       GACTGGTGGGCATACCTGAACGGTGTGCGCAAGACCTATCCGCTG
8   F07   T003004_01                  Rv3004
                       TACTGACCTGGCCGGTGAGCGCCCCGCTGTTAGTCATTCCGGTGG
8   F09   T003005_01                  Rv3005c
                       GCCGGGGACTTTGGCAGTGGAACCACCACCGTTATCCCGCCCTAT
8   F11   T003006_01                  Rv3006
                       GATCTCTATCAGCGCCGAGCCGAAGGTAAAGACGGTCATCCCCGT
8   F13   T003007_01                  Rv3007c
                       GAGTCGTTCGACGAGTTGATGGGGATGCTGGACCACCCGGTGTTT
8   F15   T003008_01                  Rv3008
                       TCACTGTCGTCGCTGTCATAGGCATACTCGAATGTGGATTAGTGCT
8   F17   T003009_01                  Rv3009c
                       TCTACCCCGACATGCCCAAGAACTACCAGATCTCACAGTACGACGA
8   F19   T003010_01                  Rv3010c
                       ACATGACCCTGATTCCTGAGCAGCCGTTCGACATCGAAGAGGTGTG
8   F21   T003011_01                  Rv3011c
                       CTACGCGTTGTCGGCCGGCTACTACGACGCCTATTACAACCAGGC
8   F23   T003012_01                  Rv3012c
                       CATTGACCGAAACCGAGCTGGACAGTTTCGCCGGCCAACTCGACG
8   H01   T003013_01                  Rv3013
                       AACGGCTATGCGATCGACGACCTGGTGGTCGAACTGCCCCCGGGA
8   H03   T003014_01                  Rv3014c
                       ATCCAAATACGACAAGGCGGTGGAGTTGGGGGTGCCGATTCTGGA
8   H05   T003015_01                  Rv3015c
                       CAGCTGCAGTCCGGATTTGCCGTGGGATCTGCTGCAGCGCAGCAG
8   H07   T003016_01                  Rv3016
                       GGGCATGCTTGACGTCGCTACGATCCTGTTGGATCAGTCACGGAT
8   H09   T003017_01                  Rv3017c
                       TTGCCAAGGTGATCTCGGGATGAGTCATCAGGACTGGCAGGCCCA
8   H11   T003018_01                  Rv3018c
                       TAGACATAGTTGTCGAGTGGGTTATTGGGAATCTGTTTGGTGTTGT
8   H13   T003019_01                  Rv3019c
                       TGGAACCAGGCCCTAGAGGATCTGGTGCGGGCCTATCAGTCGATG
8   H15   T003020_01                  Rv3020c
                       CCGCAGTTGATCGCTTCGCATACGGCGTTTGCCGCTAAGGCGGGG
8   H17   T003021_01                  Rv3021c
                       CTTACCGGGATGATCGATATGTTTTTCGCCACGGTAGGTTTTGCGT
8   H19   T003022_01                  Rv3022c
                       GTGGCAGGGTCCCAGTGCTGAGTTGTTTGTGGCCGCCTATGTGCC
8   H21   T003023_01                  Rv3023c
                       CTGCTGCACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTG
8   H23   T003024_01                  Rv3024c
                       ATGTGCTCGGAATCCCGTTTTATGTTTGGGATTTCGCAGAGAAGTT
8   J01   T003025_01                  Rv3025c
                       CGTGGCTGCGAAGGCGATGCGCTGTTGATGTTGTTGGACGCTAAC
8   J03   T003026_01                  Rv3026c
                       GTGCAACGCATCTACTGCCGGTTGGTGCTGCGCCTTTTCGGTGTC
8   J05   T003027_01                  Rv3027c
                       ATGTGGGCGGGCATCCTGGCCTACCTGGACCGATACGGCTATGAC
8   J07   T003028_01                  Rv3028c
                       TGCTGGTCGACGTGGTCGACGTGAGAGAAGGTGGAGTGGGTGTC
8   J09   T003029_01                  Rv3029c
                       GTCCTTCAAAGGCATCATGGCCGCCAAGAAGAAGGAAGTTACCGTG
8   J11   T003030_01                  Rv3030
                       CTCACTTCGCTGTTGATCGACGCGGGATTCGTCGATGTGGCCATG
8   J13   T003031_01                  Rv3031
                       GTGGAGCGGTGCCAAGGTGGCCGATCTGGTCCAGCTCAACAGCG
8   J15   T003032_01                  Rv3032
                       GCCCAGTTCTATGACGTGCCAATGGTTTCCACGATTCATGCAACGG
8   J17   T003033_01                  Rv3033
                       GAACCAGGTTGCCAACATCATCAGCGACAAACTGTTCCAGCGGGTG
8   J19   T003034_01                  Rv3034c
                       TCTGCGATTTCGACCACCGGATGGACGACATCACGCTGCCGATCA
8   J21   T003035_01                  Rv3035
                       ATGGCACGCCCGGTTTGTCGTTGCTGGTCTTCGATCCGGCCAACG
8   J23   T003036_01                  Rv3036c
                       ATCTGCCATGTGCACGCCTCGGGCCCTAAGTACATGCTGGATATGA
8   L01   T003037_01                  Rv3037c
                       GGAATAGATTTCGAGGAGGTGGGCCGGCTCGGTTTCGAGGGCGA
8   L03   T003038_01                  Rv3038c
                       GGATTCTTCCTGCTCAACTTGATCCAGGCTGGCGTTGCCCGGCGT
8   L05   T003039_01                  Rv3039c
                       TTACGCTGGCCCTAGCCGCCGATTGGCGAGTCAGCGGTGACAACG
8   L07   T003040_01                  Rv3040c
                       ATCGTCCCGGTGCAGCCACAGCTGGCCCGCAACGGCGACAACTGG
8   L09   T003041_01                  Rv3041c
                       GCGCAAGCGAGTGCTGATTGCGCGGGCTTTGATGACAGATCCAGA
8   L11   T003042_01                  Rv3042c
                       TCGTTGAGCCATCCGTACCTGGACACGGTGTTGTTCTTGTTGGGCG
8   L13   T003043_01                  Rv3043c
                       GCAATTGACCTTTGAAACCCCGATGTTGTTTTCGGTGGGCTTCATG
8   L15   T003044_01                  Rv3044
                       TCCTCAAGTCAACCTTCCTATCTGGGCACGACCGTGCATGATCTGC
8   L17   T003045_01                  Rv3045
                       TCCTGAACACCGTCTCGGCTAACTTGGACCTCGGCCAGTACCTGAA
8   L19   T003046_01                  Rv3046c
                       ACCGCGACGAGATCGCCGAGTTCATCTCCGAGGTGACCCATCACG
8   L21   T003047_01                  Rv3047c
                       TGGGACAATTGGCTGCCCAAGCTTCTGGAATCCGATAGCTACCGG
8   L23   T003048_01                  Rv3048c
                       CGAGGACGTCAAGAAGTTCTTGCGCTACAACGCCAACAAGGCGCT
8   N01   T003049_01                  Rv3049c
                       ACACGTTGAAGATCATCGAGGCCTATGCCAAATACAATATTCGTCG
8   N03   T003050_01                  Rv3050c
                       GAGGCCGGCACCGCCAAGCCCAAGATCTATCGGCATTTCACCGAC
8   N05   T003051_01                  Rv3051c
                       TATATGACCAACGACAACCTGGAGTACTACGAAGACGCCTACGAGA
8   N07   T003052_01                  Rv3052c
                       CGTCCGCACCGGTCTCGCTGAATTCTGGAAGGAACAGACGTGCCA
8   N09   T003053_01                  Rv3053c
                       AGGGCATCGCCTACCAGAAGGTTGATATCAGCCTGGATTCCGAAG
8   N11   T003054_01                  Rv3054c
                       AACGCGATCGACTGGCTGTCCAGGCCATTCGGCGATGGCGCGTTG
8   N13   T003055_01                  Rv3055
                       GCCCTGCTAGCGCTGCTCGACGTCGACTATGTCGAGCACCAACTC
8   N15   T003056_01                  Rv3056
                       GGCCCAAGACTACGAAAAGGCTGGCAAAGCTTGGGATCAACACCG
8   N17   T003057_01                  Rv3057c
                       GGTGTGTCGGCCTGGGGCACCGTTGACCAGCTCACGCACGATCAG
8   N19   T003058_01                  Rv3058c
                       GAAGAACTCGAAGAAGCCAGCCAGCATTTCTCCGCCCGTCAGCCA
8   N21   T003059_01                  Rv3059
                       GCACCAACGTGATCGCATACCCAGGGATGAATCATCGCCTGCCGG
8   N23   T003060_01                  Rv3060c
                       CAATGTCGCGAAAGTTGTCAAGCGCCGCAGCGAACCTGAGGTTGC
8   P01   T003061_01                  Rv3061c
                       GCCAAGGTGCGACAGCAATTCGGCCGTACCATCGCCACGTTTCAA
8   P03   T003062_01                  Rv3062
                       TGTTGCGGCTGCCCGCGCGACGCAGCCACTTTCGGTGTTCTTCTT
8   P05   T003063_01                  Rv3063
                       TCACCGTCGTCGTCATCAAGAAGGGGCGACTGAAGTGGGCTTGGA
8   P07   T003064_01                  Rv3064c
                       CTTTCGGTTGGTATACGGGCTGCTGTTCGCCGGCTACGGATCGAT
8   P09   T003065_01                  Rv3065
                       GATGAAGGTGGTTGGCGTCGGCCTGATTGTCGTCGGCGTGGTCAC
8   P11   T003066_01                  Rv3066
                       TCACCACCGTCTACCTGGCCGACCAGGACCGCTATCGCACGCTCA
8   P13   T003067_01                  Rv3067
                       CGCTTACGTGGCCGTCTCGATTCGCACGTATTGTCCGAAGTACGAC
8   P15   T003068_01                  Rv3068c
                       GCGAGGAATCGGCGGGGGCATCATTTCTGCGACGGGACGGATCG
8   P17   T003069_01                  Rv3069
                       ATGATCGAACACGGTCATTGGGGTTTGGCCGCTGCCTACTCCGTC
8   P19   T003070_01                  Rv3070
                       CTAGAAACCCAACGGTTGGGAGAGGACCGCCAGATGGTTTCGGCA
8   P21   T003071_01                  Rv3071
                       CGCAACGTCAATGTTCCACTGATGATCATTGCCGTCGGAACGCCTG
8   P23   T003072_01                  Rv3072c
                       GCACAACCCGGTGATAGTGGCCAAAGAAGCGGCGAGCCTGGATCG
9   A01   T003073_01                  Rv3073c
                       TGGCCGCACGGAATCCGCAAGGATGACCAGCGGGTGGGCATCTG
9   A03   T003074_01                  Rv3074
                       CCGGCTGGCGGGTCAGCACAAGTGTCGACGAAAATCACACGCACA
9   A05   T003075_01                  Rv3075c
                       GACAACGCCGTGCGTTGGTTTGGTGACGGAAACGCTGACTGGGTG
9   A07   T003076_01                  Rv3076
                       CAGCAAACCATCTGGGACGTCCTGGCCGACTTTGGTTCCTTGAGTT
9   A09   T003077_01                  Rv3077
                       TGCCGACGTTGGGTAACTGGTTTCGCGCGGCCGGGTATGACACTC
9   A11   T003078_01                  Rv3078
                       CAGCTTTCTGTTGTTGTCCCTCTCGGTGGCCATCGTGATCGGCGTG
9   A13   T003079_01                  Rv3079c
                       GATGAGCGGTTGCGCGCGATAATCGAGATCTGGACGCAGGAGCAG
9   A15   T003080_01                  Rv3080c
                       TCGATCTTGTCGAGCAGGATGAAACGAACCTGCCGGAGCAGTCAA
9   A17   T003081_01                  Rv3081
                       TATCGACGCGTTGTTCTCAACTGACGGGCCTATGCTCGAAGCGATT
9   A19   T003082_01                  Rv3082c
                       GGTCGCTACCTCTACGTCCATTCGCCCGCCCTGACGCTGACGGTT
9   A21   T003083_01                  Rv3083
                       AAGCATCCGTGGAGGGTGCTCATGCACTACGAGAAGGACGCCAAG
9   A23   T003084_01                  Rv3084
                       CTCGAAGAGATGGCTGCGGTGTACACCCGCTTGCTCGACGACGGG
9   C01   T003085_01                  Rv3085
                       CGTTGGCACTCAACCTCTCCGAGAAGCGCGCAAAGCTTGCCCTTTC
9   C03   T003086_01                  Rv3086
                       AGGGCTGCATGCCGGACGGCAGTTTCCGATTCCATTCCCAGGGAA
9   C05   T003087_01                  Rv3087
                       CGCTCAACATGACCGTCTGGAGCTATTGCGACCAGTTCAACCTGTG
9   C07   T003088_01                  Rv3088
                       GGCATTCACCGAGCTCCAAACCGAAGCCGGCACAACGAGTCCCAC
9   C09   T003089_01                  Rv3089
                       CGACATCGGCGAAATCGATGATGAGGGCTATCTTTACATCAAGGAC
9   C11   T003090_01                  Rv3090
                       ATCCCATGGATGGTGCGGTGCAGATCGACAAGTACGTCAAGGAAG
9   C13   T003091_01                  Rv3091
                       TCGTCCGGCACCACCTAGCCAATCCGGACGTGTTGAGCGGCGAAC
9   C15   T003092_01                  Rv3092c
                       GATCGGAATCGTTGTTGTTGCACTTGTGCACCTGGTTTGCTTTCGA
9   C17   T003093_01                  Rv3093c
                       CCACGTGCCGGTCATGCGCGAAACCATCGAATGCCTGCGGTCGAT
9   C19   T003094_01                  Rv3094c
                       CGGACCAATCGTGGACCGGCCGCTGTATCGCTTTCCGGTGTTTGG
9   C21   T003095_01                  Rv3095
                       CCACGCTGTCCTCGCGGCTGCGGATGCTCGTCGAGGTGGGTCTTT
9   C23   T003096_01                  Rv3096
                       AATCCTGCCGATTGCTAAGCGGCACAACGTTGGTGCGTTCAATTGG
9   E01   T003097_01                  Rv3097c
                       TTGATCCGCTCGCACAACAAGCGGTTGTCCTCGAGCACACAGCCG
9   E03   T003098_01                  Rv3098c
                       TCATTCCTTCTTGACGCCATCAACGCCCCGCGCGTAATCGCAGGTC
9   E05   T003099_01                  Rv3099c
                       AGTGACTAGCCAGCGCCGCAAGGTCTTAGCGAGCCTTTCCGATGA
9   E07   T003100_01                  Rv3100c
                       ACTTCGCCCTGGTGCCGTTGTCGCTGTATTTCGCCGAAGGCAAGG
9   E09   T003101_01                  Rv3101c
                       CAGGTCTTTCTCACCGAAGACGTTTCCGCCAACGACTCGTCCTGCG
9   E11   T003102_01                  Rv3102c
                       TGGTGATGTCCGGGTCTCGAAGTTTCATGTCAACAAACTCCGCGGT
9   E13   T003103_01                  Rv3103c
                       GGTGTTGATCGCCGCGTTCCTGGCGGTGTGGTGGATTTACGAGAC
9   E15   T003104_01                  Rv3104c
                       CTAGCGGCACAGTTCTGGCCACCTCGATAGCACAGCACTGGCATA
9   E17   T003105_01                  Rv3105c
                       GATGCGGATGTATATCCGCTGGGCCGAGCAGCACAAATACCCCGT
9   E19   T003106_01                  Rv3106
                       GTGTTCCGGTTCTTGACCTCTCCGATCGAGATCAAGGGCAAGCGC
9   E21   T003107_01                  Rv3107c
                       GTTCGCCGCGGAGTTATCGCCGAAACATTCGAAACCGCTTGCACC
9   E23   T003108_01                  Rv3108
                       CAATTCATGAAGATGCCTGCCGCATCATATCCGTTGTGCCCGTTGT
9   G01   T003109_01                  Rv3109
                       TGTCAGTCTTGATACGTTGCAACCCGAGCGCTTCAAGGCGATAAGT
9   G03   T003110_01                  Rv3110
                       GCACTACCTGGCTGGCAGCTTCTCGACATGCGACTCAGCCGCGCT
9   G05   T003111_01                  Rv3111
                       AAATGGAAGCGTTGACCGCAGTTTCAGTCGCCGCCTTGACTATCTA
9   G07   T003112_01                  Rv3112
                       ACGGTACCGATGTCGGGAATCTTGTTGATCAACTCCAGCAAAAATA
9   G09   T003113_01                  Rv3113
                       ACGAGCTTATGCACTTCGTCCAAAAATACGGGATTGCCAAGTGGTT
9   G11   T003114_01                  Rv3114
                       CAGCGGAGTGAGAGCCATCATCTTCGGCACATCAATCGAGACCCT
9   G13   T003115_01                  Rv3115
                       CTGCTGCACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTTG
9   G15   T003116_01                  Rv3116
                       TAGTGATCAGTTGTGATGAGTTGCGAACCAAACAGCAGTCGGACCA
9   G17   T003117_01                  Rv3117
                       TCCTCGCACACCTGGTTCGTGTTGCGGGAATTACTCGGACACCAAA
9   G19   T003118_01                  Rv3118
                       ATGTGCTCTGGACCCAAGCAAGGACTGACATTGCCGGCCAGCGTC
9   G21   T003119_01                  Rv3119
                       GAAACGTGCGTGACCACAATGCCGGGCATGATGTCACGCGGTTGT
9   G23   T003120_01                  Rv3120
                       GATGGACGCTTTGCTCTGGTACTTTGCCGACTATTCTGGCATCCGC
9   I01   T003121_01                  Rv3121
                       TGTCGAACGTAATCCGAACGAACACATAGCATTTGGATATGGTCCA
9   I03   T003122_01                  Rv3122
                       TGTATTCTGGTTGTTGGATAAACAACCAGAATGGGGAGACGCGGG
9   I05   T003123_01                  Rv3123
                       CGACCTCGACTCCGGCGACATCGAAACGCTGGTTCAACAACCGAT
9   I07   T003124_01                  Rv3124
                       TGCCAAAGGATATTTTAGCGAGGCGATCCGTTATCTAGATTCGGCC
9   I09   T003125_01                  Rv3125c
                       TCGTGATGGTGCGGGTTGGCATGTCACGCAGGCACGTCTCACTGT
9   I11   T003126_01                  Rv3126c
                       CTTTGTCGTTTGATGCGTTGACCACTCCGGAGCGGGATCGCGCCC
9   I13   T003127_01                  Rv3127
                       TCGACAAAGACGTTGCGATGCTTGATGTGGTATCCGACGACCAGC
9   I15   T003128_01                  Rv3128c
                       ACTTCACCCGCTTTCGCCCGTACAAGAAAAACCACTAGGCCACCAT
9   I17   T003129_01                  Rv3129
                       GCACCGTGCTGTTTCGTACCGCGGAGGGCGCCAAATTATTTTCAG
9   I19   T003130_01                  Rv3130c
                       CAGCGCTTTGAGCAAGACCGATAACCGTGTTTCGTTAATGCTGCCC
9   I21   T003131_01                  Rv3131
                       AGCCATTGTGGCGCAGGCTGTCTTGGACCACGTGACCGACGAGGA
9   I23   T003132_01                  Rv3132c
                       AACGACTCTCGGACGTGGTAGACGATCTGCAAGACGTTATACAGG
9   K01   T003133_01                  Rv3133c
                       GCGAGGGCCTGACCAACAAGCAGATCGCCGACCGAATGTTCCTAG
9   K03   T003134_01                  Rv3134c
                       AAGATCGAAACGGAGGTTCTGTGCGGCAGGCCGCTCACCAAGCTG
9   K05   T003135_01                  Rv3135
                       CAACTCCGCGCGTATGTACAGCGGTCCCGGACCGAATTCAATGTTG
9   K07   T003136_01                  Rv3136
                       GATTCCGAGCTTCATCCCTGAGGACTTCACCTTCCTTGACGCCATA
9   K09   T003137_01                  Rv3137
                       TGCGCGTCCACACCGGCTGTCGGTTTCCTCTGTGGCAGAGCTGCA
9   K11   T003138_01                  Rv3138
                       TGGCCTACCTGCGGCACCAGACGAATGTGTGGTTGGAGATCACCA
9   K13   T003139_01                  Rv3139
                       GATTGTCGGCCAGGAGTTCCTGGACAAATACCGCCTGCGCGATCC
9   K15   T003140_01                  Rv3140
                       GTGAGCATCCCGGCGTGACCGTCGAACGACTTGAACACAAACTCG
9   K17   T003141_01                  Rv3141
                       ACAGATGTGGTGTTGGCCGAGGGGTTCAAGGACGCGGTACAGGAG
9   K19   T003142_01                  Rv3142c
                       GTTCCGCGACGGTCTGGTGCTGAACTTCGACGATTACAACGAGCT
9   K21   T003143_01                  Rv3143
                       GCAAACGGTTGCACCCGGATCTGCCCGATTTGACCTACGTCGAAG
9   K23   T003144_01                  Rv3144c
                       GTTCCAGAACTTGAAGTTCCAGCAATGGGGGTGCTGCCAACTGTG
9   M01   T003145_01                  Rv3145
                       CCGCGATGTTGTTCATCGTCTTCGACATCGAAATTGTGTTCCTCTA
9   M03   T003146_01                  Rv3146
                       CTGCACGAAAAGATTCAGCAGATGCCATTAGGTATCAACCGGGAAC
9   M05   T003147_01                  Rv3147
                       ACGACTTCTTCGGGATCATCTTCGACGGCCATCCGGCCCTGACCC
9   M07   T003148_01                  Rv3148
                       GTGATGCCTACGGGCGCTACATGATTCGCGTCAAAGAGATGTGGG
9   M09   T003149_01                  Rv3149
                       CCTCAAAGAGCATCTCGGCGTCGGCCACGACGAAACCACCTCCGA
9   M11   T003150_01                  Rv3150
                       GGAAACCGGCCGGGGTAGCCATGAAGACATTGACAAACTGTTGGA
9   M13   T003151_01                  Rv3151
                       ACGGTGTGATGGAACTGCTGCTGATCAACCATCCGCTGGATTGCC
9   M15   T003152_01                  Rv3152
                       CGCACAAGACGGTGTCTGGTATGCCTTCCTGTTGTTGCCGTCATTC
9   M17   T003153_01                  Rv3153
                       AGGAGCGGTTTTCGCCGGGCGAACGCTACGGCCGGGTGTACCAG
9   M19   T003154_01                  Rv3154
                       CAACGGCAACGTCGAAGGCTTGGCCGCGCTGATTTTTTCCCGTTAC
9   M21   T003155_01                  Rv3155
                       GATCGTGATGTTCATGTGCGTCGAGCTCATGCTCAATGCCGTTAAC
9   M23   T003156_01                  Rv3156
                       TCGTGATGAACCGGGTTGGGGACGCCGGCCTAGCGGTGGGTATG
9   O01   T003157_01                  Rv3157
                       GCATGCTGCGCTACTGCCTGCAGCTGTTTCCTGACCCGTCAACGT
9   O03   T003158_01                  Rv3158
                       CGTGATCGCCGATAATCCGGCGGGTCTTTCCGCGACGTTGTTCTA
9   O05   T003159_01                  Rv3159c
                       TCAGGCTTCTTTAACACGGGCAATGTTTCGGCTGGCTATGGGAACA
9   O07   T003160_01                  Rv3160c
                       GGTGGAGCAGCCGGCCATCTACAAACACTTCTCGGCCAAACGCGA
9   O09   T003161_01                  Rv3161c
                       TTGCGCCTCAGGGTTCCCTTCACCGTTCCAGTAGAAGCGAAGTCG
9   O11   T003162_01                  Rv3162c
                       GTGGTGTTGTCGGTGGTGATGATCGTGGTGTCCGGCCCGACGCAT
9   O13   T003163_01                  Rv3163c
                       CGGATTCGCAGCGATGTTTCGAGAACGAACATGTGCGAGTGACCG
9   O15   T003164_01                  Rv3164c
                       GTGAGCATCGATGGCCAAACCCATAAACTGGCAATGCCATTCATCG
9   O17   T003165_01                  Rv3165c
                       CGGCGACCGTCAACCAGGCCCCGGCCGTGCGGCACTGGAAGAAA
9   O19   T003166_01                  Rv3166c
                       GCACCGTGAGGTGGCGATGCGTTTGCTTCGACTGGTTCTTGACGA
9   O21   T003167_01                  Rv3167c
                       CCGCGCATCGACTCGGCGATCCTGTCGGCGACGGCGGAACTGCT
9   O23   T003168_01                  Rv3168
                       GCCCGACGATGTGGAGTCGCTGTTCTATCACGCCGGCTTGATGAA
9   A02   T003169_01                  Rv3169
                       CATGTGGAAGGGCGAGAAGTTCGTCGAGCGAAGAACCTACGACAT
9   A04   T003170_01                  Rv3170
                       TTGCGCTGCTTTGCGTCGCTGTTCGGCGACGAAGCGCTCGACCCC
9   A06   T003171_01                  Rv3171c
                       AAGATGCTCGTCGAGGAAGTAGGGTCGGCACACCTCAACCTGGAT
9   A08   T003172_01                  Rv3172c
                       GAGAGCAGGGGCCGCGACGTTATTATTCTGTGATCCTATGCTTCAG
9   A10   T003173_01                  Rv3173c
                       GGCCGACAAGATGCCCAAGGCATCCAACGCGACACCACGCGAGCG
9   A12   T003174_01                  Rv3174
                       CGCCAACCGCGGCATGGGCCGCGAATACGTCGCTCAGCTTCTCGG
9   A14   T003175_01                  Rv3175
                       CGGCTCATTACTGCGGTCTGTACGGCCACAAATCGACCTGGCGCT
9   A16   T003176_01                  Rv3176c
                       AGGGGATAGCGCAGACCGTCGTCGTTGCCTTCGACTACTCCTGCA
9   A18   T003177_01                  Rv3177
                       GTTACTTTCGGGACGATCCGCGAGAGCATCAAGGCCACACTGACT
9   A20   T003178_01                  Rv3178
                       TGGGCAGGCAGAAAACCCGCAGTGGTATCGCAACCTGCCGCCCAA
9   A22   T003179_01                  Rv3179
                       TGATCAACGAGCTGATGAAGCTACGTGCGGCGACCGAACTCGAGG
9   A24   T003180_01                  Rv3180c
                       TTCGACGCCAGCGCCTTCGTCAAACTTCTCACCACCGAGACAGGG
9   C02   T003181_01                  Rv3181c
                       GTTGCCGCACGCAGAGTGATATGTACAAATCACGGTTCAGTGAGTG
9   C04   T003182_01                  Rv3182
                       GGTCGACAAAGTGAACGACTCAACGTTTCACAACATGAAGGAGCTG
9   C06   T003183_01                  Rv3183
                       TACGTTGCCGCCCTGGGCGGGCACCTGCGCATCGTCGCTGAGTTC
9   C08   T003184_01                  Rv3184
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
9   C10   T003185_01                  Rv3185
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
9   C12   T003186_01                  Rv3186
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
9   C14   T003187_01                  Rv3187
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
9   C16   T003188_01                  Rv3188
                       GCTCGCCAAGGATCGCTACGAGGATGTGCGAAGCGCGGCGGAGT
9   C18   T003189_01                  Rv3189
                       AGTGGCGGTCACACTCCAGGTACTCGACCTCACAGACGAGAGGAC
9   C20   T003190_01                  Rv3190c
                       TCATAAGCAGATCGCGAATATTGAGAAGTACCTCGGTTGGTCGCGC
9   C22   T003191_01                  Rv3191c
                       GGCAATACTTCCCAAAGGGCACCAGCCTCAGCACCTACACGCCCG
9   C24   T003192_01                  Rv3192
                       GTTTTCCAAACCGGGACACCGGATCACCACGGCGAGTTCGACAAT
9   E02   T003193_01                  Rv3193c
                       AAGGTGCAGCGCATGTTGTTGGCCAAATACCACGTCAATGATCCGG
9   E04   T003194_01                  Rv3194c
                       AAGTCGCGGGAAGAGATCGAAAATGACAACGCCGCTGATTTCAAG
9   E06   T003195_01                  Rv3195
                       TGGCCAGTCAACTGCTCGGCGCCGTCGAGGCCTACGCCATGGGC
9   E08   T003196_01                  Rv3196
                       GTCATGCGGCGGGCTGCGTCTGCTCTGTATTCGTTGAATCCTGCG
9   E10   T003197_01                  Rv3197
                       CTGCGCCAATACGTCGAGCCCATCCAGGTCGAGGTCTTCCACTAC
9   E12   T003198_01                  Rv3198c
                       GGCACTCCGCCATCCGAGGTAGCCATTCTCTACCGAGTCAATGCG
9   E14   T003199_01                  Rv3199c
                       CTGACCGTTCGCGATGTGCGCTATCTGGGCAGCCAGCAGTGGCCG
9   E16   T003200_01                  Rv3200c
                       AGTGACGAGTTAGTTCCGGGTGAAATTGTGGTCGTCGACACCGAT
9   E18   T003201_01                  Rv3201c
                       AATTTTACGGTGCTGAACTGCTGTTTGACCTGGGTGACCTGCCAGG
9   E20   T003202_01                  Rv3202c
                       CGCGATGATCCAGGCGTTCGTACAGTGGCGAGCTCAGAGTCGATC
9   E22   T003203_01                  Rv3203
                       CTGGACAAACGGCTAGGAGCCGATTTTGAGCTACTAGACTTCGACT
9   E24   T003204_01                  Rv3204
                       CATCGCAGCTCTCACAGGGCTTTCCAGTCCGCGTATTGTCGGCTG
9   G02   T003205_01                  Rv3205c
                       CAGATGTTGTTGCGCGCGTTGATGTTCCGCCTAGCAGTGTACGCG
9   G04   T003206_01                  Rv3206c
                       CTGGCACTGATCGACGTTCGCGATCCCGTGGAGTGGGACATCGTG
9   G06   T003207_01                  Rv3207c
                       TGACCCCGACTTCGTTAAGGCGGATGGAAAGACCTGCCGATTCAA
9   G08   T003208_01                  Rv3208
                       TTACCACGCGGCCGGTATGGACGAGATCGCGGATCGGGCGGGAG
9   G10   T003209_01                  Rv3209
                       ACCGAATCGGTCGTCGCGACCAGCCTTTACAGTCGTCTCAACTGCT
9   G12   T003210_01                  Rv3210c
                       TCAGCGTTAGAAAACTACCACCGGCTGACGACGCCGAGCACATGG
9   G14   T003211_01                  Rv3211
                       ACACACAACTGAATCAACATTTGCCAAACTTGGAGTCCGCGACGAA
9   G16   T003212_01                  Rv3212
                       TACCTGCCTGCAAGATCAGGCGCGCAACCGAGAGTCGACGTGATC
9   G18   T003213_01                  Rv3213c
                       AGGTTGTCTGACCTTCTCCCTTGGTCAAGATCCCGACAAACTACCG
9   G20   T003214_01                  Rv3214
                       AGATCCGGGAATCCGAACCCGATTGGCTGGTGTGGACGCACGGCT
9   G22   T003215_01                  Rv3215
                       CGATGACGAACTTGAAGAAACCACAACGAAGTTCGCCACGATATTG
9   G24   T003216_01                  Rv3216
                       TTTTCCACCTGGGACGGCGTCGCGGGCATCTATGTGGAGGACTTG
9   I02   T003217_01                  Rv3217c
                       CGTGGTATCTGATTGTGGGTTCGCATCAGCCGGCGATCGGGATCC
9   I04   T003218_01                  Rv3218
                       CCTGAGGGTGGTTCGGCAGATGTTCGCAAAACAGCCCAAGTTCGA
9   I06   T003219_01                  Rv3219
                       GGATCCGGAACTGTTCTTCCCGGTAGGAAACAGTGGTCCGGCACT
9   I08   T003220_01                  Rv3220c
                       ACGATGCGTTGTCGATGTCGGTGGACGAGCAGGTGAACCTTGACG
9   I10   T003221_01                  Rv3221c
                       GGTCAGCAAGGTGGCGGTATCGGTGGGCGATGTCATTCAGGCCG
9   I12   T003222_01                  Rv3222c
                       TCGCAGACACCGTTGCGGAGTTGTTTGTCTGCCGCCCAACCGAAC
9   I14   T003223_01                  Rv3223c
                       CTCAAGGCCTGGCTCTACCGGATACTGACCAACACCTACATCAACA
9   I16   T003224_01                  Rv3224
                       TATCCCAAGCGTGCATTCCCCATATGAAAGGCCGTGAGAACCCGCA
9   I18   T003225_01                  Rv3225c
                       ACCTGTCCCGGTTCAACATCCTGACAGCGCAAGGACGCTTGACGG
9   I20   T003226_01                  Rv3226c
                       CGACATCGCGCTGCGCCAAGTGTCCACGTTGGTCAACAACGTGCG
9   I22   T003227_01                  Rv3227
                       TGGCCTAGAGTCAGCGTGCAACCCGCCGACCACATCTTGGCAATT
9   I24   T003228_01                  Rv3228
                       CACCCCAGGAATCCGCTCATTCGGGTTGGCTCATATCCAGCCCGA
9   K02   T003229_01                  Rv3229c
                       GCTACACCCACAACTTCGTGCACCACAAATACACCAACATCCTCGG
9   K04   T003230_01                  Rv3230c
                       CGCCGCAACCAAATCACCGACGTAGTGCACCTGCATTCGGCGCCC
9   K06   T003231_01                  Rv3231c
                       TGACGCCCAGGACCACGATCTCGCCTGGTACGCCAACCAAGAGCT
9   K08   T003232_01                  Rv3232c
                       TTCGAGCAGATGCTGATCGATGACGGGATTCTGCTTCGCAAATACT
9   K10   T003233_01                  Rv3233c
                       GAGCGATGTCGATCTGCTGCCGGGGCTGTTGAGCCAAGCACTGGA
9   K12   T003234_01                  Rv3234c
                       TGTGGGAGATGTATCTCGTCGAGGGTCTGGAAAAGAATCGCATTG
9   K14   T003235_01                  Rv3235
                       CTGCGCAACACTCGTCTGCCACTCTCCAGCAGGCTCCTCGTTCGA
9   K16   T003236_01                  Rv3236c
                       CATCGGTGTCGTGTTGTTGCTTTTGGCCCTGGGTCTGGAGTTTTCT
9   K18   T003237_01                  Rv3237c
                       AGATGTCCTCATCGTGATCGGCACCGAGGACGGGATCGCCGGGG
9   K20   T003238_01                  Rv3238c
                       GTGGGCGTTGTTCTGGCTCGGGTGGGCCACGGTGTTGACGTCGA
9   K22   T003239_01                  Rv3239c
                       CCTACGCATACGAGTACTTCATTCGGCACAATCCGCTCAGTGACTA
9   K24   T003240_01                  Rv3240c
                       GACCCAGGTCGAGCAGCAGAACTTTGAGGTCCGCAAGAACGTCCT
9   M02   T003241_01                  Rv3241c
                       AACCGAAATCAAACGCTGAGATCGTGTTCAAGGGCCGTAATGTCGA
9   M04   T003242_01                  Rv3242c
                       CGCTGATTGTCGGTGTCGACCACCTGTTGTCCTGGGGCATGCTCG
9   M06   T003243_01                  Rv3243c
                       GGAAGTCACGGTTCGGATTGGGGACCATGACGTGGTGCTGACCGT
9   M08   T003244_01                  Rv3244c
                       CGCATCGATCGCCTACCCAACGGGGTTTTCCTGGACTGGCAGCAG
9   M10   T003245_01                  Rv3245c
                       GGGTAGAACGGATCCTGCGCAATCTGATTGCCAATGCCATCGACC
9   M12   T003246_01                  Rv3246c
                       AAGGATTTTGGTCGTTGACGACGACGCTTCGTTGGCTGAGATGCTC
9   M14   T003247_01                  Rv3247c
                       ATGAAAACGCGGCCGGGAAGGCAGCGGCCTGGGTTCAGCGGATC
9   M16   T003248_01                  Rv3248c
                       TCAACGTCAACGACTCGGTGACCAAGTCCAAATTCGACAACAAGTA
9   M18   T003249_01                  Rv3249c
                       GGATACGCGCTGCGCCTGGCCGACCGATTAGTGGACAACGTCCAT
9   M20   T003250_01                  Rv3250c
                       TGACTGGAGTTGCCCGGATTGCGGTGCGGCAAAGTCGGATTTCGA
9   M22   T003251_01                  Rv3251c
                       AACGGTGATGCCAGGGAAGGCTTCCCAGCCGGCACAGGCTGGGA
9   M24   T003252_01                  Rv3252c
                       GCTGGAGAATGACAAGTACTACCGCTACTGCACCTACATCTACATC
9   O02   T003253_01                  Rv3253c
                       CCGGCAGCGCCTATACCTTCTCTTATGCCACCTTCGGGGAGTTCTT
9   O04   T003254_01                  Rv3254
                       TCAATCGGGCCACCGCCAAGACCACCTATCCGGTGTGGATGATGA
9   O06   T003255_01                  Rv3255c
                       TTCGGTGTGGAAGTGATGGCCAACTCCGACAACGTGTTACGCGGT
9   O08   T003256_01                  Rv3256c
                       GTCATGCTGCGGATCGCAAACCAGGTTGTGGCCGCTACCAGGCTT
9   O10   T003257_01                  Rv3257c
                       GTTGAAATCGTTCGGCAACCGGATTGTCAGTATTGATCACCTCGAT
9   O12   T003258_01                  Rv3258c
                       TGTCCGCACTATGCAGTGGCGACGTTGACGTTCGTCTACTCGGAC
9   O14   T003259_01                  Rv3259
                       GAACGACGGGCCAAGGACACCGAGGAACTTGGTGAATTGCTGCAC
9   O16   T003260_01                  Rv3260c
                       CACCGACCAATGGCAGGACCGTGCGCTATGTGCGCAAACGGATCC
9   O18   T003261_01                  Rv3261
                       ACCGTGCCCAGGTGCCGACGCACAGCTTTGCTTTTGTCGGCGCTG
9   O20   T003262_01                  Rv3262
                       CTAGATCGGATGAAAGACAAGTGGCGGTCTGATCTCACCAGTGAC
9   O22   T003263_01                  Rv3263
                       AGGATGTTGATCTCCTGCTGAAAGCAAACGAGATCGACAAGGCGC
9   O24   T003264_01                  Rv3264c
                       TCGCCGACGGCGACTGCAAGATCTACGGCTATGTCGATGCCAGCT
9   B02   T003265_01                  Rv3265c
                       ATCACAAAAGCACCTATATCTTCTTAGCCGACCGACATTCTGGTTGG
9   B04   T003266_01                  Rv3266c
                       GGCCACGGCGCTGGCAGCACCTGCGAACTCAACTTCGATCGATCG
9   B06   T003267_01                  Rv3267
                       ACATCATGGATTTCGTCCGCCAATTGCAGAAGCTGGCCGGCGGTA
9   B08   T003268_01                  Rv3268
                       CAGATAGTTCCCGAACACAACCCCGGTCCGGTGCTTGCCGGTAGA
9   B10   T003269_01                  Rv3269
                       GACCGCCTACGAGATCTTAAAAAAGGCCGCGGCCAAAGCGCCGCT
9   B12   T003270_01                  Rv3270
                       GCGCGCCCACGCGGTAGGCAACCAAACCACCATCGGTCGCATCAT
9   B14   T003271_01                  Rv3271c
                       AGTTGCGGTGTCTTTTTGGCTGACGGCCCCCTACCTCGTTGCCGA
9   B16   T003272_01                  Rv3272
                       ACCGCCGATGGGTACATCGTCATCAGCGCATATGTGCCCAAACACT
9   B18   T003273_01                  Rv3273
                       CAGCTGGTCAAGCTGGCGCACATCAAACTAGCTTGGCGCACAGGA
9   B20   T003274_01                  Rv3274c
                       GGATGCTGCCATCGCCTACACCAAGGACCGCAAGCAGTTCGGTGA
9   B22   T003275_01                  Rv3275c
                       TCGACATTCCGGCCGAGGTTCGGGTTGTTTCGGCCCATCGCACCC
9   B24   T003276_01                  Rv3276c
                       CAGAACCTCCGTGTATTGGTCACCTCGGCAGATGACCCTGCCGCG
9   D02   T003277_01                  Rv3277
                       TCGGCCTACATTATTGGCAACTTGCTGCAAATGGCGTTCCGCTTCT
9   D04   T003278_01                  Rv3278c
                       ATCGAGTCCGCGTCACAAGATCCGCTCGAGTTCTACAACATTCCGC
9   D06   T003279_01                  Rv3279c
                       CGAGGTCGCGCAGCCGTTTGTGGTACTCGGTGTGGGACTCAACGT
9   D08   T003280_01                  Rv3280
                       TCACCGACGAGGACCTCGAATTGGATACGCTGATCCCGGACTCGC
9   D10   T003281_01                  Rv3281
                       ACGAAGTGAGTGACGGGAACGAGACGAACAATCCGGCAGAAGTGA
9   D12   T003282_01                  Rv3282
                       GCTGAAACAGCAATAACCACAGTATATTTCGGAACACCTTCGGCCT
9   D14   T003283_01                  Rv3283
                       CGAGGAATTGGAACGGCTCTATGACTTCATAAACCCGGACGACCAA
9   D16   T003284_01                  Rv3284
                       CCAGGGTCAAGACAAGCTGAGGCTGTTGCTGGAATTCGCCAACGA
9   D18   T003285_01                  Rv3285
                       ACCAGAAGCTGGTCGAGGAGGCGCCCGCACCGTTCCTGACCGACT
9   D20   T003286_01                  Rv3286c
                       CTGAGGTTATCGAAGGTTTGCTGGCGGGTAGTTCCTACCACACCTT
9   D22   T003287_01                  Rv3287c
                       CGGGTACACCATGATGAATCCCGACCATGTTGCGTTAGATCCCCAC
9   D24   T003288_01                  Rv3288c
                       CTTTCGGCACCGGACATCACGCCGAGGGCATGACCTTTGGTGTGG
9   F02   T003289_01                  Rv3289c
                       TGCACTCGGCGATTCGGTTTGCTGTTGTGGCCGCTGTCGTCGGGG
9   F04   T003290_01                  Rv3290c
                       GTTCATATCTGGTCGACGCTATAACGGGTCGGCGCTACCTGGACA
9   F06   T003291_01                  Rv3291c
                       GGCGAACGTGCGGACGCGAAGCACGATCATTCTGAACACTTTTTAC
9   F08   T003292_01                  Rv3292
                       CATTTCGCCCAATCGATGCGAACGAGCTGGCACACAACCCGTTTCG
9   F10   T003293_01                  Rv3293
                       CCGAATGCCGTCCCAGACCGCCATCGTGGCGACCGAAACGTTCGC
9   F12   T003294_01                  Rv3294
                       TCGACGCGCGCTTGGGGTTGGGCGGGGTGGAATTCATCCATTTCA
9   F14   T003295_01                  Rv3295
                       ATGACGATGTTCGAAGAGATACGAACCGGCGTGCTGGCCTATATG
9   F16   T003296_01                  Rv3296
                       ACCATCGTGTTCGCCAATTCGCGACGATTGGCCGAGCGACTTACC
9   F18   T003297_01                  Rv3297
                       TCGGGCGCGAATCATTTTGGAAGCCAACCAGCAAGAACAGGCCAT
9   F20   T003298_01                  Rv3298c
                       GGAGCTGCCTGACGTCGGGGACGGAACAATGGTGCACCTTTTCGA
9   F22   T003299_01                  Rv3299c
                       AGGACCTCGATTCGGCTCGTCACGATTTTCAAACCCTCGTCGATGC
9   F24   T003300_01                  Rv3300c
                       CGATGTCCCAGTGCTGCATCAAGACGCCGACATCGTCGTCGTCGA
9   H02   T003301_01                  Rv3301c
                       TATTGCCAAGATCACCCGACGCGAGTATCCGAACCAGGTGCTTCCT
9   H04   T003302_01                  Rv3302c
                       GATCACCGAGAAGGTCAGCCTGCTGGGCGCCGACGGTTACTTTGC
9   H06   T003303_01                  Rv3303c
                       TCACCGTCAACGAGCTGGCCCAGACACTGGCCGTTTACCCATCGT
9   H08   T003304_01                  Rv3304
                       AAGACCCAGATTCGAAGGTGTTCGTCGTGCTCTACGACATGACCCC
9   H10   T003305_01                  Rv3305c
                       GTCAACGAGGAAATCTCGACACGCATTCTCGCCCACGCTATTGAGG
9   H12   T003306_01                  Rv3306c
                       AGTATGCGATGCGTGCGGTCGAATCGGATTCGCTGCGCGAGCTGC
9   H14   T003307_01                  Rv3307
                       TCACCTGAACCTGACCGCACGTTCGCCACTGGTTGGCGGGGAGTT
9   H16   T003308_01                  Rv3308
                       GTGTCGGGATGGCGGATGCTGTCCGGTGACGAAACCGGTTGGCTA
9   H18   T003309_01                  Rv3309c
                       CAGAAGGCTGCGCCAAACGTGCGGTTGTTCACTGCGGCCATCGAC
9   H20   T003310_01                  Rv3310
                       ACTTACAACGAGACCATCAGCCACTACAACGTGCTGTCCACATTGG
9   H22   T003311_01                  Rv3311
                       CACCGGAAAAGCCGGCAATAAACGCTGGAATTCGATTGCCGAGGT
9   H24   T003312_01                  Rv3312c
                       CGCGCGATTCCGCACGTTGATTTGCACTGGGCGCACGGCAAGGGC
9   J02   T003313_01                  Rv3313c
                       GCCTCGAAATGCATCGTTTGGTAGAGGCTTTCGGTTATGGCTGGAG
9   J04   T003314_01                  Rv3314c
                       CCCGGCTGGATTTCACCGATCTGCCACTAGCGACCGTGGACAAGC
9   J06   T003315_01                  Rv3315c
                       AACGTGGAAAACGTCTCGTATGGCTTGACTTTGTGCGCCGAATGTG
9   J08   T003316_01                  Rv3316
                       CGGTCCTTTTTCACGCACTGAACGGGATTCGGGTCATCTTGATCGA
9   J10   T003317_01                  Rv3317
                       TGCGGTTTTCCGGTGTTGTGTTGGTGTTCCTGGCGATCGGGCACG
9   J12   T003318_01                  Rv3318
                       CAGCGATGTCCGCCTTGATTTCAAACCCGTCGTGCAGACCCGTTAC
9   J14   T003319_01                  Rv3319
                       TGCTCAACCTGCTCATCTACATCAAGGGCTACCTCGACGGCACGCT
9   J16   T003320_01                  Rv3320c
                       TCGACTCAAAGGTCATCGATCGTTCCCGCCTGCACAGCCCCAAACA
9   J18   T003321_01                  Rv3321c
                       CGACGATGTATTGCTGGCCGTGAAGGAACGGGCACGCAGGGAGAA
9   J20   T003322_01                  Rv3322c
                       GGAGAGCCAGCGTGTCTGCTTCCTGCCGACTTCACCGTTGTACAC
9   J22   T003323_01                  Rv3323c
                       GTACCGTGCGTAACAACAACAACGGCCACGAAGTGACCAAGTTGTA
9   J24   T003324_01                  Rv3324c
                       TTACGGTGACAGCGCTCACGGTTTACGACATGTGCAAAGCAGTCG
9   L02   T003325_01                  Rv3325
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
9   L04   T003326_01                  Rv3326
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
9   L06   T003327_01                  Rv3327
                       ACGGGCTGGACGTGGACAGGCTCACGGACATCGACAATTACGCCA
9   L08   T003328_01                  Rv3328c
                       AGGCACTGCGACAGCATCTCATGTCGGTCGCCTACAGGCTGACCG
9   L10   T003329_01                  Rv3329
                       GGTTGTTCGAACCGTTCAACGACGGCGAGACGATGTTCGCACACG
9   L12   T003330_01                  Rv3330
                       GCACCTTCGACTTCCCGGGGCACGGCGACCATCCAGGCTACGAGT
9   L14   T003331_01                  Rv3331
                       CGAGGAATTCGAACTCACCACTCGAGAACAGGAGTTGCTGACCAC
9   L16   T003332_01                  Rv3332
                       TCCGTGACGCCGAAGTGGTTGTCGCCGTGGGGCATACGGATGCG
9   L18   T003333_01                  Rv3333c
                       ATGCGCCTCTACCCTGTCCGCCTCACGACGACCATGACCCGATTTA
9   L20   T003334_01                  Rv3334
                       TCCGCGCGCAGATCGCCGAACTGATTGCCCTCGAAGGCCACTTGC
9   L22   T003335_01                  Rv3335c
                       ACGGCAGTCTTTTTGCGGCCGGACTCACCTACTACACGATCTTTGC
9   L24   T003336_01                  Rv3336c
                       GCAGCGCGCCCACGATGTGGCCAGCAAAACGGTTCAGCGAGTCTA
9   N02   T003337_01                  Rv3337
                       GCAGTCCGATACGCGTGGGTTCGGGAGAGCCGGTCCTACTGCTAC
9   N04   T003338_01                  Rv3338
                       ACGTCGAACGCCAGCTCGACGAACTGGGCTGGGAAACCAGCCATA
9   N06   T003339_01                  Rv3339c
                       TCAACGCGAAATGGCCGGTATATCTGTCCACCAAGAACACCATCCT
9   N08   T003340_01                  Rv3340
                       GATCCGACCGCGCATTGGTCGTTCGAAACCAAACAGATACACGCTG
9   N10   T003341_01                  Rv3341
                       CGGGCGCTACGCGGTGCAAAGTTATCTGGAACACCAAGGAGACAA
9   N12   T003342_01                  Rv3342
                       TTATCGACCTGGTGGCTTCGCGCAGCTATTGCATCACCTCACCGGC
9   N14   T003343_01                  Rv3343c
                       CCGATATTCAGCTCAGGCTCCATCATCGATCCATTCAGCCTTACGC
9   N16   T003344_01                  Rv3344c
                       TGGCGCCAACGGCGGTTCCAGCAACGGCAACGCTCGCGGTGGCA
9   N18   T003345_01                  Rv3345c
                       AATGCATCACCGCTGCAGGCGCTGGAGCAGCAAGTGTTGGGTGCG
9   N20   T003346_01                  Rv3346c
                       CAAGGGGATCGATTTCGTGACGACCGTGACGGTCGCGGCGGCCA
9   N22   T003347_01                  Rv3347c
                       AGGTCTCCATACTTCAACCATTCACCGTGGCACCCATCAACTTGAA
9   N24   T003348_01                  Rv3348
                       CACATCGCGATCCGCGATGATGTCGGTGCGAGGTCGATTCGATTC
9   P02   T003349_01                  Rv3349c
                       GCTCACCCTGGCCACCACCATTGACTAGTCACCCAAGATCAACACC
9   P04   T003350_01                  Rv3350c
                       GGCGGAGATGAGGATAGATCCCTTCGAAATGTGGACTCAAGGCAC
9   P06   T003351_01                  Rv3351c
                       TTGGGAACTTTGCCCAACCTTACGTGGTCGCGCTTAAAAGTGAACG
9   P08   T003352_01                  Rv3352c
                       ACATCGATGACGTTCGCGAGGTTCCCCACCGCGGACTGCGATGTC
9   P10   T003353_01                  Rv3353c
                       GCCAACGGCAGGGCGTTCACGAGCGGAAAGCAGATCTTCAATTCG
9   P12   T003354_01                  Rv3354
                       GACATGGCGCAAACCTTCACCAGTATCGCGATTTCGATGTACTGCC
9   P14   T003355_01                  Rv3355c
                       ATTTCGTGACGACCGTGACGGTCGCGGCGGCCATGGTCTACATCG
9   P16   T003356_01                  Rv3356c
                       CCACGCTGAATGAGACCATCGACGAACTGAACGCCAACCCCGACT
9   P18   T003357_01                  Rv3357
                       ATCAGTGCGAGCGAGGCGAGGCAGCGCCTGTTTCCACTCATCGAA
9   P20   T003358_01                  Rv3358
                       GGTTGATCGGAGAAATTCAGCGTGATCCGTTCAGCGGGATCGGCA
9   P22   T003359_01                  Rv3359
                       TCCGGATGACCGGCCATAGGTTTTTCCGCGAATACCCCTACCGCG
9   P24   T003360_01                  Rv3360
                       CTGACTATCAACATCGGGAAGCCCACCGGGCCGTGGATCACCTTC
9   B01   T003361_01                  Rv3361c
                       CGAGGGTCGGCGTTTCGTAATTGCACCTTCGAACGGACGACACTG
9   B03   T003362_01                  Rv3362c
                       CCGCATCACCTTGGGCGAGGATCTGGTGCTTTATCTATTCGGTACC
9   B05   T003363_01                  Rv3363c
                       CGACCGATCGACCCGCGACGAACGCCACGAACTCATAGGAAGGAC
9   B07   T003364_01                  Rv3364c
                       CCAGATCGGTTATGAGATGGCCATCCTTGTCGAGCGGGTGGGCGG
9   B09   T003365_01                  Rv3365c
                       CAAGAACCTGCAGCAGCAAATGGTGACCAGGATGGCGATCATGTC
9   B11   T003366_01                  Rv3366
                       TTCGCCTTCACGGCGCAGGCGACGACGTTGTTCACCAACGTCGGC
9   B13   T003367_01                  Rv3367
                       TCCAGCAGAATCTGCTGAACGCAATTAACGCGCCCACTCAGGCGC
9   B15   T003368_01                  Rv3368c
                       GCCCACCGGTTCCAATTCCCAAGGCTGGCAGTGGGTGTTCGTCGA
9   B17   T003369_01                  Rv3369
                       CGTTGGGCCATGAGCGTCGAACTGACACAAGAGGTTTCTGCCAGG
9   B19   T003370_01                  Rv3370c
                       TGAGATTTCCGGGCTACTTCCTGGTGGTGCACGACATCACCCGGT
9   B21   T003371_01                  Rv3371
                       TGGGAATGCTGGATCATCGAAGGCCTCAACGGCAACCGCTGGGCG
9   B23   T003372_01                  Rv3372
                       GACAAGGGGAAAACGCTGCTGTGGGTTCTTGACCATCTGCCGCAT
9   D01   T003373_01                  Rv3373
                       CGCGCTGCAACGCCATCGAAACGTTGCGTTGATCACGCTGAGCCA
9   D03   T003374_01                  Rv3374
                       AAAAGGTCGTCGCACCACAGGATTTGGCGGCCGCGACGGCCAAAC
9   D05   T003375_01                  Rv3375
                       CAAGCTACGACCACGTCGGGCCGATCACCCGTAGCGCTCACGATG
9   D07   T003376_01                  Rv3376
                       GTGTGCTCACCAGCTTTGACTGGACACGTGCCGAGGAGGATGTGC
9   D09   T003377_01                  Rv3377c
                       GTAACTATGATGATGCCCTATGCTCAGATGCGATTGGGTGGATTCT
9   D11   T003378_01                  Rv3378c
                       GGGCGTTTCAGCACTTTCGATTTTCCGCTGCTCAGCTCAGGAAAAA
9   D13   T003379_01                  Rv3379c
                       ATCACTACTTAACGCACTACATGAAGTCCCTGGACCCGAAGACCAT
9   D15   T003380_01                  Rv3380c
                       AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
9   D17   T003381_01                  Rv3381c
                       AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
9   D19   T003382_01                  Rv3382c
                       CGCTGCAATCGATGGTCGGTGAATGTGACGTTGTGTTGGTGATTG
9   D21   T003383_01                  Rv3383c
                       CGGCGGCTGTGGAGTTGGTGCACAACTTCACGTTGTTGCATGACG
9   D23   T003384_01                  Rv3384c
                       ACAAGCGCGTCCTCGATCTCGCTGGTGGGCTGCTGCCATTCGAGC
9   F01   T003385_01                  Rv3385c
                       TCCATACGAGCAGCTGCTGGCAAGCGGCGAGATCGAGCGTGCCAC
9   F03   T003386_01                  Rv3386
                       GGGTGGATGCGCTGCTCGATGATTCGGCGTTCTTCTGCCCGTTTG
9   F05   T003387_01                  Rv3387
                       GTCGAAGATGATCTCCACCAGCTCGGGGTGCGCAACGTGGCCATC
9   F07   T003388_01                  Rv3388
                       TGTTTGGCCAGCACGCCCAGGCCTATCAGGCGCTCAGCGCCCAGG
9   F09   T003389_01                  Rv3389c
                       CCGGAGATCTGGCGTTCACCACGGAGAACAGCCACGGCATCGACC
9   F11   T003390_01                  Rv3390
                       TCTCGCAGGGGGTAGCGATCATGATCTGGACGCTGATGAACGCAC
9   F13   T003391_01                  Rv3391
                       CTCGAACTGTCCGAGCGGACCATCGCCGAGCTAGGCGATATCGAC
9   F15   T003392_01                  Rv3392c
                       GCATCGTCAGCATCGGTGCTTTCGAACATTTCGGTCACGAGCGCTA
9   F17   T003393_01                  Rv3393
                       GACGCGCTGCGGTTCTACTTCGAGTCTCATGAGGCGCGCGGACAT
9   F19   T003394_01                  Rv3394c
                       ACGGATCTGTTGTGGAGGATGGGGATTCGCACCATCGGACAGTTC
9   F21   T003395_01                  Rv3395c
                       CTCCAAGGACGGGTGTTTACTGACTTCGAACATATTTTCGAACAGG
9   F23   T003396_01                  Rv3396c
                       TCGACTTCGGTGCCCAATATGCCCAGTTGATTGCCCGTCGGGTTCG
9   H01   T003397_01                  Rv3397c
                       CTCGATGCCATCAGGAAATCACTTGATAATATTGATGATTCATCCGA
9   H03   T003398_01                  Rv3398c
                       CGACGTCGCACTCGATGAGTGTCTCAAGATGGCTGAAGGCAAGAC
9   H05   T003399_01                  Rv3399
                       AGCAATACGCGAAAATGTGCACAATGTGCAATGGCGGAGGCACTA
9   H07   T003400_01                  Rv3400
                       CACACGTATGTGGACGGCAAGAAACGCGAAGACGGCGTTCGATCG
9   H09   T003401_01                  Rv3401
                       GGATTTCGAAGCCAACACCACTTATCCGTTGCTACTGCACGAGGCC
9   H11   T003402_01                  Rv3402c
                       CGATCCACGGCTCGTCGAGCACGCATACAAGTTCCAGAACTTCGG
9   H13   T003403_01                  Rv3403c
                       CCTTGCGAGCGATTCCGAACCCGCATTCACCTATATCAACGATTTC
9   H15   T003404_01                  Rv3404c
                       AGTCGTGGGATTCCTCGGGAAGTGTCTACGCCCGGCTGATGGACA
9   H17   T003405_01                  Rv3405c
                       CGAGCTGACCGGTGACGAACTACGGCTGTCCGTGAACGATGCGGT
9   H19   T003406_01                  Rv3406
                       TTCGTCGGGTTGGACAGCCACGAATCAAGGGTGTTATTCGAAGTG
9   H21   T003407_01                  Rv3407
                       TGAAGCCGGCGAGGAACTTGGCGTCACCAACAAAGGAAGACTTGT
9   H23   T003408_01                  Rv3408
                       CTCGCGGCCGCAGCCCAGATCAAGCGGGAACTGACAGCCTTCGTC
9   J01   T003409_01                  Rv3409c
                       CAACTCGATCACCACGTTCACCAAGCGCGGGAAGCTGGGTATCCG
9   J03   T003410_01                  Rv3410c
                       ATCGATGGCCAAGGCCGGGTATTGCGACCTCAAGGAGTTCCAGAA
9   J05   T003411_01                  Rv3411c
                       TTGGTGCTCGACATGGTGGGCAAACTCAAGTCCGAAGTCGGCGAC
9   J07   T003412_01                  Rv3412
                       TGTAGTGTGCTGCGACGAGTGCCAGCAAGACCACTATCACGACTG
9   J09   T003413_01                  Rv3413c
                       GGACCTGATCAACGAGGTGAACCTGCTGAATACCAAGGTGGAGAC
9   J11   T003414_01                  Rv3414c
                       GCCCGGGATGTGTCCGCTTCGTAACGTTGGAGATATCGCCGTCGA
9   J13   T003415_01                  Rv3415c
                       TTGCTGATCGATATCGGCACCGTCACGTTTTCAGCACAACAGCTGC
9   J15   T003416_01                  Rv3416
                       TCCCATGCGTTAGAGGTCGGTGAGCCCTATGGCGTTTGGGGTGGC
9   J17   T003417_01                  Rv3417c
                       TGCTGGAAAAGGTTGCAGGAACGGGTAAGCCACTACTGATCGTGG
9   J19   T003418_01                  Rv3418c
                       GACGTTGCGGAGGGTGACACCGTCATCTACAGCAAGTACGGCGGC
9   J21   T003419_01                  Rv3419c
                       CGTCTACGAACACGGGCCGCTGCCCGAGTGTGTGGCGTTGTTGGT
9   J23   T003420_01                  Rv3420c
                       ACTTTGCCAGGGGTGGTGTGGTCTACCTGGAGGTCCGCACCGATA
9   L01   T003421_01                  Rv3421c
                       TAAGCACCGTCTTGGCCATCGACACCGCTACACCGGCGGTCACGG
9   L03   T003422_01                  Rv3422c
                       CCACGTCGACGTCTACCGACTGCTGGACCACAACAGCGCCGACCT
9    L05   T003423_01                  Rv3423c
                        GGTTCTGGGAGAATGTCGGAAAGCCAAACGACACGACAGATGGGC
9    L07   T003424_01                  Rv3424c
                        GCCGCGTTGTCCAATGCCTGGGGGGTTGTGAAAATAAAAGACACG
9    L09   T003425_01                  Rv3425
                        TCCAATGGCTGTCTAAACACTCCAGTCAGCTTAAGCATGCCGCCTG
9    L11   T003426_01                  Rv3426
                        ACTCCCGTCAGATTTTGCGAACCGCCCGCGTGATCGAATCCCTCG
9    L13   T003427_01                  Rv3427c
                        AACCGCTGATCTTGACCAGCAACCGCGCACCGAATAACTGGTACG
9    L15   T003428_01                  Rv3428c
                        TCCGGTCATCCGGATGGACCAAACCGCTTGGTGTGCTTGCCATGT
9    L17   T003429_01                  Rv3429
                        GGCTGACTAAACACTCTCGTCAAATTCTGGAAACCGCCTACGTGAT
9    L19   T003430_01                  Rv3430c
                        CTGCGTGGCCCAGCAAAGTGGAGCTATTACTACCTGTATGTGATCC
9    L21   T003431_01                  Rv3431c
                        TGGGCACCGCTGTGGGTGACAGCGAGTCTTACGAGTTCTGGCGTG
9    L23   T003432_01                  Rv3432c
                        GAAAAGCTGATGGCCGAGACGTTCGACAAGAACATGATCGATAAGG
9    N01   T003433_01                  Rv3433c
                        TCGTCCTTGTCGATATCGGGCTGGACCTGGCGCACACCGACGTGT
9    N03   T003434_01                  Rv3434c
                        CGATCCGCTCGAGGTGCTGTTTTCCAGCCTGTTGTGGATCGACGG
9    N05   T003435_01                  Rv3435c
                        GACCTCGATGGTGCTGTATATCCTCTGCTGGTGGTGGCACCTGAA
9    N07   T003436_01                  Rv3436c
                        AAGCGGTCCGACACGCCAAGGAGCAGAAAGCCAAGGTGCTGGCG
9    N09   T003437_01                  Rv3437
                        ACCTACAACCTGCTCGTTGGTTGGTGGAGTTTGGTGTCGCTCCTCG
9    N11   T003438_01                  Rv3438
                        GGCGACAAGACTTATCGCAGGTTCGCCGATCCAGACCTGCAGCTG
9    N13   T003439_01                  Rv3439c
                        GGGGGCCGACGCGGCGGTGCACTTTGTGCAGCGTCACTGTGAGA
9    N15   T003440_01                  Rv3440c
                        TGAGACCCGATAGCGTAAACAGCGCCGGCATAGACATAGCAGCGG
9    N17   T003441_01                  Rv3441c
                        GGCATCAAAATCTTCGGGCCCGGCGGCCACAAATTAGATGACGAC
9    N19   T003442_01                  Rv3442c
                        CCGGCAAGTTCGACCTCAACGGCCGCAGCTTGGAGGACTACTTCC
9    N21   T003443_01                  Rv3443c
                        GCCGACAAGGTCGCCATCAGCGGCGACAAACTGCAGCACAAGATG
9    N23   T003444_01                  Rv3444c
                        TTTCAACGCTGCGCTGCAAGAGCTGAGGTCGCAGATCGCGCCGTT
9    P01   T003445_01                  Rv3445c
                        ATGTGAGCACACCGAACACGCTGAACGCCGACTTTGACCTGATGC
9    P03   T003446_01                  Rv3446c
                        TACAGGTCACTTCACCGGCCGATCCCGAGGTGGCGTTGCACGTCA
9    P05   T003447_01                  Rv3447c
                        TTTTGCGGACATATTTCTTGTCATCGACGGCTGGGCAAGCTTACGC
9    P07   T003448_01                  Rv3448
                        TGCTGCTACGAGCACGTTCAGCAGACACCAGAAGGTCACTGGTGT
9    P09   T003449_01                  Rv3449
                        TACGACGACTACGTGCTGACCGTAGGTTCGGTGAACGCCCAAGGC
9    P11   T003450_01                  Rv3450c
                        GGGGCACTCTACGTGCGAGTGGACGATGTCTGGCATCCGGTGTTG
9    P13   T003451_01                  Rv3451
                        TCGAGCCTGAGCCCGCTATTCGGTTCCAAGGCGATTGACCTGTGC
9    P15   T003452_01                  Rv3452
                        TCGTCAGTTCATTGCGCCAGCAGACCAACAAGAGCATCGGGACATA
9    P17   T003453_01                  Rv3453
                        CACCGGCTTGCCGCTGGCCTACTACGCGGCGCGGTACAACATCGA
9    P19   T003454_01                  Rv3454
                        ACGCGTGCTCGACCCTGATCATCTTCCCGCTGGTGGTCTACGGGA
9    P21   T003455_01                  Rv3455c
                        ATCCGGAATTCCTGCCGCTGTTGCGGAGGCTGGGTCGATTTCTGC
9    P23   T003456_01                  Rv3456c
                        CGCGTTGCACAACCGGCGCGAGGTGCTCAAGAAGCTCCGTGACAA
10   A01   T003457_01                  Rv3457c
                        GTACTGCACGAATTCACCACGGTGCCCGGGGTCAAAGAAGATGTC
10   A03   T003458_01                  Rv3458c
                        TTACCGGGTGTCGCAGTACGACATCGTCGACGTGCGGGACAAGTC
10   A05   T003459_01                  Rv3459c
                        ATGCCACCAGCAAAAAAAGGGCCGGCAACGTCGGCTAGGAAGGGC
10   A07   T003460_01                  Rv3460c
                        GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
10   A09   T003461_01                  Rv3461c
                        GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
10   A11   T003462_01                  Rv3462c
                        TGCCCAATGCCATGTTCCGCATTGAGCTGGAGAACGGCCACAAGG
10   A13   T003463_01                  Rv3463
                        GGACGCCAGGCGCTCGATATGTACTTCAACCTGGCTAACTACCGC
10   A15   T003464_01                  Rv3464
                        GCTATGCCATCGACCCGTCCACGCTCTACGACGAATTATGCTGGG
10   A17   T003465_01                  Rv3465
                        ATTACCCCGACCATCCATGTCGATTCCCGCGGACTGTTCTTCGAAT
10   A19   T003466_01                  Rv3466
                        GCAACCAGCAATACGACGGCATGTCACGGCTAAGTGGCTACCTGA
10   A21   T003467_01                  Rv3467
                        CCGCACCAACACCTTCCACCACCCCGAACGATTCCTCCACAACCAA
10   A23   T003468_01                  Rv3468c
                        ACATGCCTGACCTGTATGACGGGCGCAGCCAGGACAACATCAAAG
10   C01   T003469_01                  Rv3469c
                        ACGGTCGATTTGGCCGGAGACTATCTGGACTTTCTGCGCATATGTG
10   C03   T003470_01                  Rv3470c
                        CGGTCCCTGCGTCCTCGATATCGCGATCGATCCAGAGATCAACAAA
10   C05   T003471_01                  Rv3471c
                        CAGAAAATCCGGGCCCTAGGTTCAGTTCCGTTGACATTCTTGTGCG
10   C07   T003472_01                  Rv3472
                        GGATCCAGGCACTGTGTGCTCGGTACTGTTTGACGATCGACACCC
10   C09   T003473_01                  Rv3473c
                        CGGCGATCGCAACGACGCTTTCGCAGGGGCGGTCCTAGATTTTCT
10   C11   T003474_01                  Rv3474
                        AAGGGCGAACGCGATTTTAAAGACCGCGTCGGCTTTCTTCGCGGC
10   C13   T003475_01                  Rv3475
                        AGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGA
10   C15   T003476_01                  Rv3476c
                        TTTCATCAAGAACAAGGCCGATACCTACCTCGACCGCGAGCAGGG
10   C17   T003477_01                  Rv3477
                        TGATCCATGAGCAGTTTGTGACCACGCTGGCCACCAGCGCTAGTTC
10   C19   T003478_01                  Rv3478
                        GACCGCGACCAACCTCTTGGGGCAAAACACGCCGGCGATCGAGGC
10   C21   T003479_01                  Rv3479
                        ACACTCACCCTCAGTGGATACCGAGTGGTCTCGTTGACCAAAGGC
10   C23   T003480_01                  Rv3480c
                        CCAGCAATATCCGCTGGATCGACTGAAAGCCATTGGGGCTCAATAT
10   E01   T003481_01                  Rv3481c
                        CTCGACGATTCGCTGGAACGACTTAAAGACTGGATGGAGAAGAACC
10   E03   T003482_01                  Rv3482c
                        GTCGACCGTGACGGTGGACTTCGGGTCGCAATTCTGTCAGGGCGA
10   E05   T003483_01                  Rv3483c
                        ACACGTCAAAGCTGTGACGGCTGCCAAGATGGCATCTTGACGATTG
10   E07   T003484_01                  Rv3484
                        TCCGGGATACAACCACATCAAGATCAAAGAGGCGTACGGGCTGAC
10   E09   T003485_01                  Rv3485c
                        GATCGACTCGCAGGCCTGGCGGCGCACCGTGGACCTCAATGTCAA
10   E11   T003486_01                  Rv3486
                        GTTGCTCATCGACATGGTGGGAGCGATCGTGCTGACCAAACTCCG
10   E13   T003487_01                  Rv3487c
                        AGGCGTCTGTGCCGAGGTACGGGTTTGGCCCGGTCAGGCTCATCT
10   E15   T003488_01                  Rv3488
                        CTGCACATCCTGCACCACGCTGCCGACAACGAGGTGCACGGCGCG
10   E17   T003489_01                  Rv3489
                        GAACGACGCCGACGAGTGTCGGATCTTCCTGTCCATGCTCGGTAT
10   E19   T003490_01                  Rv3490
                        TCTGACCATCGGTTTCTTTTTGCACATCCCGTTCCCGCCGGTAGAG
10   E21   T003491_01                  Rv3491
                        TTCTGACCCCATCGTTTGGGCGTTCAACTGCGCTCTCAACGTGGTG
10   E23   T003492_01                  Rv3492c
                        GATCATCCCGGAGGCGAAGAAGCGTGAAGTGGTGGTCCAGGCCAA
10   G01   T003493_01                  Rv3493c
                        CTGAACGCCAACAACAACGTGGACAACCTCAAGGGTCTATTCCGGG
10   G03   T003494_01                  Rv3494c
                        CGGGTGGGCGTGATCTATCACAAGTCGATCGAACAGCTCCTGGTG
10   G05   T003495_01                  Rv3495c
                        TCTACTCGATCGTCAAGGCCCTCAACGACGACCGAAAGGATTTCGT
10   G07   T003496_01                  Rv3496c
                        TGGCTGGGCCGGGGATCACCAACTTCTACAACATCTATGACCCTGC
10   G09   T003497_01                  Rv3497c
                        TAAATAGGAAGCCAAGTAGCAAACACGAACGCGACCCGCTCCGCA
10   G11   T003498_01                  Rv3498c
                        TGCTGGGTGGGCTACGGCCGGTGCTGAAAGGCTTTGACGCTGACA
10   G13   T003499_01                  Rv3499c
                        TGCTAGCCACCATCGGTCTGTCTAATAACGCCTATGAGACGTTGGC
10   G15   T003500_01                  Rv3500c
                        CTCCGACCTGTTGTGGTCGTTTATGCAAGCCATCGCTATGTCGATC
10   G17   T003501_01                  Rv3501c
                        CGCGTTCATCTGCCTTTTCGTGATCAACGTAGTCATGACCGCTATA
10   G19   T003502_01                  Rv3502c
                        GCTGCGGGACTACTTTGCTGGTCGGGATCCGGAACAGAGCTTTTC
10   G21   T003503_01                  Rv3503c
                        ACCGATGTGAAGGCAACGCGGTGTGCTTGGGAATCGCACCGGATA
10   G23   T003504_01                  Rv3504
                        TCAACAGCGTGGCGCCGACGATCATGGCCTACGGAACCGACGAGC
10   I01   T003505_01                  Rv3505
                        GGTGTGCTCGAGCGCGGACTGCAAATGACGGCCGAATATGCGCGC
10   I03   T003506_01                  Rv3506
                        CCTGGCCGACGTCCGCCGTTATGGCGCCACTTACGCCAACTACGT
10   I05   T003507_01                  Rv3507
                        TCTGTTCTCCCAACACGCCCAGGGCTACCAAGCGGCGGCCGCTCA
10   I07   T003508_01                  Rv3508
                        CGACAACAATTTCAACGGCGGCCAGGGTGGTGCCGGCGGCCAAG
10   I09   T003509_01                  Rv3509c
                        TCCTTGATATATCGCGTCCCACAATGGATTTCGTCAAGATCGCCGA
10   I11   T003510_01                  Rv3510c
                        TCGCGACTTTCTGCACGGCAACGCTGTGCGGGTATTCAAGCTGGA
10   I13   T003511_01                  Rv3511
                        TTCGTGCAGACGTTGCGCACCGGAGCGGCCTCGTACATGTTGGCC
10   I15   T003512_01                  Rv3512
                        GTAACGGCGGCAACGGAGCAGATAACACCGCAAACATGACTGCGC
10   I17   T003513_01                  Rv3513c
                        CATCTAATATGTGCCGGCTTTCTGGTAATGCCGCAACGAACCTGGA
10   I19   T003514_01                  Rv3514
                        ATGTCGTTCGTGTTGATCGCACCGGAATTCGTGACAGCAGCCGCG
10   I21   T003515_01                  Rv3515c
                        GTGTGCTGTTCGGTGGAACCGACTTTGCGACAGGAGAGTTCGTCA
10   I23   T003516_01                  Rv3516
                        GAAAACGAGGCGTTCAAGATCGACACCCAGATCGGCATCAAGGTC
10   K01   T003517_01                  Rv3517
                        TGGATTACGAGGGCGACCATCACCGGACCGACCGCAGAACGTTCA
10   K03   T003518_01                  Rv3518c
                        GTGACATTCCTCAGTTCGCATGTGTCTCAAGAGGATTTCCAGATCA
10   K05   T003519_01                  Rv3519
                        GCCGCGTTCATCCATCATCTGCCGGTAGATCAGGTGTTCACGCTTG
10   K07   T003520_01                  Rv3520c
                        CACGCAAGTGGTCGATGAGGTCACCAAGTTATTTCGGTCTGGCCG
10   K09   T003521_01                  Rv3521
                        CAACATCGAGTACTTCCGCCCCACCGGCGAACCGGATGCCAACTA
10   K11   T003522_01                  Rv3522
                        GATTCTGGTGTTCGGGTTCGTCGGATTACCTGGCTGGACGAGCAT
10   K13   T003523_01                  Rv3523
                        TACCGCCGGGTCCTGGCATTAGCCTGGGAAAAGCAGTCGGAATCC
10   K15   T003524_01                  Rv3524
                        ACTGGAGCTGCAGTCGTTGTCGTGGTGACCCTCGCAGCCATTGGT
10   K17   T003525_01                  Rv3525c
                        GCGCCGGCCAAGGTGAAGGGACCGATTGAAGGAACGGGCGCGGA
10   K19   T003526_01                  Rv3526
                        GAATGCCGAGGTAGAGAAGAACTTGAAATCGAGAGAAGTTTCCGAC
10   K21   T003527_01                  Rv3527
                        TCACAACGATTCCCCCGAGCAACACCGCACATGTGGATCCTGGTCG
10   K23   T003528_01                  Rv3528c
                        GCTGATCTCGAATCAAAAGCTTCTGAACTCGGTTTCAAGCTGCTCT
10   M01   T003529_01                  Rv3529c
                        CTTGCATTTCATGGCGGCCTACGAGTTGGAGGAGTGTTGGCAGCT
10   M03   T003530_01                  Rv3530c
                        TATCTGGGGTGACACGCTGAAAAGCTATTTCGACCATCAGGCCGG
10   M05   T003531_01                  Rv3531c
                        GACTTCGACGCCATCCCGGCGGCACTGCCGCATTACCAGCACAAC
10   M07   T003532_01                  Rv3532
                        ACTGGCTGGGAAACCTCCTGGAAGAAATCGGAATACTGCTGCTGC
10   M09   T003533_01                  Rv3533c
                        GGCGCCCAAACGGTGGGTATCGCAAACTCGGGCGTCTTAAACTCC
10   M11   T003534_01                  Rv3534c
                        AGACCAGCTCATCGACATCGCGCTGGAAATCAAACGCGAGCTGGA
10   M13   T003535_01                  Rv3535c
                        ATCAGCACCGATCTGCTGTACAAGCTGCTGCGATCGGAGTGGCTG
10   M15   T003536_01                  Rv3536c
                        GCGTGGTGGGTCATAAGGTCGGGCTGTCGTCGCCGATCATGCAGC
10   M17   T003537_01                  Rv3537
                        TTCGATCATCGTCAACATGTCAGGCAAGCGATTCATGAACGAATCG
10   M19   T003538_01                  Rv3538
                        GAATTCGCCGCTGCCGCAGGCTTTCCCCGGCCTATTCTGCATGGC
10   M21   T003539_01                  Rv3539
                        CCAGTACAACACCAGCGTGGTTTATAGCCAGTACGATATCTGGGCC
10   M23   T003540_01                  Rv3540c
                        TTTACCCTGATTCAGTTGGAGGAGTTGGGATTCTGCGGCAAGGGC
10   O01   T003541_01                  Rv3541c
                        GGTGGTGGGCCGCAATACCCTTGGCGACCACGTGACCGCGACGG
10   O03   T003542_01                  Rv3542c
                        TATGCCGGTACGAGCGACCTATATCGATTTCCCCGACTGGAGCCTC
10   O05   T003543_01                  Rv3543c
                        CATCTGGCTGGCCTGCCGCACCGACCCGAATGCCGCTAAGCACAA
10   O07   T003544_01                  Rv3544c
                        GGGATGGACGTCACGTATCCGATGCACCGCTACTACTCCACGATC
10   O09   T003545_01                  Rv3545c
                        GCGTACAGATTAAGAAGGGTCAGCGGGTGGTGATGTTCTACCGGT
10   O11   T003546_01                  Rv3546
                        GAACAGGTCATCGGCGGTTGCGTGACCCAGTTCGGGGAGCAATCC
10   O13   T003547_01                  Rv3547
                        CTCAGCGACTTCTTTATCAAGTGGATGTCACGGATTAATACCTGGA
10   O15   T003548_01                  Rv3548c
                        GAACGTCTCACCCTTGGTGGTATGGCTGGGCAGTGCGGAGTCCCG
10   O17   T003549_01                  Rv3549c
                        ACTTCCACCGAAAGATCGTCGAGCTCAATGTGCTTGCACCGCTGCT
10   O19   T003550_01                  Rv3550
                        AACTTCATCGACGTGCAACGGGTCAATGCGAGTTACCGGATGGAG
10   O21   T003551_01                  Rv3551
                        TCTCGGTGACAGCCACGGCAATGCGGCCTACACCGGCATCGACCC
10   O23   T003552_01                  Rv3552
                        CACCATCAACCACGCCACCAGTTACTGGGTGGGCAACCACTGCAA
10   A02   T003553_01                  Rv3553
                        AGAGCTGATCGAGTCGATCGTGCTTGACGCCATCACACATTTACAA
10   A04   T003554_01                  Rv3554
                        TCACACGGCTCGCTGTGGGTGCTGCCGTTGCGCTGGTCGATGGTC
10   A06   T003555_01                  Rv3555c
                        CGACCTGGGCTACGAGCAATTGCGAGTCGGTGTCGAGTATGACGG
10   A08   T003556_01                  Rv3556c
                        GCGAACAGTTCGGGTTCACCTCGCCGACCAACGAATCCAAGCAAT
10   A10   T003557_01                  Rv3557c
                        GCAGCCTGTATCACCATTTCGCCTCCAAAGAGGAGATGGTCGATGA
10   A12   T003558_01                  Rv3558
                        GAACACGGGCCTGTTTAACATGGGCACCGCCATATCGGGGTTGTT
10   A14   T003559_01                  Rv3559c
                        GTTTCTGGCCAGCGACTACTCGAGTTACCTGACTGGTGAGGTGATT
10   A16   T003560_01                  Rv3560c
                        GAGTGGCAGCGGCTATATCTATTCACCCGCGCCGACACCATCTAC
10   A18   T003561_01                  Rv3561
                        GTTCGTCGACGTACTGCCGCGCAACGCCGCCGGTAAGGTGAGCAA
10   A20   T003562_01                  Rv3562
                        GCGCAACACCGTTATTGGGACCGAGTACTGTTCGACGCGGGCCTG
10   A22   T003563_01                  Rv3563
                        AGCGCACGCAGTTCGGCCGGGCGATCGGCTCGTATCAGGCCATCA
10   A24   T003564_01                  Rv3564
                        ATCACCTGGGAACACGACATGCACCTGTATTTCAAACGAGCGCACG
10   C02   T003565_01                  Rv3565
                        CAGCTGCGCCTGGCAGACGTCGCGAAACGCGGTGGTAGTCAACAG
10   C04   T003566_01                  Rv3566c
                        TCGCATCAACTATCGCGGCGCTACCGATCCAACCCTGGATGTTCTG
10   C06   T003567_01                  Rv3567c
                        TCAGTTCTGTACGGGGATCACTGTCATCACCACTGTGCACGACGAC
10   C08   T003568_01                  Rv3568c
                        ATGTGGTGCTGTCCACCCGCGACGATGCTGAGGCGTTGCATTTCT
10   C10   T003569_01                  Rv3569c
                        TTGGGTGCAGGTGGAGAAGTTCGACGAGTTCAACAAGCTGACGAT
10   C12   T003570_01                  Rv3570c
                        GCGCAGCGAATACGAGATCAAGGACGTGTGGTACGTGGTCGGCTT
10   C14   T003571_01                  Rv3571
                        TGAGGGACTGATTTTGGCCTGTCAATCTCGCCCGGAATCTGATTCG
10   C16   T003572_01                  Rv3572
                        CATGCAGGTGGTCTACCCGGGGGTCAACCTCACCTCGCCCAGCAC
10   C18   T003573_01                  Rv3573c
                        ACCTACTTCCTGGTGGACATGACCACACCGGGAATTGAGATCCGAC
10   C20   T003574_01                  Rv3574
                        TGGCCAACGGCGAACCAACCGAGGACCAGTACCACATAGCGCGGG
10   C22   T003575_01                  Rv3575c
                        TCCCGCACCACTGTCTCGAATGCTTTTAACCGACCGGATCAGCTCT
10   C24   T003576_01                  Rv3576
                        ATCGATGAAGGTGTGGTTCAACGCCAAGGCAATGTGGGACTGGAG
10   E02   T003577_01                  Rv3577
                        CGCCGTCCCAGGTGAACCAATCCAGTTGGGCGCCTTCGACGTGAC
10   E04   T003578_01                  Rv3578
                        TGGTCGCGTTTCTGGGTGCGGTTCTGGTGCTGGCTAAGCTGTGCG
10   E06   T003579_01                  Rv3579c
                        AGATGGCACTGACTCGTTGGTGGTGGTCGTTGGGTCGGAAGGCAA
10   E08   T003580_01                  Rv3580c
                        GCACTACCGGTCGATGCTCGAGTTCTCCGAGACCGCTATGCAGGA
10   E10   T003581_01                  Rv3581c
                        GATCACCCAGCATGGCTATCGGGTCGGCAACGCTGTGGTGCAGGT
10   E12   T003582_01                  Rv3582c
                        GGGACGGTTATGCCGCCGTCGTTCCCGTACTGCCGCTTTCTGACA
10   E14   T003583_01                  Rv3583c
                        ACCCGGACCATCAAAGGGGAACAAAAAGAGTATCTCGTCTTGAAAG
10   E16   T003584_01                  Rv3584
                        GTTCGAGAAGGCCGGTCAGGGCAGCGTAATGGTGCCGATCTCGGC
10   E18   T003585_01                  Rv3585
                        GACCGCGTTCGCTAGAGCACCTCGTCGACGTTGTGCTGCATTTTG
10   E20   T003586_01                  Rv3586
                        CGGCAACTGTCCAGGGCAGAAATCGAGGACTTCGTCACGCTGCGC
10   E22   T003587_01                  Rv3587c
                        ACGTTTACTCGCTGGACAACAAGCGGTTGTGGTCCAACCTGGACTG
10   E24   T003588_01                  Rv3588c
                        TCGAGCAACGACATGTACACGAGACGGTGGCGATCCTCATGGCGC
10   G02   T003589_01                  Rv3589
                        GCTTACACGAGTGCGCCACCGTCATCGCCCGCGACCACAATGACG
10   G04   T003590_01                  Rv3590c
                        ATGTCGTTTGTGATCGTGGCGCCGGAAGCGCTGATGTCGGTGGCT
10   G06   T003591_01                  Rv3591c
                        GATGGTCGGACATTCGATGGGAGCCTTGCATTCGTGGTGTCTGGC
10   G08   T003592_01                  Rv3592
                        CCCGGGTTTCCTCGGCTTTCAGCTGTTACGTCCGGTCAAGGGTGA
10   G10   T003593_01                  Rv3593
                        GTGTCCTGGGATGATCTGCTGACGGTCACCGCCAAAAGCAAAGCC
10   G12   T003594_01                  Rv3594
                        ACGCAATATTGGGCACAAAGAGTATGCCGGGGCGGCTCAAGGCAA
10   G14   T003595_01                  Rv3595c
                        ATGTCGTTTGTGATTGCCGTTCCGGAGTTCCTGTCGGCGGCGGCC
10   G16   T003596_01                  Rv3596c
                        TGAAACAGAAGGTCAACGACGAGCTGAAGAAACACTTCCGCCCGG
10   G18   T003597_01                  Rv3597c
                        GAATTCGGGCTTGACGGGGTGACCTATGAGATCGACCTTTCCACTA
10   G20   T003598_01                  Rv3598c
                        TCGAACTTAATCGAGTGTTCCGAAACGAAGGAGCCGATTCCACGCA
10   G22   T003599_01                  Rv3599c
                        CCCGCCGCCGACAGGCTCGACGCCACCCACGAGCGTCGGCGTGA
10   G24   T003600_01                  Rv3600c
                        TGGCCGCCTATGACCGGTTCCGGAAGGCCGCCATCGTCGTTGACT
10   I02   T003601_01                  Rv3601c
                        TGTGATTGGCATCAACGGTGCCGCCGCGCACTTGGTGCATCCGGG
10   I04   T003602_01                  Rv3602c
                        GCTGCCCGGCTTGGCACCACCAGGCTGCTGGACAACATTGCGATT
10   I06   T003603_01                  Rv3603c
                        AAACGATTGTGGCGCACACCTCCGGAGCTAACGGGATTGGCATTC
10   I08   T003604_01                  Rv3604c
                        GCTGGTCCTGGCGATTGGGGCCAGTTCCGCATTGGTTTTCACCGA
10   I10   T003605_01                  Rv3605c
                        GGATATCTGTTGGTGGCGGTGCTTTACCGGTGGTTTCCGCCGATC
10   I12   T003606_01                  Rv3606c
                        TGTGCGGTTGTTTAGGCCGTCGTTCGATCTGAATAGCAGACACCCC
10   I14   T003607_01                  Rv3607c
                        GGTTTGTCATCGATGTCACCGTGTGGATAGACCTGGCCGAGGCCG
10   I16   T003608_01                  Rv3608c
                        TGCTCGATCCCGGGCTTGGATTCGCCAAGACGGCGCAACATAATT
10   I18   T003609_01                  Rv3609c
                        AACTCGATCCACGCGGGGTAATCGTGGTGATCGAGGCTGAGCATC
10   I20   T003610_01                  Rv3610c
                        TCGACGATCGCGAGCAACAGCTGCGGCTGATCCTGAAGAAGGGTA
10   I22   T003611_01                  Rv3611
                        TGCAGCGGGTCGCCACTGGCTAGACCAACGACCGGTAGTTCCCGA
10   I24   T003612_01                  Rv3612c
                        CAGGTCCGGTGCACCGCGTGTTTGACCCGAACGCTCAGCTGTCGG
10   K02   T003613_01                  Rv3613c
                        GAACCACGTTCGCGCGCTGGATGACTCAATTGACCCGAGTTCTGC
10   K04   T003614_01                  Rv3614c
                        CGCGCTTTTTACCGTGACGAATCCCCCACGCACGGTGTCGGTATC
10   K06   T003615_01                  Rv3615c
                        GCTCACAGTTCAACGACACGTTAAATGTGTACTTGACTGCCCACAA
10   K08   T003616_01                  Rv3616c
                        ACATCATCAAGGGCACCCTCGGAGAAGTGTGGGAGTTCATCACAAA
10   K10   T003617_01                  Rv3617
                        GCACAGGTGCCGCCGACGCAAGCGTTCCGCAGCAGGTTTGGGGA
10   K12   T003618_01                  Rv3618
                        TACGGGTTACCCGACTTCTCGAGGTACTTCGGCGCGGCAGGGTTT
10   K14   T003619_01                  Rv3619c
                        GTCGCTGGAGGCCGAGCATCAGGCCATCATTTCTGATGTGTTGAC
10   K16   T003620_01                  Rv3620c
                        ATGAATCAGGCGTTTCGCAACATCGTGAACATGCTGCACGGGGTG
10   K18   T003621_01                  Rv3621c
                        CAGCGGGGCCGCAAATGCGCAAGCACTCACCGACATTCCTAAAGC
10   K20   T003622_01                  Rv3622c
                        CTGATTTGGTGTCCCTGCTAACCGCCTCCCAGTTTGCCGCGCATGC
10   K22   T003623_01                  Rv3623
                        ACGTTGATCGCTGACGTCGGCATTCAGGTCACCGCGGCCGACGTC
10   K24   T003624_01                  Rv3624c
                        ATCGCGTACGTGGGTTTCGACATTCCCAACGACTTCGTCGTGGGC
10   M02   T003625_01                  Rv3625c
                        CGGAAACAGCTCGCATACAAGCGATTTCGCTGGGATGTGTGGACG
10   M04   T003626_01                  Rv3626c
                        GCGAGCCGTGCAATCCGAGCCGCAACGTAAGGCCTTAGACCAGCT
10   M06   T003627_01                  Rv3627c
                        CGGTCCCAACGGTCGCAACGCGATGGACGCTCTGGCCACTAAGTT
10   M08   T003628_01                  Rv3628
                        TCGAAATTCCCAAGGGCCAGCGCAACAAATACGAGGTCGACCATG
10   M10   T003629_01                  Rv3629c
                        CGTTTTGGCAGCGGATGTTCCTGACCATCGGGATTCTTATTGCGGT
10   M12   T003630_01                  Rv3630
                        CTTGCTGAAGCTAACCTCCAATGAACTGGGCGCGCAGGGAGGCGT
10   M14   T003631_01                  Rv3631
                        AGGCCAACCGCTGCTCAACGGCGTCAACATCATTTTCGACGGGTTT
10   M16   T003632_01                  Rv3632
                        GCGTTCAGTTTCACCACACTGAGCACCTACATGCGGTTCAAGGACC
10   M18   T003633_01                  Rv3633
                        AGTTGGTGCGCTGCTTTGAACCTCGGCTACAGGAACTGATCGGCT
10   M20   T003634_01                  Rv3634c
                        CCTTTCGACATCTCTACGGCCTGGACTGCTCGCATATCGCACCGGC
10   M22   T003635_01                  Rv3635
                        CGGCCGTGTTGTTTTTGACCAGCAGCCTGTATTCGACCGCGACGT
10   M24   T003636_01                  Rv3636
                        GTGTTGAAGATTTCGCGGAACACGGTGAAGTCGGCGTTGGCCTCC
10   O02   T003637_01                  Rv3637
                        CGTTGAGGTCGAACAACGTCTCCTGACCACCTACGACACCGTGTTG
10   O04   T003638_01                  Rv3638
                        CCCTGCAATCTGAACTGATTCGGCTGGCCCGATACCCGCTGCTGG
10   O06   T003639_01                  Rv3639c
                        TGCCATCGCTGCGGACATCGATGAAGCACTCCGTCACGGCTACGG
10   O08   T003640_01                  Rv3640c
                        CGCTCGGGCACATCGAGTTCCCCTACGTCTACCTCGACGCCACCT
10   O10   T003641_01                  Rv3641c
                        CGCCAGCTGTTCCAGGACATTTACGTCTGGGCGGGAGATCTGCGG
10   O12   T003642_01                  Rv3642c
                        TTTGTCCAGGCGACCGAGTTGCAGAAGGTGAAGCGGCGCTTCAGG
10   O14   T003643_01                  Rv3643
                        CGAGTATTCGCGCCCTATCCGCGCCTTCAGGCCATTAAAGAGCAAC
10   O16   T003644_01                  Rv3644c
                        AGCGGTCAACGTCAAACCGAAGTTCGCCGTCGATGCCATGGTCGC
10   O18   T003645_01                  Rv3645
                        GCAGGATCTGCCACCGGTCAACCTACTGATCTTCGTCAGCACGGT
10   O20   T003646_01                  Rv3646c
                        GCATCGCCCAGCGGCTGTACGAAAACGGCTACATCACCTATATGCG
10   O22   T003647_01                  Rv3647c
                        AGATGATCCAGGAGGCTGGTTTGGTACCCGAGGTCGCCCGTACCG
10   O24   T003648_01                  Rv3648c
                        GTCCACTACACGGAGATCCAGGGAACGGGCTTCCGCACCCTTGAA
10   B02   T003649_01                  Rv3649
                        TGACACACCTATCGGTGCTTCGAAACCATGCGCGCTGGGCTGTGC
10   B04   T003650_01                  Rv3650
                        TTCACACCCGGTTCATCCGTGCGCGCTCCCGACATCCGCAGCAGG
10   B06   T003651_01                  Rv3651
                        CTGACCAGCATCACTCCCAAGCACGATCGCGTCATCCGCACCGAA
10   B08   T003652_01                  Rv3652
                        TCGACAACGGCGTTGCTGACCGCCGGCGCCGACGAAGTGTCGGC
10   B10   T003653_01                  Rv3653
                        TATTCGGAATGCACGGCCAGACCTATCAGGCACTCAGTGCGCGGG
10   B12   T003654_01                  Rv3654c
                        AGCACGCGCAGTGCAGGGTGGTGGACCTCGACGTGGTCGTCACC
10   B14   T003655_01                  Rv3655c
                        AGTTTGTGGTCGCCACTGTCACAGCACACTCAAACCTGTTGCCTAC
10   B16   T003656_01                  Rv3656c
                        CGTCACCGGGGATTCCATTGTGTCGGCGCTCAACCGCATCATCGG
10   B18   T003657_01                  Rv3657c
                        TCTGTGTGTGGGCATTGTCCCGCTAGTAGTCGGGCTGGCCGGTGA
10   B20   T003658_01                  Rv3658c
                        GATCACGGCTTGGCGATAGCCAGTTTGATGCGTGCCGCCCAACGT
10   B22   T003659_01                  Rv3659c
                        ACGACGGAAACGGATTGCGACGCAGCCAGATTCGGTTTGCTGACG
10   B24   T003660_01                  Rv3660c
                        TCTGCGATCTTCCACGTCGTCTGACCGATGCCACCCAAGCAGCGC
10   D02   T003661_01                  Rv3661
                        TGGACAAGACCATCATTGCCAAGTCCAGCACACTGGCGTTCAGCAA
10   D04   T003662_01                  Rv3662c
                        GTCGCGGCTGGTGACAATCGCCACCGGACTGGATCCGCACGGGC
10   D06   T003663_01                  Rv3663c
                        TCGGCTATGTTCCCCAGGATCCGATGACCAACCTCAATCCGGTTTG
10   D08   T003664_01                  Rv3664c
                        CCGCCATCGTGCTCATGCAAGTCATGCATCACCGCACGGTGTGGA
10   D10   T003665_01                  Rv3665c
                        ACTTGTCATTATTGCGATCCCCATCTTCGTGCTGGGCTTTCTGGCG
10   D12   T003666_01                  Rv3666c
                        GACATGCCAGTTGTGCCGCTCTGGGATTACATCAGTGTCGTCGGA
10   D14   T003667_01                  Rv3667
                        ACGTCAGGCACCACCGGCAAGCCCAAAGGCATTATGCACACCAGC
10   D16   T003668_01                  Rv3668c
                        ATCTGCTGGTCGGGATGATCCACGGCGCATTCAGCGACAATCTGC
10   D18   T003669_01                  Rv3669
                        GCAGTGTTTTCTTCATCTCCTCGCTGGTGGTCGGGTTCTACTCCAC
10   D20   T003670_01                  Rv3670
                        CGAAGAGGCGCCGGAGGAAGTCAACCGACATCTGATGCGTTTCCT
10   D22   T003671_01                  Rv3671c
                        TCAACAATCCGGTGGTGGCGGCCACCGAGCCAAGTGTCGTCAAAA
10   D24   T003672_01                  Rv3672c
                        GGACACCGGTGACATCCGCGAGTTGGACGCGGCAATGGTGCTGAT
10   F02   T003673_01                  Rv3673c
                        AACAACCCCCGCTGAGACCGCAATGACGACGTTAACCGGAAAGAC
10   F04   T003674_01                  Rv3674c
                        CGCTCGAGCTAGCCGTGGCAACCATACTTTCGGCGCAGAGCACCG
10   F06   T003675_01                  Rv3675
                        TCTCCTTGTGTCATGGTTGCTCGTGGCCTGCGTTCCTGGGTTGTTG
10   F08   T003676_01                  Rv3676
                        CTGGATCCGCCTTGAGGGCAAGAGTGTGCTGATCTCTGACTCCGA
10   F10   T003677_01                  Rv3677c
                        TGCGACGTGATGGGGAGACGCTGACCGACGGGGAAGTGATCGAC
10   F12   T003678_01                  Rv3678c
                        GTTGATTCGCTGGTGGATCTCGACGCGGTGACCCGGGTGGTCAAA
10   F14   T003679_01                  Rv3679
                        TGCTGCTCACCGGCAAGATCAAGGAGACGGTGGTGCGCCTCGACA
10   F16   T003680_01                  Rv3680
                        AAGAGTACATGGCTATGGAGAAGCTGGGCCAACTGCTAAGCCAGG
10   F18   T003681_01                  Rv3681c
                        GCGTGGGTATCCAAGGCGCTGTGCCGGACTACCGACCCTGACGAA
10   F20   T003682_01                  Rv3682
                        CGGATGGCACTCACGCTGGACAAGACCTTCACAAAATCTGAAATCC
10   F22   T003683_01                  Rv3683
                        TGTTCGGCAGCAACGACTACTTTGGGCCGCGCCTGAAGAACCCAA
10   F24   T003684_01                  Rv3684
                        GAGAATTCCGCGTTCTTCCCCGCGTACTCCGAAGGCCGGTACGAC
10   H02   T003685_01                  Rv3685c
                        GCTGTCTGGGTGCGAACTTTTCGATGCGAGAGTTGATCACCGTATT
10   H04   T003686_01                  Rv3686c
                        CGGTCATGGCACCTTGGTGCCGGGTGGCCTATATCGCGCATGGCC
10   H06   T003687_01                  Rv3687c
                        GCACGGGGTTCGGTAACCAGAAGGCCGATTCATCTGATGGGTCTG
10   H08   T003688_01                  Rv3688c
                        ACGACGAGGTGATCAAGGTGTTGGCCAGGGAATCGCGCAAGCGTG
10   H10   T003689_01                  Rv3689
                        GACACTGAGACCTACATTGAGAAATGCACCGACCGCCGACAGGAT
10   H12   T003690_01                  Rv3690
                        GGAGAAGGGATCCTCGATACCTGGCGGTTGGTTCACCATCACCGT
10   H14   T003691_01                  Rv3691
                        CTTTCCGACCTGATTCCGGAGAACGTGCACTGGACCATCTGGCAAT
10   H16   T003692_01                  Rv3692
                        CCGAAGCCCAACTGGATCGTTTCCTGCTGAAACTGAATGTGACACT
10   H18   T003693_01                  Rv3693
                        GCTGGCCAAGCTGCGGGAGATCGACGGGCTGTTACCCACGTTGAT
10   H20   T003694_01                  Rv3694c
                        TGTCTGTTGTGCTGGGGCTGCCGATACCGCTGGTGCTCTTCGATA
10   H22   T003695_01                  Rv3695
                        CGCGCGGTCAGCGCGGTCATCGATATCACCATAATATTCATCGGCT
10   H24   T003696_01                  Rv3696c
                        CGTGCGATCGAATAACGGCCTGCTAACCACGGTGTGCTACCAATTC
10   J02   T003697_01                  Rv3697c
                        GTCGATGTTCTGGTCCATGCGACGCACCGAGCCAGCCCGTTTCAC
10   J04   T003698_01                  Rv3698
                        GGATGCCATCGCCGACCCGGCGTACCAGACCGAATTAGGCGCTTA
10   J06   T003699_01                  Rv3699
                        GCAAATACTGGAAGATCGACGAAATCCGGCCCGCCTTCATTCATGT
10   J08   T003700_01                  Rv3700c
                        GCCCAACAACTCGGATTTGGCGAAGCCAATGTAGCTGCGCGAGTG
10   J10   T003701_01                  Rv3701c
                        TTACCGCCCAAGTGGTTTTACGACACGGTGGGTAGTGAACTGTTCG
10   J12   T003702_01                  Rv3702c
                        ATCGAAGTCAGCGCGACCCCGCCGTTCACCGATGGGCACTGGTTG
10   J14   T003703_01                  Rv3703c
                        GATCGGCCGGGTTCCGGTCACCAACGGTGAATGGCAAGACTTCAT
10   J16   T003704_01                  Rv3704c
                        CTCGCAGCTGGATAACGCTGCCCCGGACGACGTCGAGATCACCGA
10   J18   T003705_01                  Rv3705c
                        TGCTTTGTTCAAACCAGGCTGCGCGAAAACGTATTGCTGCAGGCCA
10   J20   T003706_01                  Rv3706c
                        TGCGACACATGAGTGAAACATCTGAAACCCCAACACCACCGCCTCA
10   J22   T003707_01                  Rv3707c
                        CCTACGACAATCGACTCGCACAACCGTATGGCGGCTACATCTCGCC
10   J24   T003708_01                  Rv3708c
                        CGAGGATCAAAAGTTGCGCTTCGAGAGCCGCAAGATCCTTGGCAT
10   L02   T003709_01                  Rv3709c
                        TACTCGGACAGACCGGGCACCGTCGTTGTCGGATCGATCAAGGAC
10   L04   T003710_01                  Rv3710
                        GTGCCTGGTCACGCTGGGACTCAACCTGTTCTCCCGAGGTGTGGA
10   L06   T003711_01                  Rv3711c
                        CGTCGGGGGCGCCAGCGTGGAGGACTTCACCGACGTCGCTCCCG
10   L08   T003712_01                  Rv3712
                        GTCGTCGTCTTGCTCAACCTCTCCCGAGACCAGCTGGACCGGGTC
10   L10   T003713_01                  Rv3713
                        TCGGCGAGTTGGTCAGCAAGCCGTTGCTGGCCGGTTTGACCCAAC
10   L12   T003714_01                  Rv3714c
                        ACGTGGCCATCGAGCTGATTTCTCCCACTACCCGCCCGCAGCACG
10   L14   T003715_01                  Rv3715c
                        AAGTTGCCGGGGATCGGACCCAAGAGTGCGCAGCGAATCGCCTTC
10   L16   T003716_01                  Rv3716c
                        CGCTCAGGCGCAGCAGATGCAGCAAAAGCTCCTGGAGGCCCAGCA
10   L18   T003717_01                  Rv3717
                        TGGCCGGCCTGAACCTAGCCCAATATCCGTCGATCCTGGTCGAGT
10   L20   T003718_01                  Rv3718c
                        GCTAGGGCTGAAGAAGATCCAGGCCGAGGTGCTGTCCAACCTCAA
10   L22   T003719_01                  Rv3719
                        TATACCCGCGAGGAGTTCGACGAGCTCTACGGCGGCGAGACTTAC
10   L24   T003720_01                  Rv3720
                        AAGACCCGTGACGCCGAGGCTATCCATCACCACTACGACGTCTCC
10   N02   T003721_01                  Rv3721c
                        AAGATCGTGGAGGAACCGCCCGAACACCTGATCTTCATATTCGCCA
10   N04   T003722_01                  Rv3722c
                        TCACCAGCAGATACTGGCGCCGAAATTCGCGTTGGTGGCCGAAGT
10   N06   T003723_01                  Rv3723
                        GGCGCCGGCGTCCTCTACTTCTATTTCGTATTGCCCCGTTGGCCTG
10   N08   T003724_01                  Rv3724
                        AAGACGGTCATCGACGGAATTCGCGACGCGGGCTCTCATATCCAG
10   N10   T003725_01                  Rv3725
                        GATCGGTGCTGGATCAAGCCGGGCCCTATCTGCCTTTCAATACTCC
10   N12   T003726_01                  Rv3726
                        CACGCCTTCATGCGATCGAATCAGCAGGTGGTGTTCGGACACGAG
10   N14   T003727_01                  Rv3727
                        TTCTGTCAATAACCTGGAGTGATGTGGAAACGCCCGGACCTGTTTT
10   N16   T003728_01                  Rv3728
                        CACGCAACAGATTGAGCTGCAAGCAGGCTCGTATTTGTTCCACGCG
10   N18   T003729_01                  Rv3729
                        GGAAGTTTCGAGGCCCTGGTGTACGGGGATGCCCAGATGTATTTG
10   N20   T003730_01                  Rv3730c
                        ATCCGGGGGTAGAGGGATTCACGTATTCCTGCGCATCGCCACCGA
10   N22   T003731_01                  Rv3731
                        GCACATCACCTATCAACCGGACAAACGCGTTATGTTCAAGATCAAA
10   N24   T003732_01                  Rv3732
                        CGTGACCCTCTGTTGCGCGAGCTGATCGGCAACCACGGCTCATAT
10   P02   T003733_01                  Rv3733c
                        TCTGGACATCACCGACGCACGAAGCAGCACCTTCGAATTGGACTG
10   P04   T003734_01                  Rv3734c
                        CTCGTCACTGTTGGATGCGCTGTTCAAGATGGCGGGATCCGTTGT
10   P06   T003735_01                  Rv3735
                        TGGTGTCGGTCGACAAGCCGGACGATGTCAACGTCGTGATCGGCC
10   P08   T003736_01                  Rv3736
                        CTTGCGGAGGAGAACACCACATTCGTTATTCTGGTCGATCGGGTCC
10   P10   T003737_01                  Rv3737
                        ACGTGGCTCAGGCCTACCAGCTCACCGATTGCGTTGTCGACATCA
10   P12   T003738_01                  Rv3738c
                        GCCGGCGATCTCCGCCGCAACGTTGGACCCCGCCAGCATCATCGG
10   P14   T003739_01                  Rv3739c
                        AATGGACATCGCTGAGTGCGGAGTATGCTTCGGCAGCCCAAGAGC
10   P16   T003740_01                  Rv3740c
                        TGCGCGCGAACCGCTGTACTTCAACGGCGCCAGGATGGTCGGCAA
10   P18   T003741_01                  Rv3741c
                        CGAGCACTTCAAGCCGGTCTACAACCCATGGGACCAACGCCTGTG
10   P20   T003742_01                  Rv3742c
                        GAAGCCCGGTATCCAGCAATTCGATCCGACTCCGACCTGCACACG
10   P22   T003743_01                  Rv3743c
                        GCCAAGTCCGCGATCGTGATGGAACAACTTGGAACCACCACACGG
10   P24   T003744_01                  Rv3744
                        GGTAACCGACCTCGCCGAGGCTATTGGAATGGAACAGTCCGCCGT
10   B01   T003745_01                  Rv3745c
                        ATGTCCGATTGCAATGTGCTGGGCGGCGCCCTGGAACAGGGTGGC
10   B03   T003746_01                  Rv3746c
                        TCGATCCGGCCGTTGCCGACATCGGATCGCAGGTCGTCAACAACG
10   B05   T003747_01                  Rv3747
                        CATTACGGTCGAGATGAGGCCGCCGACCGATGACGAACCGATACG
10   B07   T003748_01                  Rv3748
                        TGGACAACAAGCTCAATGTCTCCGGCGGCGTGCTGTACCGATTTG
10   B09   T003749_01                  Rv3749c
                        TAGCTGCAGCGGTCCGAGAGCGCGCGGAGGTGATAGTCACGACAA
10   B11   T003750_01                  Rv3750c
                        CAAGGCAAAGGCATTTCATTGGTGCCACGCCACCTCAAACTAACCA
10   B13   T003751_01                  Rv3751
                        CAACGGATTCTCGGGCACAAGTCCGCGAAGGTCACCCTGGACACG
10   B15   T003752_01                  Rv3752c
                        TGGAGGGGACCACCTTGGCGGTCACCGTCGAACCGTGCACTATGT
10   B17   T003753_01                  Rv3753c
                        GTTCTGGGAGTCATCCTCGACGAGACCGACCTTTACGCCGACGAA
10   B19   T003754_01                  Rv3754
                        AGGCGTTGATCGTGCTGGCCGTTCCGATGCCGGCCTTGCCAGGCA
10   B21   T003755_01                  Rv3755c
                        GGTGCATTGGACATCGATTTGGTGTTCAGTCCATTCTTCAATGCGT
10   B23   T003756_01                  Rv3756c
                        TGGTTTGCGCGCTTTGCCCACGTTGGGTGTTCTGCTGCTAGGGGT
10   D01   T003757_01                  Rv3757c
                        AGATGTTGAAAGTCGAACTGCCGCTGTCTATCCCCGTGCTGGTAGC
10   D03   T003758_01                  Rv3758c
                        CTGCCCGGCTGTTATCCAGTCCGGCGAATGACTTCGTGTCGAAGT
10   D05   T003759_01                  Rv3759c
                        ATTGGCAGTCGAGAGACGTATATCCTGGCGCTCAAAGATCATTCCA
10   D07   T003760_01                  Rv3760
                        CGTCGGCTTTCTGATCCTCATCCTGTTGCTGATATTCATCGCCCAG
10   D09   T003761_01                  Rv3761c
                        TACCGGATCGACAACACGATCTTGGACACCGATGACCCATGCCATG
10   D11   T003762_01                  Rv3762c
                        CAGGTGGTGCCGGGCATCTATCAGGTCCGCGGATTCGATATCTCC
10   D13   T003763_01                  Rv3763
                        GACTGACGGTCGCGGTAGCCGGAGCCGCCATTCTGGTCGCAGGT
10   D15   T003764_01                  Rv3764c
                        GTCACCGGCCTGTCGATGGGCAACGTCGACGCCACGATGTTGCAG
10   D17   T003765_01                  Rv3765c
                        GGTGGTCGACGACGAACCCGTTCTGGCCGAGATGGTGTCCATGGC
10   D19   T003766_01                  Rv3766
                        ACGCCGGCTCGCCCGTGCGAATCATCGGTTATGCCAACGCCTACG
10   D21   T003767_01                  Rv3767c
                        GGCAGCCAAGCTGGTCGAAACTGAGATATCAGATGTCGATGACCT
10   D23   T003768_01                  Rv3768
                        ACGCACTGTGGGACTTAAAGACCCAAATCTTCGAGGGCGACATACT
10   F01   T003769_01                  Rv3769
                        TCCGACGACACCAATGCGCGGGTGCGGTCTCTGGAAGAGGGACAG
10   F03   T003770_01                  Rv3770c
                        AGTGGCATACAACAGAACACGCTTATGGATAACGATCCCCTCGCCC
10   F05   T003771_01                  Rv3771c
                        TGTTCGCCTATGCGGTGACGGTGATCGCCGCGGTCGTGACCGTGA
10   F07   T003772_01                  Rv3772
                        CCACCCCGACGTCATAACCGCGCTGGACAAGGTCTACGTGCCATT
10   F09   T003773_01                  Rv3773c
                        AGGCCAAGCAGACACCGTGCCCGGGGTACGACGTGAAAAAACTAA
10   F11   T003774_01                  Rv3774
                        TATGCCAGCGCCGACGCGAAGTTCTCGGTGCGCGAGGTCAAGCTA
10   F13   T003775_01                  Rv3775
                        AGCACCATCCTCCCGTCGTCCAACACTGTGTCAACGGCCAACGAG
10   F15   T003776_01                  Rv3776
                        AGCGGTGGCGGAGGGATTTGAACCCCCGGACGGTGTTAGCCGTC
10   F17   T003777_01                  Rv3777
                        TGGCGTGCACGGTGTGGTCGAACCTGGTGATGACCGCTCATCTGC
10   F19   T003778_01                  Rv3778c
                        GGCGATGGTTTTCCGTGACCCGTCAGTGATGAATTCCTTCGGATCG
10   F21   T003779_01                  Rv3779
                        TTTGCCGTGCCGGACGGACTAGTGTCGTTAGAGACATCGAGGTCG
10   F23   T003780_01                  Rv3780
                        AGGCACAGCTGGTCGGCTGGCTGGAAGGGCTGTTCCACGGCATCC
10   H01   T003781_01                  Rv3781
                        GAATTTGGTCGAACGTTCCGGGATCCTGGTTTTCGCAAGCCATTCC
10   H03   T003782_01                  Rv3782
                        CCCTGCGGATCAGACGAATTCAAGCCGATCCTTTGTGGCCGCATG
10   H05   T003783_01                  Rv3783
                        CTGCTGTTTTCCGTTGTGCAGTTGTTGTTCTTCATGACGCCGATCA
10   H07   T003784_01                  Rv3784
                        ATCGGGTTCCAGCCGCAAGTCGAAATTTGGGACGGCATCGATCGC
10   H09   T003785_01                  Rv3785
                        GGGCTCACCTTGGAATCGACCCCGCAGGGAACAACCTTCGACCAC
10   H11   T003786_01                  Rv3786c
                        ACTATCTGCGGCTCGATCCGGACTATCGGTTCAACTTCGGGGTGG
10   H13   T003787_01                  Rv3787c
                        TTTGTTCGGATACCTTCCCCCGGACGCGCAGAATCGTCTGCTGGA
10   H15   T003788_01                  Rv3788
                        CACGGTGACCTACTCGACCCCGCAGGGTCCTAATCAGGTCCAGCT
10   H17   T003789_01                  Rv3789
                        TGCTCCTCTACGGAATCACCTTCGCCGTGCAGGTCGGACTCAACC
10   H19   T003790_01                  Rv3790
                        TGCCTGCGAAACTGCGGAGCGAACCTTTGAAATTCGATGCGCCAC
10   H21   T003791_01                  Rv3791
                        CTCGCGGTGACCGCGTCCGCAAAAGGTAAGGAATTGGTTTGGGCG
10   H23   T003792_01                  Rv3792
                        CGACTACAGCTTCCTGTCGTACTACCCCTACTGGGGCTTTCAGGGG
10   J01   T003793_01                  Rv3793
                        GCTGGTGGTACGTGTCCAACTTCGGTGTGCCATGGTCGAACTCGT
10   J03   T003794_01                  Rv3794
                        CTCACCGGATTGCTGGCAGCCTGGTATCACTTCCGGATGGACTAC
10   J05   T003795_01                  Rv3795
                        CCGAAGTTCCGCATCACACCGGACTACTCGGCTAAGAAGCTGGAC
10   J07   T003796_01                  Rv3796
                        CCGTTACCTTCTCGGGTGACACCACTAAGTCCGACAACCTGATTAC
10   J09   T003797_01                  Rv3797
                        TCACGGATCCGACCCTGCAGTTCATCATGGCCTATTACCTACGACC
10   J11   T003798_01                  Rv3798
                        GCCTATCCCAAGGCCTGATCGAATCCACCAACACCAAGATCCGCCT
10   J13   T003799_01                  Rv3799c
                        TGCCGCAGATCTCCATCATTTTGGGCAAATGCGCTGGGGGAGCGG
10   J15   T003800_01                  Rv3800c
                        ATGGCGCTGGTGGAATACTCCGCCGACGAAATCAGAGAAGTGTTC
10   J17   T003801_01                  Rv3801c
                        ACAACTTGGGTACCGGTTATTGGGGCAAAGAAGAAGAGTCCGCCC
10   J19   T003802_01                  Rv3802c
                        ACAATCCGCTGACCACGGATAATCAGATGTCGTACAACGACAGCCG
10   J21   T003803_01                  Rv3803c
                        CGCTTCGGCTTCGCTGGCTCGATGTCGGGCTTTTTGTACCCGTCG
10   J23   T003804_01                  Rv3804c
                        CCTGCCGGCCAAGTTCCTCGAGGGCTTCGTGCGGACCAGCAACAT
10   L01   T003805_01                  Rv3805c
                        AGCATGCCCGTATCGGCCATGACAAGAATCTGTTCCCGGACTGGG
10   L03   T003806_01                  Rv3806c
                        GGGGGCGTGGCCACCAAAATCCCGCTGTCCAAGTGGTTTTTGCTG
10   L05   T003807_01                  Rv3807c
                        CATCCGGCCATCGCGGTCAACGTGGACACGCCAAGTCAACTGAGC
10   L07   T003808_01                  Rv3808c
                        CGAGTATGACCACGACTTCGCCGAATACCCGTTGAACGACAACAAC
10   L09   T003809_01                  Rv3809c
                        TGCACAACGGGCAGGCATATCAGTTTCCGATGGGGCTCGGCCTGG
10   L11   T003810_01                  Rv3810
                        CATGAGCGCGGTCGCCGCCCTGGCAGTTGCAAGTCCTTGTGCATA
10   L13   T003811_01                  Rv3811
                        CGCTGCAGATCACGCAGAACTTTCAACACGGAACCTTGAACTTCGA
10   L15   T003812_01                  Rv3812
                        CATCGACGCGGCCGTCCAGCAATTCCTGGCCTTCAACGCGGCGTA
10   L17   T003813_01                  Rv3813c
                        GCGTGGCTGAATCCGGACAACACCGAAGTGTCGATCGACCACCTG
10   L19   T003814_01                  Rv3814c
                        AAGATCACATTCGAAGGCCTGGAGAACATCCCCGAACGTGGCGGC
10   L21   T003815_01                  Rv3815c
                        CCGTCGTTGTCTGGGGTGCTCAGCGGATCTGGACCAAGGACCATC
10   L23   T003816_01                  Rv3816c
                        CGTCGTCGCGATCAACCACACCAGCTACCTCGACTTCACCTTTGCG
10   N01   T003817_01                  Rv3817
                        GTTGCAATGGAACTTTCCCGACTACCCGGGCCAGGTCAGAGATGA
10   N03   T003818_01                  Rv3818
                        CCATCGGTCCCGAAACCATTGTTTTGGACTTTCCGAAAAGAGCTGT
10   N05   T003819_01                  Rv3819
                        CTGCACGCCCACGCGCCCCAAAGAATTCATCGCACTGCTGGACGA
10   N07   T003820_01                  Rv3820c
                        ATGAATTATGCGATCAACGCACACCTTCGCCGCCACGACACCTACC
10   N09   T003821_01                  Rv3821
                        TGCTCCATTTGCTCACATTCTTGTGCGGTGGTTACACGATGGCTGG
10   N11   T003822_01                  Rv3822
                        CGAATTACTACAACCCCACCGCTACCCGCCACGTCGTTTCATATCC
10   N13   T003823_01                  Rv3823c
                        GGCTCGGTTATCGTATCGTACCTGGCGGCGCTCGGTATTGGCGTT
10   N15   T003824_01                  Rv3824c
                        CCTATTTTGGAATTACTCCCAAAGATATCCGCACACCAGCCGACCT
10   N17   T003825_01                  Rv3825c
                        CGAGTTGATAGCTGCGCTGGCCGACCTGAATCCGAAAGCTCCTGA
10   N19   T003826_01                  Rv3826
                        CGCAATCACCCATTGTTCGGATCGTCGATCCCAACACCAATACCGA
10   N21   T003827_01                  Rv3827c
                        GGTAAACGTGAGGGCAAGACAATGGGCTTCCCCCGGTTCAAGAAG
10   N23   T003828_01                  Rv3828c
                        TGGTGGCCGAGGGTGGTTGGGCGTTGAATGGACATCGCCGTAAGT
10   P01   T003829_01                  Rv3829c
                        ACAAGATCACTAGGTTGGCACCGAACTTCAAAGGCAGCATTCTCCG
10   P03   T003830_01                  Rv3830c
                        GATTGCGGAGGACGCCGGGGTGTCGCTGCGTACTTTCTATCGCCA
10   P05   T003831_01                  Rv3831
                        ACTTCAACATTCGTTTTGTGCAGCAGTACGCGCACGGAGCCGCCAA
10   P07   T003832_01                  Rv3832c
                        ATGAATCTTCTACATCGGCGTCATTGCAGCTCGGCAGGCTGGGAAA
10   P09   T003833_01                  Rv3833
                        GTACTGCAGGATCAACTGCCAACAACGAGCATCCGCGAGCCACTG
10   P11   T003834_01                  Rv3834c
                        GCAAGGACACGCGCGGCATCATCCGGGTGCACCAGTTCGACAAAG
10   P13   T003835_01                  Rv3835
                        GTTCATCAAGGACGCGTGCACCCGGATGACGGACGCCTACCTCGC
10   P15   T003836_01                  Rv3836
                        TCGTCGTGTTAGTCGCCAATCGCCACCCCCAGCACGAAAATCTGCT
10   P17   T003837_01                  Rv3837c
                        ACAACCACTTGGAAAACGTCGAGTCGGTGGTGCTGGCCCCGATAA
10   P19   T003838_01                  Rv3838c
                        GAATCCCGGCCCACCCGTACCGAACTTGGCACCTATCTGTTCTTCG
10   P21   T003839_01                  Rv3839
                        GAATCAACCTTGCTCTGGCACCTAGCCACCGCCCATGACGATGTG
10   P23   T003840_01                  Rv3840
                        TCCGGGGTTGGCATCCGACAACCCGACGACACTGATATCGATCCC
11   A01   T003841_01                  Rv3841
                        CAGTTGGCGAAGCATTTTTACAGCCAAGCGGTCGAGGAACGAAAC
11   A03   T003842_01                  Rv3842c
                        GGCAACCGCCGTGGGACCCTCACTGCCTGCGTTAAAGGAATATCC
11   A05   T003843_01                  Rv3843c
                        CGGTCGTGGTGTTTGTGGTGCGGTATGTGTTGCTGGTCATCAACC
11   A07   T003844_01                  Rv3844
                        CACATCGCGATCCGCGATGATGTCGGTGCGAGGTCGATTCGATTC
11   A09   T003845_01                  Rv3845
                        CGACACCAGGACCCACCCACACAACCGCGCCCACACTGACACCAT
11   A11   T003846_01                  Rv3846
                        CAAGCTGCTGATATTCCAGGTTTACGACCACCAGACGAACTTCCCG
11   A13   T003847_01                  Rv3847
                        AGGTGGGCCTATTGGGGTTTCTCCCTTCCATTCGCGTGGTGCCCT
11   A15   T003848_01                  Rv3848
                        CCGGAGCGGTTGCTGCAGGTCCTGACTGGCCTGCTGTTCCTGCTG
11   A17   T003849_01                  Rv3849
                        ACGACGAGTACTACGAAAAGCTCGACAAGGAATTGCAGTGGCTGTG
11   A19   T003850_01                  Rv3850
                        AGCCGAGCGATCGTTGCGGATGGTGCAGGAAAAGAAGCCGAAGGA
11   A21   T003851_01                  Rv3851
                        AACGACGTCCCGACGTGGCCATTCGTCGTAGGGACCGTGGCGGC
11   A23   T003852_01                  Rv3852
                        GCCCGTCAGTTTGCAGCAGCGGATCGAAACCAACGGCCAGCTTGC
11   C01   T003853_01                  Rv3853
                        CGCCGGACCGATCAGCACCGTGCGGTGTTTTCAGGACAATGCGTT
11   C03   T003854_01                  Rv3854c
                        TTGGCTACACCAATGCCTCCTGGACGCTGAAGGCCGACCTGGTGT
11   C05   T003855_01                  Rv3855
                        TATCTCGGTCGACGATCTGGCCAAGGGCGCCGGTATCTCGAGGCC
11   C07   T003856_01                  Rv3856c
                        AATCGTGGCATCCGGCCAGAATCGAAGTTCGATGCAGAGGCGGTG
11   C09   T003857_01                  Rv3857c
                        AACCCATCCTGTTGGCGAGTTATGTCACCCATGGCGCGCGCCGTG
11   C11   T003858_01                  Rv3858c
                        AGGAATTCGACAACGAGAGCCTGCGCCAACAGGCGACCCGCTGCA
11   C13   T003859_01                  Rv3859c
                        ACATCAAAGCCGCAGGTAAGGGTGTGCTGAAAGTGATGTCGAAGA
11   C15   T003860_01                  Rv3860
                        CCATCTACCGCGAAGCCGCCCTAAGGTTGGATCACCATTTCGCAAT
11   C17   T003861_01                  Rv3861
                        CGCGCAATGTGGACAGCGCGAGAAATCTTGTCGATGTTCTCGCGC
11   C19   T003862_01                  Rv3862c
                        CCTGCAACGCTTTCTGGAGGAACGTAGACATGACAGTAACCGCCC
11   C21   T003863_01                  Rv3863
                        CGAAGCCGAGGAAGAGTTGCCAGCCGAGGCCACCGAAGCGATCG
11   C23   T003864_01                  Rv3864
                        TCTCGACAAATTAACCGGCAACATGATCTCGAATCAGGCCAAATAC
11   E01   T003865_01                  Rv3865
                        CGCAGCCGCCGGCGCCTACCTCAAGGCCGACGATGGCCTAGCCG
11   E03   T003866_01                  Rv3866
                        GGGTGTGGCAACCGAGCTAGCCGAATGCACAACCGCGTCCCAATT
11   E05   T003867_01                  Rv3867
                        TCTGGCCCGCCAAAAGGCGCGGGCGTCGCAGTACACGTTCATGGT
11   E07   T003868_01                  Rv3868
                        CGAGATCAACGGCTCAGATATGGCGGAGGCTATCGCCGCGGTGCA
11   E09   T003869_01                  Rv3869
                        ACCTGATGATCTAGTGATCGGATCGGTCTTCCAGATCCACACCGAC
11   E11   T003870_01                  Rv3870
                        CTCACCGACTTCAAAGGTGGTTCAACCTTCCTGGGAATGGAAAAGC
11   E13   T003871_01                  Rv3871
                        ATCCATACGGCGACGTCTTTCTGATCATCGACGGATGGCCCGGTTT
11   E15   T003872_01                  Rv3872
                        ATGAGGTCTCCGCCCAAGCGGCGACGGCGTTCACATCGGAGGGC
11   E17   T003873_01                  Rv3873
                        ATCCCGATCGCGTTGACCGAGATGGATTATTTCATCCGTATGTGGA
11   E19   T003874_01                  Rv3874
                        GCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTC
11   E21   T003875_01                  Rv3875
                        AATTTCGCGGGTATCGAGGCCGCGGCAAGCGCAATCCAGGGAAAT
11   E23   T003876_01                  Rv3876
                        TCACATCATGCCGGGAGAACCCAATGTCGCAGTTAAAGACCTGGTG
11   G01   T003877_01                  Rv3877
                        GTTTCACCGGTCGTAAAACGAACTCTGGAATTGATCGACGGCGCCA
11   G03   T003878_01                  Rv3878
                        CGGCGGACGTCTATGCGAAGACCGATCAGTCACTGGGAACCAGTT
11   G05   T003879_01                  Rv3879c
                        TGAGCGGGTGCTGGAATCCAAGAATTGGAAACCTCCGAAGAACGC
11   G07   T003880_01                  Rv3880c
                        GACCGTCGAAGTGACGATCAATGGGCACCAGTGGCTCACCGGCCT
11   G09   T003881_01                  Rv3881c
                        AGAGGTCGGAGAAGGTGCTGACCGAATACAACAACAAGGCAGCCC
11   G11   T003882_01                  Rv3882c
                        AGGTAAAGGTGGCGTGGCCGAATGCGACGACCTATCTCGGCCCGC
11   G13   T003883_01                  Rv3883c
                        AGCAGGCCGATCGATGAAACCTCACTGGGTGCATCCATCGACTATG
11   G15   T003884_01                  Rv3884c
                        CGGAACACCGGACATGATCGGCATGGAGGCGGTCAATCAACTCCT
11   G17   T003885_01                  Rv3885c
                        GATCGGGCAACGGTGAAAGTCGGTGCGGCAGGACAAAACTGGCTG
11   G19   T003886_01                  Rv3886c
                        TGCTCCACACCGATCACCGTAAGAAATCCCGACGTGGCGCAGCTA
11   G21   T003887_01                  Rv3887c
                        CGCATAAGGTTGCTTTCCCGGCACGTTGTGCGGTCAACATTTGCTA
11   G23   T003888_01                  Rv3888c
                        AAAGGCGGGATCATTGATACGGTGCATGAATTAAATAAGAAGTCGC
11   I01   T003889_01                  Rv3889c
                        GACGGTCGATGGCCTGTGGGTACTACAAGCGGTAACCGGGGTGG
11   I03   T003890_01                  Rv3890c
                        TATAACCCGGGAGCCGTATCCGACTTCGCTTCCGACGTGGGCTCG
11   I05   T003891_01                  Rv3891c
                        TTGCTTCGCATATGACAGCCACCGAGATCACCAATGAATTGAACAA
11   I07   T003892_01                  Rv3892c
                        CAGCGTGCTGTGGACACTAACGCCTCGAATCGTCTCTTTGGACGTC
11   I09   T003893_01                  Rv3893c
                        ATGGTTTGGTCTGTGCAACCAGAAGCAGTGCTGGCGTCGGCAGCT
11   I11   T003894_01                  Rv3894c
                        CGCTGACGCACTCACCGGAAACATTCAACGTCATCTTCGTCGACAT
11   I13   T003895_01                  Rv3895c
                        ACCAACAGGGCGGTCACCTTGAGCTTGGGGCTCGACCCCGGCGTG
11   I15   T003896_01                  Rv3896c
                        CGCGAATCGAACTACAACGCCAACGCCATAAACCACTGGGATTCCA
11   I17   T003897_01                  Rv3897c
                        CCGACGACAAGCCGGTGGTCACCAAGTCGACGCGACGGATCCTTG
11   I19   T003898_01                  Rv3898c
                        GAAATCTTATTGCAGGTTTTGACGACGCCGCCAGCGTCCGGACCG
11   I21   T003899_01                  Rv3899c
                        GCTGGAAAACGAAGCCGAGCTGCTGCACGGCTGCATCACCGCGGT
11   I23   T003900_01                  Rv3900c
                        GGAGCGAAATCCGAGGTCACTAAGGCAGAGAAGTACGAAATAAAG
11   K01   T003901_01                  Rv3901c
                        GCAATTGTGCGACACATACAAGCTGGTGGCCCATGCTGTACCAGTT
11   K03   T003902_01                  Rv3902c
                        TGTGGACCTGTCAACGGATTTGCAGGACTGGATCCGCTTATCTGGC
11   K05   T003903_01                  Rv3903c
                        GATATTCGATCATCAGAACGAGATGCGCAAAGTGGAAGAGTTAATA
11   K07   T003904_01                  Rv3904c
                        CGAATTCGGTCGCCACGTCGAGGAGCTGGTCGCCGAGATTGAGTC
11   K09   T003905_01                  Rv3905c
                        TGAGGTGCAGCTGGGATTGTCGATGCTGGCGGCGGCGATAGCTCA
11   K11   T003906_01                  Rv3906c
                        CGTCGAGCACACCGGTGGTCCACTGGTTGACTTCGACGGGTTCGG
11   K13   T003907_01                  Rv3907c
                        GTGGGTAAGAGCGACCACCGCATGGAGATCACCACATTCCGTGCC
11   K15   T003908_01                  Rv3908
                        ACGGCCGGCGGGTGCACAAGACCGTCCACCATTATTTGATGCGGT
11   K17   T003909_01                  Rv3909
                        ACCTGCCGCTACGAGTACCAATCGAGGTGAACTTCACACAGCGGG
11   K19   T003910_01                  Rv3910
                        TACCTTGGGAACCACCGACGGAAAGAGTCAAGCCGACATCTCGGA
11   K21   T003911_01                  Rv3911
                        TGCTGGGCTATCTCAACACCGGGGTGAACATCCGGCGCTGACCCC
11   K23   T003912_01                  Rv3912
                        TCACGGTGTCAAAACCTGCCCCGGTGATTCCGCTGTCTCGGCCGC
11   M01   T003913_01                  Rv3913
                        CGGTGACTCGGCAATGGAGGAAGCTACCTTCCTGACCCGATTCGC
11   M03   T003914_01                  Rv3914
                        CCAAGCTCGACGTGGACACCAACCCGGAGACCGCCCGCAACTTCC
11   M05   T003915_01                  Rv3915
                        TTGCCGATTTCATTCAACGAGAAGTGGTGGCGCGCACCGGTTTACG
11   M07   T003916_01                  Rv3916c
                        GAACTGGACAAAGGGCTGGGGTGGAAAGCCGAAGTCGAGGCCGC
11   M09   T003917_01                  Rv3917c
                        TTTAGCGCGCATAGTCGGTTTGATGACCACTGATGGCCGAGATAAA
11   M11   T003918_01                  Rv3918c
                        GTGTGTCGCAGCTTATGCGCAACATCGAGATGGTGAAGGCCCACC
11   M13   T003919_01                  Rv3919c
                        CTCCAGGTAGTTCTCCTAGAACCGCTACTGCGCCGCACCGAGTCT
11   M15   T003920_01                  Rv3920c
                        TGTCGAAGGCAATCGTGCGGTGGTGAGCATCGACGGCAGTGACGA
11   M17   T003921_01                  Rv3921c
                        CGAACAATATCTGGACGTTCGGGCAGCAGCATTACGTCTTCGGCAT
11   M19   T003922_01                  Rv3922c
                        TAGTCAGTACGCCGTCGATGCGCTCACCGAGTATGGCCTGTTGCG
11   M21   T003923_01                  Rv3923c
                        CACGTCGGCTGCGGCACGTGGCTGGGTCGATCGTCAAAGAACTCC
11   M23   T003924_01                  Rv3924c
                        AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
11   O01   T003925_01   ATGTCCACGCCGCATTATTCCGCTTCGAGCGGTGAACCGCGCCGC
11   O03   T003926_01   TTGATGGGGTCACCCGTGATCCGGATGGTTCCGCTCGGGCCGATT
11   O05   T003927_01   GACTGCGATACGCTCGGCGGGCCACCGATCAGTCGATCGGGTGG
11   O07   T003928_01   CCACCGCCTTGGTGGTGGGGTGTGGTGTTTGAGAACTGGATAGTG
11   O09   T003929_01   GTTTACCACCCTCTACGGGTTGGCTAACCGCCTATTCATCCCGCAG
11   O11   T003930_01   CGACCTGGACGTTGCCATCGAGTGGTATCACGACCACCTTGGCAT
11   O13   T003931_01   CTTTTACGCATTATCGCTGACGATCTTTGCCTCCCAGGACTCCAGA
11   O15   T003932_01   TACACCTTGCCGCAGGGAGTGGGCGAGCACGCTCTCTTGCGAATG
11   O17   T003933_01   CTGCCAATTTTCGCCGACATCTCCGCGGTGCAACCCAACAAGGATC
11   O19   T003934_01   CCGACACCAGCAGGGCACACTTACGTCGAGTCGTTCGGTCCATTG
11   O21   T003935_01   GACAACCAGATTCAGCACGGCCTGGTAATCGACAGGATTCTGGGA
11   O23   T003936_01                  Rv1452c
                        CATGCTCGGGAGTATCAGGCGATCAGCACGCAGGTGGCAGCGTTT
11   A02   T003937_01   AGTATCCGCAACCTGGCGGCCACCACCGGCCGGTCGTACGGATCT
11   A04   T003938_01   AGCTGGCCAAACTGTACGAATTGCGCTCAAGTCGGGATCGGGTCA
11   A06   T003939_01   AAACTTGGGTGCCGTCGAAGAATAACCCCACCAAAGGCCCTACATC
11   A08   T003940_01   ACAGTCAATTCGAGGCCACCTGGTCGACGGAGCGGTCGCGCACTT
11   A10   T003941_01   TGGAGGACATCAGGACCGGCGAGTTGACAGATCTCAAAGATGGGC
11   A12   T003942_01   TGGATCCGTCGTGGTAGAAATGCCGGATTTCGCGGCAGCCGCAGG
11   A14   T003943_01   AACTCGGACCTGGCACACAACCTCGTCACGCCAGACTTAAACCAGT
11   A16   T003944_01   GTACCGACCTTCGAATCCGTCCGCGAGAAGATCGAAACCCGATAC
11   A18   T003945_01   AGATGTTCGTATATTCAATTGATTGTTTGATCATGTCATTCCGACAC
11   A20   T003946_01   ATCACATTGGGGCGTCATCGAGGTCGATCGACGGATACATCAGGG
11   A22   T003947_01   TCTACATGGGCTCGCTCGCAGCGTTCAAGCTTGGCTGGCTGCTAT
11   A24   T003948_01   TCTTGATCGCGGTGAGCACGACACGAATCGTCATCTTCCGCAAAGA
11   C02   T003949_01                  Rv1753c
                        GGTGGTTCACCCATACACATTGACCGGCCCTATTGTCATCGGTTCA
11   C04   T003950_01   ACATCGACGATCCGATCAATTTGCGTCCACTGTCGCCCGGACAGG
11   C06   T003951_01   GGTGTTGTTCGAATTACCTTGCCCGCCAAGCATATTCCATATACCG
11   C08   T003952_01   ATCACCGTGCAGCCTGGTGCTTCGCAGAATTACTTTCAGGCTCTGG
11   C10   T003953_01   TTGCACTGGTCGGTATTGCCGATTGCGTTTGTTTTGCTGATATCGG
11   C12   T003954_01   AGGCTTGGTCGGTGTGAGCCGCCAAATCGGTATTGACGAATTCGT
11   C14   T003955_01   CTGTTGTTCACGATCATCTGGTGGAATGTCAATCACGGCCGGGCC
11   C16   T003956_01   ACGAAACTCACCATCACACGCTGTTCACAGACCCGATGCCCCCGAC
11   C18   T003957_01   TGAGTTGGTGCATCATTCCGACCCCGGATCGCAGTAACTATCGCTG
11   C20   T003958_01   TGTTGACGAGGTGCCAGATGTCATTTGTGGTCACGATCCCGGAGG
11   C22   T003959_01   GTGTTTTCGTGGGCGCTTTTCTGCTGTTCAGCGGTGCTTTCAGGTG
11   C24   T003960_01   CTGTTACGCAACGAAGGCTTGGCAGCTGCAGTCCAAACTGGCCAC
11   E02   T003961_01                  Rv1917c
                        TCCGCTGAGCGGTGCTACCAACGCTGTCACGATCCCTGGTTTCGC
11   E04   T003962_01   ATGCGGTTTGGCTCCCTTGCGCTGGTCGCCTACGACTCGGCCATC
11   E06   T003963_01   CATCAATGGGTTTACGGTTTCAGGTGCCACCCGATCTGGTGTCGTT
11   E08   T003964_01   ATACGAACGCTCAACCAGGAGACGTCCAAGGTCCTGGCCCGCGTC
11   E10   T003965_01   TAGGGCTCCGGCGATCGAAGACGCCTCAGATGCGCTGCTGGAACT
11   E12   T003966_01   AACTTCTCGACATCTTGCGTACCGAAATCTGGCCCCTGCTTGCCGA
11   E14   T003967_01   CTGCTCGCAGCTCACCTTCAATTGCCAAAGAGCCGAGTCAAATTGG
11   E16   T003968_01   ATGGGCATTCAGTTTCGGCTCGGGCCGGCTGATCACAAACCGGTC
11   E18   T003969_01   ACAGCTATTTCTCTGCCGGATGAGACGTTCGATCGGGTATCGCGG
11   E20   T003970_01   GTGGTCAAGACTTTTCACCGGGGCGACGTTTCCTGGGGCTAGTAA
11   E22   T003971_01   AGTCCGTACAAATGACGTTACGCAACGTCAGATCGCTGTCGGAAAG
11   E24   T003972_01   CCTCAACACTATGAACAGCAACTTCTGTTACTTCGACGACGCCGGG
11   G02   T003973_01   CCCTCGAAAGAAGGTGCGCACGAAACCCGGGAGGCTTCACTATGT
11   G04   T003974_01   CGAATGAACTACAGGTTGTACTTGGTCAGCTTGAGGTTGCGGCCAG
11   G06   T003975_01                  Rv2082
                        TCGCCGATACGGTGAACTATTTGCGGGATCGGCTGACCGAGATCG
11   G08   T003976_01   GGAACTGGATCGCAAAGATGCCAAGGGACACAAAGGGGTTCCACG
11   G10   T003977_01   GATCGCGGTCGACAGCTTTGGTACCGAGCACATCGCCACAACGCG
11   G12   T003978_01   GCTGTTCGGCGCGAATGCGCAGGAATACCAACAGATCAGCGCGCA
11   G14   T003979_01   GATGAGCAGATTGAGCTCGTCGAGCACATCAACGGAAACCTAGCC
11   G16   T003980_01   CGTGCTCATCGGGGTACCGGAAAGCCTGTCGCATGACGAGCGTGC
11   G18   T003981_01   TTGCTGGGCGTGGAATTCGGTGTTTGGTCGACCCCGATGCTGTCG
11   G20   T003982_01   GGATATGGCAGTGTCGTGGTCGTGGGTGAGCGACCTGGGTTTCAA
11   G22   T003983_01   CCGGTGATCTGGATAGCGACATTGCCGCAACGCCCGGTTGGTCAG
11   G24   T003984_01   TGCCGACGGCCGAACTCATTTCTCAACACGGCTCCAAGCCGGTAG
11   I02   T003985_01   AACGAATATGTTGGATCGGCGAGCAATACGTGTTGGTTTGCCAGAG
11   I04   T003986_01   AAAGTCACCCATGTTGTCGATGAAAACCTGCTTCGGCTTGGTGTGG
11   I06   T003987_01   TCGTACCACGGATTGTTGCGGTACTGACGCTGACCCTGGTTCTCG
11   I08   T003988_01   CTGAGGTACTGGCGTTACTGGGCACCAGTCCGCGCAGCTATCGCC
11   I10   T003989_01   TGTCTTAGATCAGGCTGAAGACGTCGGTGTCGACCACCGTCGCCG
11   I12   T003990_01   AAACTGGGGCAAAAGGTTCACCGCGGGTGTAAGCCAGCTAGGTGA
11   I14   T003991_01   CGGTTGGTGAGTGCATGCCACTCGCCTGATGATGCCGGGACTCCG
11   I16   T003992_01   TGTCGCTGGGTATCGGGCACTCGCCGACAGTAAAAAATTATTCGAA
11   I18   T003993_01   TAGCGACAAGTGTTGCCCTGGCTGTTGACGTGCTCTTCGGGCAAG
11   I20   T003994_01   TCATCACTGCGTTGGGCCGCAATTTCGCGGTGATATACCAGCAGG
11   I22   T003995_01   GGTTGGCTGAGGCGACATCGTTGGACACGATGACTCAGATGAATC
11   I24   T003996_01   GACGCTCGATGCGCACCAATTCGAACCAACTCAGGTCTTACGTTGC
11   K02   T003997_01   ACGGCGAAGAAGTCCACGGCGAGTGCGACGAGCTGACGATTAACC
11   K04   T003998_01   AACGCCGCGAGGACATGCTGCGCCATCCTGCATTTCTGTCCAAGC
11   K06   T003999_01   AGGCGTTGGCAGTCATGCCGGTCGTGCTGGCTTTGGCCTATTTCA
11   K08   T004000_01   GAGAAGTCCTACCAGCGTCTTGCCGGGATTATCGGCAAGCTGATC
11   K10   T004001_01   TTCCTCGATTGGTCGCTGGTGGCTTTTCGGCAAACGCGATGATCG
11   K12   T004002_01   GCTTTCACCACCGCGTCATCGCGACTAGCGTTGTGTTGGCACTGTG
11   K14   T004003_01   ACCTCTGGACTGCAGCAAAGTCAGCAAAGACGACGTGGGCAATCC
11   K16   T004004_01   TCTGCGGCAAACGAAACTGTGCAACGCTGTCCATCATCGATAGCAA
11   K18   T004005_01   TTGTCGAGGTTGACGGATTTCCGGTTTTTGATGTTCCGCCGGATGC
11   K20   T004006_01   CAGTTATCTTTGGTACTGCGTTCTCGGCGGAGGACTTCAAGGTTGT
11   K22   T004007_01   TGCGGGAAGAGATGACCGAACGTTTCAGTCACGTAGAAGAACGTT
11   K24   T004008_01   ATGAAAGATGTCGTGACCGAACTGCTCAGATCCGGTCTGTCCCAGA
11   M02   T004009_01   TACGCCGAGCGTCGCGCTACTGCACAGGCTTCTTTGTGCTGATTCA
11   M04   T004010_01                  Rv2741
                        CCTCCGCTGAAGCCGCCGCCGTGACACCGCTTCAGCAACTAGTCG
11   M06   T004011_01   ACGTTCGCGCGGACATCGTTCTCGGCGAAGATCTTTTCCAACACGT
11   M08   T004012_01   TTGCGTCACGGCCCGACGAGACAGGGGCAGAACCTGATTGGCAGG
11   M10   T004013_01   TTCAAGACCAGTTCGTGACCGCATCACGTACCACTGCCTATTCGGG
11   M12   T004014_01   CCTGAGCGCCATGTGCGATGTGGCGTCGTTCATGGGCGCCGTCGC
11   M14   T004015_01   CGAAACACACCGTCGGGCTGGCTTCGCTAAGCCTAATGAGCACCG
11   M16   T004016_01   AACGCTGAAGTACCGCAACGACTCTCCTGAACGGTTCGATTCGATC
11   M18   T004017_01   TTGTCGGCCACCGCCGGCAAACCAACATTCAGCCACAACGCGACA
11   M20   T004018_01   TTGCAGCCGCTGCAGAAGGTCGTTGAATGTTGTTCCAAGATACCGG
11   M22   T004019_01   TTGATTCCGCTAGCGGGTGATCCGGTGTCCTCGCACCGCACGGTC
11   M24   T004020_01   GTTTGATGGGCCCCCATCCGAATGCCGTTGCGCTGTTGGTGGATC
11   O02   T004021_01   GACCAGGGGCTCCACTTCCCCTATCGCTACGACCTTCGACTGGCG
11   O04   T004022_01   CCGTTGACATCGCTGCGGCAATCAACAACACTCGTCATATCCGATA
11   O06   T004023_01   TTGGTCGAGGTGCCACCGGATAATCCTGAGGTCGTAGCGGGCTGG
11   O08   T004024_01   TGGTTGCGGTCCCGGCTGCCGACGTTGTGGACGAACTCGTATTTT
11   O10   T004025_01   CACCACATTCTGGCGATGTTGGTGAGGTTTGTTCCTGCGCCCGTC
11   O12   T004026_01   GACCGTCGGTCAAATACTTCCGGTGGTGTACTCGCCGAAGAATCC
11   O14   T004027_01   AGCCGTTATTACGCCGAGCGTGAACTCAGTGCAAGAACGCACGCG
11   O16   T004028_01   TAACTCGGGCAACTCCAACGAGGGCTTCTTCAACACGGGCATGTTT
11   O18   T004029_01   ACGACACCCGTGGGAGTTGCCGGGTCCAGCGACTTGATTCGGCCG
11   O20   T004030_01   TGACGGACGACGTTTCCGAATCCGTTCGCAAAAAGCTCATTACGCT
11   O22   T004031_01   GATTACTGTTCTCGATATGAACGGATTCAAGGATGCGAGGCCCGAT
11   O24   T004032_01   ATACACGCGCCTCCAACTTCACCGGCGACCTGTTACGAATGCCGC
11   B02   T004033_01   CTGTACAACGGCCCGACTACTCCGAAACCGACTGGGACGCGCTAC
11   B04   T004034_01   GATCCGGGAGCCGACGAGCACCCGTGAGCAGACGCAGAAGTCCC
11   B06   T004035_01   AACCATGTCAGCAAGATCAACGCAGCACGACGCTGCCGACGCCCT
11   B08   T004036_01   TCTATACGACATCATGGTGTGGCTATTGCCTTCGACTCAAAACAGC
11   B10   T004037_01   GTCCACAGGACGAAATACCCGAAGCCGATGCGGTGGAGCAAGGGC
11   B12   T004038_01   TGCTGACCCTGACCGACGAGCGGGGCCGTCGCTTCCTAATTCACA
11   B14   T004039_01   GGTGCCTGAGGCATTACGGGCTCGAGGAACGGATCAAGGCGTTGA
11   B16   T004040_01   ATGTTAGCGATGATCGCGCTGATCAAGGTGATCAGGTCCGGCGGG
11   B18   T004041_01   CTCGAAATTCTCCAAGAAGGACGACAGGACTTAGGCGCCGTGATAG
11   B20   T004042_01   ACATCGACAAGGCTGTTACCCGCACACCCGTTCGCCGGATCGTGC
11   B22   T004043_01   CCAGATCGCTTTCGTACCGTCATCGCATGTACCGGTTCGCGTGCC
11   B24   T004044_01   GCGACGCAATGGTCGATGGACAAGGTCTTCACGAAAGCGCAGATG
11   D02   T004045_01   GCACCGCCAGGGTATCGACTCGCCGTTGCCGATAACCAATATGAT
11   D04   T004046_01   TGCCAAGAATTCGCTGAGGGGTGTGCCGGAGTCTGTGGTCATGTC
11   D06   T004047_01                  Rv3343c
                        CTCCATCATCGATCCATTCAGCCTTACGCTGCTGGGGTTCATCAAC
11   D08   T004048_01                  Rv3345c
                        TATGCGACTGCCGAGGCGGCGAATGCATCACCGCTGCAGGCGCTG
11   D10   T004049_01   GGTCAATGAATCTGCCGCAAACCCCACGCCCGTTGGCCCATATTG
11   D12   T004050_01   CGGGCGATACGCTCCGACCGTCAACGAGGAGGACGGCCATGTGG
11   D14   T004051_01   GCACCCCTCTACACTACGCAAGCACGCGGTGATAACGCCAGAAAT
11   D16   T004052_01   TATGACCGCGCCGATCGCACGGAAAGGGGTGCGATCTTGCGGCG
11   D18   T004053_01   GAACCGCAATCATTTCACCGGAAGGGAAGTGTGCGGACACGCTAA
11   D20   T004054_01                  Rv3507
                        CGCTCAGGTAGCAGCGTTTCATAGCCGGTTTGTGCAAGCCCTGAC
11   D22   T004055_01   AACTGGATTGAACACCAAACAGGTTGGAGCATCAAGAAATTCGTTC
11   D24   T004056_01   ATGGCTTTTCGGGAGGTCAGTATGAACAAGATCAGGGAAGTGCTG
11   F02   T004057_01   TCTCCCTGGCAAGCGACAGCTCGGGCAATCCACCTGGTAATCAAAC
11   F04   T004058_01                  Rv3595c
                        CAGAGTTTGCTGAACGCGATCAATGCGCCCACCCAGGCACTGTTG
11   F06   T004059_01   ACTGTCTGAACGGGCAATCGTCACCACCCTGCTGATGCCGGCGCC
11   F08   T004060_01   GGCGGACAATCTGCTGGAGCGCAGCTTATCGCTATCCGGGAAGCA
11   F10   T004061_01   AAGAACTCGAATCGCCGCCCACCAACACGGTTCTCGGTTACCAAGC
11   F12   T004062_01   GACTGCCGACTTGCGGCCCCGTGTGGATCTTGACGACAAGGACGC
11   F14   T004063_01   GAGATGACCGAAGGAGTACGAGGAGTGACGCAGGGGGTAGTTCCT
11   F16   T004064_01   GACCAAAGCCAGCCCAGTTTATCTGCCTGGTGTAAAGGGACGTATC
11   F18   T004065_01   TGAGCACACCGACCCGTTCGGGCGGAAGGTTCGGATCAGCCGGC
11   F20   T004066_01   AATGGAGCCTAATGGCACAGGGTGTCTATGCGCCGGCGATTCCGC
11   F22   T004067_01   GATCAGCGGCTGCTAACCGCATGGTTGGAGCTTGGCATGGCAACC
11   F24   T004068_01   TCAATGCGTTCTCATCGACAGCCTGGCAGGTACCCGAGCGAAATG
11   H02   T004069_01   CATTGCCGCTTTGCGGGCCGCCCTGATCGCTCTGGCGTTACTGGC
11   H04   T004070_01   CTCGCGCTCAAGGAATTTTGTCTGGGCGCATGCGTAGCCGGAATT
11   H06   T004071_01   GAGTTGTCTATCGGTTTCTCATTTTCAGCGTCTTTTCAGAGTCGCG
11   H08   T004072_01   GAAGGTCTATGGGGTGGGTGGGCAAGAAGAAGTCGACGGCTGGG
11   H10   T004073_01   ATAAGGAAATTCGAAGGAGTCTGTTCGGGCGGCGAATCGCCAAAT
11   H12   T004074_01   TGACCACCCGGCTGATCGCCCAAGCGGTGCATCATGCGCGCGGAT
11   H14   T004075_01   TGCAGGTGTTCCAACTGACCAGCACCGTTATCGATCTCACCACCAA
11   H16   T004076_01   CTTACATAGACGAGTCCGGCAATACCGGAGACCCCGCCAACGGCG
11   H18   T004077_01                  Rv0020c
                        TATATCCAAGAACAGGGGTGGCAAACGTATGGTGATGTGGTCGTCC
11   H20   T004078_01   GAGAATTGTTCGGCCCCAATCCGATCGAGCCGCCCACCGACATCG
11   H22   T004079_01   AGCTCGTCGTTGGCAGAACCAACTATCCGATGCAGATCCGCTTTCA
11   H24   T004080_01   CAATACCGCACCTTTCGACGTTATCGCCGGCCCACCAGCACCGGC
11   J02   T004081_01   TCATGGAACTTTCCGTGTCTGTTATCGCGGGGTTGGTCATCGCACT
11   J04   T004082_01   TGTTGTCGCGGTGGCAAACGACGATGCCGCGGAATCTTTAGTCCG
11   J06   T004083_01   ACGATGATCATGACTTTTGTTGTTCCACAACGTGTTACCCGTGCGA
11   J08   T004084_01   CGGGTTGGGGAGGTGTGTGATGTCGTTTGTCAGCGTAGCCCCGGA
11   J10   T004085_01   TTGGCCTTCCCGATGGATTGGTGCCAGCAGCAACCGGCATCATCG
11   J12   T004086_01   ATACGAATGACGAACTACGAGGCTGGGACCTTGCTGACCTGCAGC
11   J14   T004087_01   TTTTGACGCCGGCACCGGTCCGCGGCCAGGTATCGACCTAACCTC
11   J16   T004088_01   TCGACTCGGCCCTGCGGCCAAGCTTTTAGGCACGGCTGGCAAGAT
11   J18   T004089_01   GCATCGACCGCATACCAATGAGGTTGTCACCGAACCGTATACGGC
11   J20   T004090_01   ACTTCGGCAACAACTCGGGCCTCTACAACTTCGCCACTAGCAGCAT
11   J22   T004091_01   AGCCTTATACACGCCGACCTGTTGGCTGCCGCCGACTACAACGTTG
11   J24   T004092_01   ATGTCAGGCCCAGCTGATCCGGTCACTACATGTCTCCTTTGCTGCA
11   L02   T004093_01   CTGGTGGCGCTCACCCCGTTCCGGACTCAGAAATTCGCGATCACA
11   L04   T004094_01   CGGTTCGGGTCGGGCGGTCATTCCGGGTGCATGCCAAGGCCGTC
11   L06   T004095_01   TGCTGATTTTGGCGACGCTGATCTACCTTGGCTGGCGCGCTGCAC
11   L08   T004096_01   GAAACCCGCTGTGAAGGTGGGTTATCCCGAGCATCGCCGGCATAT
11   L10   T004097_01   CAATGTACACGCTGCAAGCAAACCATCGAACCCGGATGGCTATACA
11   L12   T004098_01   CGAAGGTCCTCAAGACCGCGCCCAAAGGTCACATTGCCGGCGACA
11   L14   T004099_01   CTCGGTGGCAATCTCACTTCGTCGAGCCGCGGGCACGGCTTTCGA
11   L16   T004100_01   CGAAGATCACTTTGGCATGCGAGGTGTGCAAGCACCGTAACTACAT
11   L18   T004101_01   AGACGCTAAACGGGTCAATCTGTTGGGCAGCATGCGCCGCATGTG
11   L20   T004102_01   ATGCAAGACCGGCTCATCCACCACGGCGAGCAGACGCAGAATCGC
11   L22   T004103_01   TGCTCGGAGTGGGCTGCATGATGCCGCGCATCTTCAGTCGTCGAT
11   L24   T004104_01   GACACTCCTTCGATGAAGGAGTTGAGTGTGGCAGAACAGCGGTAT
11   N02   T004105_01   GAATATCAGATGTGCGTCAGGGCAAGAGGTTTGAGCTGGAGGTCG
11   N04   T004106_01                  Rv0792c
                        AGCTACACCAATGACGGCAAGCCCCTTGAAGTGGTCGTGTTCCAC
11   N06   T004107_01   GTGTCTTGCAAGAGTTATCGCCTTGACCGCACAATTCTGTATGGAC
11   N08   T004108_01   AGATCATGCTGGTCTTGGCGACCGTGGTTATCTCCTGGTTCGCGC
11   N10   T004109_01   CTGTGATGCTGGAAATGGCTGAACAATCAGGTCTTTCACGAGCGAT
11   N12   T004110_01                  Rv0834c
                        CGTTGTTTTCCAGCCACGGTCAGCAGTATCAGGCGATGAGCGCGC
11   N14   T004111_01   CATGGCTTGTTGGGTTCGTCGTTCCTCGCGCCTGCTCGGCCTGAC
11   N16   T004112_01   TGTGCCATCGCCGCCTCCTCGCTGACGAATCACGAAGGTTGCCTA
11   N18   T004113_01   CCACAGCACCGACCGACTCCGCGATTACTCCCATCATGGTCCGGG
11   N20   T004114_01   CGAAACAGACCATCACGAACAGCTGTGCCGGTATTGCTCGGACAA
11   N22   T004115_01   GCACGATGTCATGCTCCAGGGTGCTGGTCAGCCGATGGCCTTTGG
11   N24   T004116_01   GGTCGGTGCTGTGGTCGGTGATTGGTTGGTATCAGATGACGTAGC
11   P02   T004117_01   TTGAGCGGCAATAGGCGACAGGCTTTGCAAAGCAAGTACCAAGCG
11   P04   T004118_01   GACAATCCGGCGCTTCTTGGGGACTTGCCCGATATCGGCATCGAC
11   P06   T004119_01                  Rv0980c
                        TATGGGGTGGCGGTCAACCCAGGCGGCAACATCTACGTCACCAAC
11   P08   T004120_01   ATCGACGCGTGTCTATCTCGTGTCGAGTTCGAGAGGGGTTTGTAAT
11   P10   T004121_01   ATTCACCAACGCGTGTTGGCGTTGCGGGCATCCGCCAACGTGTCG
11   P12   T004122_01   GCAGAGGCAGCGGACAATCCGCGCTCACGGGTGCTGGCGTTTGC
11   P14   T004123_01   TGTTCCGCGCTTTCGACCTACCTCGTGTTCGACGCATTGATCGCCC
11   P16   T004124_01   TTGCTGTTGTCAACTCTTGCGAGTTACGTGAGTGCGGCCGGAGCA
11   P18   T004125_01   CAAGTCTTCACCGCCGGCGACATCGACTACCGGATGTTTCAAACGA
11   P20   T004126_01                  Rv1068c
                        TACATGATTGCGGTGCCAGACATGCTCAGCTCGGCGGCTGGGGAT
11   P22   T004127_01   GCGGTATGGCAGCACCGATTTGTCTTCCAGGGGAATGTTCGTACC
11   P24   T004128_01   TACTCGCCACCGACAAATCTGCTGATCAACGGTCAAGCCGTCACCA
11   B01   T004129_01                  Rv1091
                        AGAGCACCGACCAGCGGCTGCTCGATCTGATCAATGGGCCCACCC
11   B03   T004130_01   TATCCCGAATCTCACCCACATGACGATCGCGGCGGGCCCGATGAG
11   B05   T004131_01   GACTTCGAGGCTCTCTACCACGGCGACATGCTGGTAGAGGGCGAC
11   B07   T004132_01   GGGCCAGCTGGGACGCCGACGATGTCCGTGACGATCTGCGTGAC
11   B09   T004133_01   CAAGAGTCCAGCTCAGAGGGTGAGACCAAGCGCAAGTTCCGGGAA
11   B11   T004134_01   CTGACTCAGGCCCACCTTGCCAGCGTTCATCCCGGCCTGGAGTAC
11   B13   T004135_01   ATCCGTTGGCGAACAGTAACTTTCGCGCTGGTTACGCATGCGGTAG
11   B15   T004136_01   CGGTGGCGGATTTCGCAAATTGCGGTGTGTCGCAAGTTGTTCAAC
11   B17   T004137_01   ACGCGCTGACCCGCCACAACCACCGGATCGGAACGATCATTCCTG
11   B19   T004138_01   CTCGCCCCCCGAAACGGTCCTCACGATGCCCACGATGGCCACCTG
11   B21   T004139_01                  Rv0978c
                        ACCAACTTCGACAGCAACACGGTGTCGGTGATCGACCCGACCACC
11   B23   T004140_01                  Rv1087
                        AACAAGACCTGTTGGCCGCGATCAACGCTCGCTTCGAGCGGATTT
11   D01   T004141_01   CAGAAACTCATGTGGCAAACCACAATCGGTGCGACATAGTTGGCCG
11   D03   T004142_01   GGTTGATGACTACAGTGCTACACCACATGCCGGACAAGGGAATTCG
11   D05   T004143_01   AACGTGAGCGATCTTGCATGGGAACCATGGCGAACTCAGCGGCTG
11   D07   T004144_01   ACCCGTCCCGGCGGCAACAAGAAGCGACTCAACGTTTGCACATCC
11   D09   T004145_01   GGCTGGGTCGTGAACGGCCCAATGCGGACGTTGTTGAAATTGAAG
11   D11   T004146_01   AAATGGGCGCTTATGCGTCTGCTCGCGCCCGGCTTGGCGCGCAGC
11   D13   T004147_01   CGGTATTCGGCATGGGTCAACTGCCCGCCTTCCAGTCGTCCTGTC
11   D15   T004148_01   TGATGATCAGACTCATGTCGGAGTCCGTCGATGGTGGCCAGCCGT
11   D17   T004149_01   ACGTATCGAAGCTCAATTCCATGCAGTTGTCTGGTCATGGCCGAAC
11   D19   T004150_01   ACAGCAAGAGCTTCCAGCGCAAACCTGACGCGCAGGTACCTGACC
11   D21   T004151_01   TGCGGATTTCCGGCAGTTGCCGGCATCTCTGTACTCCTGTGACGC
11   D23   T004152_01   CCGGGTTACCGTCTTGGCCTCGACCACGGCGACGACGGCACCGC
11   F01   T004153_01   TTTCGGCCATCACCTCGAGGTCTTCACAGCCGTATCGTGGACATTT
11   F03   T004154_01   TAATGGTTACTGTGCGGTCAATGGAAAGGATTTTGCGGTCGGCCCT
11   F05   T004155_01   CGTTACGAAAGCCAGTTCGATTCATTCGGATATATCGAGAAGGTGC
11   F07   T004156_01   GAACGCACCACGAAACGAAACACTTGTGAGGACCAAGATTCTCCGA
11   F09   T004157_01   ACGGAAACTAGTACGCCATCTGTGCCTCATACAGGTCCAGTGCCCT
11   F11   T004158_01   CACACCACAGCCACGCTACTGCTCCATGTCCTCAGACCCAAAACCC
11   F13   T004159_01   ACTACAAGAGATACAAGCCGATATGGGCATTAATGCGCCGCAAATG
11   F15   T004160_01   CGACAATATTAAGAATCCTTGGGTGCGGTCGCGTCTTGTCGCTCGA
11   F17   T004161_01   AACATCACCATCCGGCCACTCACTGCCTTCCAACTCGATTGGCCCG
11   F19   T004162_01   TTGACGTTTTGTGGTCAGGGCGCGGCCCGCTAGTGGTCGAAGAGG
11   F21   T004163_01   CTGCGGGTTGTGTCAAAGGTCACCAGCGCCTTTTTCGCACTGTTTA
11   F23   T004164_01   TTGCGCATACTTCGCCGGGTGAGGTCGCCGGTGAAGGCAGTCCGG
11   H01   T004165_01   TGGCCACGAACATGTGTCCGCGACTGGCGTCTGCGATACCAACCC
11   H03   T004166_01                  Rv0278c
                        CGGTCTAGACGGATTCAATGCTCCCGCGAGCACCTCGCCACTGCA
11   H05   T004167_01   TCGCTGGAAATGGGATGCTTCTTACTGCCGATTTTTGCTGGTGACG
11   H07   T004168_01   TGAGGGCTTGGGTGGGCTCGTTGATCGCGTTGAGGATTTGTTGCT
11   H09   T004169_01   TGCGAGCGCACGGCGGACGGGCAACTGCAATGGGTATCAATTCCT
11   H11   T004170_01   TCCAATGCTGCGACGTCCTCGGTAGACAAGCTCACGCTTGGCTTCA
11   H13   T004171_01   ACTATTTTCGTTCCGACGATCCGGTGGCAGCGGCGGGCTTTGTGG
11   H15   T004172_01   ATGCTGAAGAGGGTCGAGATAGAGGTTGATGACGACCTTATCCAAA
11   H17   T004173_01   CAAACAGGTCAATCCGAGCACGGAGCCATCCTCGATGCTACCGAC
11   H19   T004174_01   AAAGGCAATCCAGATGGACTACGAAACCGATACCGACACCGAGCTT
11   H21   T004175_01   GCTGCCGAATGTGCATTTCGGTCAGGCATTGAGCAGGGGACCGAA
11   H23   T004176_01   TCGCCCGCACACAGCCTTGTCGCGATCAATTTCAAGGCCGAAATCG
11   J01   T004177_01   CGATCGTGGGCGCTACCGCCAATCCGGTATCCGGGTAGATCATGA
11   J03   T004178_01                  Rv0747
                        CCAGCACCTCGCCCCTGCACACCCTGCAGCAGGACGTGATCAATA
11   J05   T004179_01   TACGACAGCACCGAGGAACTGGAGTTGCTCAACCAGCTGTGGCAG
11   J07   T004180_01   GGCGGCAGTCTCAGAAGATTCGACGTTCAGTGCAAAAACAACGTCG
11   J09   T004181_01   GACAGGCTCACGGATATTGACTCCCGGCGCGATGGAAAATCATCG
11   J11   T004182_01   CGACGAGACGACAACAACATCTGTCATCTCAATGCGCTCACCAGGA
11   J13   T004183_01   CGTTGGCAACATCCCGATTCCCATTGATTGCACGTTGCGCGGCCTA
11   J15   T004184_01   ATCGCAATTCCCGCAGTGGGTGAGTACCTGACGCTCCTGTGGTTTT
11   J17   T004185_01   GTGTTTGTCTCGGTAGCTGCTCTGTATAGTATGCGTTGCTTAACCG
11   J19   T004186_01   CTGGAGACCCAGGGGCAACACCCGCACGATTGGCTCAAACATTCT
11   J21   T004187_01   CGATACGAAACGTCTACACATAGAGTTATCTGCCTACGTTCCGTAC
11   J23   T004188_01   GTTTTCGAGGTGAGATCTGGGTGGGCGGCGATGCCCCGTGCTTCG
11   L01   T004189_01   CCTATCGAAGCGACGGGATCCACGCTTCCCGGCTGGCGGTTGAAT
11   L03   T004190_01   CATCAACCCGGTTTCCCATGGACAGAATGCACACCATCCCGCTGGC
11   L05   T004191_01   TTACCACTGACTGGTACGGCTACCTTCCTGCGTCACCCCTTCGCTT
11   L07   T004192_01   GTGCCAAACCATCCCGTCGATATGGACTCTTGGGGAAGATCAGCC
11   L09   T004193_01   GGAACATGCTGTGAGCGCGGCGGCATGCTAGTGACGATGGTGTCG
11   L11   T004194_01   GTGGCGCCCTGGACTACCACTTCGACAGCAAGAAAGATCTGTTCC
11   L13   T004195_01   GCCAGCCCGAACCGCGGTCAGGACAATTTTCACACCAGCCCGATG
11   L15   T004196_01   GGCGCATCAGCGTCTGCGCATCGATCAGCGCCTCGTTGCCGACCG
11   L17   T004197_01   CAGTGAGCACTCCGTCCTCGGGTCCGATCCTTCCAGGAGACGTTG
11   L19   T004198_01   TCATCAGTCAATATTAAAGTCGCAGCTCACAACTATAATACGCCGG
11   L21   T004199_01   GTGTTGCGGACGTGACGAAAGAGCGGTACGGACAGATATTCATGT
11   L23   T004200_01   TTCTGAGCTACAAGCTAGTGCGCGGCGTTTTTCTCGATTGCCGGAT
11   N01   T004201_01   CTGAACAGCTTCGTGGGGGGATCCGCTTCGTCAACCAACGCGGAA
11   N03   T004202_01   GATCTCGGTGGGTTATTTGCGGTGGGATTTTTTCCCGAAGCCGGG
11   N05   T004203_01   TCACCAACCAAACCGTGTGTGACGCCGTGGCGCGAGGTGCGTCGA
11   N07   T004204_01   TGTCGAGCAACCACCGCTGTCACTGCATTGCTGTCACTAAATCGTT
11   N09   T004205_01   ACTTGCTGCTAACGAGCCTGTAGTTTTGCCAGCCCCCACTCGCGCT
11   N11   T004206_01   CGCCAAGGCAGCAGAGCACATCGCCCCGCGCTATAGGATACTAGC
11   N13   T004207_01   CGCTAGCACAAACGGCGCAGCTAACCCAATACGACCAGCTTCACTT
11   N15   T004208_01   TGCGGTGCGCTCGTTGGTGAGGTAGAAGTGTGGGGCCGTGACGT
11   N17   T004209_01   CTGCGCAGCTTCCAAATTAGTTAGGCAGCGCCATGAAACCGCTATC
11   N19   T004210_01   CGAGGAGATGACGGGCCGGCACGCCACAACGGCAACGAGTTTCAG
11   N21   T004211_01   GGTGAGATCATCCCGATTTCTCCCACCCGAAGGTGCGAAATGCAC
11   N23   T004212_01   TTTTCTGTGGCACTTTCCCGCGAGTCACCTCGGATTGCCGTTAGCA
11   P01   T004213_01   CCGACCATCCGTTGCCGGCGCTTGGATCCGCTCTTACCAACGCGC
11   P03   T004214_01   TCAAGTGCGGGTACCAGCGCCGTTTGTTGGTACGACGCTTACCTTG
11   P05   T004215_01   CAGTGTCGACCCTGCACGGCTGGGCTGCAAAGCGAGAGCGCGGA
11   P07   T004216_01   ACCGGTACGATTCAATCTCCATATGAGCGGTGCGGCGGCTGTTGT
11   P09   T004217_01   TCCGGGCGTCCAGGTACTCCTGAGTGCATCAAGTGCACAATTTTCG
11   P11   T004218_01   CGCCACGATGCGTCGGCCAGAGGCGGGTAACGAGAAGGTGGCGG
11   P13   T004219_01   CAGTGGCGTTTCGAACATTTGCTCATTCCTTTCCTAGTTGCGTTGG
11   P15   T004220_01   ACGCTGCTAACCTGGCTGCTCGGCGCGATAGTTACTGGGTTGTAC
11   P17   T004221_01   ACCTCCGGCGTGGCTTGTTCGGACTCACTCGGTGTTTCGTGCCAT
11   P19   T004222_01   GCTGATCAAGGCAGTTTTGTTATCAAATCGTTATGCTGGGAATTCG
11   P21   T004223_01   AAAACAACAACTGTCACACTGGTTTCAGTGGTCACGGATGCATCAC
11   P23   T004224_01   GATGTTGACGACCTGGCTACCCAGCAGGACGTCGACGACGGACAG
12   A01   T004225_01   GCACACCGGCTCGAAGAAGTCGGCCACGCGCATGAGGTAGTCGCG
12   A03   T004226_01   AGGGGACGGAAACTCCACATCGATTTCCTTGACCTCGCCAGGAGA
12   A05   T004227_01   ACCATCGCCGCAACAACTAGTGCGCATGGTTCTGGATCAGGTCGT
12   A07   T004228_01   GGTCTGCTCAGCGCGGCCCCGAATTAGGACAATTTTCGCACCTAG
12   A09   T004229_01   GCCTTCGTAACCACGACGACGACAAGAAGGGATGAAGCGATGAGG
12   A11   T004230_01   CAAGACAGGTGTCAATAATTCGCTCCGCTGGTGACGGTAACCGGT
12   A13   T004231_01   CGGCGGTGGTGTCGCTCGCGAGGATCCATTGGAACCTGATCCGCT
12   A15   T004232_01   AGAGGAGATCGACGAGCGCCGCCGCATGAACGGGCAACTCAAACA
12   A17   T004233_01   GAATACTGGCTGGCCCCCAGCGGTTTTACGCGCGCACCACAAAAC
12   A19   T004234_01   ACTGTAAGCCATTTCTGGGACTTTGCTGTGAAAAGCTGGGCGATGG
12   A21   T004235_01   GAGGTCCGAATTGGGCTGGGTGCGCAATCGACGTTAGGGGCCTG
12   A23   T004236_01   TGGGATTGCTGCTGATTGCTGTGTTGGGAACGGATTTGGGAACAG
12   C01   T004237_01   AAACAGGACGTGTCGGTACTGACAGTCCCCAGACAGACCCCCAGA
12   C03   T004238_01   ACGTGAACCCCGGAAAGCGCGCGAATGAGAAGGAGGCATGTGGTG
12   C05   T004239_01   GGTGTCGATGGTTGTTCTCATCTGGTAACTCCTTTCCGCAGGCCGC
12   C07   T004240_01   ACGCAATGGTGGTGCGCTTCCCAAGGGAGCACAACGCGAAGCTAA
12   C09   T004241_01   TCCATGCGATTCGCATTGTCGCGCCGTCTGACGGTCACCATAGTG
12   C11   T004242_01   TTGGCGTGCGCGCCAGGCGGGCGATCAGATCGCTTGACTACCAAT
12   C13   T004243_01                  Rv3514
                        GATGAGGTGTCTGCCCGTATTGCGGCGCTGTTCGGCGGGTTTGGC
12   C15   T004244_01                  Rv3514
                        TCGCACCGGAATTCGTGACAGCAGCCGCGGGGGATCTGACGAATC
12   C17   T004245_01   CGATGTGGATGGAAGTAAGGCACGGGTGTTCTCGCGCGTCGCGAA
12   C19   T004246_01   TGCAGACGCTTACGTCAAGGAGCAGCATTGTCGCCGATCAGTTCG
12   C21   T004247_01   ACGGCATGTTCACTTGTTGTCGACTACATCGTCTGCGCACATTTGC
12   C23   T004248_01   TGTCCGCGAATTCACCGGAATTTGAACTGGACCTGGCCGGCAATC
12   E01   T004249_01   CTGCACCCGGGTGTGAGCGTAGATCACTCATGTCTTAGCCGATGC
12   E03   T004250_01   GATAAAGCTAACCGGTGCCAACGAACGACGCCACATCGCACATGT
12   E05   T004251_01   GTGATGTGTAGCCTGCAAGACACCGGCTTTCTTGGCTATGACTGCA
12   E07   T004252_01   GAATTGTTTTCACCGTCGCAGTCATCTTCTTCTCTGGCGCGTTGGT
12   E09   T004253_01   CCGGGTTTTACGGGCCGACACGATGCGTAGCGACCAGGTGATGTC
12   E11   T004254_01   TCATGGTTTCGCCACCCGGTCAAAAGCCACGAGTTCCCCGCCAAG
12   E13   T004255_01   GTCAAGCGGGTTTTGTCATATCGTTTTACGACTTGTCGAGTCCGAT
12   E15   T004256_01   TCACTGATGGTGACCGACGCGGTCATCCGGTTGGCGGTCGCCGCG
12   E17   T004257_01   TTGGCCCACGCAGAAATGCCTGGCCTTCGCGACGAGTTGGGGCTT
12   E19   T004258_01   CTGGGACCTGGTGTCCTACGTGGAGCGGGCCGCGGCTTTGGCGT
12   E21   T004259_01                  Rv1817
                        ATCCCGATTTCCACAAGCAGCCGGAATTCCTTGCAGCACAAGACAA
12   E23   T004260_01   ACACCGTCGCCATCGCCGGATCCGCTCATCGACACATCATCCGCC
12   G01   T004261_01   AACTTACCGAGGCCATGCTCGCCAAACCCATGTCGGCGCGCCGCA
12   G03   T004262_01   AGATGGGTTCGTCGAAGGGGTGGACGGCATCGGGGATCGCCCTC
12   G05   T004263_01   TGGGCGCCACGAGCACGACCGCGTCGAGCTGCCGCGCGAGGTTC
12   G07   T004264_01   ATCTGCGAATCGCGCTGGTGGCTCGGCGGCACATCGACCTCAAGC
12   G09   T004265_01   TTTACCACGCGTGATGTCCAGGCATCCCTGATGCGAATCCCGGCC
12   G11   T004266_01   TGCTACGGCGCGTGCAGGCCGGCGAAGACATCACCATCACTGCCA
12   G13   T004267_01   AGAGTGACCGGGTCGCCGGGGCAACCGTCAACGTTGACCGAGTAC
12   G15   T004268_01   AGCTCGACACCGCACGCGAGGTGATCCGTGTGCAGGGGGAACTG
12   G17   T004269_01   GAGTTCGGAGCCGCAGCTTTGCGCGAGCAGCGGGCACTGGTCATC
12   G19   T004270_01   ATGGGAGTACGCCACGGTCCCGCTGTTGACGCACGCCACCAAACA
12   G21   T004271_01   TGGGGCGATCCAACGGATCCTGCGCGCCCAGCTGGCTGGCGACC
12   G23   T004272_01   GCCGGCGACGATGCAAAGCGCAGCGATGAGGAGGAGCGGCGCGC
12   I01   T004273_01   ATGACGCTCCAAACCTTGTCTAGCGGTCGGGCCACCACCACGCTG
12   I03   T004274_01   GTAACGATCCTGGCCACCCGGCCGCCGAGCTGTCTGGGCATCGAA
12   I05   T004275_01   CTTGCCGGCGGTGACGGGTCCGTATATGGTGCTCGGCGCAGTGAA
12   I07   T004276_01   CACTCGCCGGACTTGGTCTCCTGCAGTTGCAGGCGCGCCTTGAGC
12   I09   T004277_01   AAGTGAGCCACCACCGTAGCGCCGCCGAGTTCGCTTCCGCGGACG
12   I11   T004278_01   TCCGCCGCGTCGATCCTTTCCACGTGGTGGCCTGGGCCACCGAGG
12   I13   T004279_01   GAACCATCGATCCAGCAAGGCTTTCGACCTGCGCGGGGGTCACGT
12   I15   T004280_01   TGAGTGGTTACAACTTGGCCGCCGTGCTGGCGGGATTGCCCGACG
12   I17   T004281_01   ATGATCGAGTACGCGGTGACCCTCCACAGAAAGCCGCCCGGGCGC
12   I19   T004282_01   GTCCAGCAGCTGGCGCCTGCGAAACGTGTGGAAGCGCTGCATGCG
12   I21   T004283_01                  Rv1450c
                        ATGGGCGGTGATGGCGGCAACGGTGCCAAGGGCACGTTCGATAAC
12   I23   T004284_01   TTGATTTCAGGGGTGACGTTCTTGGCGACTCTCCGGCGCGTCGGC
12   K01   T004285_01   CAATGGCGGTGTCGGCGGCAACGCCGTGCTGATCGGCAACGGCG
12   K03   T004286_01   ACGGTGTCCACGTCGAGGCGCCGGCCTTGTGGTACCGGTAAGTGC
12   K05   T004287_01   TGTGTGCTGAACGAGTACGACCCGTCCCTACAAATTGCGGTGGCG
12   K07   T004288_01   CGGGTCGGCACCATCGGGCTAAGTGCCGATCGCAAGCGCGGCGC
12   K09   T004289_01   CGGGTCGGCACCATCGGGCTAAGTGCCGATCGCAAGCGCGGCGC
12   K11   T004290_01   ATTGACAACAACGCATTTGGTGTCGGCGCGGCTGCCGCGGTGCCA
12   K13   T004291_01   GGCGGTCAAGGCTCGCGCGAGCCGGCTGTACGCGCCATTGGTGT
12   K15   T004292_01   TCAGCCGCGCCAGGATCGGTCGGCAATGGCACCACCGGAGCAGG
12   K17   T004293_01   GGACCGACTACGCGAGGCGGCCATATCGCTAGCCCTGTGGCGCC
12   K19   T004294_01   TTGAACCGCACCATGATGGGGTGCGCGGACATCGGTTGGCGATAC
12   K21   T004295_01   GTGTGGGTCGCCAACGCCGTGCTGCCAGCCTCCGGCAAGCTCGA
12   K23   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
12   M01   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
12   M03   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
12   M05   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
12   M07   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
12   M09   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
12   M11   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
12   M13   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
12   M15   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
12   M17   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
12   M19   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
12   M21   c16_01    GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
12   M23   c178_01   GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
12   O01   c191_01   GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
12   O03   c215_01   TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
12   O05   c3_01     AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
12   O07   c38_01    GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
12   O09   c7_01     GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
12   O11   c86_01    CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
12   O13   c91_01    GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
12   O15   c13_01    ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
12   O17   c155_01   CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
12   O19   c229_01   CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
12   O21   c242_01   TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
12   O23   c47_01    CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
12   A02
12   A04
12   A06
12   A08
12   A10
12   A12
12   A14
12   A16
12   A18
12   A20
12   A22
12   A24
12   C02
12   C04
12   C06
12   C08
12   C10
12   C12
12   C14
12   C16
12   C18
12   C20
12   C22
12   C24
12   E02
12   E04
12   E06
12   E08
12   E10
12   E12
12   E14
12   E16
12   E18
12   E20
12   E22
12   E24
12   G02
12   G04
12   G06
12   G08
12   G10
12   G12
12   G14
12   G16
12   G18
12   G20
12   G22
12   G24
12   I02
12   I04
12   I06
12   I08
12   I10
12   I12
12   I14
12   I16
12   I18
12   I20
12   I22
12   I24
12   K02
12   K04
12   K06
12   K08
12   K10
12   K12
12   K14
12   K16
12   K18
12   K20
12   K22
12   K24
12   M02
12   M04
12   M06
12   M08
12   M10
12   M12
12   M14
12   M16
12   M18
12   M20
12   M22
12   M24
12   O02
12   O04
12   O06
12   O08
12   O10
12   O12
12   O14
12   O16
12   O18
12   O20
12   O22
12   O24
12   B02
12   B04
12   B06
12   B08
12   B10
12   B12
12   B14
12   B16
12   B18
12   B20
12   B22
12   B24
12   D02
12   D04
12   D06
12   D08
12   D10
12   D12
12   D14
12   D16
12   D18
12   D20
12   D22
12   D24
12   F02
12   F04
12   F06
12   F08
12   F10
12   F12
12   F14
12   F16
12   F18
12   F20
12   F22
12   F24
12   H02
12   H04
12   H06
12   H08
12   H10
12   H12
12   H14
12   H16
12   H18
12   H20
12   H22
12   H24
12   J02
12   J04
12   J06
12   J08
12   J10
12   J12
12   J14
12   J16
12   J18
12   J20
12   J22
12   J24
12   L02
12   L04
12   L06
12   L08
12   L10
12   L12
12   L14
12   L16
12   L18
12   L20
12   L22
12   L24
12   N02
12   N04
12   N06
12   N08
12   N10
12   N12
12   N14
12   N16
12   N18
12   N20
12   N22
12   N24
12   P02
12   P04
12   P06
12   P08
12   P10
12   P12
12   P14
12   P16
12   P18
12   P20
12   P22
12   P24
12   B01
12   B03
12   B05
12   B07
12   B09
12   B11
12   B13
12   B15
12   B17
12   B19
12   B21
12   B23
12   D01
12   D03
12   D05
12   D07
12   D09
12   D11
12   D13
12   D15
12   D17
12   D19
12   D21
12   D23
12   F01
12   F03
12   F05
12   F07
12   F09
12   F11
12   F13
12   F15
12   F17
12   F19
12   F21
12   F23
12   H01
12   H03
12   H05
12   H07
12   H09
12   H11
12   H13
12   H15
12   H17
12   H19
12   H21
12   H23
12   J01
12   J03
12   J05
12   J07
12   J09
12   J11
12   J13
12   J15
12   J17
12   J19
12   J21
12   J23
12   L01
12   L03
12   L05
12   L07
12   L09
12   L11
12   L13
12   L15
12   L17
12   L19
12   L21
12   L23
12   N01
12   N03
12   N05
12   N07
12   N09
12   N11
12   N13
12   N15
12   N17
12   N19
12   N21
12   N23
12   P01
12   P03
12   P05
12   P07
12   P09
12   P11
12   P13
12   P15
12   P17
12   P19
12   P21
12   P23
13   A01   T100001_01                  Rv0029
                        CGTCACGGGAGACCCGATCGCGGCGAACTATCACTTCGCGTGGTT
13   A03   T100002_01                  Rv0199
                        GAACTTGCGGCTCGATGTCTCCGATGTGGACGGCAAGCTGATGAT
13   A05   T100003_01                  Rv0228
                        GATCGGAGCGTTCCCGTTTACCGGGCGAATGCCGACGGTGCTGGT
13   A07   T100004_01                  Rv0234c
                        CATCGACGACATCGTGGCGGGCCAGGTTTTTATCAACGGCATGAC
13   A09   T100005_01                  Rv0314c
                        GGTTCTGGTGGGTGGCATCGCCGCATTCAGCGCACAGCGGCTTTC
13   A11   T100006_01                  Rv0360c
                        TGAGCCAATCCTGTTGCCTGGCGACAGCGACGCCGAAGCGGAGCT
13   A13   T100007_01                  Rv0390
                        CCTTGGTCGTGAAGTGGTCTATGTCGAATGGGCGACGTCCGACGG
13   A15   T100008_01                  Rv0492c
                        CATTTCGCGCACAGAACGGCCGCGATTTCATGTGGAACAGCGGGG
13   A17   T100009_01                  Rv0558
                        GCTACTAGTGTGCGAATTCTCCACGCCCACCAATGCGTTGTTCGCC
13   A19   T100010_01                  Rv0740
                        AGAATTCGTGTTCGTGCTCGGCTATCTGGGGCATGTGCGGGCCAT
13   A21   T100011_01                  Rv0999a
                        ATCGTTGCGACTGCCGTTGGCGCATGGCGATCTATTGGTGATGGG
13   A23   T100012_01                  Rv1103c
                        GAGTACACAGATTGCGGTTCGCTTGCCCGATGAGATTGTCGCGTTC
13   C01   T100013_01                  Rv1125
                        GCAGTTCTACTGGATGTCGGCCAAAGTCCCCAACGACCAGTTCCTG
13   C03   T100014_01                  Rv1179c
                        ATGGCGAAAGCACATCGGCCCACCCCGACAACTGCCAGCAGACTC
13   C05   T100015_01                  Rv1285
                        GTTCCCGGTCATGCACGTCGACACCGGTCACAACTTCGACGAAGT
13   C07   T100016_01                  Rv1388
                        CAAAATGAAGGTGTCTGCGCTGCTTGAGGCCTTGCCAAAGGTGGG
13   C09   T100017_01                  Rv1424c
                        TGGAACACGTTCTGCAAACCGGGAGTTCAGCCGATTCGTCGTCAC
13   C11   T100018_01                  Rv1486c
                        GAGCACCATCGGACTGGGATCTAGCGACGTCGCCAATCCCCGTGG
13   C13   T100019_01                  Rv1510
                        CGTTGCCTGCGTCTACACGGTCATCTATCTGGCGGCCCGCGACCT
13   C15   T100020_01                  Rv2123
                        CGCGCAATACACCGAAATTGCAACGGAACTCGCAAGCGTGCTCGC
13   C17   T100021_01                  Rv2124c
                        CATCGGCAAGAACCTGGTCGACATCATCTTGAGCAACAACGGCTAC
13   C19   T100022_01                  Rv2227
                        GGTCGATATGGCATCCAAGCGGTACGGCGCCGGGCAGTATCGATA
13   C21   T100023_01                  Rv2227
                        CCATGGGCTTTCGACTATTCGTTCCGGCGAACGCTATGCCATGGG
13   C23   T100024_01                  Rv2246
                        GATCGATTTGGACGTGGTGGCGGGTGAACCGCGACCGGGCAATTA
13   E01   T100025_01                  Rv2269c
                        GAAACGGTTACCGATCACGGCGCCGTTGGTCGGCGCTATCACCAG
13   E03   T100026_01                  Rv2274c
                        GCTGCTGCCGCTGTGGCGGCGGGTACACTCACATATTTTGCGTAT
13   E05   T100027_01                  Rv2295
                        CGCCGACAAAATCGAGGAATTCATCCTGACGCTCGATCGAAACGG
13   E07   T100028_01                  Rv2405
                        GCTCGACGTACCCGAGGAGAGTATCCGCCGCGAAGGCGCGATTCT
13   E09   T100029_01                  Rv2415c
                        ACTCGCACGCCGCATCTGCACACTTAGACCCGGAGCCACACGATC
13   E11   T100030_01                  Rv2513
                        GGACATAACCTTCACGGTCACGCGGGCCATAAGTTCGGGTGGGGA
13   E13   T100031_01                  Rv2740
                        ATGTCTACGACATGTTCAAGGGCCTCTTGCGAGGCCTGGTGGCGC
13   E15   T100032_01                  Rv2767c
                        GAATCCGCCACAGCTGGGGCACGTTCAAGCCGGATACCGTTCGGA
13   E17   T100033_01                  Rv2926c
                        CGACGAAACCATCGATCTCGAGCAGCCGATCATCGATGCGGTCGG
13   E19   T100034_01                  Rv3278c
                        GGATTTTTCGCACCGGGACGTTGATTATCGAGTCCGCGTCACAAGA
13   E21   T100035_01                  Rv3287c
                        CTTGCCGGATGCCACCCTGCGCCTGGTGGTCGATCCGCGAAAAGA
13   E23   T100036_01                  Rv3328c
                        CGACGGAAAGGTGTGCGCGCTGTGGGATATCGCCAATCCCGACAA
13   G01   T100037_01                  Rv1576c
                        AGCTGCTGGATTCCGTTCTCCATCGAGCTGGAGGGTGACGCGGCG
13   G03   T100038_01                  Rv1576c
                        GAAGCAATTCCTCATCGGCGACAGAGTTGGGTCCATGGTGGAGTT
13   G05   T100039_01                  Rv3519
                        CAAAGAACTGGCATCGCTGGGCCTGCCGAAGCGGGCTCTGTTGTC
13   G07   T100040_01                  Rv3558
                        CCGGAGCGGCTTGAACACGGGCCTGTTTAACATGGGCACCGCCAT
13   G09   T100041_01                  Rv3695
                        GACCCAGTTCGACGAAGCCTTGACCACCGCATTCCTGATCATCTTC
13   G11   T100042_01                  Rv3840
                        ACTGATATCGATCCCGCGTGACTCTTATGTACCGATCCCTGGCCAC
13   G13   T100043_01                  Rv3887c
                        CAAGAGCCTCGACGAGCTGGGCGTTCAAGACGGTAACACGCTGGT
13   G15   T100044_01                  Rv3911
                        GGTCAACGCTTGCCTGGACCGGCTGCGTCGGGCCAAAGCCCATCC
13   G17   T100045_01                  Rv1291c
                        CGCGTCGGCCTACTGCCCGCAGTACGTGACCTCGAGCTAA
13   G19   T100046_01                  Rv2365c
                        ACTCGCCCCGACCGCTGCGATCATCGTCACCGATCGGGCA
13   G21   T100047_01                  Rv2369c
                        CATCGAACGGGCGGACACAGACAGGCCTCATCGCGGATAA
13   G23   T100048_01                  Rv2598
                        CGAACCCGATGGAACCGGGTGGCGTTGGCGGACTTGGCAT
13   I01   T100049_01                  Rv2811
                        GGGTGACGCATGTGTTGTTGCCGGTGAGCGCGTTGCTGCG
13   I03   T100050_01                  Rv2922c
                        GCAGTCGACGGAGCAGATCACCGGGTTCAGCGAGCGGTAA
13   I05   T100051_01                  Rv3344c
                        TGATGGGAGCTTCGGCGCTACCAGCGGCCCCGCCTCCATC
13   I07   T100052_01                  Rv3653
                        CGCCAGCGTCTCGCCGCTGCAGAGCGCGCTCGATTTGCTG
13   I09   T100053_01                  Rv3654c
                        ACAGGCGGCGGCTGATCTGGCTTCGTTAGCCGCTGCCGCC
13   I11   T100054_01   TGACCTCGAGTCCTTCGTTGCGGGCCAGCAGAGCCGCATTGTCCG
13   I13   T100055_01   TGCCGTCGATACGCCCATGGGAGCGCGTGAGTTTCAACGTTCCTG
13   I15   T100056_01   CGAGTCGATTCAACGTTTGACGGAGTTTGAAATGAAGTTGAAGTTT
13   I17   T100057_01   GGCATCAACCGAACAGGATTTCAGGCTGTTCTCGGGAATGTCTGCC
13   I19   T100058_01   CGTCAACGGTCGTCCGTTCGACGCGATAGCACTGGTCTCTGTTCG
13   I21   T100059_01   GCCCGTAGAGCACCGTGGTGGTGATCTGCGGGGACAGGAACGAC
13   I23   T100060_01   AGTGACCCTGATGGTGCAGCAGGACAAGAAACCGCCACTCCCCGG
13   K01   T100061_01   TCACCGGCTTCCTGCATCGTCATCGCCTGACGGGAAGAATATTGGC
13   K03   T100062_01   TCCGAGACTGGCCAAATCCGTTGCCGCTGCCGCGATAACCTCTGG
13   K05   T100063_01   GCAGTCGGGGTTGGAACAGCCCGGGAGACAGACGGGGTGGGCGA
13   K07   T100064_01   CGGCATTGAGGGCGTCGTGCCAGGCCAGCACGGTAGCGATCTCC
13   K09   T100065_01   GCACGTCGCCGTAGTTGGTTCGCGACAGGCGCTCCTCGATAGCTG
13   K11   T100066_01   GTACACACTCATGGGGGTAAAGCGTATAGCTTCTTCGATCCGAGAA
13   K13   T100067_01   CAACATCAGGACCCCGTGCCTTTACCCAATACCCGTGTTTTGGGCA
13   K15   T100068_01   TCACCCACGGAATTCGACGACCTATCGCGTACCACTAGGACTAAGG
13   K17   T100069_01   GGTCGGCTTCTACCTACTTATCGCCGTAAACGTCATGCTGGCTGCC
13   K19   T100070_01   CCAGCAATACCAGCATGACGGTACCCACGAGGTGGCTCACGCATT
13   K21   T100071_01   TGTCGTGTCGCCCTGTGACGTCATTGAACGGACCCTACTTTCCCCA
13   K23   T100072_01   AGGCCTGAAGAACTGGGTCGAGGCCGCCGACAACGGTCACTCTCG
13   M01   T100073_01   GCCTGGTAGTCGGCATTGTGCACAAGTGGGTTGGGCATTCAGCAC
13   M03   T100074_01   GATCTGGTCGAAGTCACCGAGTCGCATCAGTTCGTTAGCCACCGC
13   M05   T100075_01   CTTGTTGACGCTATCGTCAAAAGGGCAAAACCCCAAACTTTACGCG
13   M07   T100076_01   CGTCGAAATAGGCAAGCAGCGCACTCGTGTCGATGATCACCGCTC
13   M09   T100077_01   GCAGCAAGTTACCGGAAACGCCGATGTCGCGTCCGTCAACTCGCA
13   M11   T100078_01   CATATACGGTGACTTCTTCAACTTCTATCTGTGTGACATCTCACTGA
13   M13   T100079_01   ATTGCCTTTGGTGAGCGTCGGGACCGTCGTGACCTCCGAGGACGT
13   M15   T100080_01   GATGGATCCGCAATCGGGCCCACATTCGGGCGGCATCGTCGTCGA
13   M17   T100081_01   CGTCATCCGCCTGGACGCATCGGCGCGATGTATCCTTTCTCCGCA
13   M19   T100082_01   CCAGATCTACGCCAAGTTCGCCGCCGATCACGCCGACTTGGACTT
13   M21   T100083_01   GGTCGCAATACCCACGAGGGTTTGGCCGAGGTTCATTCTGCGAGT
13   M23   T100084_01   TATGCTCGCTGGCGCTGATGCTGGCCATGTTCGGAGCCAATGTCT
13   O01   T100085_01   GTCGATGACCCCTGTAGTTGCTTCGGTGGTTGTGCCAATCATGGC
13   O03   T100086_01   GGTTACAACGGAAGTTCAGACTAGGGCATCTGAAACGGCGAACGA
13   O05   T100087_01   ATGCCGGTTCATGGCGTCCCGCCGTTTCGGAACCATGGCTATGGT
13   O07   T100088_01   GGAAGCCCATACCAAAAGAGGAAGGCCCACCATGGCTGTGCCCAA
13   O09   T100089_01   CACGATGTTTGACCGGAATGCCTTCGTCAACCTGTCTCGGTCGGC
13   O11   T100090_01   ACGACCCAACACCGCGGATTATCTTAAGCAACTCTTAAGTAGCTGC
13   O13   T100091_01   GGTATTGTTGTTCATGCAGACCTTGTGCGAATCCATCCGTTCACCG
13   O15   T100092_01   CGCAATTTTCACGCTCGCGACCGCCCTGGGCGTGCCGGGTCAGAA
13   O17   T100093_01   CACCGGTGCGGTTCTGCAGGCTCCGGGCAACGCCGTCAACGGTTT
13   O19   T100094_01   GGGCGTACCGTCAGCCAGCACTGTCGCATTGCCAACGTTTGTGGG
13   O21   T100095_01   AATCTCGCGGCATCCAGCGCTGCCGGTGCTGACACAGGTGTACGA
13   O23   T100096_01   AAGACGACGACGAACCACATTGACACCCAACAACGAAGACGTTGCC
13   A02   T100097_01                  Rv1037c
                        GTTCATTACCCAGCTGGGCCGTAACTTCCAGGTGATCTACGAGCAG
13   A04   T100098_01   GCACATTTCGAGCATGGTCCAACGGAAACCGAACACAGTGATCGG
13   A06   T100099_01   CGACGTACTCAGAGAGGCGATTGCGGACTTCGCCCAGTGGGACAA
13   A08   T100100_01   GCACCAACAGGATTCCCGTGGGACATTCACGATCATCTTTACAGGG
13   A10   T100101_01   GAGCATTCCAAAGGGCTACCGGGACTTCGGCTTTGGCAGTCTACG
13   A12   T100102_01   GGGCCTTGACAGATTCTCAATAAATCCTTGGCAATATCGATACCGG
13   A14   T100103_01                  Rv1325c
                        GTTGGAGGGCCTGCTCAACATTGTGAACACGCCCACCCAGCTGTT
13   A16   T100104_01   GATTACAAACGACATGCTTTCCTCCGATCAGCTGTGCGTCGAGTAT
13   A18   T100105_01   GATGGCCCCAGCCGAGGACGAGAACGTCCCCGAGGAGTATGCAG
13   A20   T100106_01   CAGTAAGTCGTTGGGAACCCTGAAGCAAACGCATTCGCGGTACTTC
13   A22   T100107_01   CATCAGCGTCAACTCTCCTCTATTCGCGCGCAGATATTTCCGCAAT
13   A24   T100108_01   AGATCGCGTTGTTAATGCGATTCCGGCGGCGTCATTCCTGACGTTG
13   C02   T100109_01   AAATATCCTCGCCAAGGTATGTAATTTGATTGAACAATCGCGACTTT
13   C04   T100110_01   GCAGGCACGCCTCCAAATGCCCGGTGTCATAGATTTCCAGTTCCG
13   C06   T100111_01   CTCATCCTGTTACTGCGGCGCACCGCGTCAGCTCGTTGATCGACA
13   C08   T100112_01   CAGAGTTCGAGCCGCTCGAGATTGCAGCGGGCCCTCGATTCGCCG
13   C10   T100113_01   AGACCGGATCGAAAGCTATCCCGCCGACGGAGACCGGGTAATCAC
13   C12   T100114_01   TCAGCACAACGCTTTAAAGTTCACGCAAAACACGATCAGGGGACAA
13   C14   T100115_01   CCCAGCGGAATTCCGACGGCGGCTCGGTGCCGTAGACCCCGAAAC
13   C16   T100116_01   AGGGGCGAAGGCGAAATCCAAAGGCAAGGCCCGCCGCGGCTCTC
13   C18   T100117_01   AGCAGGATTTGTGATTCCGGTGCGCAAGAAGGGGGTTCGAGCCGA
13   C20   T100118_01   TGGTGACCAGACCAGGAACAAGCACCAAGACCGAGGCAACGGTGA
13   C22   T100119_01   GACGATTAGGGTTTCAACCCAGACTCGGGATCGTCTGGCCGCCCA
13   C24   T100120_01   GGTCGTTTCCGTGGACGAGCTACTCACCGGAATCGACGACGAACT
13   E02   T100121_01   TGTCGTGGATTTGACGATCAAGTCACCCTGCGGTCGGCTCGAAGG
13   E04   T100122_01   CGCCGGTCGCCACGTGCCACACGGGTTGGTGATCACTGACATCGA
13   E06   T100123_01   TCCGTCGACAAGAGAGAAGGACTGCATGCTGGTTTTGCACGGCTT
13   E08   T100124_01   ACGTTTGGCTGCGGATGCCGTCAACGAAACACGGGCGATTGTTCA
13   E10   T100125_01   ACCCTACGACTACCTGCTACACATTCGGGTCTGCGACACAGCGGA
13   E12   T100126_01   GTCGTTGTCGGTGATGCCGATTTTCGAGGCACCGCAGTCGACGCT
13   E14   T100127_01   AATGCTCGAGCGTGCAAAGTTTCCGCGGCGCTTGTTTTGTCGTAAT
13   E16   T100128_01   TCGGGCGATCTACTTCTTGCCTTATCGATCGCCCTGGTGTCGGGG
13   E18   T100129_01   CGCCGCGGTGGCGGCAAAGCAGTGGTTCAGCAGTGCCGCAAGCA
13   E20   T100130_01   ATACCCGCTCGGCCGCAATGCGCAGCTAGCGGCCATGTTGATCGA
13   E22   T100131_01   CGGTTCCTCCAGATCGACATCGGACGCGATTCGGCACGATGTTAG
13   E24   T100132_01   AGTGTTGGGCGGATCGTCAGGCAACGGGCCCTCTAACGCAGCGTC
13   G02   T100133_01   CGCGGTATTGCTCGGGCAGGTCGTCACGGTTTTCGTTGAGTATTG
13   G04   T100134_01   GGTTGTGCTGTCTGTGCTGATCTGGTCGCGCAAGGGACCTCACCC
13   G06   T100135_01   GGCATGGCGCACCGCATTCGGTTTTTCTGAGCGTTGGGAAAATGG
13   G08   T100136_01   CTGGCTACATCGCTCAAATATTCGAATGAGTCCGGCTAAAACCTTT
13   G10   T100137_01   TGAGCAGGATGGTCGCCAGGTTGTAGCCGGTCATCCGTTGCAGCG
13   G12   T100138_01   GAGCGTCGCCGGCGTTGCCAAGTGCAGCCCAGAAGGACGTGTCG
13   G14   T100139_01   CATCGGCCGCAACCTTGGTTCGATACCTATCTTGGAGGTCATTTAC
13   G16   T100140_01   ATCCGGGCAAGCCGAATTGCGTGAGCCGCACCGCCATTAGCAGCC
13   G18   T100141_01   TGGAGCTGCCGTGACAAACGACATCAGCCACCCTCCCAACCCGTC
13   G20   T100142_01   CCAGCTTTTCGGCGGCCAGGCTGGTCAGCGAAATGGATTCCATCG
13   G22   T100143_01   ATCGCATTTGTACTGGTTAGAGACTTGCCGAGTGGCCGCATTAGCC
13   G24   T100144_01   TGTCCAGGATCAGTTCCGGATGGGTGTGCAGCGCGCGATTGAGAG
13   I02   T100145_01   TCACGCCAACGAGCACGAGGCGAAACTGACCGAGATGTCCGCCGT
13   I04   T100146_01   CGGTGGTGAGGTTGCACATTCGTCAAAGCGGGCAATCGCCGCACT
13   I06   T100147_01   GTACATGCCCGAGACTCTGACTGGTCGCCTCAACTTCCGCCTGTCT
13   I08   T100148_01   CATTGAGCTTGCCCTTGATCGTCGAAATCGGCAGTATCCGCATACC
13   I10   T100149_01   CGAAGTGCTCCACCTCGGTACTTGCCACGGCGATTCCTCCGGTTG
13   I12   T100150_01   GCCGCACCAAGCAGCGACCAGCAAAGGATCAGTACGCTGCGGCTC
13   I14   T100151_01   CCCGGCTCCGCCGCACTCGCGATCGCCACTACTTCTTGCCTGGGA
13   I16   T100152_01   TCATGGCTTCTTTCTACCCGGGGGTCTTTGCGTCGAGATCGACGG
13   I18   T100153_01   AACAACTGGCAACCCCTACCAAGTGTGGTGTCTGCGATGGGTGAT
13   I20   T100154_01   CTTGCAAGAGGCGGGTTGGCCACCCAAGATCACGCCGCCCAAGGG
13   I22   T100155_01   GGCAGAGCTTCGTGCTCTGGGAGCCGGGTCATGCTGCGAGGCTG
13   I24   T100156_01   ATTCGCATGGGATTTCGCAGTGCCGTCACGCTCGCGGATCAAGAC
13   K02   T100157_01                  Rv3018c
                        GTTTGTTGGGACGGCTGGCAAGGAGTCGGTTGGGCAGCCGGCGG
13   K04   T100158_01   CACCAGTCTCAAGGTTTCGACATCACTCGCGCCAGTGTGGTGCGG
13   K06   T100159_01   TCCGTGCCACCCCCTAGGTGTAGTGTTTTCGAGTACCGGCAGATC
13   K08   T100160_01   ACTTTCATCTGCGGCACCGGTGGATTGGCGGAATCCGCCGAAGAG
13   K10   T100161_01   TCTAGAAGTCCGGCGTGCTGAGCCATCGGTGCGTCACGATGTGTC
13   K12   T100162_01   CTTCCAAAATCTCCATGATCTCCTCGGCAGACTTCACGTCACCCCT
13   K14   T100163_01   GAAGGTGTTGCAACGGAAGGTGTTTGCCGTCCGCGCTGGGCCTTC
13   K16   T100164_01   CGGCCCAGCGGATCGAAGGCGGACTGAACAGCAATACCAGCACGC
13   K18   T100165_01   CCGGATAGCTCATGCCCGCGACCTTAATCTTTTGGGGACGCCAGC
13   K20   T100166_01   CATCATCGAAACTTTCGTGATCGCAGAACTCCGGCGACAACTCGGA
13   K22   T100167_01   TCGATGTGAGGAGTCAAGCCTTCACGACGTGTGCTGCGGCAGGCT
13   K24   T100168_01   TATCAGTGAAGGAATACGCGGTTACCTCACCGAAAGATCTACCTTA
13   M02   T100169_01   GCAGATCGGCTACGAGCGCTCCCGTGAATTTCATCTGTGCGTTGTC
13   M04   T100170_01   GGTTGCCGATCACCCGGTGTTTGGCTCAGATTGCCGGTGCCGCAT
13   M06   T100171_01                  Rv1575
                        GCCCATGGGCCCCAAGCCAGAATCGGAGCGTCGTTCGACGAAAAC
13   M08   T100172_01   GGCGTGTGGCTTTGACTGCTGGGGGTCAATCGGGTTCGTCGTCGT
13   M10   T100173_01   CATCGATCTCCCGAACACCGACCCCACTCGTGTCGGTACTCACCTG
13   M12   T100174_01   GGTGATCGGCATTGCACTCCTGCGGGTTCGCTACCTAAGCAAGCA
13   M14   T100175_01   CTATCGAGCGTTCCACCGCGGTGACGACGGACTTGCGGATCGAGT
13   M16   T100176_01   CAGCCCGACTACTAGCGGGACAATGCCCACACACAGAAACGCCGG
13   M18   T100177_01   CGGCGACGAAAAAGAAGAAAAAGAAGGTGGAGTAGAACCCGACCA
13   M20   T100178_01   GCACGGGACAACCTTTCTGCAAAGCCCCGGGGGTCGTCGCTCAAG
13   M22   T100179_01   GGCATCGAAGAGATCCGCATACGTGTCCAGGGTGACCTTCGCGGA
13   M24   T100180_01   TCACGGGCTCATCCTATCCGGCAGATCAGCAGGCGGTTCCTCCGC
13   O02   T100181_01   GCGTCCGCCTGCTCCGTCCTGGATTCTCGGCAGTCACGGGTTAGC
13   O04   T100182_01   CAAGGAGCCAGGAATGGAGACGATCGCCTCAAGTGACCGTTGCGT
13   O06   T100183_01   GAATCAACGGAGACGCGGTGTGCGGCAAGCGGATTCGAGATTGGA
13   O08   T100184_01   GCGGGTCCACAAGGTGTATTCGAGCGACGAGCCGACGTAG
13   O10   T100185_01   ACGTTCGGCGCAGCCAGTGCACACACGGCACGGAGTTTAG
13   O12   T100186_01   TCCGCATGCGTTCATCGTCTCAGGCGCCTGCCGGCCAGGC
13   O14   T100187_01   GGCAGTGCCGTCGTGGGTCGTCATTGTCGACGCCGTCGAA
13   O16   T100188_01   CCACCTCGAGCGGTTCGTTCGCAAACCACCCGAGCCACCC
13   O18   T100189_01   TCCGGCATGGCGTGCTTCCCTCGACCGCCAAATGCACTAG
13   O20   T100190_01   GCTCGGCCAGGGCATGAGCAGTTCGCTGGCTACGCTGCTC
13   O22   T100191_01   GCCACCCGCACAGAACAGGGAGCTCGCGCGGCCGAGCCTG
13   O24   T100192_01   GCGGCGCAGATGGTTGGCGCCGGCGACGATGCAGAGCGCA
13   B02   T100193_01                  Rv1576c
                        TCGTTGCGGGACACCGCGTTTCGCACACTGGATTCTTGTG
13   B04   T100194_01   CTTAGATCAGGCTGAAGACGTCGGTGTCGACCACCGTCGCCGCTA
13   B06   T100195_01                  Rv2580c
                        AATCACCTCCCTGGGAGACGAGAGTTGCCGTCCGCAGTACCGGGA
13   B08   T100196_01                  Rv2710
                        AATCGGCAAACTATTCGGGCTGTCCCGTGAGCGGGTTCGTCAGAT
13   B10   T100197_01                  Rv2993c
                        AGACCCGGTGATATTCCTCAAGCCCAACACCGCGATCATCGGTCCG
13   B12   T100198_01                  Rv3204
                        CATCGCAGCTCTCGCAGGGCTTTCCAGTCCGCGTATTGTCGGCTG
13   B14   T100199_01   GGGGGCCGAGCCGACATCGATGTGGATGGAAGTAAGGCACGGGT
13   B16   T100200_01                  Rv3557c
                        CGAGCATCATCACGCGCAAGTGGTGATCTACCAGGATGAAGCGCA
13   B18   T100201_01                  Rv3836
                        GATCCATGAGGTCGCCCATCACTTCGGCATCGGCGACGAGCGCTT
13   B20   T100202_01                  Rv3886c
                        CGCGGCCTGGACCTGATCAGCCCATGCGCCGCTCCAACAGCTGCT
13   B22   T100203_01                  Rv0999a
                        GTTGGCGCATGGCGATCTATTGGTGATGGGCGGATCGTGTCAACG
13   B24   T100204_01                  Rv0857
                        CGCTCGCCGACATGGACGCTGTGCCGTCTTGGTCTTCAGTGCACA
13   D02   T100205_01                  Rv0930
                        CTCTATCGTGGCGGCGTTATTCGTCTTCAGCCTGTGGATCGCCACC
13   D04   T100206_01                  Rv1054
                        CAAGACGAAGCGGGATCGTCACGTACCAGTGCCTGAGCCTGTTTG
13   D06   T100207_01                  Rv2232
                        ACCACCTGCTCACCAAACTTCGCGATCATCGCCTGATACCACAGCG
13   D08   T100208_01                  Rv3224a
                        GCAAACGGCATTGGGCCGTCACGGTGGCCCCGCCGGACCTGATC
13   D10   T100209_01                  Rv3337
                        TATGCGCAGTCCGATACGCGTGGGTTCGGGAGAGCCGGTCCTACT
13   D12   T100210_01                  Rv3652
                        GGATTTGGCTACTCTCGGCTCGACGATCGGCGCCGCCAAC
13   D14
13   D16
13   D18
13   D20
13   D22
13   D24
13   F02
13   F04
13   F06
13   F08
13   F10
13   F12
13   F14
13   F16
13   F18
13   F20
13   F22
13   F24
13   H02
13   H04
13   H06
13   H08
13   H10
13   H12
13   H14
13   H16
13   H18
13   H20
13   H22
13   H24
13   J02
13   J04
13   J06
13   J08
13   J10
13   J12
13   J14
13   J16
13   J18
13   J20
13   J22
13   J24
13   L02
13   L04
13   L06
13   L08
13   L10
13   L12
13   L14
13   L16
13   L18
13   L20
13   L22
13   L24
13   N02
13   N04
13   N06
13   N08
13   N10
13   N12
13   N14
13   N16
13   N18
13   N20
13   N22
13   N24
13   P02
13   P04
13   P06
13   P08
13   P10
13   P12
13   P14
13   P16
13   P18
13   P20
13   P22
13   P24
13   B01
13   B03
13   B05
13   B07
13   B09
13   B11
13   B13
13   B15
13   B17
13   B19
13   B21
13   B23
13   D01
13   D03
13   D05
13   D07
13   D09
13   D11
13   D13
13   D15
13   D17
13   D19
13   D21
13   D23
13   F01
13   F03
13   F05
13   F07
13   F09
13   F11
13   F13
13   F15
13   F17
13   F19
13   F21
13   F23
13   H01
13   H03
13   H05
13   H07
13   H09
13   H11
13   H13
13   H15
13   H17
13   H19
13   H21
13   H23
13   J01
13   J03
13   J05
13   J07
13   J09
13   J11
13   J13
13   J15
13   J17
13   J19
13   J21
13   J23
13   L01
13   L03
13   L05
13   L07
13   L09
13   L11
13   L13
13   L15
13   L17
13   L19
13   L21
13   L23
13   N01
13   N03
13   N05
13   N07
13   N09
13   N11
13   N13
13   N15
13   N17
13   N19
13   N21
13   N23
13   P01
13   P03
13             P05
13             P07
13             P09
13             P11
13             P13
13             P15
13             P17
13             P19
13             P21
13             P23
Tcontrol_384   A01   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   A03   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   A05   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   A07   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   A09   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   A11   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   A13   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   A15   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   A17   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   A19   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   A21   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   A23   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   C01   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   C03   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   C05   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   C07   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   C09   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   C11   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   C13   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   C15   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   C17   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   C19   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   C21   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   C23   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   E01   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   E03   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   E05   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   E07   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   E09   T000053_01                  Rv0053
                                  ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
Tcontrol_384   E11   T000056_01                  Rv0056
                                  CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
Tcontrol_384   E13   T003460_01                  Rv3460c
                                  GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
Tcontrol_384   E15   T003461_01                  Rv3461c
                                  GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
Tcontrol_384   E17   T003924_01                  Rv3924c
                                  AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
Tcontrol_384   E19   T001436_01                  Rv1436
                                  CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
Tcontrol_384   E21   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   E23   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   G01   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   G03   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   G05   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   G07   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   G09   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   G11   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   G13   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   G15   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   G17   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   G19   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   G21   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   G23   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   I01   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   I03   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   I05   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   I07   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   I09   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   I11   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   I13   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   I15   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   I17   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   I19   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   I21   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   I23   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   K01   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   K03   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   K05   T000053_01                  Rv0053
                                  ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
Tcontrol_384   K07   T000056_01                  Rv0056
                                  CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
Tcontrol_384   K09   T003460_01                  Rv3460c
                                  GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
Tcontrol_384   K11   T003461_01                  Rv3461c
                                  GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
Tcontrol_384   K13   T003924_01                  Rv3924c
                                  AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
Tcontrol_384   K15   T001436_01                  Rv1436
                                  CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
Tcontrol_384   K17   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   K19   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   K21   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   K23   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   M01   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   M03   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   M05   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   M07   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   M09   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   M11   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   M13   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   M15   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   M17   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   M19   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   M21   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   M23   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   O01   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   O03   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   O05   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   O07   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   O09   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   O11   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   O13   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   O15   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   O17   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   O19   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   O21   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   O23   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   A02   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   A04   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   A06   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   A08   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   A10   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   A12   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   A14   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   A16   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   A18   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   A20   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   A22   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   A24   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   C02   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   C04   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   C06   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   C08   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   C10   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   C12   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   C14   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   C16   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   C18   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   C20   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   C22   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   C24   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   E02   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   E04   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   E06   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   E08   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   E10   T000053_01                  Rv0053
                                  ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
Tcontrol_384   E12   T000056_01                  Rv0056
                                  CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
Tcontrol_384   E14   T003460_01                  Rv3460c
                                  GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
Tcontrol_384   E16   T003461_01                  Rv3461c
                                  GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
Tcontrol_384   E18   T003924_01                  Rv3924c
                                  AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
Tcontrol_384   E20   T001436_01                  Rv1436
                                  CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
Tcontrol_384   E22   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   E24   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   G02   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   G04   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   G06   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   G08   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   G10   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   G12   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   G14   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   G16   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   G18   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   G20   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   G22   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   G24   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   I02   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   I04   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   I06   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   I08   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   I10   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   I12   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   I14   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   I16   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   I18   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   I20   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   I22   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   I24   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   K02   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   K04   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   K06   T000053_01                  Rv0053
                                  ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
Tcontrol_384   K08   T000056_01                  Rv0056
                                  CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
Tcontrol_384   K10   T003460_01                  Rv3460c
                                  GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
Tcontrol_384   K12   T003461_01                  Rv3461c
                                  GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
Tcontrol_384   K14   T003924_01                  Rv3924c
                                  AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
Tcontrol_384   K16   T001436_01                  Rv1436
                                  CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
Tcontrol_384   K18   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   K20   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   K22   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   K24   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   M02   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   M04   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   M06   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   M08   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   M10   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   M12   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   M14   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   M16   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   M18   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   M20   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   M22   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   M24   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   O02   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   O04   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   O06   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   O08   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   O10   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   O12   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   O14   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   O16   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   O18   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   O20   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   O22   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   O24   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   B02   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   B04   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   B06   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   B08   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   B10   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   B12   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   B14   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   B16   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   B18   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   B20   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   B22   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   B24   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   D02   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   D04   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   D06   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   D08   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   D10   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   D12   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   D14   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   D16   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   D18   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   D20   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   D22   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   D24   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   F02   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   F04   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   F06   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   F08   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   F10   T000053_01                  Rv0053
                                  ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
Tcontrol_384   F12   T000056_01                  Rv0056
                                  CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
Tcontrol_384   F14   T003460_01                  Rv3460c
                                  GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
Tcontrol_384   F16   T003461_01                  Rv3461c
                                  GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
Tcontrol_384   F18   T003924_01                  Rv3924c
                                  AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
Tcontrol_384   F20   T001436_01                  Rv1436
                                  CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
Tcontrol_384   F22   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   F24   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   H02   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   H04   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   H06   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   H08   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   H10   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   H12   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   H14   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   H16   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   H18   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   H20   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   H22   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   H24   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   J02   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   J04   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   J06   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   J08   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   J10   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   J12   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   J14   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   J16   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   J18   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   J20   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   J22   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   J24   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   L02   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   L04   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   L06   T000053_01                  Rv0053
                                  ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
Tcontrol_384   L08   T000056_01                  Rv0056
                                  CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
Tcontrol_384   L10   T003460_01                  Rv3460c
                                  GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
Tcontrol_384   L12   T003461_01                  Rv3461c
                                  GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
Tcontrol_384   L14   T003924_01                  Rv3924c
                                  AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
Tcontrol_384   L16   T001436_01                  Rv1436
                                  CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
Tcontrol_384   L18   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   L20   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   L22   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   L24   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   N02   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   N04   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   N06   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   N08   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   N10   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   N12   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   N14   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   N16   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   N18   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   N20   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   N22   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   N24   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   P02   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   P04   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   P06   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   P08   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   P10   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   P12   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   P14   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   P16   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   P18   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   P20   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   P22   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   P24   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   B01   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   B03   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   B05   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   B07   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   B09   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   B11   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   B13   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   B15   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   B17   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   B19   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   B21   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   B23   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   D01   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   D03   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   D05   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   D07   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   D09   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   D11   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   D13   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   D15   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   D17   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   D19   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   D21   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   D23   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   F01   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   F03   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   F05   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   F07   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   F09   T000053_01                  Rv0053
                                  ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
Tcontrol_384   F11   T000056_01                  Rv0056
                                  CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
Tcontrol_384   F13   T003460_01                  Rv3460c
                                  GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
Tcontrol_384   F15   T003461_01                  Rv3461c
                                  GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
Tcontrol_384   F17   T003924_01                  Rv3924c
                                  AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
Tcontrol_384   F19   T001436_01                  Rv1436
                                  CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
Tcontrol_384   F21   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   F23   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   H01   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   H03   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   H05   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   H07   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   H09   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   H11   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   H13   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   H15   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   H17   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   H19   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   H21   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   H23   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   J01   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   J03   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   J05   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   J07   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   J09   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   J11   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   J13   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   J15   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   J17   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   J19   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   J21   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   J23   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   L01   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   L03   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
Tcontrol_384   L05   T000053_01                  Rv0053
                                  ACATCTGGGGCAAGCGTCGGCTGGCGTACGAGATCGCCAAGCATG
Tcontrol_384   L07   T000056_01                  Rv0056
                                  CCGCAGATGTGGTTGCTGCCATCAAGAAGGCCGGTGGACCAAACC
Tcontrol_384   L09   T003460_01                  Rv3460c
                                  GACAAAAACCAACGCGCGGACCCGCAAAGGCCCCAAGCGCACCAT
Tcontrol_384   L11   T003461_01                  Rv3461c
                                  GCTGATCCGTCGGCACGGGCGGGTTATGGTGATCTGTTCCGATCC
Tcontrol_384   L13   T003924_01                  Rv3924c
                                  AAAAGGACCTTCCAGCCGAACAACCGGCGGCGAGCTCGTGTTCAC
Tcontrol_384   L15   T001436_01                  Rv1436
                                  CGCCGATCGTCTCGAGCGACATCGTCACCGACCCGCACAGTTCGA
Tcontrol_384   L17   c15_01       GCCCCGTTAAGAATAGTTAATTCGTTTTTATGGAAAGATGACTACTT
Tcontrol_384   L19   c73_01       CTGAACCAAAGAGTGAGTATTAAGTACGGATAACCATGCAGTCAGT
Tcontrol_384   L21   c98_01       ACTCCTGCTGCCTAATTTACTTGCTACTCCACTATCACGTTAATCAG
Tcontrol_384   L23   c207_01      ATACATTCAGCACCTTACGTGGTTATATTATTTAAAATGCGTCTCCT
Tcontrol_384   N01   c234_01      CAATTCGGAGTATTTCCAGGGTCCTATTCACTCGGATATATGAGGT
Tcontrol_384   N03   c37_01       ACCTGGAAGCTAAAGAAGTCGGAAGGAGAGACAGAGCCTTGGATT
Tcontrol_384   N05   c180_01      TTCTGGATCCACTCCCTTTTTTCCTGATACAACCTATATCCTGACTC
Tcontrol_384   N07   c203_01      GACACATTTTGCCCGCTTCTAAAGCTAAAGTTTCTCGTACTTTAAGG
Tcontrol_384   N09   c24_01       ACATAGCAATTTAGGGGTCGGAATGGAATGTTATTAGACGAACCTT
Tcontrol_384   N11   c56_01       CGGAAACTACAATTGCTGTCTTTTAACATCTCTCCTGTTTCTTATGC
Tcontrol_384   N13   c148_01      GCGACCACTCTAGATGGGCTATTTAGTAATGTCCATGCAGGAGACC
Tcontrol_384   N15   c16_01       GCGCGTCCAAACTTGACACGCTTCACCCCCCATACCTTGATTCGGA
Tcontrol_384   N17   c178_01      GAAGCGACTAGATTGGGCGAAATCCAAATGACTCTATAGGACTTAG
Tcontrol_384   N19   c191_01      GCTGTAAAAATCGAGTATACATGAAACTGCTCGGTGTTTTTTAGTGC
Tcontrol_384   N21   c215_01      TAAATACAGAAATAGTACCGGTGACAGGGGGCTGGTTTTCTAGGAA
Tcontrol_384   N23   c3_01        AACGGAACAGACAAACCGCATTACCAAAATTATATGCAACTATTCTC
Tcontrol_384   P01   c38_01       GAAGTTATACTGACCACGATCGGCCACTGTAAAATAATAACTGCAA
Tcontrol_384   P03   c7_01        GATTAACTCTGATGCTATCGCAGTTACTGTAATAATCGTTCCTCAAC
Tcontrol_384   P05   c86_01       CCGGCCGTCTCCCGAGTCCTTTAAGAGACGATTGGAAAACTGGCA
Tcontrol_384   P07   c91_01       GATAAGGTCATAACATCGGCTCTCCATACTCTTATTGCTAGGAGTC
Tcontrol_384   P09   c13_01       ATCGTTACCATAACCAGTACGGGCTATAACCCCTTCGAGTAGAAAG
Tcontrol_384   P11   c155_01      CATGCGCGCCCGGTCTCACCCTCCTACAGGCAGCTTTCGAGTTAG
Tcontrol_384   P13   c229_01      CTGGTAGGATATTTGATCTCTTCCAGACCCCTCACCCTTCTAATATT
Tcontrol_384   P15   c242_01      TTACTCTGCAGTTGGTCGTACGCACATGTAAGAAAACAGTCATATC
Tcontrol_384   P17   c47_01       CGATGGCATTCGACTTTATGGGGAGCGATGTACTTTCCACACAAGA
Tcontrol_384   P19   T000350_01                  Rv0350
                                  TCGCGAGGAGGCCGATGTTCGTAATCAAGCCGAGACATTGGTCTA
Tcontrol_384   P21   T000384_01                  Rv0384c
                                  ACCACCCGCTGGCAGAACGAGAAGAACGCGATCGAAATCGTCCGC
Tcontrol_384   P23   T002299_01                  Rv2299c
                                  ACTACACCTCGGAATGGAAGATCCGTAACCTGGTCAAGAAATACTC
TIGR_CDC1551_ORF_name Gene_Symbol
MT0001                dnaA
MT0002                dnaN
MT0003                recF
MT0004                Rv0004
MT0005                gyrB
MT0006                gyrA
                      Rv0007
MT0010                Rv0008c
MT0011                ppiA
MT0013                Rv0010c
MT0014                Rv0011c
MT0015                Rv0012
MT0016                pabA
MT0017                pknB
MT0018                pknA
MT0019                pbpA
MT0020                rodA
MT0021                ppp
MT0022                Rv0019c
MT0023                Rv0020c
MT0024                Rv0021c
                      Rv0022c
MT0026                Rv0023
MT0027                Rv0024
MT0028                Rv0025
MT0029                Rv0026
MT0030                Rv0027
                      Rv0028
                      Rv0029
MT0034                Rv0030
MT0035                Rv0031
MT0037                bioF2
MT0038                Rv0033
MT0039                Rv0034
MT0040                fadD34
MT0041                Rv0036c
MT0042                Rv0037c
MT0043                Rv0038
                      Rv0039c
MT0046                Rv0040c
MT0047                leuS
MT0048                Rv0042c
MT0049   Rv0043c
MT0050   Rv0044c
MT0051   Rv0045c
MT0052   Rv0046c
MT0053   Rv0047c
MT0054   Rv0048c
MT0055   Rv0049
MT0056   ponA
MT0057   Rv0051
         Rv0052
MT0059   rpsF
MT0060   ssb
MT0061   rpsR
MT0062   rplI
         Rv0057
MT0064   dnaB
         Rv0059
MT0066   Rv0060
         Rv0061
MT0067   celA
MT0068   Rv0063
MT0070   Rv0064
MT0071   Rv0065
MT0072   icd2
MT0073   Rv0067c
MT0074   Rv0068
         sdaA
MT0076   glyA2
MT0077   Rv0071
MT0078   Rv0072
MT0079   Rv0073
MT0080   Rv0074
MT0081   Rv0075
         Rv0076c
MT0083   Rv0077c
MT0084   Rv0078
MT0086   Rv0079
MT0087   Rv0080
MT0088   Rv0081
MT0089   Rv0082
MT0090   Rv0083
MT0091   hycD
MT0092   hycP
MT0093   hycQ
MT0095   hycE
MT0096   Rv0088
MT0098   Rv0089
MT0099   Rv0090
MT0100   Rv0091
MT0101   ctpA
MT0102   Rv0093c
         Rv0094c
           Rv0095c
MT0105     PPE
MT0106     Rv0097
MT0107     Rv0098
MT0108     fadD10
MT0109     Rv0100
MT0110     nrp
MT0111     Rv0102
MT0112     ctpB
MT0113     Rv0104
MT0114     rpmB
MT0115     Rv0106
MT0116     ctpI
           Rv0108c
MT0118     PE_PGRS
MT0119     Rv0110
MT0120     Rv0111
MT0121     gca
MT0122     gmhA
MT0122     Rv0114
MT0123     Rv0115
MT0125     Rv0116c
MT0125.1   oxyS
MT0126     oxcA
MT0127     fadD7
MT0128     fusA2
           Rv0121c
           Rv0122
MT0131     Rv0123
MT0132     PE_PGRS
MT0133     pepA
MT0134     Rv0126
MT0135     Rv0127
MT0136     Rv0128
MT0137     fbpC2
MT0138     Rv0130
MT0139     fadE1
MT0140     Rv0132c
MT0141     Rv0133
MT0142     ephF
MT0143     Rv0135c
MT0144     Rv0136
MT0145     Rv0137c
MT0146     Rv0138
MT0147     Rv0139
MT0148     Rv0140
MT0149     Rv0141c
MT0150     Rv0142
MT0151     Rv0143c
MT0152     Rv0144
MT0153     Rv0145
MT0154     Rv0146
MT0155   Rv0147
MT0156   Rv0148
MT0157   Rv0149
         Rv0150c
         PE
MT0161   PE
MT0162   Rv0153c
MT0163   fadE2
MT0164   pntAA
MT0164   pntAB
MT0165   pntB
MT0167   Rv0158
MT0168   PE
MT0169   PE
MT0170   Rv0161
MT0171   adhE
MT0172   Rv0163
MT0173   Rv0164
MT0174   Rv0165c
MT0175   fadD5
         Rv0167
         Rv0168
MT0178   mce1
MT0179   Rv0170
MT0180   Rv0171
MT0181   Rv0172
MT0182   lprK
MT0183   Rv0174
MT0184   Rv0175
MT0185   Rv0176
MT0186   Rv0177
MT0187   Rv0178
MT0188   lprO
         Rv0180c
MT0190   Rv0181c
MT0191   sigG
MT0192   Rv0183
MT0193   Rv0184
MT0194   Rv0185
MT0195   bglS
MT0197   Rv0187
MT0198   Rv0188
MT0199   ilvD
MT0200   Rv0190
MT0201   Rv0191
MT0202   Rv0192
MT0203   Rv0193c
MT0204   Rv0194
MT0205   Rv0195
MT0206   Rv0196
MT0207   Rv0197
MT0208   Rv0198c
         Rv0199
MT0210   Rv0200
         Rv0201c
MT0212   mmpL11
MT0213   Rv0203
MT0214   Rv0204c
MT0215   Rv0205
MT0216   mmpL3
MT0217   Rv0207c
         Rv0208c
MT0219   Rv0209
MT0220   Rv0210
MT0221   pckA
MT0222   nadR
MT0223   Rv0213c
MT0224   fadD4
MT0225   fadE3
MT0226   Rv0216
MT0227   lipW
MT0228   Rv0218
MT0229   Rv0219
MT0230   lipC
MT0231   Rv0221
MT0232   echA1
MT0233   Rv0223c
         Rv0224c
MT0235   Rv0225
MT0236   Rv0226c
MT0237   Rv0227c
         Rv0228
MT0239   Rv0229c
MT0240   Rv0230c
MT0241   fadE4
MT0242   Rv0232
MT0244   nrdB
         gabD2
MT0246   Rv0235c
MT0247   Rv0236c
MT0251   lpqI
MT0252   Rv0238
MT0253   Rv0239
MT0254   Rv0240
MT0255   Rv0241c
MT0256   fabG4
MT0257   fadA2
MT0258   fadE5
MT0259   Rv0245
MT0260   Rv0246
MT0261   Rv0247c
MT0262   Rv0248c
         Rv0249c
MT0264   Rv0250c
MT0265     hsp
MT0266     nirB
           nirD
           cobU
MT0268     cobQ
MT0269     PPE
           Rv0257c
MT0271     Rv0258c
MT0272     Rv0259c
MT0273     Rv0260c
MT0274     narK3
MT0275     Rv0262c
MT0276     Rv0263c
MT0277     Rv0264c
MT0278     fecB2
MT0279     Rv0266c
MT0280     narU
MT0281     Rv0268c
MT0282     Rv0269c
MT0283     fadD2
MT0284     fadE6
MT0285     Rv0272c
MT0286     Rv0273c
MT0286.1   Rv0274
MT0287     fadD27
MT0288     Rv0276
           Rv0277c
           PE_PGRS
           PE_PGRS
MT0292     PPE
MT0293     Rv0281
MT0295     Rv0282
MT0296     Rv0283
MT0297     Rv0284
           PE
MT0299     PPE
MT0300     Rv0287
MT0301     Rv0288
MT0302     Rv0289
           Rv0290
MT0304     Rv0291
MT0305     Rv0292
MT0306     Rv0293c
MT0307     Rv0294
MT0308     Rv0295c
MT0310     atsG
MT0311     PE_PGRS
MT0312     Rv0298
           Rv0299
           Rv0300
MT0314     Rv0301
MT0315     Rv0302
           Rv0303
MT0318     PPE
MT0318     PPE
           Rv0306
MT0320     Rv0307c
MT0321     Rv0308
MT0322     Rv0309
MT0323     Rv0310c
MT0324     Rv0311
MT0326     Rv0312
MT0327     Rv0313
           Rv0314c
MT0329     Rv0315
           Rv0316
MT0332     glpQ2
           Rv03183
           pcp
MT0335     Rv0320
           dcd
MT0337     udgA
MT0338     Rv0323c
MT0339     Rv0324
MT0340     Rv0325
MT0341     Rv0326
MT0342     Rv0327c
MT0343     Rv0328
MT0344     Rv0329c
           Rv0330c
MT0346     Rv0331
           Rv0332
           Rv0333
MT0348     rmlA
MT0349     PE
MT0350     Rv0336
MT0351     aspC
MT0352     Rv0338c
MT0353     Rv0339c
MT0355     Rv0340
MT0356     Rv0341
MT0357     Rv0342
MT0357.1   Rv0343
MT0359     lpqJ
MT0360     Rv0345
MT0361     aroP2
MT0362     Rv0347
           Rv0348
MT0364     Rv0349
MT0365     dnaK
MT0366     grpE
MT0367     dnaJ
MT0368     hspR
MT0369     PPE
           PPE
MT0372     Rv0356c
MT0373     purA
MT0374     Rv0358
MT0375     Rv0359
           Rv0360c
           Rv0361
MT0378     mgtE
MT0379     fba
MT0380     Rv0364
MT0381     Rv0365c
MT0382     Rv0366c
           Rv0367c
MT0384     Rv0368c
MT0384.1   Rv0369c
MT0385     Rv0370c
MT0386     Rv0371c
MT0387     Rv0372c
MT0388     Rv0373c
MT0389     Rv0374c
MT0390     Rv0375c
           Rv0376c
MT0391     Rv0377
           Rv0378
           sec
MT0393     Rv0380c
MT0394     Rv0381c
MT0395     umpA
MT0396     Rv0383c
MT0397     clpB
MT0398     Rv0385
MT0399     Rv0386
MT0400     Rv0387c
MT0400     PPE
MT0401     purT
           Rv0390
MT0402     metZ
MT0403     Rv0392c
MT0404     Rv0393
MT0404.1   Rv0394c
MT0405     Rv0395
MT0406     Rv0396
           Rv0397
MT0408     Rv0398c
MT0409     lpqK
MT0410     fadE7
MT0411     Rv0401
MT0412     mmpL1
MT0415     mmpS1
           fadD30
MT0418     pks6
           Rv0406c
MT0420   Rv0407
MT0421   pta
MT0422   ackA
MT0423   pknG
MT0424   glnH
MT0425   Rv0412c
MT0426   mutT3
MT0427   thiE
MT0428   Rv0415
MT0429   Rv0416
MT0430   thiG
MT0432   lpqL
MT0433   lpqM
         Rv0420c
MT0435   Rv0421c
MT0436   thiD
         thiC
         Rv0424c
MT0440   ctpH
MT0441   Rv0426c
MT0442   xthA
MT0443   Rv0428c
MT0444   def
MT0445   Rv0430
MT0446   Rv0431
MT0447   sodC
MT0448   Rv0433
         Rv0434
MT0451   Rv0435c
MT0452   pssA
MT0453   psd
MT0454   moaA3
MT0455   Rv0439c
MT0456   groEL2
MT0457   Rv0441c
MT0458   PPE
MT0459   Rv0443
MT0460   Rv0444c
MT0461   sigK
MT0462   Rv0446c
MT0463   ufaA1
MT0464   Rv0448c
MT0465   Rv0449c
MT0466   mmpL4
         mmpS4
MT0468   Rv0452
MT0469   PPE
         Rv0454
MT0471   Rv0455c
MT0472   echA2
MT0473   Rv0457c
         Rv0458
MT0475   Rv0459
         Rv0460
MT0477   Rv0461
MT0478   Rv0462
         Rv0463
MT0480   Rv0464c
MT0481   Rv0465c
MT0482   Rv0466
MT0483   aceA
         fadB2
MT0485   umaA1
MT0486   umaA2
MT0488   Rv0471c
MT0489   Rv0472c
MT0490   Rv0473
MT0491   Rv0474
MT0493   Rv0475
MT0495   Rv0476
         Rv0477
MT0496   deoC
MT0497   Rv0479c
         Rv0480c
         Rv0481c
MT0500   murB
MT0501   Rv0483
MT0502   Rv0484c
MT0503   Rv0485
MT0504   Rv0486
MT0505   Rv0487
MT0507   Rv0488
MT0508   gpm
         senX3
MT0510   regX3
MT0511   Rv0492c
MT0513   Rv0493c
MT0514   Rv0494
MT0515   Rv0495c
MT0516   Rv0496
MT0517   Rv0497
         Rv0498
MT0519   Rv0499
MT0520   proC
MT0522   galE1
MT0523   Rv0502
         cmaA2
         Rv0504c
MT0526   serB
MT0527   mmpS2
MT0528   mmpL2
         Rv0508
MT0530   hemA
MT0531   hemC
MT0532   cysG
MT0533   hemB
MT0534   Rv0513
MT0535   Rv0514
MT0350   Rv0515
MT0537   Rv0516c
MT0538   Rv0517
MT0539   Rv0518
MT0541   Rv0519c
MT0542   Rv0520
         Rv0521c
MT0544   gabP
MT0545   Rv0523c
MT0546   hemL
         Rv0525
MT0548   Rv0526
         ccsA
MT0550   Rv0528
MT0551   ccsB
MT0552   Rv0530
MT0554   Rv0531
MT0556   PE_PGRS
MT0557   fabH
MT0558   menA
MT0559   pnp
MT0560   galE2
MT0562   Rv0537c
MT0563   Rv0538
         Rv0539
MT0565   Rv0540
MT0566   Rv0541c
MT0567   menE
         Rv0543c
         Rv0544c
MT0570   pitA
MT0571   Rv0546c
MT0572   Rv0547c
         menB
         Rv0549c
         Rv0550c
MT0577   fadD8
MT0578   Rv0552
         menC
         bpoC
MT0581   menD
MT0582   Rv0556
MT0583   Rv0557
         ubiE
MT0585   Rv0559c
MT0586   Rv0560c
MT0587   Rv0561c
MT0588   grcC1
MT0589     htpX
MT0590     gpdA1
MT0591     Rv0565c
MT0592     Rv0566c
MT0593     Rv0567
MT0594     Rv0568
MT0595     Rv0569
MT0596     nrdZ
MT0597     Rv0571c
MT0599     Rv0572c
MT0601     Rv0573c
MT0602     Rv0574c
MT0604     Rv0575c
MT0605     Rv0576
MT0606     Rv0577
MT0607     PE_PGRS
MT0608.1   Rv0579
MT0609     Rv0580c
           Rv0581
           Rv0582
MT0611     lpqN
MT0612     Rv0584
MT0613     Rv0585c
MT0615     Rv0586
MT0616     Rv0587
MT0617     Rv0588
MT0618     mce2
MT0619     Rv0590
MT0621     Rv0591
MT0622     Rv0592
MT0623     lprL
MT0624     Rv0594
MT0625     Rv0595c
           Rv0596c
MT0627     Rv0597c
MT0628     Rv0598c
MT0629     Rv0599c
           Rv0600c
MT0630     Rv0601c
MT0631     tcrA
           Rv0603
MT0632     lpqO
MT0633     Rv0605
MT0635     Rv0606
MT0636     Rv0607
MT0637     Rv0608
MT0638     Rv0609
MT0640     Rv0610c
MT0641     Rv0611c
MT0642     Rv0612
MT0643     Rv0613c
MT0644     Rv0614
MT0645     Rv0615
MT0645.1   Rv0616c
MT0646     Rv0617
MT0647     galT'
MT0647     galT
MT0648     galK
MT0649     Rv0621
MT0650     Rv0622
           Rv0623
           Rv0624
MT0653     Rv0625c
MT0654     Rv0626
           Rv0627
MT0656     Rv0628c
MT0657     recD
MT0658     recB
MT0659     recC
MT0660     echA3
MT0661     Rv0633c
MT0662     Rv0634c
MT0664     Rv0635
MT0665     Rv0636
MT0666     Rv0637
MT0667     secE
MT0668     nusG
MT0669     rplK
MT0669.1   rplA
MT0670     mmaA4
MT0671     mmaA3
MT0672     mmaA2
MT0673     mmaA1
MT0674     lipG
MT0675     Rv0647c
MT0676     Rv0648
           fabD2
           Rv0650
MT0680     rplJ
MT0681     rplL
MT0682     Rv0653c
MT0683     Rv0654
MT0684     Rv0655
MT0685     Rv0656c
MT0686     Rv0657c
MT0687     Rv0658c
MT0688     Rv0659c
MT0689     Rv0660c
MT0690     Rv0661c
MT0691     Rv0662c
MT0692     atsD
MT0692.1   Rv0664
MT0693     Rv0665
           Rv0666
MT0695     rpoB
MT0696     rpoC
MT0698     Rv0669c
MT0699     end
MT0700     lpqP
MT0701     fadE8
MT0702     echA4
MT0703     Rv0674
MT0704     echA5
MT0705     mmpL5
MT0706     mmpS5
MT0706.1   Rv0678
           Rv0679c
           Rv0680c
MT0709     Rv0681
MT0710     rpsL
MT0711     rpsG
MT0712     fusA
MT0713     tuf
MT0714     Rv0686
MT0715     Rv0687
MT0716     Rv0688
           Rv0689c
MT0718     Rv0690c
MT0719     Rv0691c
MT0719.2   Rv0692
MT0720     pqqE
MT0721     lldD1
MT0722     Rv0695
MT0723     Rv0696
MT0724     Rv0697
           Rv0698
           Rv0699
MT0727     rpsJ
MT0728     rplC
MT0729     rplD
MT0730     rplW
MT0731     rplB
           rpsS
           rplV
MT0734     rpsC
MT0735     rplP
MT0736     rpmC
MT0737     rpsQ
           atsA
MT0739     Rv0712
MT0740     Rv0713
           rplN
MT0741.1   rplX
MT0742     rplE
MT0742.1   rpsN
MT0743     rpsH
MT0744     rplF
MT0745     rplR
MT0746     rpsE
MT0747     rpmD
MT0748     rplO
MT0749     sppA
MT0750     Rv0725c
MT0751     Rv0726c
MT0752     fucA
MT0753     Rv0728c
MT0754     xylB
MT0755     Rv0730
MT0756     Rv0731c
MT0756.1   secY
MT0757     adk
MT0758     map'
MT0759     sigL
MT0760     Rv0736
MT0762     Rv0737
MT0763     Rv0738
MT0764     Rv0739
MT0765     Rv0740
MT0767     Rv0741
MT0768     PE_PGRS
MT0769     Rv0743c
MT0770     Rv0744c
           Rv0745
           PE_PGRS
MT0772.5   PE_PGRS
           Rv0748
MT0773     Rv0749
MT0774     Rv0750
MT0775     mmsB
MT0776     fadE9
MT0777     mmsA
MT0778     PE_PGRS
MT0779     PPE
           Rv0756c
MT0782     phoP
MT0783     phoR
MT0784     Rv0759c
MT0785     Rv0760c
MT0786     adhB
MT0787     Rv0762c
           Rv0763c
MT0788     Rv0764c
MT0789     Rv0765c
MT0790     Rv0766c
MT0791     Rv0767c
MT0792     aldA
MT0793     Rv0769
MT0794     Rv0770
MT0795   Rv0771
MT0796   purD
MT0797   ggtA
MT0798   Rv0774c
MT0799   Rv0775
MT0800   Rv0776c
MT0801   purB
MT0802   Rv0778
MT0803   Rv0779c
         purC
MT0805   ptrBb
MT0805   ptrBa
MT0807   Rv0783c
MT0808   Rv0784
MT0809   Rv0785
MT0810   Rv0786c
MT0811   Rv0787
MT0813   purQ
MT0814   Rv0789c
MT0815   Rv0790c
         Rv0791c
         Rv0792c
         Rv0793
         lpdB
         Rv0795
MT2881   Rv0796
         Rv0797
MT0819   Rv0798c
MT0820   Rv0799c
MT0821   pepC
         Rv0801
MT0822   Rv0802c
MT0823   purL
MT0824   Rv0804
MT0825   Rv0805
MT0826   cpsY
MT0828   Rv0807
MT0829   purF
MT0830   purM
MT0831   Rv0810c
MT0832   Rv0811c
         pabC
MT0834   Rv0813c
MT0836   sseC2
MT0837   cysA2
MT0838   thiX
MT0839   Rv0817c
MT0840   Rv0818
MT0841   Rv0819
MT0842   phoT
MT0843   phoY2
MT0844   Rv0822c
MT0845     Rv0823c
MT0846     desA1
MT0847     Rv0825c
MT0848     Rv0826
MT0849     Rv0827c
           Rv0828c
MT0850     Rv0829
MT0851     Rv0830
MT0852     Rv0831c
MT0854     PE_PGRS
           PE_PGRS
MT0855     PE_PGRS
MT0856     lpqQ
MT0857     Rv0836c
MT0858     Rv0837c
MT0860     lpqR
MT0861     Rv0839
           Rv0840c
           Rv0841c
MT0864     Rv0842
MT0865     Rv0843
MT0866     narL
MT0867     Rv0845
MT0869     Rv0846c
MT0870     lpqS
MT0871     cysM3
MT0872     Rv0849
MT0873     Rv0850
MT0874     Rv0851c
MT0875     fadD16
MT0876     pdc
MT0877     Rv0854
MT0878     far
MT0879     Rv0856
MT0880     Rv0857
MT0881     Rv0858c
MT0882     fadA
MT0883     fadB
MT0884     Rv0861c
MT0885     Rv0862c
MT0886     Rv0863
           moaC2
MT0888     mog
           moaE2
MT0890     Rv0867c
MT0891     moaD2
MT0892     moaA2
MT0892.1   Rv0870c
MT0893     cspB
MT0894     PE_PGRS
MT0896     fadE10
           Rv0874c
MT0898     Rv0875c
MT0899     Rv0876c
MT0900     Rv0877
MT0901     PPE
MT0902     Rv0879c
           Rv0880
MT0904     Rv0881
MT0905     Rv0882
MT0906     Rv0883c
MT0907     serC
MT0908     Rv0885
MT0909     fprB
MT0910     Rv0887c
MT0911     Rv0888
MT0912     citA
MT0914     Rv0890c
MT0915     Rv0891c
MT0916     Rv0892
MT0917     Rv0893c
MT0918     Rv0894
MT0919     Rv0895
MT0920     gltA2
MT0921     Rv0897c
MT0921.1   Rv0898c
MT0922     ompA
MT0923     Rv0900
MT0924     Rv0901
MT0925     Rv0902c
MT0926     Rv0903c
MT0927     accD3
MT0928     echA6
MT0929     Rv0906
MT0930     Rv0907
           ctpE
MT0933     Rv0909
MT0934     Rv0910
MT0934.1   Rv0911
MT0936     Rv0912
MT0938     Rv0913c
MT0939     Rv0914c
MT0940     PPE
MT0941     PE
MT0942     betP
MT0944     Rv0918
MT0945     Rv0919
MT0947     Rv0920c
MT0948     Rv0921
MT0949     Rv0922
MT0950     Rv0923c
MT0951     nramp
MT0952     Rv0925c
MT0953     Rv0926c
MT0954     Rv0927c
           phoS2
MT0956     pstC2
MT0957     pstA1
MT0958     pknD
MT0959     pstS
MT0960     pstB
MT0961     phoS1
MT0962     pstC
MT0963     pstA2
MT0964     Rv0937c
MT0965     Rv0938
MT0966     Rv0939
MT0967     Rv0940c
           Rv0941c
           Rv0942
MT0969     Rv0943c
MT0970     Rv0944
MT0971     Rv0945
MT0972     pgi
           Rv0947c
MT0975     Rv0948c
MT0976     uvrD
MT0977     Rv0950c
MT0978     sucC
MT0979     sucD
MT0980     Rv0953c
MT0981     Rv0954
MT0982     Rv0955
MT0983     purN
MT0984     purH
MT0985     Rv0958
MT0986     Rv0959
MT0988     Rv0960
MT0989     Rv0961
MT0990     Rv0962c
MT0992     Rv0963c
MT0992.1   Rv0964c
MT0993     Rv0965c
MT0994     Rv0966c
MT0995     Rv0967
MT0996     Rv0968
MT0997     ctpV
MT0998     Rv0970
MT0999.1   echA7
MT1000     fadE12
           accA2
MT1002     accD2
MT1003     fadE13
MT1003.1   Rv0976c
MT1004     PE_PGRS
           PE_PGRS
         Rv0979c
MT1008   PE_PGRS
MT1009   Rv0981
MT1010   Rv0982
         Rv0983
MT1012   moaB2
MT1013   mscL
MT1014   Rv0986
MT1015   Rv0987
MT1017   Rv0988
MT1018   grcC2
MT1019   Rv0990c
         Rv0991c
MT1021   Rv0992c
MT1022   galU
MT1023   moeA
MT1024   rimJ
MT1025   Rv0996
         Rv0997
MT1027   Rv0998
MT1028   Rv0999
         Rv1000
MT1030   arcA
         Rv1002c
MT1032   Rv1003
MT1033   Rv1004c
MT1034   pabB
MT1035   Rv1006
MT1036   metS
MT1037   Rv1008
MT1038   Rv1009
MT1039   ksgA
MT1040   Rv1011
         Rv1012
MT1041   pks16
MT1042   pth
MT1043   rplY
MT1044   lpqT
MT1045   prsA
         glmU
MT1047   Rv1019
MT1048   mfd
MT1049   Rv1021
MT1050   lpqU
MT1051   eno
MT1052   Rv1024
MT1053   Rv1025
         Rv1026
MT1056   kdpE
MT1057   kdpD
MT1058   kdpA
MT1059   kdpB
MT1060     kdpC
MT1061     Rv1032c
MT1062     Rv1033c
MT1063     Rv1034c
MT1065     Rv1035c
           Rv1036c
MT1066     Rv1037c
MT1067     Rv1038c
MT1068     PPE
MT1069     PE
MT1072     Rv1041c
MT1072     Rv1042c
MT1073     Rv1043c
MT1074     Rv1044
MT1075     Rv1045
MT1075.1   Rv1046c
MT3107     Rv1047
MT1078     Rv1048c
MT1079     Rv1049
MT1080     Rv1050
MT1081     Rv1051c
MT1083     Rv1052
           Rv1053c
MT1084     Rv1054
           Rv1055
MT1085     Rv1056
MT1087     Rv1057
           fadD14
MT1089     Rv1059
MT1090     Rv1060
           Rv1061
MT1092     Rv1062
MT1093     Rv1063c
MT1094     lpqV
MT1095     Rv1065
           Rv1066
MT1096.1   PE_PGRS
MT1097     PE_PGRS
MT1099     Rv1069c
           echA8
MT1101     echA9
MT1102     Rv1072
MT1103     Rv1073
MT1104     fadA3
MT1105     Rv1075c
MT1106     lipU
MT1108     cysM2
MT1109     pra
MT1110     metB
MT1111     greA
MT1112     Rv1081c
MT1113     Rv1082
MT1114           Rv1083
MT1115           Rv1084
MT1117           Rv1085c
MT1118           Rv1086
MT1118.1         PE_PGRS
MT1119           PE
                 PE
                 Rv1090
MT1123           PE_PGRS
MT1124           coaA
MT1125           glyA
MT1126           desA2
MT1127           phoH2
MT1128           Rv1096
MT1129           Rv1097c
MT1130           fum
MT1131           Rv1099c
MT1132           Rv1100
MT1133           Rv1101c
MT1134           Rv1102c
                 Rv1103c
MT1136           Rv1104
MT1136           Rv1105
MT1137           Rv1106c
MT1138           xseB
MT1139           xseA
MT1140           Rv1109c
MT1141           lytB'
MT1142           Rv1111c
MT1143           Rv1112
MT1143.1         Rv1113
MT1144           Rv1114
                 Rv1115
MT1147           Rv1116
MT1149           Rv1117
MT1150           Rv1118c
MT1151           Rv1119c
MT1152           Rv1120c
MT1153           zwf
MT1154           gnd2
MT1155           bpoB
MT1156           ephC
MT1157           Rv1125
MT1157.1MT1158   Rv1126c
MT1159           ppdK
MT1160           Rv1128c
MT1161           Rv1129c
MT1162           Rv1130
MT1163           gltA1
MT1164           Rv1132
MT1165           metE
                 Rv1134
MT1168     PPE
MT1169.1   Rv1136
           Rv1137c
MT1171     Rv1138c
           Rv1139c
MT1173     Rv1140
MT1174     echA11
MT1175     echA10
MT1176     mcr
MT1177     Rv1144
           Rv1145
MT1179.1   Rv1146
MT1180     Rv1147
MT1995     Rv1148c
MT1072     Rv1149
MT1072     Rv1150
MT1185     Rv1151c
MT1186     Rv1152
MT1187     omt
MT1188     Rv1154c
MT1189     Rv1155
MT1191     Rv1156
MT1193     Rv1157c
MT1194     Rv1158c
MT1195     Rv1159
MT1197     mutT2
MT1198     narG
MT1199     narH
MT1200     narJ
MT1201     narI
MT1202     Rv1165
MT1203     lpqW
           Rv1167c
MT1205     PPE
MT1206     PE
MT1207     Rv1170
MT1208     Rv1171
MT1209     PE
MT1210     Rv1173
           Rv1174c
MT1212     fadH
MT1213     Rv1176c
MT1214     fdxC
MT1215     Rv1178
MT1217     Rv1179c
MT1218     pks3
MT1218     pks4
MT1219     papA3
MT1220     mmpL10
MT1221     Rv1184c
MT1222     fadD21
MT1223     Rv1186c
MT1224   rocA
MT1225   Rv1188
         sigI
MT1227   Rv1190
         Rv1191
MT1229   Rv1192
MT1230   fadD36
MT1231   Rv1194c
MT1233   PE
MT1234   PPE
MT1067   Rv1197
MT3721   Rv1198
MT3107   Rv1199c
MT1238   Rv1200
MT1239   Rv1201c
MT1240   dapE
MT1241   Rv1203c
MT1242   Rv1204c
         Rv1205
MT1244   fadD6
MT1245   folP2
MT1246   Rv1208
MT1247   Rv1209
MT1248   tagA
         Rv1211
MT1250   Rv1212c
MT1251   glgC
         PE
MT1253   Rv1215c
MT1254   Rv1216c
MT1255   Rv1217c
MT1256   Rv1218c
MT1257   Rv1219c
MT1258   Rv1220c
MT1259   sigE
MT1260   Rv1222
MT1261   htrA
MT1262   Rv1224
MT1263   Rv1225c
MT1264   Rv1226c
         Rv1227c
         lpqX
MT1267   mrp
MT1268   Rv1230c
MT1269   Rv1231c
MT1270   Rv1232c
MT1271   Rv1233c
         Rv1234
MT1273   lpqY
MT1274   sugA
         sugB
MT1276   sugC
           corA
MT1278     mdh
MT1279     Rv1241
           Rv1242
MT1280.1   PE_PGRS
MT1281     lpqZ
MT1283     Rv1245c
           Rv1246c
           Rv1247c
MT1286     sucA
MT1287     Rv1249c
MT1289     Rv1250
MT1290     Rv1251c
MT1291     lprE
MT1292     deaD
MT1293     Rv1254
MT1294     Rv1255c
MT1295     Rv1256c
MT1296     Rv1257c
MT1297     Rv1258c
           Rv1259
MT1298     Rv1260
MT1299     Rv1261c
MT1300     Rv1262c
MT1301     amiB2
MT1302     Rv1264
MT1303     Rv1265
           pknH
MT1305     embR
MT1306     Rv1268c
MT1307     Rv1269c
MT1308     lprA
MT1309     Rv1271c
MT1310     Rv1272c
MT1311     Rv1273c
           lprB
MT1312.1   lprC
MT1313     Rv1276c
MT1314     Rv1277
MT1315     Rv1278
MT1316     Rv1279
MT1317     oppA
MT1318     oppD
MT1319     oppC
MT1320     oppB
MT1322     Rv1284
           cysD
MT1324     cysN
MT1325     Rv1287
MT1326     Rv1288
MT1327     Rv1289
MT1328     Rv1290c
           Rv1291c
MT1331     argS
MT1332     lysA
MT1333     thrA
MT1334     thrC
MT1335     thrB
MT1336     rho
MT1337     rpmE
           prfA
MT1339     hemK
MT1340     Rv1301
MT1341     rfe
           Rv1303
           atpB
MT1345     atpE
MT1346     atpF
MT1347     atpH
MT1348     atpA
MT1349     atpG
MT1350     atpD
MT1351     atpC
MT1352     Rv1312
MT1353     Rv1313c
MT1354     Rv1314c
MT1355     murA
MT1357     ogt
           alkA
MT1359     Rv1318c
MT1361     Rv1319c
MT1362     Rv1320c
           Rv1321
MT1363.1   Rv1322
MT1365     fadA4
MT1366     Rv1324
           PE_PGRS
MT1368     glgB
MT1369     Rv1327c
MT1370     glgP
MT1371     dinG
MT1372     Rv1330c
MT1373     Rv1331
MT1374     Rv1332
MT1375     Rv1333
           Rv1334
MT1376.1   Rv1335
MT1377     cysM
MT1378     Rv1337
MT1379     murI
MT1380     Rv1339
MT1381     rphA
MT1382     Rv1341
MT1383     pks14
MT1384   Rv1343c
         Rv1344
MT1387   fadD33
MT1388   fadE14
MT1389   Rv1347c
MT1390   Rv1348
MT1392   Rv1349
MT1393   fabG2
MT1394   Rv1351
         Rv1352
MT1396   Rv1353c
MT1397   Rv1354c
MT1398   moeY
MT1399   Rv1356c
MT1400   Rv1357c
MT1402   Rv1358
MT1403   Rv1359
MT1405   Rv1360
MT3582   PPE
MT1407   Rv1362c
         Rv1363c
MT1410   rsbU
MT1411   Rv1365c
MT1412   Rv1366
MT1414   Rv1367c
MT1415   lprF
MT2881   Rv1369c
         Rv1370c
MT1416   Rv1371
MT1417   pks18
MT1418   Rv1373
         Rv1374c
MT1419   Rv1375
MT1420   Rv1376
MT1421   Rv1377c
MT1422   Rv1378c
MT1423   pyrR
MT1424   pyrB
MT1425   pyrC
         Rv1382
MT1427   carA
MT1428   carB
MT1429   pyrF
MT1430   PE
MT1431   PPE
         mIHF
         gmk
MT1435   Rv1390
         dfp
MT1437   metK
MT1438   Rv1393c
MT1439   Rv1394c
MT1440     Rv1395
MT1440.1   PE_PGRS
MT1441     Rv1397c
MT1442     Rv1398c
MT1443     lipH
MT1444     lipI
MT1445     Rv1401
           priA
           Rv1403c
MT1448     Rv1404
MT1449     Rv1405c
MT1450     fmt
MT1451     fmu
MT1452     rpe
MT1453     ribG
MT1454     Rv1410c
MT1455     lprG
MT1456     ribC
           Rv1413
MT1457     Rv1414
MT1458     ribA2
MT1459     ribH
MT1460     Rv1417
MT1461     lprH
MT1462     Rv1419
MT1463     uvrC
MT1464     Rv1421
MT1465     Rv1422
MT1466     Rv1423
           Rv1424c
MT1468     Rv1425
MT1469     lipO
MT1470     fadD12
MT1471     Rv1428c
MT1472     Rv1429
MT1474     PE
MT1475     Rv1431
MT1476     Rv1432
MT1477     Rv1433
           Rv1434
MT1479     Rv1435c
MT1480     gap
           pgk
MT1482     tpi
MT1484     Rv1439c
           secG
MT1486     PE_PGRS
MT1487     bisC
MT1489     Rv1443c
MT1491     Rv1444c
MT1492     devB
MT1493     opcA
MT1494     zwf2
MT1495     tal
MT1496     tkt
MT1497.1   PE_PGRS
MT1498     ctaB
MT1497.1   PE_PGRS
           Rv1453
MT1501     qor
MT1502     Rv1455
MT1503     Rv1456c
MT1504     Rv1457c
           Rv1458c
MT1506     Rv1459c
MT1507     Rv1460
MT1508     Rv1461
           Rv1462
MT1510     Rv1463
MT1511     Rv1464
MT1512     Rv1465
MT1513     Rv1466
MT1514     fadE15
MT1514.1   PE_PGRS
MT1515     ctpD
MT1516     trxA
MT1517     trxB
MT1518     echA12
MT1519     Rv1473
MT1521     Rv1474c
MT1522     acn
MT1523     Rv1476
MT1524     Rv1477
           Rv1478
MT1526     moxR
MT1527     Rv1480
MT1528     Rv1481
MT1529     Rv1482c
MT1530     fabG1
MT1531     inhA
MT1532     hemZ
           Rv1486c
           Rv1487
MT1533.2   Rv1488
           Rv1489c
MT1536     Rv1490
MT1538     Rv1491c
MT1539     mutA
MT1540     mutB
MT1541     Rv1494
MT1542     Rv1495
           Rv1496
MT1545     lipL
MT1546     Rv1498c
MT1548   Rv1499
MT1549   Rv1500
MT1550   Rv1501
MT1551   Rv1502
MT1552   Rv1503c
MT1552   Rv1504c
MT1553   Rv1505c
MT1554   Rv1506c
MT1555   Rv1507c
MT1556   Rv1508c
MT1557   Rv1509
MT1560   Rv1510
MT1561   gmdA
MT1562   epiA
MT1563   Rv1513
MT1564   Rv1514c
MT1565   Rv1515c
MT1566   Rv1516c
MT1567   Rv1517
MT1568   Rv1518
MT1569   Rv1519
MT1570   Rv1520
MT1572   fadD25
MT1573   mmpL12
MT1574   Rv1523
MT1575   Rv1524
MT1576   wbbl2
MT1577   Rv1526c
MT1578   pks5
MT1579   papA4
MT1580   fadD24
MT1581   adh
MT1582   Rv1531
MT1583   Rv1532c
MT1584   Rv1533
MT1585   Rv1534
MT1586   Rv1535
MT1587   ileS
MT1589   dinX
MT1590   ansA
MT1591   lspA
MT1592   Rv1540
MT1593   lprI
MT1594   glbN
         Rv1543
MT1596   Rv1544
         Rv1545
MT1597   Rv1546
MT1598   dnaE1
MT1599   PPE
         fadD11'
MT1600   fadD11
MT1601      plsB1
MT1603      frdA
MT1604      frdB
MT1605      frdC
            frdD
MT1607      Rv1556
MT1608      mmpL6
MT1609      Rv1558
MT1610      ilvA
MT1611      Rv1560
            Rv1561
MT1613      glgZ
MT1614      glgY
MT1615      glgX
MT1616      Rv1565c
MT1617      Rv1566c
MT1618      Rv1567c
MT1619      bioA
MT1620      bioF
MT1621      bioD
MT1622      Rv1571
            Rv1572c
MT3573.15   Rv1573
MT3573.14   Rv1574
            Rv1575
MT3573.9    Rv1576c
            Rv1577c
MT3573.7    Rv1578c
MT3573.6    Rv1579c
MT3573.5    Rv1580c
            Rv1581c
MT3573.3    Rv1582c
            Rv1583c
MT3573.1    Rv1584c
MT3573.1    Rv1585c
MT3573      Rv1586c
MT1622.1    Rv1587c
MT0103      Rv1588c
MT1624      bioB
MT1625      Rv1590
MT1626      Rv1591
MT1628      Rv1592c
MT1629      Rv1593c
MT1630      nadA
MT1631      nadB
MT1632      nadC
MT1633      Rv1597
MT1634      Rv1598c
MT1635      hisD
MT1636      hisC
MT1637      hisB
MT1638      hisH
MT1639     hisA
MT1640     impA
MT1641     hisF
MT1641.1   hisI2
MT1642     chaA
MT1643     bcpB
MT1644     trpE
MT1645     Rv1610
MT1646     trpC
MT1647     trpB
MT1648     trpA
MT1649     lgt
           Rv1615
MT1652     Rv1616
MT1653     pykA
MT1654     tesB1
MT1655     Rv1619
MT1656     cydC
MT1657     cydD
MT1658     cydB
MT1659     appC
MT1660     Rv1624c
MT1661     Rv1625c
MT1662     Rv1626
MT1663     Rv1627c
MT1664     Rv1628c
MT1665     polA
MT1666     rpsA
MT1667     Rv1631
MT1668     Rv1632c
MT1669     uvrB
MT1670     Rv1634
MT1671     Rv1635c
MT1672     Rv1636
MT1673     Rv1637c
MT1675     uvrA
MT1677     Rv1639c
           lysX
MT1679     infC
           rpmI
MT1681     rplT
MT1682     tsnR
MT1683     Rv1645c
MT1684     PE
MT1685     Rv1647
MT1686     Rv1648
MT1687     pheS
MT1688     pheT
MT1689     PE_PGRS
MT1690     argC
           argJ
MT1692     argB
MT1693     argD
MT1694     argF
MT1695     argR
MT1696     argG
MT1697     argH
MT1698     pks10
MT1701     pks7
MT1702     pks8
MT1703     pks17
MT1704     pks9
MT1705     pks11
MT1706     Rv1666c
           Rv1667c
MT1707     Rv1668c
MT1707.1   Rv1669
MT1708     Rv1670
MT1709     Rv1671
MT1710     Rv1672c
MT1711     Rv1673c
MT1712     Rv1674c
MT1714     Rv1675c
MT1715     Rv1676
MT1716     dsbF
MT1718     Rv1678
MT1719     fadE16
MT1720     Rv1680
MT1721     moeX
MT1722     Rv1682
MT1723     Rv1683
MT1724     Rv1684
MT1725     Rv1685c
MT1726     Rv1686c
MT1727     Rv1687c
MT1727.1   Rv1688
MT1728     tyrS
MT1729     lprJ
           Rv1691
MT1731     Rv1692
MT1732     Rv1693
MT1733     tlyA
MT1734     Rv1695
MT1735     recN
           Rv1697
MT1737     Rv1698
MT1738     pyrG
MT1739     Rv1700
MT1740     Rv1701
MT1741     Rv1702c
MT1743     Rv1703c
MT1744     cycA
MT1745     PPE
MT1746     PPE
           Rv1707
MT1749     Rv1708
MT1750     Rv1709
MT1751     Rv1710
MT1751.1   Rv1711
MT1752     cmk
MT1753     Rv1713
           Rv1714
MT1754     fadB3
MT1755     Rv1716
MT1756     Rv1717
           Rv1718
           Rv1719
MT1761     Rv1720c
MT1762     Rv1721c
MT1763     Rv1722
MT1764     Rv1723
MT1765     Rv1724c
MT1766     Rv1725c
MT1767     Rv1726
MT1768     Rv1727
MT1769     Rv1728c
MT1770     Rv1729c
MT1771     Rv1730c
MT1772     gabD1
MT1773     Rv1732c
MT1774     Rv1733c
           Rv1734c
MT1776     Rv1735c
MT1778     narX
MT1779     narK2
MT1780     Rv1738
MT1781     Rv1739c
MT1782     Rv1740
           Rv1741
MT1784     Rv1742
MT1785     pknE
MT1786     Rv1744c
MT1787     Rv1745c
MT1788     pknF
           Rv1747
MT1791     Rv1748
MT1792     Rv1749c
MT1793     fadD1
MT1794     Rv1751
MT1795     Rv1752
MT1796     PPE
           Rv1754c
MT1799     plcD
MT2881     Rv1756c
           Rv1757c
MT1805     Rv1758
MT1807     PE_PGRS(wag22)
MT1809     Rv1760
MT1810     Rv1761c
MT1811     Rv1762c
           Rv1763
MT2881     Rv1764
MT1814     Rv1765c
MT1816     Rv1766
           Rv1767
MT1818     PE_PGRS
MT1820     Rv1769
MT1820.1   Rv1770
MT1821     Rv1771
           Rv1772
MT1823     Rv1773c
MT1824     Rv1774
MT1825     Rv1775
MT1826     Rv1776c
MT1827     Rv1777
MT1828     Rv1778c
MT1829     Rv1779c
MT1830     Rv1780
MT1831     Rv1781c
           Rv1782
MT1833     Rv1783
MT1833     Rv1784
MT1834     Rv1785c
MT1835     Rv1786
MT1836     PPE
MT1837     PE
MT1838     PPE
MT1839     PPE
MT1840     PE
           Rv1792
MT2411     Rv1793
           Rv1794
MT1844     Rv1795
MT1845     Rv1796
MT1846     Rv1797
MT1847     Rv1798
MT1848     lppT
MT1849     PPE
MT1850     PPE
MT1851     PPE
MT1853     PE_PGRS
MT1854     Rv1804c
MT1854.1   Rv1805c
MT1855     PE
MT1856     PPE
MT1856.1   PPE
MT1857     PPE
           Rv1810
MT1859   mgtC
MT1860   Rv1812c
MT1861   Rv1813c
MT1862   Rv1814
MT1863   Rv1815
MT1864   Rv1816
MT1865   Rv1817
MT1866   PE_PGRS
MT1867   Rv1819c
MT1868   ilvG
MT1869   secA2
MT1870   pgsA2
MT1871   Rv1823
MT1872   Rv1824
MT1873   Rv1825
MT1874   gcvH
MT1875   Rv1827
MT1876   Rv1828
MT1877   Rv1829
MT1879   Rv1830
         Rv1831
MT1880   gcvB
MT1881   Rv1833c
MT1882   Rv1834
MT1883   Rv1835c
MT1884   Rv1836c
MT1885   glcB
MT1886   Rv1838c
MT1887   Rv1839c
MT1888   PE_PGRS
MT1889   Rv1841c
MT1890   Rv1842c
MT1891   guaB1
         gnd
MT1893   Rv1845c
MT1894   Rv1846c
MT1895   Rv1847
         ureA
MT1897   ureB
MT1898   ureC
MT1899   ureF
MT1900   ureG
         ureD
MT1902   ndh
MT1903   Rv1855c
MT1904   Rv1856c
MT1905   modA
MT1906   modB
MT1907   modC
MT1908   modD
MT1910   Rv1861
MT1911   adhA
MT1912     Rv1863c
MT1913     Rv1864c
MT1914     Rv1865c
MT1915     Rv1866
           Rv1867
MT1917     Rv1868
MT1918     Rv1869c
MT1919     Rv1870c
MT1920     Rv1871c
MT1921     lldD2
MT1922     Rv1873
           Rv1874
MT1924     Rv1875
MT1925     bfrA
           Rv1877
MT1927     glnA3
MT1928     Rv1879
MT1929     Rv1880c
           lppE
MT1931     Rv1882c
MT1931.1   Rv1883c
           Rv1884c
MT1933     Rv1885c
MT1934     fbpB
MT1935     Rv1887
MT1936     Rv1888c
MT1937     Rv1889c
           Rv1890c
MT1941     Rv1891
           Rv1892
           Rv1893
MT1944     Rv1894c
MT1946     Rv1895
MT1947     Rv1896c
MT1948     Rv1897c
MT1949     Rv1898
MT1950     lppD
MT1951     lipJ
MT1952     cinA
           nanT
MT1954     Rv1903
MT1955     Rv1904
MT1956     aao
MT1957     Rv1906c
MT1958     Rv1907c
MT1959     katG
           furA
MT1961     Rv1910c
MT1962     lppC
MT1963     fadB5
MT1964     Rv1913
MT1965     Rv1914c
MT1966     aceAa
MT1967     aceAb
MT1968     PPE
MT1969     PPE
MT1970     Rv1919c
MT1971     Rv1920
MT1972     lppF
MT1973     Rv1922
MT1974     lipD
           Rv1924c
MT1976     fadD31
MT1977     Rv1926c
MT1979     Rv1927
MT1980     Rv1928c
MT1980.1   Rv1929c
MT1980.2   Rv1930c
           Rv1931c
MT1982     tpx
MT1983     fadE18
MT1984     fadE17
MT1985     echA13
MT1986     Rv1936
MT1987     Rv1937
MT1988     ephB
MT1989     Rv1939
MT1990     ribA
MT1991     Rv1941
MT1992     Rv1942c
MT1993     Rv1943c
           Rv1944c
           Rv1945
MT1997     lppG
MT1998     Rv1947
MT1998.1   Rv1948c
MT1999     Rv1949c
MT2000     Rv1950c
MT2001     Rv1951c
MT2002     Rv1952
           Rv1953
           Rv1954c
MT2004     Rv1955
MT2005     Rv1956
MT2006     Rv1957
           Rv1958c
MT2008     Rv1959c
MT2009     Rv1960c
MT2010     Rv1961
MT2012     Rv1962c
MT2014     Rv1963c
MT2016     Rv1964
           Rv1965
MT2018     mce3
MT2019   Rv1967
MT2020   Rv1968
MT2021   Rv1969
MT2022   lprM
MT2023   Rv1971
MT2024   Rv1972
         Rv1973
         Rv1974
MT2026   Rv1975
MT2028   Rv1976c
MT2029   Rv1977
MT2030   Rv1978
MT2031   Rv1979c
MT2032   mpt64
MT2033   nrdF
MT2034   Rv1982c
MT2036   PE_PGRS
MT2037   Rv1984c
MT2039   Rv1985c
MT2040   Rv1986
MT2041   Rv1987
MT2042   Rv1988
MT2043   Rv1989c
MT2044   Rv1990c
MT2046   Rv1991c
MT2048   ctpG
MT2049   Rv1993c
MT2050   Rv1994c
         Rv1995
MT2052   Rv1996
MT2053   ctpF
         Rv1998c
         Rv1999c
MT2056   Rv2000
MT2057   Rv2001
MT2058   fabG3
MT2059   Rv2003c
MT2060   Rv2004c
MT2061   Rv2005c
MT2062   otsB
MT2063   fdxA
MT2064   Rv2008c
         Rv2009
MT2065   Rv2010
MT2066   Rv2011c
MT2067   Rv2012
MT2069   Rv2013
MT2070   Rv2014
MT1814   Rv2015c
MT2072   Rv2016
MT2073   Rv2017
MT2074   Rv2018
         Rv2019
MT2076   Rv2020c
         Rv2021c
MT2078   Rv2022c
MT2079   Rv2023c
MT2082   Rv2024c
MT2084   Rv2025c
MT2085   Rv2026c
MT2086   Rv2027c
MT2087   Rv2028c
         pfkB
MT2089   Rv2030c
         hspX
MT2091   Rv2032
         Rv2033c
         Rv2034
MT2095   Rv2035
MT2096   Rv2036
MT2097   Rv2037c
MT2098   Rv2038c
         Rv2039c
MT2100   Rv2040c
MT2101   Rv2041c
MT2102   Rv2042c
MT2103   pncA
MT2104   Rv2044c
         lipT
MT2106   lppI
         Rv2047c
MT2108   pks12
MT2109   Rv2049c
         Rv2050
MT2111   Rv2051c
MT2112   Rv2052c
         Rv2053c
MT2114   Rv2054
MT2116   rpsR2
MT2117   rpsN2
         rpmG
MT2118   rpmB2
MT2119   Rv2059
MT2119   Rv2060
         Rv2061c
MT2121   cobN
         Rv2063c
MT2124   cobG
MT2125   cobH
MT2126   cobI
MT2127   Rv2067c
MT2128   blaC
MT2129   sigC
MT2130   cobK
         cobM
MT2132   cobL
MT2133   Rv2073c
MT2134   Rv2074
MT2135   Rv2075c
         Rv2076c
MT2137   Rv2077c
         Rv2078
MT2140   Rv2079
         lppJ
MT2143   Rv2081c
MT2144   Rv2082
         Rv2083
MT2146   Rv2084
MT2147   Rv2085
         Rv2086
MT2148   Rv2087
MT2149   pknJ
MT2150   pepE
         Rv2090
MT2152   Rv2091c
MT2153   helY
MT2154   Rv2093c
MT2155   Rv2094c
MT2156   Rv2095c
MT2157   Rv2096c
MT2158   Rv2097c
MT2159   PE_PGRS
MT2159   PE
MT2160   Rv2100
MT2161   helZ
MT2162   Rv2102
MT2163   Rv2103c
MT2164   Rv2104c
         Rv2105
MT2881   Rv2106
MT2166   PE
MT2167   PPE
MT2169   prcA
MT2170   prcB
MT2171   Rv2111c
         Rv2112c
MT2173   Rv2113
MT2174   Rv2114
MT2175   Rv2115c
MT2176   lppK
MT2177   Rv2117
MT2178   Rv2118c
MT2179   Rv2119
MT2180   Rv2120c
MT2181   hisG
MT2182   hisI
           PPE
           metH
MT2184     Rv2125
           PE_PGRS
MT2186     ansP
           Rv2128
           Rv2129c
MT2188     cysS2
MT2189     cysQ
MT2190     Rv2132
MT2191     Rv2133c
MT2192     Rv2134c
MT2193     Rv2135c
MT2194     Rv2136c
MT2195     Rv2137c
MT2196     lppL
MT2197     pyrD
MT2198     Rv2140c
MT2199     dapE2
MT2200     Rv2142c
MT2202     Rv2143
MT2203     Rv2144c
MT2204     wag31
           Rv2146c
MT2206     Rv2147c
MT2207     Rv2148c
MT2208     yfiH
MT2209     ftsZ
MT2210     ftsQ
MT2211     murC
MT2212     murG
MT2213     ftsW
MT2214     murD
MT2215     murX
MT2216     murF
MT2217     murE
MT2218     Rv2159c
MT2218.1   Rv2160c
MT2219     Rv2161c
MT2220     PE_PGRS
MT2221     pbpB
MT2222     Rv2164c
MT2223     Rv2165c
           Rv2166c
MT2881     Rv2167c
           Rv2168c
MT2225     Rv2169c
MT2226     Rv2170
MT2227     lppM
MT2228     Rv2172c
MT2229     idsA2
MT2230     Rv2174
MT2231     Rv2175c
MT2232     pknL
MT2233     Rv2177c
MT2234     aroG
MT2234.1   Rv2179c
MT2235     Rv2180c
MT2236     Rv2181
MT2237     Rv2182c
           Rv2183c
           Rv2184c
MT2240     Rv2185c
           Rv2186c
MT2242     fadD15
MT2243     Rv2188c
MT2244     Rv2189c
MT2245     Rv2190c
MT2247     Rv2191
MT2248     trpD
MT2249     ctaE
MT2250     qcrC
MT2251     qcrA
MT2252     qcrB
MT2253     Rv2197c
           mmpS3
           Rv2199c
MT2256     ctaC
MT2257     asnB
MT2258     cbhK
MT2259     Rv2203
MT2260     Rv2204c
           Rv2205c
MT2262     Rv2206
MT2263     cobT
MT2264     cobS
MT2265     Rv2209
MT2266     ilvE
MT2267     gcvT
MT2268     Rv2212
MT2269     pepB
MT2270     ephD
MT2272     sucB
MT2273     Rv2216
MT2274     lipB
MT2275     lipA
MT2276     Rv2219
MT2278     glnA1
MT2279     glnE
MT2280     glnA2
MT2281     Rv2223c
MT2282     Rv2224c
MT2284     panB
MT2285     Rv2226
         Rv2227
MT2287   Rv2228c
MT2289   Rv2229c
MT2289   Rv2230c
MT2290   cobC
MT2292   Rv2232
         Rv2233
MT2293   ptpA
MT2294   Rv2235
MT2295   cobD
MT2296   Rv2237
MT2298   ahpE
MT2299   Rv2239c
MT2300   Rv2240c
MT2301   aceE
MT2302   Rv2242
         fabD
MT2304   acpM
MT2305   kasA
         kasB
MT2307   accD6
MT2308   Rv2248
MT2309   glpD1
MT2310   Rv2250c
MT2311   Rv2251
MT2312   Rv2252
MT2314   Rv2253
MT2315   Rv2254c
         Rv2255c
MT2317   Rv2256c
MT2318   Rv2257c
MT2319   Rv2258c
         adhE2
MT2321   Rv2260
MT2322   Rv2261c
MT2322   Rv2262c
MT2323   Rv2263
MT2324   Rv2264c
MT2327   Rv2265
MT2328   Rv2266
MT2329   Rv2267c
MT2330   Rv2268c
         Rv2269c
MT2331   lppN
         Rv2271
MT2333   Rv2272
         Rv2273
         Rv2274c
MT2335   Rv2275
MT2336   Rv2276
MT2337   Rv2277c
         Rv2278
MT2881     Rv2279
MT2338     Rv2280
MT2339     pitB
MT2340     Rv2282c
           Rv2283
MT2342     lipM
MT2343     Rv2285
MT2344     Rv2286c
MT2345     yjcE
MT2345.1   Rv2288
MT2346     cdh
MT2347     lppO
MT2348     sseB
MT2349     Rv2292c
MT2350     Rv2293c
MT2351     Rv2294
           Rv2295
MT2353     Rv2296
MT2354     Rv2297
MT2355     Rv2298
MT2356     htpG
MT2357     Rv2300c
           Rv2301
MT2359     Rv2302
MT2360     Rv2303c
MT2361     Rv2304c
MT2362     Rv2305
MT2363     Rv2306c
MT2364     Rv2307c
MT2366     Rv2308
           Rv2309c
MT2372     Rv2310
MT2373     Rv2311
           Rv2312
MT2376     Rv2313c
MT2377     Rv2314c
           Rv2315c
           uspA
           uspE
MT2381     uspC
           Rv2319c
MT2383     rocE
MT2384.1   rocD2
MT2384.1   rocD1
MT2385     Rv2323c
           Rv2324
           Rv2325c
MT2388     Rv2326c
MT2389     Rv2327
MT2390     PE
MT2391     narK1
MT2392     lppP
MT2393   Rv2331
MT2394   mez
         Rv2333c
         cysK
MT2398   cysE
MT2399   Rv2336
MT2400   Rv2337c
MT2401   moeW
MT2402   mmpL9
MT2404   PE
MT2406   lppQ
MT2407   Rv2342
MT2408   dnaG
MT2409   dgt
MT2410   Rv2345
MT1842   Rv2346c
MT1067   Rv2347c
MT2413   Rv2348c
MT2414   plcC
MT2415   plcB
MT2416   plcA
MT2419   PPE
MT2423   PPE
         Rv2354
MT2881   Rv2355
         PPE
MT2426   glyS
MT2427   Rv2358
         furB
MT2429   Rv2360c
MT2430   Rv2361c
MT2431   Rv2362c
MT2432   amiA2
MT2433   bex
         Rv2365c
MT2435   Rv2366c
MT2436   Rv2367c
MT2437   phoH
         Rv2369c
MT2439   Rv2370c
         PE
         Rv2372c
MT2442   dnaJ2
         hrcA
MT2444   Rv2375
         Rv2376c
         mbtH
MT2446   mbtG
MT2447   mbtF
MT2448   mbtE
MT2449   mbtD
MT2450   mbtC
MT2451     mbtB
MT2452     mbtA
           lipK
           trpE2
MT2456     Rv2387
MT2457     hemN
MT2458     Rv2389c
MT2459     Rv2390c
MT2461     nirA
MT2462     cysH
MT2463     Rv2393
MT2464     ggtB
MT2465     Rv2395
MT2467.1   PE_PGRS
MT2468     cysA
MT2469     cysW
MT2470     cysT
MT2471     subI
MT2472     Rv2401
MT2474     Rv2402
MT2475     lppR
MT2476     lepA
           Rv2405
           Rv2406c
MT2479     Rv2407
MT2481     PE
MT2482     Rv2409c
MT2483     Rv2410c
           Rv2411c
           rpsT
MT2486     Rv2413c
           Rv2414c
MT2488     Rv2415c
MT2489     Rv2416c
MT2490     Rv2417c
MT2491     Rv2418c
           Rv2419c
MT2493     Rv2420c
MT2494     Rv2421c
MT2495     Rv2422
MT2496     Rv2423
MT2233     Rv2424c
MT2498     Rv2425c
MT2499     Rv2426c
MT2500     proA
MT2503     ahpC
MT2504     ahpD
MT2505     PPE
           PE
           Rv2432c
MT2507     Rv2433c
MT2508     Rv2434c
MT2509     Rv2435c
MT2511     rbsK
MT2512     Rv2437
MT2513     Rv2438c
MT2515     proB
MT2516     obg
           rpmA
MT2518     rplU
MT2519     dctA
MT2520     rne
MT2521     ndkA
           Rv2446c
           folC
MT2524     valS
MT2525     Rv2449c
MT2526     Rv2450c
MT2527     Rv2451
MT2527.1   Rv2452c
MT2528     Rv2453c
MT2529     Rv2454c
MT2530     Rv2455c
MT2531     Rv2456c
MT2532     clpX
MT2533     Rv2458
MT2534     Rv2459
MT2535     clpP2
MT2536     clpP
MT2537     tig
MT2538     lipP
MT2539     Rv2464c
MT2540     rpi
           Rv2466c
MT2542     pepD
MT2543     Rv2468c
MT2545     Rv2469c
MT2546     glbO
MT2547     Rv2471
MT2547.1   Rv2472
MT2548     Rv2473
MT2549     Rv2474c
MT2550     Rv2475c
MT2551     Rv2476c
MT2552     Rv2477c
MT2553     Rv2478c
MT2881     Rv2479c
           Rv2480c
           Rv2481c
MT2555     plsB2
MT2556     Rv2483c
MT2557     Rv2484c
MT2559     lipQ
MT2560     echA14
MT2561     PE_PGRS
MT2563     Rv2488c
           Rv2489c
MT2564     PE_PGRS
MT2566     Rv2491
MT2567     Rv2492
MT2568     Rv2493
           Rv2494
MT2570     pdhC
MT2571     pdhB
MT2572     pdhA
MT2573     citE
MT2574     Rv2499c
MT2575     fadE19
           accA1
MT2577     accD1
MT2578     scoB
MT2579     scoA
MT2580     fadD35
MT2581     Rv2506
MT2582     Rv2507
MT2583     Rv2508c
MT2584     Rv2509
MT2585     Rv2510c
MT2586     Rv2511
MT3107     Rv2512c
           Rv2513
           Rv2514c
MT2591     Rv2515c
MT2593     Rv2516c
MT2593.1   Rv2517c
MT2594     lppS
MT2595     PE
MT2596     Rv2520c
MT2597     bcp
MT2598     Rv2522c
MT2599     acpS
MT2600     fas
MT2601     Rv2525c
MT2601.2   Rv2526
MT2602     Rv2527
MT2603     mrr
MT2604     Rv2529
MT2605     Rv2530c
MT2607     adi
           Rv2532c
MT2608     nusB
MT2609     efp
           pepQ
MT2611     Rv2536
MT2612     aroD
MT2613     aroB
MT2614   aroK
MT2615   aroF
         Rv2541
MT2616   Rv2542
MT2618   lppA
MT2620   lppB
MT2621   Rv2545
MT2622   Rv2546
MT2623   Rv2547
MT2624   Rv2548
         Rv2549c
         Rv2550c
         Rv2551c
MT2629   aroE
MT2630   Rv2553c
         Rv2554c
MT2632   alaS
MT2633   Rv2556c
MT2634   Rv2557
MT2635   Rv2558
MT2636   Rv2559c
MT2637   Rv2560
         Rv2561
MT2638   Rv2562
MT2639   Rv2563
MT2640   glnQ
MT2641   Rv2565
MT2642   Rv2566
MT2643   Rv2567
MT2644   Rv2568c
MT2645   Rv2569c
         Rv2570
MT2647   Rv2571c
MT2648   aspS
MT2649   Rv2573
         Rv2574
MT2651   Rv2575
MT2652   Rv2576c
MT2654   Rv2577
MT2655   Rv2578c
MT2656   linB
         hisS
MT2658   Rv2581c
MT2659   ppiB
MT2660   relA
MT2661   apt
MT2662   Rv2585c
MT2663   secF
MT2664   secD
MT2665   Rv2588c
MT2666   gabT
MT2667   fadD9
MT2668.1   PE_PGRS
MT2669     ruvB
MT2670     ruvA
MT2671     ruvC
           Rv2595
MT2672     Rv2596
MT2673     Rv2597
           Rv2598
MT2674     Rv2599
MT2674.1   Rv2600
MT2675     speE
MT2677     Rv2602
MT2678     Rv2603c
MT2679     Rv2604c
MT2680     tesB2
MT2681     Rv2606c
MT2682     pdxH
MT2683     PPE
MT2684     Rv2609c
MT2685     Rv2610c
MT2686     Rv2611c
MT2687     pgsA
MT2688     Rv2613c
           thrS
MT2690     PE_PGRS
MT2691.1   Rv2616
MT2692     Rv2617c
           Rv2618
           Rv2619c
           Rv2620c
MT2696     Rv2621c
           Rv2622
MT2698     Rv2623
MT2699     Rv2624c
MT2700     Rv2625c
MT2701     Rv2626c
MT2702     Rv2627c
MT2703     Rv2628
MT2704     Rv2629
MT2705     Rv2630
MT2707     Rv2631
MT2708     Rv2632c
MT2709     Rv2633c
MT2712     PE_PGRS
MT2713     Rv2635
MT2714     Rv2636
MT2715     dedA
MT2716     Rv2638
MT2717     Rv2639c
           Rv2640c
MT2719     Rv2641
           Rv2642
MT2720   arsC
         Rv2644c
MT2723   Rv2645
MT2724   Rv2646
         Rv2647
         Rv2648
MT2881   Rv2649
MT2727   Rv2650c
         Rv2651c
MT2729   Rv2652c
MT2730   Rv2653c
         Rv2654c
MT2732   Rv2655c
         Rv2656c
MT2734   Rv2657c
         Rv2658c
MT2735   Rv2659c
MT2736   Rv2660c
         Rv2661c
         Rv2662
         Rv2663
MT2738   Rv2664
         Rv2665
         Rv2666
MT2741   clpX'
         Rv2668
MT2743   Rv2669
MT2744   Rv2670c
MT2745   ribD
MT2746   Rv2672
MT2747   Rv2673
         Rv2674
MT2749   Rv2675c
MT2750   Rv2676c
MT2751   hemY'
MT2752   hemE
MT2753   echA15
MT2754   Rv2680
MT2755   Rv2681
MT2756   dxs
MT2757   Rv2683
MT2758   arsA
MT2759   arsB
MT2760   Rv2686c
MT2761   Rv2687c
MT2762   Rv2688c
         Rv2689c
MT2764   Rv2690c
MT2765   trkA
MT2766   trkB
MT2767   Rv2693c
         Rv2694c
MT2769     Rv2695
MT2770     Rv2696c
MT2771     dut
MT2772     Rv2698
MT2773     Rv2699c
MT2774     Rv2700
MT2775     suhB
MT2776     ppgK
MT2777     sigA
MT2777.1   Rv2704
MT2778     Rv2705c
           Rv2706c
MT2780     Rv2707
MT2781     Rv2708c
MT2782     Rv2709
MT2783     sigB
           ideR
MT2785     Rv2712c
MT2786     Rv2713
MT2787     Rv2714
MT2788     Rv2715
MT2789     Rv2716
MT2790     Rv2717c
MT2791     Rv2718c
MT2792     Rv2719c
MT2793     lexA
MT2794     Rv2721c
MT2794.1   Rv2722
MT2795     Rv2723
MT2796     fadE20
MT2797     hflX
MT2798     dapF
MT2799     miaA
MT2800     Rv2728c
MT2801     Rv2729c
MT2801.1   Rv2730
MT2802     Rv2731
MT2802.1   Rv2732c
MT2803     Rv2733c
MT2803.2   Rv2734
MT2804     Rv2735c
MT2805     recX
MT2806     recA
MT2808     Rv2738c
MT2808.1   Rv2739c
           Rv2740
MT2812     PE_PGRS
MT2813     Rv2742c
MT2814     Rv2743c
MT2815     35kd_ag
MT2816     Rv2745c
MT2817     pgsA3
MT2818     Rv2747
MT2819     ftsK
           Rv2749
MT2820     Rv2750
           Rv2751
MT2822     Rv2752c
MT2823     dapA
MT2824     Rv2754c
           hsdS'
MT2826     hsdM
MT2827     Rv2757c
           Rv2758c
MT2829     Rv2759c
MT2830     Rv2760c
MT2831     Rv2761c
MT2832     Rv2762c
MT2833     dfrA
MT2834     thyA
MT2835     Rv2765
MT2836     fabG5
           Rv2767c
MT2838     PPE
MT2839     PE
MT2840     PPE
MT2841     Rv2771c
MT2842     Rv2772c
MT2843     dapB
MT2844     Rv2774c
MT2845     Rv2775
           Rv2776c
MT2847     Rv2777c
MT2848     Rv2778c
MT2849     Rv2779c
MT2850     ald
MT2851     Rv2781c
           pepR
MT2853     gpsI
MT2854     lppU
           rpsO
MT2856     ribF
MT2857     Rv2787
MT2858     sirR
MT2859     fadE21
MT2860     ltp1
MT2861     Rv2791c
MT2862     Rv2792c
MT2862.1   truB
MT2863     Rv2794c
MT2864     Rv2795c
MT2865     lppV
MT2866     Rv2797c
MT2867     Rv2798c
MT2867.1   Rv2799
MT2868     Rv2800
MT2869     Rv2801c
MT2870     Rv2802c
           Rv2803c
MT2872     Rv2804c
           Rv2805
MT2873     Rv2806
           Rv2807
MT2875     Rv2808
MT2876     Rv2809
           Rv2810c
           Rv2811
MT2879     Rv2812
MT2880     Rv2813
MT2881     Rv2814c
           Rv2815c
           Rv2816c
MT2884     Rv2817c
           Rv2818c
MT2886     Rv2819c
MT2887     Rv2820c
MT2888     Rv2821c
           Rv2822c
MT2890     Rv2823c
MT2891     Rv2824c
MT2895.1   Rv2825c
MT2893     Rv2826c
MT2894     Rv2827c
MT2895.1   Rv2828c
MT2896     Rv2829c
           Rv2830c
MT2897     echA16
MT2898     ugpC
MT2899     ugpB
MT2900     ugpE
MT2901     ugpA
MT2902     dinF
MT2903     Rv2837c
MT2904     rbfA
MT2905     infB
           Rv2840c
MT2907     nusA
MT2908     Rv2842c
MT2909     Rv2843
MT2910     Rv2844
MT2911     proS
MT2912     efpA
MT2913     cysG2
MT2914     cobB
MT2915     cobA
           Rv2850c
MT2917   Rv2851c
MT2918   Rv2852c
MT2919   PE_PGRS
MT2921   Rv2854
MT2922   gorA
MT2923   nicT
         Rv2857c
         aldC
MT2927   Rv2859c
MT2928   glnA4
MT2929   map
MT2930   Rv2862c
         Rv2863
         Rv2864c
         Rv2865
         Rv2866
MT2935   Rv2867c
MT2936   gcpE
MT2937   Rv2869c
MT2938   Rv2870c
         Rv2871
         Rv2872
MT2940   mpt83
         Rv2874
MT2943   mpt70
         Rv2876
MT2945   Rv2877c
MT2946   mpt53
MT2947   Rv2879c
MT2947   Rv2880c
MT2948   cdsA
MT2949   frr
MT2951   pyrH
         Rv2884
MT2953   Rv2885c
MT2954   Rv2886c
MT2955   Rv2887
MT2956   amiC
MT2957   tsf
MT2958   rpsB
         Rv2891
MT2959   PPE
MT2961   Rv2893
MT2962   xerC
MT2963   viuB
MT2964   Rv2896c
MT2965   Rv2897c
MT2966   Rv2898c
MT2967   fdhD
MT2968   fdhF
MT2969   Rv2901c
MT2970   rnhB
MT2971     lepB
MT2972     rplS
MT2973     lppW
MT2974     trmD
           rimM
MT2976     Rv2908c
MT2977     rpsP
           Rv2910c
MT2979     dacB
MT2980     Rv2912c
MT2981     Rv2913c
MT2982     pknI
           Rv2915c
MT2984     ffh
MT2985     Rv2917
MT2986     glnD
MT2987     glnB
           amt
MT2989     ftsY
MT2990     smc
MT2992     Rv2923c
MT2994     fpg
MT2995     rnc
           Rv2926c
MT2997     Rv2927c
MT2998     tesA
MT2998.1   Rv2929
MT2999     fadD26
MT3000     ppsA
           ppsB
MT3003     ppsC
MT3004     ppsD
MT3005     ppsE
MT3006     drrA
MT3007     drrB
MT3008     drrC
MT3009     papA5
MT3010     mas
MT3011     fadD28
MT3012     mmpL7
MT3015     Rv2943
MT3016     Rv2944
MT3017     lppX
MT3018     pks1
MT3021.1   pks15
MT3021     fadD22
           Rv2949c
MT3023     fadD29
MT3025     Rv2951c
MT3026     Rv2952
MT3027     Rv2953
MT3028     Rv2954c
MT3029     Rv2955c
MT3030     Rv2956
MT3031     Rv2957
MT3034     Rv2958c
MT3035     Rv2959c
MT3036     Rv2960c
           Rv2961
MT3038     Rv2962c
MT3039     Rv2963
MT3041     purU
MT3043     kdtB
           Rv2966c
MT3045     pca
           Rv2968c
           Rv2969c
MT3048     lipN
MT3049     Rv2971
MT3050     Rv2972c
MT3051     recG
MT3052     Rv2974c
MT3052.1   Rv2975c
MT3053     ung
           thiL
MT3056     Rv2978c
MT3057     Rv2979c
MT3058     Rv2980
MT3059     ddlA
MT3060     gpdA2
MT3061     Rv2983
MT3062     ppk
MT3063     mutT1
MT3064     hupB
MT3065     leuD
MT3066     leuC
MT3067     Rv2989
MT3068     Rv2990c
MT3069     Rv2991
MT3070     gltS
MT3071     Rv2993c
MT3072     Rv2994
MT3073     leuB
MT3074     serA
MT3075     Rv2997
           Rv2998
MT3078     lppY
MT3080     Rv3000
MT3081     ilvC
MT3082     ilvN
MT3083     ilvB
           Rv3004
MT3085     Rv3005c
MT3086     lppZ
MT3087   Rv3007c
MT3088   Rv3008
MT3089   gatB
MT3090   pfkA
MT3091   gatA
MT3092   gatC
MT3093   Rv3013
MT3094   ligA
MT3095   Rv3015c
MT3096   lpqA
MT3097   Rv3017c
MT3101   PPE
MT3104   Rv3019c
MT3105   PE
MT3106   PPE
MT3101   PPE
MT3107   Rv3023c
MT3108   Rv3024c
MT3109   Rv3025c
MT3110   Rv3026c
MT3111   Rv3027c
MT3112   fixB
MT3113   fixA
MT3114   Rv3030
MT3115   Rv3031
MT3116   Rv3032
MT3118   Rv3033
MT3119   Rv3034c
MT3120   Rv3035
MT3121   Rv3036c
MT3122   Rv3037c
MT3123   Rv3038c
MT3124   echA17
MT3125   Rv3040c
MT3126   Rv3041c
MT3127   serB2
MT3128   ctaD
MT3129   fecB
MT3130   adhC
MT3131   Rv3046c
         Rv3047c
MT3133   nrdG
MT3134   Rv3049c
MT3136   Rv3050c
MT3137   nrdE
         nrdI
MT3139   nrdH
MT3140   Rv3054c
MT3141   Rv3055
MT3142   dinP
MT3143   Rv3057c
MT3144   Rv3058c
MT3145     Rv3059
MT3146     Rv3060c
MT3147     fadE22
MT3148     ligB
MT3149     cstA
MT3150     Rv3064c
           emrE
MT3151     Rv3066
           Rv3067
MT3153     pgmA
MT3153.1   Rv3069
MT3154     Rv3070
MT3155     Rv3071
MT3157     Rv3072c
MT3158     Rv3073c
MT3159     Rv3074
MT3160     Rv3075c
MT3161     Rv3076
MT3162     atsF
           Rv3078
MT3164     Rv3079c
MT3165     pknK
MT3166     Rv3081
MT3167     virS
MT3168     Rv3083
MT3169     lipR
MT3170     Rv3085
MT3171     adhD
MT3172     Rv3087
           Rv3088
MT3174     fadD13
MT3175     Rv3090
MT3176     Rv3091
           Rv3092c
MT3177     Rv3093c
MT3178     Rv3094c
MT3179     Rv3095
MT3180     Rv3096
MT3181     PE
MT3182     Rv3098c
MT3183     Rv3099c
MT3184     smpB
MT3185     ftsX
MT3186     ftsE
MT3186.1   Rv3103c
MT3187     Rv3104c
MT3188     prfB
MT3189     fprA
MT3190     Rv3107c
MT3191     Rv3108
MT3192     moaA
MT3193     moaB
MT3194     moaC
MT3194.1   moaD
MT3195     Rv3113
MT3196     Rv3114
MT3107     Rv3115
MT3198     moeB
MT0837     cysA3
MT0836     sseC
MT3201     moaE
MT3202     Rv3120
MT3203     Rv3121
MT3205     Rv3122
           Rv3123
MT3208     Rv3124
           PPE
MT3211     Rv3126c
MT3212     Rv3127
MT3214     Rv3128c
MT3215     Rv3129
MT3216     Rv3130c
MT3217     Rv3131
MT3218     Rv3132c
MT3219     Rv3133c
MT3220     Rv3134c
           PPE
MT3221     PPE
MT3224     Rv3137
MT3225     pflA
MT3226     fadE24
MT3227     fadE23
MT3228     fadB4
MT3229     Rv3142c
MT3230     Rv3143
MT3231     PPE
MT3233     nuoA
MT3234     nuoB
MT3235     nuoC
MT3236     nuoD
MT3237     nuoE
MT3238     nuoF
MT3239     nuoG
MT3240     nuoH
MT3241     nuoI
MT3242     nuoJ
MT3243     nuoK
MT3244     nuoL
MT3245     nuoM
MT3246     nuoN
MT3247     PPE
MT3249     Rv3160c
MT3250     Rv3161c
MT3251     Rv3162c
MT3252   Rv3163c
MT3253   moxR3
         Rv3165c
         Rv3166c
MT3256   Rv3167c
MT3258   Rv3168
MT3258   Rv3169
MT3259   Rv3170
MT3260   hpx
         Rv3172c
MT3262   Rv3173c
MT3263   Rv3174
MT3264   Rv3175
MT3265   lipS
MT3266   Rv3177
MT3267   Rv3178
MT3270   Rv3179
MT3271   Rv3180c
MT3272   Rv3181c
MT3274   Rv3182
MT3275   Rv3183
         Rv3184
MT2881   Rv3185
         Rv3186
MT2881   Rv3187
         Rv3188
MT3277   Rv3189
MT3278   Rv3190c
MT3281   Rv3191c
MT3283   Rv3192
MT3285   Rv3193c
MT3286   Rv3194c
MT3287   Rv3195
MT3288   Rv3196
MT3290   Rv3197
MT3291   uvrD2
MT3293   Rv3199c
MT3294   Rv3200c
MT3295   Rv3201c
MT3296   Rv3202c
MT3298   lipV
MT3299   Rv3204
MT3300   Rv3205c
MT3301   moeZ
         Rv3207c
MT3303   Rv3208
MT3305   Rv3209
MT3306   Rv3210c
MT3307   rhlE
MT3308   Rv3212
MT3309   Rv3213c
MT3310   entD
           entC
MT3312     Rv3216
           Rv3217c
MT3314     Rv3218
MT3315     whiB1
MT3316     Rv3220c
           Rv3221c
MT3319     Rv3222c
MT3320     sigH
MT3321     Rv3224
MT3323     Rv3225c
MT3323.1   Rv3226c
MT3324     aroA
MT3325     Rv3228
MT3326     desA3
MT3327     Rv3230c
           Rv3231c
MT3329     pvdS
           Rv3233c
MT3331     Rv3234c
MT3332     Rv3235
MT3333     kefB
           Rv3237c
MT3335     Rv3238c
MT3337     Rv3239c
MT3338     secA
MT3339     Rv3241c
MT3340     Rv3242c
MT3341     Rv3243c
MT3342     lpqB
MT3343     mtrB
MT3344     mtrA
MT3345     tmk
MT3346     sahH
MT3347     Rv3249c
           rubB
MT3349     rubA
MT3350     Rv3252c
MT3351     Rv3253c
MT3352     Rv3254
MT3353     manA
MT3354     Rv3256c
MT3355     pmmA
MT3356     Rv3258c
MT3357     Rv3259
MT3358     whiB2
MT3359     Rv3261
MT3361     Rv3262
MT3363     Rv3263
MT3364     rmlA2
MT3365     wbbL
           rmlD
MT3367     Rv3267
MT3368     Rv3268
MT3369     Rv3269
MT3370     ctpC
MT3371     Rv3271c
MT3372     Rv3272
MT3373     Rv3273
MT3374     fadE25
MT3375     purE
MT3376     purK
MT3377     Rv3277
MT3377.1   Rv3278c
MT3379     birA
MT3379.1   accD5
MT3380     Rv3281
MT3381     Rv3282
MT3382     sseA
MT3383     Rv3284
MT3384     accA3
MT3385     sigF
           rsbW
MT3387     Rv3288c
MT3388     Rv3289c
MT3389     lat
           Rv3291c
MT3391     Rv3292
MT3392     aldB
           Rv3294
MT3394     Rv3295
MT3395     lhr
MT3396     nei
MT3397     lpqC
MT3398     atsB
MT3399     Rv3300c
MT3400     phoY1
MT3401     glpD2
MT3402     lpdA
MT3403     Rv3304
MT3404     amiA
MT3405     amiB
MT3406     deoD
MT3407     pmmB
MT3408     upp
MT3409     Rv3310
MT3410     Rv3311
MT3411     Rv3312c
MT3414     add
MT3415     deoA
MT3416     cdd
MT3417     sdhC
MT3418     sdhD
           sdhA
MT3420   sdhB
MT3421   Rv3320c
MT3422   Rv3321c
MT3423   moaE3
MT3424   gphA
MT3425   moaC3
         Rv3325
MT2881   Rv3326
MT3430   Rv3327
         sigJ
MT3432   Rv3329
MT3433   Rv3330
MT3434   sugI
MT3435   nagA
MT3437   Rv3333c
MT3438   Rv3334
MT3439   Rv3335c
         trpS
         Rv3337
MT3441   Rv3338
MT3442   icd1
MT3443   metC
MT3444   metA
MT3445   Rv3342
MT3447   PPE
         PE_PGRS
MT3449   PE_PGRS
MT3450   Rv3346c
MT3453   PPE
MT3455   Rv3348
MT3456   Rv3349c
MT3458   PPE
MT3459   Rv3351c
MT3460   Rv3352c
MT3461   Rv3353c
MT3462   Rv3354
MT3463   Rv3355c
MT3464   folD
MT3465   Rv3357
MT3466   Rv3358
MT3467   Rv3359
MT3468   Rv3360
MT3469   Rv3361c
MT3470   Rv3362c
         Rv3363c
         Rv3364c
MT3474   Rv3365c
MT3475   spoU
MT3476   PE_PGRS
MT3477   Rv3368c
MT3478   Rv3369
MT3480   dnaE2
MT3481     Rv3371
MT3482     otsB2
MT3484     echA18
MT3484     echA18'
MT3485     amiD
MT3486     Rv3376
MT3487     Rv3377c
MT3488     Rv3378c
           Rv3379c
MT2881     Rv3380c
           Rv3381c
MT3490     lytB
MT3491     idsB
MT3492     Rv3384c
MT3493     Rv3385c
MT3494     Rv3386
MT3494.1   Rv3387
MT3495     PE_PGRS
MT3496     Rv3389c
MT3497     lpqD
MT3498     acrA1
MT3499     cmaA1
MT3500     iunH
MT3501     Rv3394c
MT3502     Rv3395c
MT3504     guaA
MT3505     phyA
MT3506     idsA
MT3507     Rv3399
MT3508     Rv3400
MT3509     Rv3401
MT3510     Rv3402c
MT3511     Rv3403c
MT3512     Rv3404c
           Rv3405c
MT3514     Rv3406
MT3515     Rv3407
MT3516     Rv3408
MT3517     choD
           guaB3
MT3519     guaB2
MT3521     Rv3412
MT3522     Rv3413c
MT3523     sigD
MT3524     Rv3415c
MT3525     whiB3
MT3526     groEL1
MT3527     groES
MT3528     gcp
MT3529     rimI
MT3530     Rv3421c
MT3531     Rv3422c
MT3532     alr
MT3532.2   Rv3424c
           PPE
           PPE
           Rv3427c
           Rv3428c
MT3533     PPE
MT3534     Rv3430c
MT3537     Rv3431c
MT3538     gadB
MT3539     Rv3433c
MT3540     Rv3434c
           Rv3435c
MT3542     glmS
MT3542.1   Rv3437
MT3543     Rv3438
MT3544     Rv3439c
MT3545     Rv3440c
MT3546     mrsA
MT3547     rpsI
MT3548     rplM
MT3549     Rv3444c
MT3550     Rv3445c
MT3551     Rv3446c
MT3553     Rv3447c
MT3554     Rv3448
MT3555     Rv3449
MT3556     Rv3450c
MT3557     Rv3451
MT3559     Rv3452
MT3561     Rv3453
MT3561     Rv3454
MT3562     truA
MT3563     rplQ
MT3564     rpoA
MT3565     rpsD
MT3566     rpsK
           rpsM
           rpmJ
MT3568     infA
MT3569     Rv3463
MT3570     rmlB
MT3571     rmlC
MT0103     Rv3466
           Rv3467
MT3574     rmlB3
MT3575     mhpE
           ilvB2
MT3577     Rv3471c
MT3578     Rv3472
           bpoA
           Rv3474
MT2881     Rv3475
           kgtP
MT3581     PE
           PPE
MT3583     Rv3479
MT3584     Rv3480c
MT3585     Rv3481c
           Rv3482c
MT3587     Rv3483c
MT3588     cpsA
MT3589     Rv3485c
MT3590     Rv3486
MT3591     lipF
           Rv3488
           Rv3489
MT3594     otsA
MT3595     Rv3491
MT3596     Rv3492c
MT3597     Rv3493c
MT3598     Rv3494c
MT3599     lprN
MT3600     Rv3496c
MT3601     Rv3497c
MT3602     Rv3498c
MT3603     mce4
MT3604     Rv3500c
           Rv3501c
MT3606     Rv3502c
MT3607     fdxD
MT3608     fadE26
MT3609     fadE27
MT3610     fadD17
MT3612     PE_PGRS
           PE_PGRS
MT3613     ilvX
           Rv3510c
MT3615.1   PE_PGRS
MT3615.1   PE_PGRS
MT3615.2   fadD18
MT3615.3   PE_PGRS
MT3616     fadD19
MT3617     echA19
MT3618     Rv3517
MT3619     Rv3518c
           Rv3519
MT3621     Rv3520c
           Rv3521
MT3622.1   Rv3522
MT3623     Rv3523
MT3624     Rv3524
MT3625     Rv3525c
           Rv3526
MT3627   Rv3527
MT3629   Rv3528c
MT3632   Rv3529c
MT3633   Rv3530c
MT3634   Rv3531c
MT3636   PPE
MT3637   PPE
         Rv3534c
MT3639   Rv3535c
MT3640   Rv3536c
MT3641   Rv3537
MT3642   ufaA2
MT3643   PE
MT3644   ltp2
         Rv3541c
         Rv3542c
MT3647   fadE29
MT3648   fadE28
MT3649   Rv3545c
MT3650   fadA5
MT3651   Rv3547
MT3652   Rv3548c
MT3653   Rv3549c
MT3654   echA20
MT3655   Rv3551
MT3656   Rv3552
         Rv3553
MT3658   fdxB
MT3659   Rv3555c
MT3660   fadA6
MT3661   Rv3557c
MT3663   PPE
         Rv3559c
MT3665   fadE30
         fadD3
MT3667   fadE31
MT3668   fadE32
MT3669   fadE33
MT3670   aspB
MT3671   nhoA
MT3672   Rv3567c
MT3673   Rv3568c
         Rv3569c
MT3675   Rv3570c
         Rv3571
         Rv3572
MT3678   fadE34
MT3679   Rv3574
MT3680   Rv3575c
MT3681   pknM
MT3682   Rv3577
MT3684   arsB2
MT3685     Rv3579c
MT3686     cysS
MT3687     Rv3581c
MT3688     Rv3582c
MT3689     Rv3583c
           lpqE
MT3691     radA
MT3692     Rv3586
MT3693     Rv3587c
MT3694     Rv3588c
MT3695     mutY
MT3696     PE_PGRS
MT3697     Rv3591c
MT3698     Rv3592
MT3699     lpqF
MT3700     Rv3594
MT3701     PE_PGRS
MT3703     clpC
MT3704     lsr2
MT3705     lysS
           Rv3599c
MT3706     Rv3600c
MT3706.1   panD
MT3707     panC
MT3708     Rv3603c
MT3709     Rv3604c
MT3710     Rv3605c
           folK
MT3712.1   folX
MT3712     folP
MT3713     folE
MT3714     ftsH
           Rv3611
MT3715     Rv3612c
           Rv3613c
MT3716     Rv3614c
MT3717     Rv3615c
MT3718     Rv3616c
MT3719     ephA
MT3720     Rv3618
MT1066     Rv3619c
MT1067     Rv3620c
MT3723     PPE
MT3724     PE
MT3725     lpqG
MT3726     hpt
MT3727     mesJ
MT3728     Rv3626c
           Rv3627c
MT3730     ppa
MT3731     Rv3629c
MT3732     Rv3630
           Rv3631
MT3734     Rv3632
MT3735     Rv3633
MT3736     rmlB2
MT3737     Rv3635
MT3739     Rv3636
           Rv3637
MT3740     Rv3638
MT3741     Rv3639c
MT3742     Rv3640c
MT3743     fic
MT3743.1   Rv3642c
           Rv3643
           Rv3644c
MT3748     Rv3645
MT3749     topA
MT3750     Rv3647c
MT3750.1   cspA
MT3751     Rv3649
MT3752     PE
MT3753     Rv3651
           PE_PGRS
           PE_PGRS
           Rv3654c
MT3756.2   Rv3655c
           Rv3656c
           Rv3657c
MT3758     Rv3658c
MT3759     trbB
MT3760     Rv3660c
MT3761     Rv3661
MT3763     Rv3662c
MT3764     dppD
MT3765     dppC
MT3766     dppB
MT3767     dppA
MT3768     acs
MT3769     Rv3668c
           Rv3669
           ephE
MT3772     Rv3671c
           Rv3672c
MT3774     Rv3673c
MT3775     nth
MT3776     Rv3675
           Rv3676
MT3778     Rv3677c
MT3779     Rv3678c
MT3781     Rv3679
MT3782     Rv3680
MT3783     whiB4
MT3784     ponA'
MT3785   Rv3683
MT3786   Rv3684
MT3787   Rv3685c
MT3788   Rv3686c
MT3789   Rv3687c
MT3790   Rv3688c
MT3791   Rv3689
MT3792   Rv3690
MT3793   Rv3691
MT3794   moxR2
MT3795   Rv3693
MT3796   Rv3694c
         Rv3695
MT3798   glpK
MT3799   Rv3697c
MT3801   Rv3698
MT3802   Rv3699
MT3803   Rv3700c
MT3804   Rv3701c
MT3805   Rv3702c
MT3806   Rv3703c
MT3807   gshA
MT3808   Rv3705c
MT3809   Rv3706c
MT3810   Rv3707c
MT3811   asd
MT3812   ask
MT3813   leuA
         dnaQ
MT3815   Rv3712
MT3816   cobQ2
MT3817   Rv3714c
MT3818   recR
MT3819   Rv3716c
MT3820   Rv3717
         Rv3718c
MT3822   Rv3719
MT3823   Rv3720
MT3824   dnaZX
MT3825   Rv3722c
MT3826   Rv3723
MT3827   Rv3724
MT3828   Rv3725
MT3829   Rv3726
MT3830   Rv3727
MT3831   Rv3728
MT3833   Rv3729
MT3835   Rv3730c
MT3836   ligC
MT3837   Rv3732
MT3838   Rv3733c
MT3839   Rv3734c
MT3840   Rv3735
MT3841   Rv3736
MT3842   Rv3737
MT3844   PPE
MT3844   PPE
MT3848   Rv3740c
MT3849   Rv3741c
MT3850   Rv3742c
MT3851   Rv3743c
MT3852   Rv3744
MT3853   Rv3745c
MT3854   PE
         Rv3747
         Rv3748
MT3856   Rv3749c
MT3857   Rv3750c
         Rv3751
         Rv3752c
MT3860   Rv3753c
MT3861   tyrA
MT3862   Rv3755c
MT3863   proZ
MT3864   proW
MT3865   proV
MT3866   proX
MT3867   Rv3760
MT3868   fadE36
MT3869   Rv3762c
MT3870   lpqH
MT3871   Rv3764c
MT3872   Rv3765c
MT3873   Rv3766
MT3874   Rv3767c
MT3875   Rv3768
         Rv3769
MT3877   Rv3770c
MT3880   Rv3771c
MT3881   hisC2
MT3882   Rv3773c
MT3883   echA21
MT3884   lipE
         Rv3776
MT3886   Rv3777
MT3887   Rv3778c
MT3888   Rv3779
MT3889   Rv3780
MT3890   Rv3781
MT3891   rfbE
MT3892   Rv3783
MT3893   epiB
MT3893   Rv3785
MT3894   Rv3786c
MT3895     Rv3787c
           Rv3788
MT3897     Rv3789
MT3898     Rv3790
MT3899     Rv3791
MT3899.1   Rv3792
MT3900     embC
MT3901     embA
MT3902     embB
MT3903     atsH
MT3904     fadE35
MT1353     Rv3798
MT3906     accD4
MT3907     pks13
MT3908     fadD32
MT3909     Rv3802c
MT3910     fbpC1
MT3911     fbpA
MT3912     Rv3805c
MT3913     Rv3806c
MT3914     Rv3807c
MT3915     Rv3808c
MT3916     glf
MT3917     pirG
MT3918     csp
MT3920     PE_PGRS
MT3922     Rv3813c
MT3923     Rv3814c
MT3924     Rv3815c
MT3925     Rv3816c
MT3925.1   Rv3817
MT3926     Rv3818
           Rv3819
MT3928     papA2
MT3929     Rv3821
MT3930     Rv3822
MT3931     mmpL8
MT3932     papA1
MT3933     pks2
MT3934     fadD23
MT3935     Rv3827c
MT3936     Rv3828c
MT3937     Rv3829c
MT3938     Rv3830c
MT3939     Rv3831
MT3940     Rv3832c
MT3941     Rv3833
MT3942     serS
MT3943     Rv3835
MT3944     Rv3836
MT3945     Rv3837c
MT3946     pheA
MT3947   Rv3839
         Rv3840
MT3949   bfrB
MT3950   glpQ1
MT3951   Rv3843c
MT3455   Rv3844
         Rv3845
MT3960   sodA
MT3961   Rv3847
MT3963   Rv3848
MT3964   Rv3849
MT3965   Rv3850
         Rv3851
MT3967   hns
MT3968   menG
MT3969   Rv3854c
MT3970   Rv3855
MT3971   Rv3856c
MT3972   Rv3857c
MT3973   gltD
MT3974   gltB
MT3975   Rv3860
         Rv3861
MT3976   Rv3862c
         Rv3863
MT3978   Rv3864
         Rv3865
MT3980   Rv3866
MT3980   Rv3867
         Rv3868
MT3982   Rv3869
MT3983   Rv3870
MT3985   Rv3871
MT3986   PE
MT3987   PPE
MT3988   Rv3874
MT3989   esat6
MT3990   Rv3876
MT3991   Rv3877
MT3992   Rv3878
MT3993   Rv3879c
MT3995   Rv3880c
MT3996   Rv3881c
MT3997   Rv3882c
MT3998   Rv3883c
MT3999   Rv3884c
MT4000   Rv3885c
MT4001   Rv3886c
         Rv3887c
MT4003   Rv3888c
MT4004   Rv3889c
MT4005   Rv3890c
MT4006     Rv3891c
MT4007     PPE
MT4008     PE
MT4010     Rv3894c
MT4011     Rv3895c
MT4012     Rv3896c
MT4013     Rv3897c
MT4014     Rv3898c
MT4016     Rv3899c
MT4017     Rv3900c
MT4018     Rv3901c
MT4020     Rv3902c
           Rv3903c
MT4023     Rv3904c
MT4024     Rv3905c
MT4025     Rv3906c
MT4026     pcnA
MT4027     Rv3908
MT4028     Rv3909
           Rv3910
           sigM
MT4031     Rv3912
MT4032     trxB2
MT4033     trxC
MT4034     cwlM
MT4035     Rv3916c
           parA
MT4037     parB
MT4038     gid
MT4039     Rv3920c
MT4040     Rv3921c
MT4040.1   Rv3922c
MT4041     rnpA
MT4041.1   rpmH
MT1288
MT1321
MT1342
MT1356
MT1360
MT1364
MT1401
MT1404
MT1432
MT1488
MT1490
MT1499
MT1520
MT1535
MT1537
MT1547
MT1571
MT1602
MT1627
MT1676
MT1713
MT1742
MT1747
MT1777
MT1796
MT1798
MT1800
MT1801
MT1802
MT1808
MT1812
MT1813
MT1815
MT1866
MT1909
MT1945
MT1968
MT1978
MT2011
MT2013
MT2027
MT2035
MT2038
MT2045
MT2047
MT2068
MT2080
MT2081
MT2083
MT2138
MT2144
MT2165
MT2168
MT2185.1
MT2201
MT2246
MT2277
MT2297
MT2325
MT2326
MT2365
MT2367
MT2369
MT2370
MT2375
MT2396
MT2405
MT2417
MT2418
MT2420
MT2421
MT2424
MT2455
MT2466
MT2473
MT2501
MT2510
MT2558
MT2565
MT2588
MT2606
MT2619
MT2625
MT2676
MT2710
MT2812
MT2924
MT2931
MT2960
MT3014
MT3024
MT3033
MT3042
MT3077
MT3102
MT3103
MT3117
MT3135
MT3156
MT3204
MT3207
MT3222
MT3223
MT3248
MT3268
MT3269
MT3279
MT3280
MT3282
MT3284
MT3289
MT3292
MT3297
MT3304
MT3318
MT3322
MT3362
MT3412
MT3413
MT3427   moaA-3
MT3428
MT3429
MT3447
MT3449
MT3476
MT3483
MT3520
MT3536
MT3560
MT3612
MT3628
MT3630
MT3631
MT3701
MT3754
MT3755
MT3762
MT3800
MT3846
MT3847
MT3879
MT3919
MT3921
MT3952
MT3953
MT3954
MT3958
MT3959
MT3962
MT3994
MT4019
MT0009
MT0023
MT0031
MT0032
MT0036
MT0069
MT0085
MT0124
MT0132
MT0159
MT0196
MT0290
MT0294
MT0325
MT0370
MT0431
MT0492
MT0506
MT0521
MT0553
MT0576
MT0600
MT0603
MT0639
MT0663     rpmG-1
MT0694
MT0697
MT0761
MT0780
MT0812
MT0817
MT0827
MT0835
MT0853
MT0855
MT0859
MT0895
MT0932
MT0937
MT0943
MT0946
MT0973
MT0987
MT1008
MT1033
MT1055
MT1070
MT1071
MT1077
MT1086
MT1097
MT1098
MT1121
MT1123
MT1166
MT1178
MT1181
MT1190
MT1192
MT1196
MT1232
MT1266
MT1814.2
MT1006.1
MT1118.1
MT3671.1
MT1169
MT2627.1
MT3052.2   rpmB-3
MT0085.1
MT0762.1
MT0768.1
MT1025.2
MT1054.1
MT1083.2
         MT1585.1
         MT2365.2
         MT2367.1
         MT2370.1
         MT2370.3
         MT2589.1
         MT2880.2
         MT2880.1
         MT3454
         MT4026.1
         MT4041.2
GCCCGCTAGTGGTCGAAGAGGCGTTCGGGGTGGTGGTAGTCGTTGG
         MT0099.1
         MT0116.1
         MT0204.1
         MT0291
         MT0291.2
         MT0291.4
         MT0407.1
         MT0472.1
         MT0638.1
         MT0662.1
         MT0717.1
         MT0719.1
         MT0724.1
         MT0726.1
         MT0740.1
         MT0772.5
         MT0773.1
         MT0856.1
         MT0910.1
         MT0910.2
         MT0910.3
         MT0910.4
         MT0915.1
         MT1070.1
         MT1082
         MT1096.2
         MT1118.2
         MT1122.1
TCCTGCGTCACCCCTTCGCTTGACTACTACCAGCGAAGTTCCCAC
 ACTCTTGGGGAAGATCAGCCTGTTATCCCCGGGGTACCTTTTATC
         MT1414.1
         MT1483
         MT1497.2
         MT1556.1
         MT1560.1
         MT1578.1
         MT1650.1
         MT1746.1
         MT1771.1
         MT1838.1
        MT1924.1
        MT1957.1
        MT2015.1
        MT2015.2
        MT2042.1
        MT2045.1
        MT2080.1
        MT2138.1
        MT2165.1
CACCTCGGATTGCCGTTAGCAATCACCCTGCTCTGTGAAGTCCGG
        MT2361.1
        MT2365.1
        MT2370.2
        MT2401.2
        MT2423.1
        MT2467
        MT2554
        MT2554.1
        MT2586.1
        MT2600.1
        MT2601.1
        MT2689.1
        MT2803.1
        MT2882.1
        MT2988.1
        MT3041.1
        MT3080.1
        MT3106.1
        MT3149.1
        MT3174.1
        MT3174.2
        MT3220.1
        MT3220.2
        MT3275.1
        MT3290.1
        MT3427.1
        MT3437.1
        MT3491.1
        MT3580.1
        MT3580.2
        MT3615.3
        MT3615.3
        MT3615.4
        MT3671.2
        MT3718.1
        MT3718.2
        MT3767.1
        MT3767.2
        MT3767.3
        MT3808.1
        MT3814.1
        MT3972.1
          MT3974.1
ATCCGGTTGGCGGTCGCCGCGGCAGCGGTTGTGATCGGAT
          MT1717
GCGGGCCGCGGCTTTGGCGTTGGGATACCTGGCCTA
          MT1865
          MT2092
          MT2115
CGGCATCGGGGATCGCCCTCGGGCGATGGCCAAGGT
 CGAGCTGCCGCGCGAGGTTCATCAG
GGCGGCACATCGACCTCAAGCGGGTCTGCAGCTGTGGCTGT
          MT2722
          MT2941
          MT3436
TCCGTGTGCAGGGGGAACTGTCCGCGCTCTTGGAGAGGCT
GAGCAGCGGGCACTGGTCATCCCGTTCGACCCGGTGTTTC
          MT3780
CGCCCAGCTGGCTGGCGACCGCATAGCGTT
 GATGAGGAGGAGCGGCGCGCATGACTGC
          MT0270
          MT0416
          MT0450
          MT0540
CCGAGTTCGCTTCCGCGGACGCAAGCCCGGGATTTG
 GGTGGCCTGGGCCACCGAGGCTCTAGAGGCTGAAC
          MT0868
          MT0991
          MT0573.1
CGTGTGGAAGCGCTGCATGCGGTGCCGGATCGCGATATCGT
          MT1497.1
          MT2895
 CGTGCTGATCGGCAACGGCGGCAACG
 CCTTGTGGTACCGGTAAGTGCTGTGGCGACCGCGATCT
 CCCTACAAATTGCGGTGGCGCCGGGTGGCGCCCCCGAAC
GCCGATCGCAAGCGCGGCGCTAGCG
GCCGATCGCAAGCGCGGCGCTAGCG
          MT3290.2
 GCTGTACGCGCCATTGGTGTTGGAGGAATGGTCATGTCGC
 AATGGCACCACCGGAGCAGGCGAAAGGTACCCGGTT
 ATCGCTAGCCCTGTGGCGCCGGGACGAA
          MT3876.1
CCAGCCTCCGGCAAGCTCGACAGCATCACC
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
MT0033
MT0209
MT0238
MT0245
MT0328.2
MT0376
MT0401.1
MT0512
MT0584
MT0766
MT1029
MT1135
MT1157
MT1216
MT1323
MT1433
MT1467
MT1533
MT1558
MT2182.1
MT2183
MT2285.2
MT2286
MT2306
MT2330.1
MT2334.1
MT2352
MT2477
MT2488.1
MT2589
MT2810
MT2837
MT2996
MT3377.1
MT3386
MT3431
MT3573.11
MT3573.12
MT3620
MT3663
MT3797
MT3948
MT4002
MT4030
MT1330
MT2434
MT2438
MT2673.1
MT2878
MT2991
MT3448
MT3756
MT3756.1
MT0025
MT0028
MT0066.1
MT0066.2
MT0130
MT0177
MT0250
MT0270.1
MT0291.1
MT0328.1
MT0347
MT0383
MT0392
MT0407
MT0470
MT0487
MT0494
MT0525
MT0543
MT0555
MT0568
MT0608
MT0610
MT0614
MT0620
MT0645.2
MT0655
MT0726
MT0771
MT0781
MT0806
MT0863
MT0903
MT0968.1
MT1007
MT1025.3
MT1040.1
MT1083.1
MT1116
MT1148
MT1170
MT1172.1
MT1182
MT1236
MT1264.1
MT1285
MT1305.1
MT1329
MT1330.1
MT1367
MT1367.1
MT1409
MT1413
MT1479.1
MT1534
MT1555.1
MT1757
MT1775
MT1821.1
MT1839.1
MT1849.1
MT1916
MT2007
MT2015
MT2113
MT2122
MT2123
MT2138.2
MT2142
MT2160.1
MT2291
MT2316
MT2341
MT2401.1
MT2480
MT2502
MT2514
MT2518.1
MT2520.1
MT2541
MT2544
MT2554.2
MT2593.2
MT2617
MT2626
MT2637.1
MT2653
MT2668
MT2694
MT2721
MT2726
MT2779
MT2807
MT2871
MT2934
MT2944
MT2958.1
MT2983
MT2993
MT3013
MT3032
MT3037
MT3084
MT3098
MT3131.1
MT3139.1
MT3145.1
MT3210
MT3270.1
MT3273
MT3313
MT3378
MT3393
MT3426
MT3456.1
MT3503
MT3532.1
MT3573.13
MT3573.16
MT3626
MT3653.1
MT3745
MT3757
MT3770
MT3855
MT3858
MT3876
MT3954.1
MT3957
MT4035.1
MT0012
MT0270.2
MT1107
MT1650
MT1760
MT1822
MT2547.2
MT2736.1
MT2950
MT3573.10
MT2375
MT2657
MT2783
MT3071
MT3299
MT3615.4
MT3661
MT3944
MT4001
MT1029      alkB

            pstA1
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
          MT0059             rpsF
          MT0062             rplI
                             rpsM
                             rpmJ
          MT4041.1           rpmH
          MT1480             gap
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
          MT0059             rpsF
          MT0062             rplI
                             rpsM
                             rpmJ
          MT4041.1           rpmH
          MT1480             gap
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
          MT0059             rpsF
          MT0062             rplI
                             rpsM
                             rpmJ
          MT4041.1           rpmH
          MT1480             gap
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
          MT0059             rpsF
          MT0062             rplI
                             rpsM
                             rpmJ
          MT4041.1           rpmH
          MT1480             gap
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
          MT0059             rpsF
          MT0062             rplI
                             rpsM
                             rpmJ
          MT4041.1           rpmH
          MT1480             gap
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
          MT0059             rpsF
          MT0062             rplI
                             rpsM
                             rpmJ
          MT4041.1           rpmH
          MT1480             gap
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
          MT0059             rpsF
          MT0062             rplI
                             rpsM
                             rpmJ
          MT4041.1           rpmH
          MT1480             gap
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
          MT0059             rpsF
          MT0062             rplI
                             rpsM
                             rpmJ
          MT4041.1           rpmH
          MT1480             gap
TTTTATGGAAAGATGACTACTTAGTAGGCCCCCCCCATACACAAA
ACGGATAACCATGCAGTCAGTCCTCATGCCGCGAATAATGCACAC
ACTCCACTATCACGTTAATCAGAATGAGACGAGGGATTATGCAAA
TATTATTTAAAATGCGTCTCCTCGCCCTACAACATCATCCAGCAA
ATTCACTCGGATATATGAGGTATTGGGGTTGAGCGTGCAAACACA
 GAGAGACAGAGCCTTGGATTGTAATGTGGTACTGGGTTGCACGGC
 ATACAACCTATATCCTGACTCATCAGAGATAATCGTCTCAAACT
TAAAGTTTCTCGTACTTTAAGGACTAGTCACCCCCACCTTCCCAC
 GAATGTTATTAGACGAACCTTACGCACGCAATCAGTTGATGCGTG
 CATCTCTCCTGTTTCTTATGCGACTACTTCACGAGCCCTTAGGA
 GTAATGTCCATGCAGGAGACCTTTATAAGTAAGCCGAATCCTAGT
 CCCCCCATACCTTGATTCGGATTACGCAGTATAGAGTACTGGTGC
 AAATGACTCTATAGGACTTAGGTTAATAACCAGGTATCACCCACT
ACTGCTCGGTGTTTTTTAGTGCAGGGTCAAGCCCAGCCCTCAGAT
AGGGGGCTGGTTTTCTAGGAAGCCTTATGAAGGTACCGCAAAAAA
 AAAATTATATGCAACTATTCTCGCTTCGTGAAGCCCAGCAGACGA
 ACTGTAAAATAATAACTGCAACCGCCAAACCATATGCATCTAGGA
ACTGTAATAATCGTTCCTCAACATGTATCAGCGCTCGAATATCGT
 AGACGATTGGAAAACTGGCATTAAATAAACGCTTTGTGGGATGCT
ATACTCTTATTGCTAGGAGTCCCAAGTGCCTGCTTAATACGAAAT
ATAACCCCTTCGAGTAGAAAGCTCGAACTCCTACTCGAGCATTAG
TACAGGCAGCTTTCGAGTTAGAATCGAGCGTATCAGTGTGTTCGAT
GACCCCTCACCCTTCTAATATTACGCAGGCGCGAGTGCATGCAGC
 ATGTAAGAAAACAGTCATATCACTACCGGCATAGGCGCCTGCAGA
 CGATGTACTTTCCACACAAGAAGATATCGTAACATAAAGATGGAG
          MT0365             dnaK
          MT0397             clpB
          MT2356             htpG
Description
chromosomal replication initiator protein
DNA polymerase III, [beta] subunit
DNA replication and SOS induction
conserved hypothetical protein
DNA gyrase subunit B
DNA gyrase subunit A
conserved hypothetical protein
hypothetical protein
peptidyl-prolyl cis-trans isomerase
hypothetical protein
hypothetical protein
possible cell division protein
p-aminobenzoate synthase glutamine amidotransferase
serine-threonine protein kinase
serine-threonine protein kinase
penicillin-binding protein
FtsW/RodA/SpovE family
putative phosphoprotein phosphatase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
putative p60 homologue
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
C-terminal similar to B. subtilis BioF
possible acyl carrier protein
hypothetical protein
acyl-CoA synthase
conserved hypothetical protein
probable membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
leucyl-tRNA synthase
conserved hypothetical protein
transcriptional regulator (GntR family)
possible monooxygenase
possible dihydrolipoamide acetyltransferase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
penicillin-bonding protein
probable membrane protein
conserved hypothetical protein
30S ribosomal protein S6
single strand binding protein
30S ribosomal protein S18
50S ribosomal protein L9
hypothetical protein
DNA helicase (contains intein)
hypothetical protein
hypothetical protein
hypothetical protein
cellulase/endoglucanase
probable oxidoreductase
possible membrane protein
conserved hypothetical protein
isocitrate dehydrogenase
transcriptional regulator (TetR/AcrR family)
probable oxidoreductase
L-serine dehydratase 1
serine hydroxymethyltransferase
group II intron maturase
ABC-transporter transmembrane subunit
ABC-transporter ATP-binding subunit
conserved hypothetical protein
probable aminotransferase
possible membranememebrane spanning protein
probable oxidoreductase
transcriptional regulator (TetR/AcrR family)
hypothetical protein
hypothetical protein
transcriptional regulator (ArsR family)
probable oxidoreductase subunit
probable oxidoreductase subunit
formate hydrogenlyase subunit 4
putative formate hydrogen lyase hycP
probable formate hydrogenlyase subunit
probable formate hydrogenlyase subunit 5
hypothetical protein
possible bioC biotin synthesis gene
hypothetical protein
conserved hypothetical protein
cation-transporting ATPase
hypothetical protein
REP-family protein
REP-family protein
PPE-family protein
conserved hypothetical protein
hypothetical protein
acyl-CoA synthase
hypothetical protein
unknown non-ribosomal peptide synthase
membrane protein
cation transport ATPase
hypothetical protein
50S ribosomal protein L28
conserved hypothetical protein
probable magnesium transport ATPase
hypothetical protein
PE_PGRS-family protein
transmembrane protein
possible acyltransferase
probable GDP-mannose dehydratase
phosphoheptose isomerase
similar to HisB
conserved hypothetical protein
conserved hypothetical protein
transcriptional regulator (LysR family)
oxalyl-CoA decarboxylase
acyl-CoA synthase
elongation factor G
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS-family protein
probable serine protease
probable glycosyl hydrolase
conserved hypothetical protein
hypothetical protein
antigen 85C, mycolytransferase
conserved hypothetical protein
acyl-CoA dehydrogenase
putative oxidoreductase
possible puromycin N-acetyltransferase
probable epoxide hydrolase
putative transcriptional regulator
cytochrome p450
putative peptide methionine sulfoxide
conserved hypothetical protein
putative oxidoreductase
conserved hypothetical protein
hypothetical protein
hypothetical protein
probable chloride channel
putative transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
aldehyde dehydrogenase
steroid dehydrogenase
putative oxidoreductase
conserved hypothetical protein
PE-family protein
PE-family protein
putative protein-tyrosine-phosphatase
acyl-CoA dehydrogenase
pyridine transhydrogenase subunit [alpha]1
pyridine transhydrogenase subunit [alpha]2
pyridine transhydrogenase subunit [beta]
transcriptional regulator (TetR/AcrR family)
PE-family protein
PE-family protein
possible oxidoreductase
alcohol dehydrogenase (Zn)
probable dehydrogenase
conserved hypothetical protein
transcriptional regulator (GntR family)
acyl-CoA synthase
part of mce1 operon
part of mce1 operon
cell invasion protein
part of mce1 operon
part of mce1 operon
part of mce1 operon
part of mce1 operon
part of mce1 operon
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
lipoprotein
probable membrane protein
conserved hypothetical protein
sigma-70 factors ECF subfamily
Probable oxidoreductase
conserved hypothetical protein
conserved hypothetical protein
[beta]-glucosidase
probable o-methyltransferase
putative methyltransferase
dihydroxy-acid dehydratase
conserved hypothetical protein
probable chloramphenicol resistance protein
conserved hypothetical protein
hypothetical protein
Probable ABC transporter
transcriptional regulator (LuxR/UhpA family)
transcriptional regulator (TetR/AcrR family)
conserved hypothetical protein
probable zinc metalloprotease
conserved hypothetical protein
probable membrane protein
conserved hypothetical protein
conserved large membrane protein
hypothetical protein
probable membrane protein
probable membrane protein
conserved large membrane protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
phosphoenolpyruvate carboxykinase
similar to E.coli NadR
some similarity to methyltransferases
acyl-CoA synthase
acyl-CoA dehydrogenase
conserved hypothetical protein
probable esterase
some similarity with sulphitesulfite oxidases
hypothetical protein
probable esterase
conserved hypothetical protein
enoyl-CoA hydratase/isomerase superfamily
aldehyde dehydrogenase (possible betB)
Probable methyltransferase
possible involved in LPS synthesis
probable membrane protein
possible membrane protein
similar to acyltransferases
conserved hypothetical protein
conserved hypothetical protein
acyl-CoA dehydrogenase
transcriptional regulator (TetR/AcrR family)
ribonucleoside-diphosphate reductase B2
succinate-semialdehyde dehydrogenase
conserved hypothetical protein
possible membrane protein
beta-hexosaminidase precursorBETA-HEXOSAMINIDASE A
transcriptional regulator (TetR/AcrR family)
conserved hypothetical protein
hypothetical protein
hypothetical protein
3-oxoacyl-[ACP] reductase
acetyl-CoA C-acetyltransferase
acyl-CoA dehydrogenase
probable monooxygenase
probable membrane transport protein
probable iron-sulphur protein
probable flavoprotein subunit of Rv0247c
probable membrane anchor protein
hypothetical protein
possible heat shock protein
nitrite reductase flavoprotein
probable nitrite reductase small subunit
cobinamide kinase
cobyric acid synthase
PPE-family protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
two-component response regulator
nitrite extrusion protein1
aminoglycoside 2'-N-acetyltransferase
conserved hypothetical protein
conserved hypothetical protein
iron transport protein FeIII dicitrate transporter
conserved hypothetical protein
similar to nitrite extrusion protein 2
hypothetical protein
conserved hypothetical protein
acyl-CoA synthase
acyl-CoA dehydrogenase
hypothetical protein
putative transcriptional regulator
hypothetical protein
acyl-CoA synthase
conserved hypothetical protein
conserved hypothetical protein
PE_PGRS-family protein
PE_PGRS-family protein
PPE-family protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
PE-family protein
PPE-family protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
unknown hydrophobic protein
secreted protease
unknown possible membrane protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
proable arylsulfatase
PE_PGRS-family protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
transcriptional regulator (TetR/AcrR family)
similar to NADPH dehydrogenase
PPE-family protein
PPE-family protein
similar to BluB cobalamin synthesis protein R.
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
unknown hydrophobic protein
probable [beta]-1,3-glucanase
probable muconolactone isomerase
glycerophosphoryl diester phosphodiesterase

pyrrolidone-carboxylate peptidase
conserved hypothetical protein
deoxycytidine triphosphate deaminase
UDP-glucose dehydrogenase/GDP-mannose
conserved hypothetical protein
putative transcriptional regulator
hypothetical protein
hypothetical protein
cytochrome P-450 monooxygenasemonoxygenase
transcriptional regulator (TetR/AcrR family)
conserved hypothetical protein
hypothetical protein
putative dehydrogenase
hypothetical protein
hypothetical protein
glucose-1-phosphate thymidyltransferase
PE-family protein
conserved hypothetical protein
aspartate aminotransferase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
lipoprotein
unknown possible membrane protein
probable aromatic amino acid permease
conserved hypothetical protein
putative transcriptional regulator
hypothetical protein
70 kD heat shock protein, chromosome replication
stimulates DnaK ATPase activity
acts with GrpE to stimulate DnaK ATPase
heat shock regulator
PPE-family protein
PPE-family protein
hypothetical protein
adenylosuccinate synthase
hypothetical protein
conserved hypothetical protein
hypothetical protein
possible membrane protein
putative magnesium ion transporter
fructose bisphosphate aldolase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
putative CO dehydrogenase gene cluster
putative CO dehydrogenase gene cluster
Possible membrane protein
conserved hypothetical protein
putative CO dehydrogenase gene cluster
putative CO dehydrogenase gene cluster
putative CO dehydrogenase gene cluster
conserved hypothetical protein
transcriptional regulator (LysR family)
conserved hypothetical protein
probable transport protein SecE/Sec61- g family
some similarity with methyltransferases
hypothetical protein
probable uridine 5'-monophosphate synthase
unknown possible membrane protein
heat shock protein
similar to oxidoreductases
transcriptional regulator (LuxR/UhpA family)
conserved hypothetical protein
PPE-family protein
phosphoribosylglycinamide formyltransferase II
hypothetical protein
o-succinylhomoserine sulfhydrylase
possible dehydrogenasedehydrogemase
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
possible PBP
acyl-CoA dehydrogenase
probable membrane protein
conserved large membrane protein
conserved small membrane protein
acyl-CoA synthase
polyketide synthase
conserved hypothetical protein
probable coenzyme F420-dependent enzyme
phosphate acetyltransferase
acetate kinase
serine-threonine protein kinase
putative glutamine binding protein
unknown probable membrane protein
MutT homologue
thiamine synthesis, thiazole moiety
conserved hypothetical protein
conserved hypothetical protein
thiamine synthesis, thiazole moiety
probable aminopeptidase Y
possible zinc metallopeptidase
hypothetical protein
hypothetical protein
phosphomethylpyrimidine kinase
thiamine synthesis, pyrimidine moiety
hypothetical protein
C-terminal region putative cation-transporting
hypothetical protein
exodeoxyribonuclease III
hypothetical protein
polypeptide deformylase
hypothetical protein
tuberculin related peptide (AT103)
superoxide dismutase precursor (Cu-Zn)
conserved hypothetical protein
conserved hypothetical protein
ATPase of AAA-family
CDP-diacylglycerol-serine o-phosphatidyltransferase
putative phosphatidylserine decarboxylase
molybdenum cofactor biosynthesis, protein A
Probable oxidoreductase
60 kD chaperonin 2
65 kDa antigen
PPE-family protein
hypothetical protein
conserved hypothetical protein
ECF-type sigma factor
conserved hypothetical protein
unknown fatty acid methyltransferase
conserved hypothetical protein
putative dehydrogenase
conserved large membrane protein
conserved small membrane protein
putative transcriptional regulator
PPE-family protein
conserved hypothetical protein
hypothetical protein
enoyl-CoA hydratase/isomerase superfamily
probable peptidase
aldehyde dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
unknown possible membrane protein
probable dihydrolipoamide dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
transcriptional regulator (PbsX/Xre family)
conserved hypothetical protein
isocitrate lyase
3-hydroxyacyl-CoA dehydrogenase
unknown mycolic acid methyltransferase
unknown mycolic acid methyltransferase
hypothetical protein
transcriptional regulator (TetR/AcrR family)
possible membrane protein
transcriptional regulator (PbsX/Xre family)
possible exported protein
unknownunkown hydrophobic protein
possible exported protein
deoxyribose-phosphate aldolase
unknown hydrophobic protein
conserved hypothetical protein
hypothetical protein
UDP-N-acetylenolpyruvoylglucosamine reductase
conserved hypothetical protein
oxidoreductase
transcriptional regulator (ROK family)
conserved hypothetical protein
conserved hypothetical protein
probable membrane protein
phosphoglycerate mutase I
sensor histidine kinase
two-component response regulator
gmc-type oxidoreductase
conserved hypothetical protein
transcriptional regulator (GntR family)
conserved hypothetical protein
conserved hypothetical protein
probable membrane protein
conserved hypothetical protein
hypothetical protein
pyrroline-5-carboxylate reductase
UDP-glucose 4-epimerase
conserved hypothetical protein
cyclopropane mycolic acid synthase 2
conserved hypothetical protein
probable phosphoserine phosphatase
conserved small membrane protein
conserved large membrane protein
hypothetical protein
glutamyl-tRNA reductase
porphobilinogen deaminase
uroporphyrin-III c-methyltransferase
[delta]-aminolevulinic acid dehydratase
probable membrane protein
possible membrane protein
conserved hypothetical protein
conserved hypothetical protein
possible acyltransferase
hypothetical protein
conserved hypothetical protein
similar to methyltransferases
hypothetical protein
probable 4-amino butyrate transporter
conserved hypothetical protein
glutamate-1-semialdehyde aminotransferase
conserved hypothetical protein
conserved hypothetical protein
cytochrome c-type biogenesis protein
probable membrane protein
cytochrome c-type biogenesis protein
conserved hypothetical protein
unknown, membrane protein.
PE_PGRS-family protein
[beta]-ketoacyl-ACP synthase III
4-dihydroxy-2-naphthoate octaprenyltransferase
phosphorylase from Pnp/MtaP family 2
UDP-glucose 4-epimerase
unknown, possible membrane protein,
possible transmembrane protein
probable glycosyltransferase
conserved hypothetical protein
unknown membrane protein
o-succinylbenzoic acid-CoA ligase
conserved hypothetical protein
membrane protein
low-affinity inorganic phosphate transporter
conserved hypothetical protein
putative oxidoreductase
naphthoate synthase
conserved hypothetical protein
hypothetical protein
acyl-CoA synthase
putative transcriptional regulator
o-succinylbenzoate-CoA synthase
probable non-heme bromoperoxidase
2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carbox ylate
possible membrane protein
conserved hypothetical protein
ubiquinone/menaquinone biosynthesis methyltransferase
possible exported
methyl transferase
similar to squalene monooxygenase
heptaprenyl diphosphate synthase II
probable (transmembrane) heat shock protein
glycerol-3-phosphate dehydrogenase
Probable monooxygenasemonoxygenase
conserved hypothetical protein
Probable methyltransferase
similar too MTCY63.32c cytochrome P-450
conserved hypothetical protein
ribonucleotide reductase, class II
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
possible oxidoreductase
putative transcriptional regulator
conserved hypothetical protein
PE_PGRS-family protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
equivalent to MKU20446_1 MK35
hypothetical protein
possible membrane protein
transcriptional regulator (GntR family)
part of mce2 operon
part of mce2 operon
cell invasion protein
part of mce2 operon
part of mce2 operon
part of mce2 operon
part of mce2 operon
part of mce2 operon
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
sensor histidine kinase
sensor histidine kinase
two-component response regulator
hypothetical protein
lipoprotein
resolvase
transposase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
possible monooxygenase
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
possible membrane protein
hypothetical protein
conserved hypothetical protein
galactose-1-phosphate uridylyltransferase N-term
galactose-1-phosphate uridylyltransferase C-term
galactokinase
membrane spanning ATP/GTP-binding protein
potential membrane spanning protein
conserved hypothetical protein
conserved hypothetical protein
probable integral membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
exodeoxyribonuclease V
exodeoxyribonuclease V
exodeoxyribonuclease V
enoyl-CoA hydratase/isomerase superfamily
hypothetical protein
putative glyoxylase II
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
SecE preprotein translocase
transcription antitermination protein
50S ribosomal protein L11
50S ribosomal protein L1
methoxymycolic acid synthase 4
methoxymycolic acid synthase 3
methoxymycolic acid synthase 2
methoxymycolic acid synthase 1
probable hydrolase
conserved hypothetical protein
conserved hypothetical protein
malonyl CoA-[ACP] transacylase
transcriptional regulator (ROK family)
50S ribosomal protein L10
50S ribosomal protein L7/L12
putative transcriptional regulator
putative dioxygenase
ABC transporter
similar to beta dioxygenases
conserved hypothetical protein
probable membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
proable arylsulfatase
hypothetical protein
conserved hypothetical protein
hypothetical protein
[beta] subunit of RNA polymerase
[beta]' subunit of RNA polymerase
conserved hypothetical protein
endonuclease IV (apurinase)
probable esterase
acyl-CoA dehydrogenase (aka aidB)
enoyl-CoA hydratase/isomerase superfamily
hypothetical protein
enoyl-CoA hydratase/isomerase superfamily
conserved large membrane protein
conserved small membrane protein
hypothetical protein
possible membrane protein
possible membrane protein
transcriptional regulator (TetR/AcrR family)
30S ribosomal protein S12
30S ribosomal protein S7
elongation factor G
elongation factor EF-Tu
potential membrane protein
putative dehydrogenase, SDR family
putative oxidoreductase
hypothetical protein
hypothetical protein
transcriptional regulator (TetR/AcrR family)
hypothetical protein
coenzyme pqq synthesis protein E
L-lactate dehydrogenase (cytochrome)
conserved hypothetical protein
glycosyltransferase
gmc-type oxidoreductase
conserved hypothetical protein
hypothetical protein
30S ribosomal protein S10
50S ribosomal protein L3
50S ribosomal protein L4
50S ribosomal protein L23
50S ribosomal protein L2
30S ribosomal protein S19
50S ribosomal protein L22
30S ribosomal protein S3
50S ribosomal protein L16
50S ribosomal protein L29
30S ribosomal protein S17
arylsulfatase
conserved hypothetical protein
potential membrane protein
50S ribosomal protein L14
50S ribosomal protein L24
50S ribosomal protein L5
30S ribosomal protein S14
30S ribosomal protein S8
50S ribosomal protein L6
50S ribosomal protein L18
30S ribosomal protein S5
50S ribosomal protein L30
50S ribosomal protein L15
protease IV, signal peptide peptidase
conserved hypothetical protein
conserved hypothetical protein
L-fuculose phosphate aldolase
similar to D-3-phosphoglycerate dehydrogenases
xylulose kinase
conserved hypothetical protein
conserved hypothetical protein
SecY subunit of preprotein translocase
probable adenylate kinase
probable methionine aminopeptidase
sigma-70 factors ECF subfamily
hypothetical protein
putative transcriptional regulator
possible membrane protein
conserved hypothetical protein
conserved hypothetical protein
truncated copy of IS1557
PE_PGRS-family protein
hypothetical protein
putative transcriptional regulator
conserved hypothetical protein
PE_PGRS-family protein
PE_PGRS-family protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
methylmalmonate semialdehyde oxidoreductase
acyl-CoA dehydrogenase
methylmalmonate semialdehyde dehydrogenase
PE_PGRS-family protein
PPE-family protein
hypothetical protein
two-component response regulator
sensor histidine kinase
conserved hypothetical protein
conserved hypothetical protein
zinc-containing alcohol dehydrogenase
hypothetical protein
ferredoxin for cytochrome P-450 system
possible lanosterol 14-demethylase cytochrome P450
short-chain alcohol dehydrogenase family
cytochrome p-450
hypothetical protein
aldehyde dehydrogenases
similar to 7-alpha-hydroxysteroid dehydrogenase
similar to 3-hydroxyisobutyrate dehydrogenase
probable 4-carboxymuconolactone decarboxylase
phosphoribosylamine-glycine ligase
putative [gamma]-glutamyl transpeptidase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
adenylosuccinate lyase
similar linalool 8-monooxygenase, cytochrome p-450
conserved hypothetical protein
phosphoribosylaminoimidazole-succinocarboxamide
protease II, [beta] subunit
protease II, [alpha] subunit
multidrug resistance protein
conserved hypothetical protein
putative dehydrogenases
conserved hypothetical protein
hypothetical protein
phosphoribosylformylglycinamidine synthase I
hypothetical protein
hypothetical protein
possible monooxygenasemonoxygenase
transcriptional regulator (GntR family)
conserved hypothetical protein
dihydrolipoamide dehydrogenase
possible IS6110 transposase
possible IS6110 transposase
hypothetical protein
similar to bacteriocins
conserved hypothetical protein
aminopeptidase I
hypothetical protein
acetyltransferase
phosphoribosylformylglycinamidine synthase II
conserved hypothetical protein
conserved hypothetical protein
probable UDP-glucose-4-epimerase
conserved hypothetical protein
amidophosphoribosyltransferase
5'-phosphoribosyl-5-aminoimidazole synthase
hypothetical protein
conserved hypothetical protein
aminodeoxychorismate lyase
conserved hypothetical protein
thiosulfate sulfurtransferase
thiosulfate sulfurtransferase
equivalent to M. leprae ThiX
probable exported protein
two-component response regulator
conserved hypothetical protein
phosphate transport system ABC transporter
phosphate transport system regulator
conserved hypothetical protein
transcriptional regulator (NifR3/Smm1 family)
acyl-[ACP] desaturase
conserved hypothetical protein
conserved hypothetical protein
transcriptional regulator (ArsR family)
conserved hypothetical protein
probable transposase fragment, highly similarsim
conserved hypothetical protein
conserved hypothetical protein
PE_PGRS-family protein
PE_PGRS-family protein
PE_PGRS-family protein
lipoprotein
hypothetical protein
hypothetical protein
lipoprotein
conserved hypothetical protein
probable proline iminopeptidase
hypothetical protein
Unknown integral membrane protein
similar to various dehydrogenases
two-component response regulator
sensor histidine kinase
similar to several L-ascorbate oxidases
lipoprotein
putative cysteine synthase
possible quinolone efflux pump
transposase fragment
Short-chain dehydrogenases/reductase
acyl-CoA synthase
pyruvate (or indolepyruvate) decarboxylase
conserved hypothetical protein
fatty acyl-CoA racemase
conserved hypothetical protein
conserved hypothetical protein
possible aminotransferase
[beta] oxidation complex, subunit (acetyl-CoA
hypothetical protein
probable DNA helicase
conserved hypothetical protein
conserved hypothetical protein
molybdenum cofactor biosynthesis, protein C
molybdopterin biosynthesis
molybdopterin-converting factor subunit 2
probable exported protein
molybdopterin converting factor subunit 1
molybdenum cofactor biosynthesis, protein A
unknown hydrophobic protein
probable cold shock protein
PE_PGRS-family protein
acyl-CoA dehydrogenase
conserved hypothetical protein
possible exported protein
possible membrane protein
conserved hypothetical protein
PPE-family protein
hypothetical protein
conserved hypothetical protein
possible rRNA methyltransferase
unknown hydrophobic protein
conserved hypothetical protein
phosphoserine aminotransferase
unknown transmembrane protein
ferredoxin, ferredoxin-NADP reductase
hypothetical protein
possible membrane protein
citrate synthase 2
transcriptional regulator (LuxR/UhpA family)
putative transcriptional regulator
putative monooxygenase
conserved hypothetical protein
putative transcriptional regulator
conserved hypothetical protein
citrate synthase 1
possible oxidoreductase
hypothetical protein
member of OmpA family
hypothetical protein
conserved hypothetical protein
sensor histidine kinase
two-component response regulator
acetyl/propionyl CoA carboxylase [beta] subunit
enoyl-CoA hydratase/isomerase superfamily (aka
probable membrane protein
probable penicillin binding protein
probable cation transport ATPase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable dioxygenase
lipid transfer protein
PPE-family protein
PE-family protein
glycine betaine transport
conserved hypothetical protein
conserved hypothetical protein
probable transposase, related to IS1081
resolvase
transposase
hypothetical protein
transmembrane protein belonging to Nramp family
hypothetical protein
conserved hypothetical protein
short-chain alcohol dehydrogenase family
PstS component of phosphate uptake
membrane-bound component of phosphate transport
PstA component of phosphate uptake
serine-threonine protein kinase
PstS component of phosphate uptake
ABC transport component of phosphate uptake
PstS component of phosphate uptake
PstC component of phosphate uptake
PstA component of phosphate uptake
conserved hypothetical protein
conserved hypothetical protein
probable dehydrase
probable monooxygenase
hypothetical protein
hypothetical protein
probable monooxygenase
possible formamidopyrimidine-DNA glycosylase
ketoacyl reductase
glucose-6-phosphate isomerase
similarity with A85C_MYCTU P31953
hypothetical protein
DNA-dependent ATPase I and helicase II
conserved hypothetical protein
succinyl-CoA synthase [beta] chain
succinyl-CoA synthase [alpha] chain
similar to alkanal monooxygenase beta chains
cell envelope antigen
possible membrane protein
phosphoribosylglycinamide formyltransferase I
phosphoribosylaminoimidazolecarboxamide
similar to magnesium-chelatase subunit
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
cation transport ATPase
hypothetical protein
enoyl-CoA hydratase/isomerase superfamily
acyl-CoA dehydrogenase
acetyl/propionyl-CoA carboxylase, [alpha] subunit
acetyl/propionyl-CoA carboxylase, [beta] subunit
acyl-CoA dehydrogenase
hypothetical protein
PE_PGRS-family protein
PE_PGRS-family protein
hypothetical protein
PE_PGRS-family protein
two-component response regulator
sensor histidine kinase
probable serine protease
molybdenum cofactor biosynthesis, protein B
highly similar to large-conductance mechanosensitive
Probable ABC transporter
potential integral membrane protein
conserved hypothetical protein
heptaprenyl diphosphate synthase II
hypothetical protein
hypothetical protein
conserved hypothetical protein
UTP-glucose-1-phosphate uridylyltransferase
molybdopterin biosynthesis
acetylation of 30S S5 subunit
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
arginine deiminase
probable membrane protein
conserved hypothetical protein
possible exported protein
p-aminobenzoate synthase
hypothetical protein
methionyl-tRNA synthase
conserved hypothetical protein
conserved hypothetical protein
16S rRNA dimethyltransferase
conserved hypothetical protein
hypothetical protein
polyketide synthase
peptidyl-tRNA hydrolase
50S ribosomal protein L25
similar to M. kansasii Q49597
ribose-phosphate pyrophosphokinase
UDP-N-acetylglucosamine pyrophosphorylase
transcriptional regulator (TetR/AcrR family)
transcription-repair coupling factor
conserved hypothetical protein
lipoprotein
enolase
hypothetical protein
hypothetical protein
probable pppGpp-5'phosphohydrolase
two-component response regulator
sensor histidine kinase
potassium-transporting ATPase A chain
potassium-transporting ATPase B chain
potassium-transporting ATPase C chain
sensor histidine kinase
two-component response regulator
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
PPE-family protein
PE-family protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
possible IS1081 transposase
hypothetical protein
transcriptional regulator (MarR family)
probable oxidoreductaseoxidoreducatse
conserved hypothetical protein
hypothetical protein
hypothetical protein
integrase-a
integrase-b
conserved hypothetical protein
conserved hypothetical protein
acyl-CoA synthase
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
lipoprotein
conserved hypothetical protein
conserved hypothetical protein
PE_PGRS-family protein
PE_PGRS-family protein
conserved hypothetical protein
enoyl-CoA hydratase/isomerase superfamily
enoyl-CoA hydratase/isomerase superfamily
probable transmembrane protein
conserved hypothetical protein
acetyl-CoA C-acetyltransferase
conserved hypothetical protein
probable esterase
cystathionine [beta]-synthase
MLPRAG (64.8% id) proline rich Ag
cystathionine [gamma]-synthase
transcription elongation factor G
hypothetical protein
similar to S. lincolnensis lmbE
conserved hypothetical protein
conserved hypothetical protein
possible hemolysin
conserved hypothetical protein
PE_PGRS-family protein
PE-family protein
PE-family protein
probable inactivated cellulase/endoglucanase
PE_PGRS-family protein
pantothenate kinase
serine hydroxymethyltransferase
acyl-[ACP] desaturase
PhoH-like protein
carbohydrate degrading enzyme
probable membrane spanning protein
fumarase
conserved hypothetical protein
conserved hypothetical protein
putative membrane protein
conserved hypothetical protein
hypothetical protein
probable esterase pseudogene
probable esterase pseudogene
probable cholesterol dehydrogenase
exonuclease VII small subunit
exonuclease VII large subunit
hypothetical protein
very similar to LytB
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
glucose-6-phosphate 1-dehydrogenase
6-phosphogluconate dehydrogenase (Gram +)
probable non-heme bromoperoxidase
probable epoxide hydrolase
hypothetical protein
conserved hypothetical protein
similar to pyruvate, phosphate dikinase
REP-family protein
transcriptional regulator (PbsX/Xre family)
conserved hypothetical protein
citrate synthase 3
possible transporter
5-methyltetrahydropteroyltriglutamate-homocystei ne
hypothetical protein
PPE-family protein
probable carnitine racemase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
enoyl-CoA hydratase/isomerase superfamily
enoyl-CoA hydratase/isomerase superfamily
[alpha]-methyl acyl-CoA racemase
short-chain alcohol dehydrogenase
probable drug transporter
probable drug transporter
similar to phosphatidylethanolamine N-methyltransferase
REP-family protein
hypothetical protein
hypothetical protein
putative transcriptional regulator
transcriptional regulator (GntR family)
PKS o-methyltransferase
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable membrane protein
MutT homologue
nitrate reductase [alpha] subunit
nitrate reductase [beta] chain
nitrate reductase [delta] chain
nitrate reductase [gamma] chain
conserved hypothetical protein
lipoprotein
putative transcriptional regulator
PPE-family protein
PE-family protein
similar to S. lincolnensis lmbE
hypothetical protein
PE-family protein
conserved hypothetical protein
hypothetical protein
2,4-Dienoyl-CoA Reductase
conserved hypothetical protein
ferredoxin 4Fe-4S
possible aminotransferase
hypothetical protein
polyketide synthase
polyketide synthase
PKS-associated protein, unknown function
conserved large membrane protein
conserved hypothetical protein
acyl-CoA synthase
hypothetical protein
pyrroline-5-carboxylate dehydrogenase
probable dehydrogenase
ECF family sigma factor
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
acyl-CoA synthase
conserved hypothetical protein
PE-family protein
PPE-family protein
conserved hypothetical protein
conserved hypothetical protein
possible IS1081 transposase
probable sugar transporter
conserved hypothetical protein
succinyl-diaminopimelate desuccinylase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
acyl-CoA synthase
dihydropteroate synthase
conserved hypothetical protein
conserved hypothetical protein
DNA-3-methyladenine glycosidase I
conserved hypothetical protein
possible involved in LPS synthesis
glucose-1-phosphate adenylyltransferase
PE-family protein
conserved hypothetical protein
conserved hypothetical protein
probable integral membrane protein
probable ABC transmembrane transport proteinportein
putative transcriptional regulator
probable methyltransferase
ECF subfamily sigma subunit
hypothetical protein
serine protease
conserved hypothetical protein
conserved hypothetical protein
possible membrane protein
probable transmembrane protein
lipoprotein
similar to MRP/NBP35 ATP-binding proteins
possible membrane protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
possible role in sugar transport
membrane protein probably involved in sugar
sugar transport protein
ABC transporter component of sugar uptake system
probable magnesium and cobalt transport protein
malate dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
PE_PGRS-family protein
lipoprotein
putative dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
2-oxoglutarate dehydrogenase
possible membrane protein
probable drug efflux protein
hypothetical protein
lipoprotein
ATP-dependent DNA/RNA helicase
acyltransferase
transcriptional regulator (TetR/AcrR family)
Probable cytochrome P-450
similar to many dehydrogenases
probable multidrug resistance pump
hypothetical protein
probable oxidoreductase
conserved hypothetical protein
conserved hypothetical protein
putative amidase AMI2_MYCTU Q11056
similar to adenylate cyclases
hypothetical protein
serine-threonine protein kinase
regulator of embAB genes (AfsR/DndI/RedD family)
hypothetical protein
conserved hypothetical protein
lipoprotein
conserved hypothetical protein
probable ABC transporter
ABC transporter
lipoprotein
lipoprotein
hypothetical protein
hypothetical protein
hypothetical protein
probable choline dehydrogenase
probable oligopeptide transport protein
probable peptide transport protein
oligopeptide transport system permease
oligopeptide transport protein
conserved hypothetical protein
ATP:sulphurylase subunit 2
ATP:sulphurylase subunit 1
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
arginyl-tRNA synthase
diaminopimelate decarboxylase
homoserine dehydrogenase
homoserine synthase
homoserine kinase
transcription termination factor rho
50S ribosomal protein L31
peptide chain release factor 1
protoporphyrinogen oxidase
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
ATP synthase a chain
ATP synthase c chain
ATP synthase b chain
ATP synthase [delta] chain
ATP synthase [alpha] chain
ATP synthase [gamma] chain
ATP synthase [beta] chain
ATP synthase [epsilon] chain
conserved hypothetical protein
transposase
conserved hypothetical protein
UDP-N-acetylglucosamine-1-carboxyvinyltransferase
methylated-DNA-protein-cysteine methyltransferase
DNA-3-methyladenine glycosidase II
similar at C-term to adenylate cyclases
similar at C-term to adenylate cyclases
similar at C-term to adenylate cyclases
conserved hypothetical protein
hypothetical protein
acetyl-CoA C-acetyltransferase (aka thiL)
hypothetical protein
PE_PGRS-family protein
1,4-[alpha]-glucan branching enzyme
probable glycosyl hydrolase, [alpha]-amylase family
probable glycogen phosphorylase
probable ATP-dependent helicase
conserved hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
probable hydrolase
conserved hypothetical protein
conserved hypothetical protein
cysteine synthase B
conserved hypothetical protein
glutamate racemase
conserved hypothetical protein
ribonuclease PH
conserved hypothetical protein
polyketide synthase (chalcone synthase-like)
conserved hypothetical protein
possible acyl carrier protein
acyl-CoA synthase
acyl-CoA dehydrogenase
possible aminoglycoside 6'-N-acetyltransferase
heavy metal tolerance protein
probable membrane protein
3-oxoacyl-[ACP] reductase
hypothetical protein
conserved hypothetical protein
transcriptional regulator (TetR/AcrR family)
conserved hypothetical protein
weak similarity to E. coli MoeB
hypothetical protein
conserved hypothetical protein
transcriptional regulator (LuxR/UhpA family)
putative transcriptional regulator
coenzyme F420-dependent
PPE-family protein
conserved hypothetical protein
conserved hypothetical protein
SigB regulation protein
conserved hypothetical protein
hypothetical protein
probable penicillin binding protein
lipoprotein
possible IS6110 transposase
possible IS6110 transposase
hypothetical protein
polyketide synthase
slight similarity to sulfotransferases
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
some similarity to methyltransferases
conserved hypothetical protein
regulatory protein pyrimidine biosynthesis
aspartate carbamoyltransferase
dihydroorotase
hypothetical protein
carbamoyl-phosphate synthase subunit
carbamoyl-phosphate synthase subunit
orotidine 5'-phosphate decarboxylase
PE-family protein
PPE-family protein
integration host factor
putative guanylate kinase
hypothetical protein
flavoprotein
S-adenosylmethionine synthase
FAD-containing monooxygenase
possible cytochrome p450
transcriptional regulator (AraC/XylS family)
PE_PGRS-family protein
conserved hypothetical protein
conserved hypothetical protein
probable lipase
probable lipase
possible membrane protein
putative primosomal protein n' (replication factor
similar to phosphatidylethanolamine N-methyltransferase
transcriptional regulator (MarR family)
similar to phosphatidylethanolamine N-methyltransferase
methionyl-tRNA formyltransferase
similar to Fmu protein
ribulose-phosphate 3-epimerase
riboflavin biosynthesis
probable drug efflux protein
lipoprotein
riboflavin synthase [alpha] chain
hypothetical protein
hypothetical protein
probable GTP cyclohydrolase II
riboflavin synthase [beta] chain
hypothetical protein
lipoprotein
hypothetical protein
excinuclease ABC subunit C
conserved hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
possible membrane protein
conserved hypothetical protein
probable esterase
acyl-CoA synthase
conserved hypothetical protein
conserved hypothetical protein
PE-family protein
possible transporter
putative dehydrogenase
possible membrane protein
hypothetical protein
conserved hypothetical protein
glyceraldehyde 3-phosphate dehydrogenase
phosphoglycerate kinase
triosephosphate isomerase
hypothetical protein
protein-export membrane protein SecG
PE_PGRS-family protein
biotin sulfoxide reductase
hypothetical protein
hypothetical protein
glucose-6-phosphate 1-dehydrogenase
unknown function, may aid G6PDH
glucose-6-phosphate 1-dehydrogenase
transaldolase
transketolase
PE_PGRS-family protein
cytochrome c oxidase assembly factor
PE_PGRS-family protein
conserved hypothetical protein
Probable quinone oxidoreductase
conserved hypothetical protein
probable membrane protein
probable membrane protein
ABC-type transporter
conserved hypothetical protein
putative transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
ABC-type transporter
NifS-like protein
conserved hypothetical protein
conserved hypothetical protein
acyl-CoA dehydrogenase
PE_PGRS-family protein
probable cadmium-transporting ATPase
thioredoxin
thioredoxin reductase
enoyl-CoA hydratase/isomerase superfamily
ABC transporter, possible in EF-3 subfamily
transcriptional regulator (TetR/AcrR family)
aconitate hydratase
hypothetical protein
putative exported p60 protein homologue
putative exported p60 protein homologue
transcriptional regulator, MoxR homologue
conserved hypothetical protein
possible membrane protein
conserved hypothetical protein
3-oxoacyl-[ACP] reductase (aka MabA)
enoyl-[ACP] reductase
ferrochelatase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
unknown putative membrane protein
probable membrane protein
methylmalonyl-CoA mutase, [beta] subunit
methylmalonyl-CoA mutase, [alpha] subunit
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
esterase
methyltransferase
hypothetical protein
similarity to B. subtilis glycosyltransferase
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
probable membrane protein
hypothetical protein
probable membrane proteinvery similar to
GDP-mannose 4,6 dehydratase
nucleotide sugar epimerase
conserved hypothetical protein
involved in polysaccharide synthesis
conserved hypothetical protein
probable glucosyltransferase
conserved hypothetical protein
involved in exopolysaccharide synthesis
conserved hypothetical protein
glycosyltransferase
acyl-CoA synthase
conserved large membrane protein
possible methyl-sterol transferase
possible rhamnosyl/glycosyl transferase
dTDP-rhamnosyl transferase
possible rhamnosyl/glycosyl transferase
polyketide synthase
PKS-associated protein, unknown function
acyl-CoA synthase
alcohol dehydrogenase (Zn)
conserved hypothetical protein
conserved hypothetical protein
probable dioxygenase
transcriptional regulator (TetR/AcrR family)
hypothetical protein
isoleucyl-tRNA synthase
probable DNA-damage-inducible protein
L-asparaginase
lipoprotein signal peptidase
conserved hypothetical protein
lipoprotein
hemoglobin-like, oxygen carrier
probable fatty-acyl CoA reductase
probable ketoacyl reductase
hypothetical protein
conserved hypothetical protein
DNA polymerase III, [alpha] subunit
PPE-family protein
acyl-CoA synthase, C-term
acyl-CoA synthase, N-term
glycerol-3-phosphate acyltransferase
fumarate reductase flavoprotein subunit
fumarate reductase iron sulphur protein
fumarate reductase 15kD anchor protein
fumarate reductase 13kD anchor protein
putative transcriptional regulator
conserved large membrane protein
conserved hypothetical protein
threonine deaminase
conserved hypothetical protein
conserved hypothetical protein
maltooligosyltrehalose trehalohydrolase
putative [alpha]-amylase
probable glycogen debranching enzyme
Unknown membrane protein
putative exported p60 protein homologue
hypothetical protein
adenosylmethionine-8-amino-7-oxononanoate
8-amino-7-oxononanoate synthase
dethiobiotin synthase
conserved hypothetical protein
conserved hypothetical protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 possible prohead protease
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 phage related protein
phiRV1 integrase
REP-family protein
REP-family protein
biotin synthase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
quinolinate synthase
L-aspartate oxidase
nicotinate-nucleotide pyrophosphatase
hypothetical protein
conserved hypothetical protein
histidinol dehydrogenase
histidinol-phosphate aminotransferase
imidazole glycerol-phosphate dehydratase
amidotransferase
phosphoribosylformimino-5-aminoimidazole
impA, inositol monophosphatasemonophosphtase
imidazole glycerol-phosphate synthase
probable phosphoribosyl-AMP 1,6 cyclohydrolase
putative calcium/proton antiporter
probable bacterioferritin comigratory protein
anthranilate synthase component I
possible membrane protein
indole-3-glycerol phosphate synthase
tryptophan synthase [beta] chain
tryptophan synthase [alpha] chain
prolipoprotein diacylglyceryl transferase
hypothetical protein
conserved hypothetical protein
pyruvate kinase
thioesterase II
conserved hypothetical protein
ABC transporter
ABC transporter
cytochrome d ubiquinol oxidase subunit II
cytochrome bd-II oxidase subunit I
possible membrane protein
C-term similar eukaryotic adenylate/guanylate cyclases
two-component response regulator
lipid carrier protein
conserved hypothetical protein
DNA polymerase I
30S ribosomal protein S1
conserved hypothetical protein
hypothetical protein
excinuclease ABC subunit B
probable drug efflux protein
unknown membrane protein
conserved hypothetical protein
conserved hypothetical protein
excinuclease ABC subunit A
conserved hypothetical protein
C-term lysyl-tRNA synthase
initiation factor IF-3
50S ribosomal protein L35
50S ribosomal protein L20
putative 23S rRNA methyltransferase
conserved hypothetical protein
PE-family protein
conserved hypothetical protein
possible membrane protein
phenylalanyl-tRNA synthase [alpha] subunit
phenylalanyl-tRNA synthase [beta] subunit
PE_PGRS-family protein
N-acetyl-[gamma]-glutamyl-phosphate reductase
glutamate N-acetyltransferase
acetylglutamate kinase
acetylornithine aminotransferase
ornithine carbamoyltransferase
arginine repressor
arginosuccinate synthase
arginosuccinate lyase
polyketide synthase (chalcone synthase-like)
polyketide synthase
polyketide synthase
polyketide synthase
polyketide synthase
polyketide synthase (chalcone synthase-like)
Probable cytochrome p450
Probable ABC transporter
probable ABC transporter
hypothetical protein
conserved hypothetical protein
similar to many mercuric transport proteins
probable ABC transporter
conserved hypothetical protein
putative transcriptional regulator
putative transcriptional regulator
possible cytochrome P450
highly similar to C-term Mpt53
probably integral membrane protein
acyl-CoA dehydrogenase
hypothetical protein
weak similarity to E. coli MoaA
conserved hypothetical protein
possible acyl-CoA synthase
conserved hypothetical protein
conserved hypothetical protein
probable transmembrane protein
probable ABC transporter
probable 3-methylpurine DNA glycosylase
tyrosyl-tRNA synthase
lipoprotein
hypothetical protein
probable hydrolase
hypothetical protein
cytotoxin/hemolysin homologue
conserved hypothetical protein
recombination and DNA repair
conserved hypothetical protein
conserved hypothetical protein
CTP synthase
conserved hypothetical protein
integrase/recombinase
REP-family protein
putative methyltransferase
transport of D-alanine, D-serine and glycine
PPE-family protein
PPE-family protein
probable sulphate permease
possible role in chromosome partitioning
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
cytidylate kinase
conserved hypothetical protein
Probable oxidoreductase/gluconate 3-dehydrogenase
3-hydroxyacyl-CoA dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
transcriptional regulator (IclR family)
conserved hypothetical protein
hypothetical protein
possible biotin carboxylase
6-aminohexanoate-dimer hydrolase
hypothetical protein
conserved hypothetical protein
6-hydroxy-d-nicotine oxidase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable penicillin binding protein
succinate-semialdehyde dehydrogenase
conserved hypothetical protein
possible membrane protein
hypothetical protein
hypothetical protein
fused nitrate reductase
nitrite extrusion protein
conserved hypothetical protein
possible sulphate transporter
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
serine-threonine protein kinase
hypothetical protein
conserved hypothetical protein
serine-threonine protein kinase
ABC transporter
hypothetical protein
possible integral membrane protein
acyl-CoA synthase
possible hydroxylasehyroxylase
hypothetical protein
PPE-family protein
conserved hypothetical protein
partial CDS for phospholipase C
possible IS6110 transposase
possible IS6110 transposase
partial cutinase
PE_PGRS-family protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
possible IS6110 transposase
possible IS6110 transposase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
PE_PGRS-family protein
hypothetical protein
conserved hypothetical protein
oxidoreductase, possible
hypothetical protein
transcriptional regulator (IclR family)
putative oxidoreductase with FAD-binding site
conserved hypothetical protein
putative transcriptional regulator
probable cytochrome p450
hypothetical protein
possible integral membrane protein
conserved hypothetical protein
probable 4-[alpha]-glucanotransferase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
Probable member of the cytochrome P450
Probable ferredoxin
PPE-family protein
PE-family protein
PPE-family protein
PPE-family protein
PE-family protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable lipoprotein
PPE-family protein
PPE-family protein
PPE-family protein
PE_PGRS-family protein
conserved hypothetical protein
hypothetical protein
PE-family protein
PPE-family protein
PPE-family protein
PPE-family protein
conserved hypothetical protein
probable magnesium transport ATPase protein C
probable dehydrogenase
conserved hypothetical protein
possible C-5 sterol desaturase
conserved hypothetical protein
putative transcriptional regulator
flavoprotein
PE_PGRS-family protein
probable multidrug resistance pump
acetolactate synthase II
SecA, preprotein translocase subunit
CDP-diacylglycerol-glycerol-3-phosphate
conserved hypothetical protein
small basic protein similar SBP_BACSU
hypothetical protein
glycine cleavage system H protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
glycine decarboxylase
similar to 1,3,4,6-tetrachloro-1,4-cyclohexadien
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
malate synthase
conserved hypothetical protein
conserved hypothetical protein
PE_PGRS-family protein
possible membrane protein
possible membrane protein
inosine-5'-monophosphate dehydrogenase
6-phosphogluconate dehydrogenase (Gram -)
hypothetical protein
putative transcriptional regulator
conserved hypothetical protein
urease [gamma] subunit
urease [beta] subunit
urease [alpha] subunit
urease accessory protein
urease accessory protein
urease accessory protein
probable NADH dehydrogenase
probable monooxygenase
short-chain dehydrogenase/reductase family
molybdate binding protein
transport system permease, molybdate uptake
molybdate uptake ABC-transporter
precursor of Apa (45/47 kD secreted protein)
hypothetical protein
alcohol dehydrogenase (Zn)
probable membrane protein
conserved hypothetical protein
Short-chain alcohol dehydrogenase
conserved hypothetical protein
similar to acetyl CoA synthase/lipid carriers
conserved hypothetical protein
probable reductase (like rhodocoxin reductase)
hypothetical protein
hypothetical protein
L-lactate dehydrogenase
hypothetical protein
hypothetical protein
conserved hypothetical protein
bacterioferritin
probable drug efflux protein
probable glutamine synthase
conserved hypothetical protein
Similar to 6-deoxyerythronolide beta hydroxylase
lipoprotein
probable dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
antigen 85B, mycolyltransferase
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
some similarity to dioxygenases
similar to sorbitol and alcohol dehydrogenases
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
lipoprotein
probable esterase
competence damage protein
probable sialic acid transporter
unknown membrane protein
conserved hypothetical protein
D-amino acid oxidase
conserved hypothetical protein
hypothetical protein
catalase-peroxidase
ferric uptake regulatory protein
probable secreted protein
lipoprotein
3-hydroxyacyl-CoA dehydrogenase
hypothetical protein
hypothetical protein
isocitrate lyase, [alpha] module
isocitrate lyase, [beta] module
PPE-family protein
PPE-family protein
weak similarity to pollen antigens
probableproable membrane protein
lipoprotein
probable penicillin binding protein
probable esterase
hypothetical protein
acyl-CoA synthase
hypothetical protein
hypothetical protein
short-chain alcohol dehydrogenase family
hypothetical protein
conserved hypothetical protein
transcriptional regulator (AraC/XylS family)
thiol peroxidase
acyl-CoA dehydrogenase
acyl-CoA dehydrogenase
enoyl-CoA hydratase/isomerase superfamily
similar alkanal monooxygenase alpha chain
similar to ring-hydroxylating dioxygenases
probable epoxide hydrolase
similar nitrilotriacetate monooxygenase component
GTP cyclohydrolase II
short-chain alcohol dehydrogenase family
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
REP-family protein
lipoprotein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
putative transcriptional regulator
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
part of mce3 operon
part of mce3 operon
cell invasion protein
part of mce3 operon
part of mce3 operon
part of mce3 operon
part of mce3 operon
part of mce3 operon
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
probable zinc metallopeptidase
similar to methyltransferases
unknown permease
secreted immunogenic protein Mpb64/Mpt64
ribonucleotide reductase small subunit
conserved hypothetical protein
PE_PGRS-family protein
probable secreted protein
transcriptional regulator (LysR family)
membrane protein, LYSE/YGGA family
probable secreted protein
possible rRNAmethyltransferase
hypothetical protein
putative transcriptional regulator
conserved hypothetical protein
probable cation transport ATPase
conserved hypothetical protein
transcriptional regulator (MerR family)
hypothetical protein
conserved hypothetical protein
probable cation transport ATPase
conserved hypothetical protein
unknown membrane protein
hypothetical protein
conserved hypothetical protein
3-oxoacyl-[ACP] reductase
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
trehalose-6-phosphate phosphatase
ferredoxin
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
transposase
transposase
conserved hypothetical protein
hypothetical protein
putative transcriptional regulator (PbsX/Xre
conserved hypothetical protein
hypothetical protein
hypothetical protein
putative transcriptional regulator
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
possible membrane protein
conserved hypothetical protein
sensor histidine kinase
conserved hypothetical protein
phosphofructokinase II
conserved hypothetical protein
14kD antigen, heat shock protein Hsp20 family
conserved hypothetical protein
hypothetical protein
transcriptional regulator (ArsR family)
hypothetical protein
similar to lincomycin production genes
probableprob transmembrane protein
probable ABC sugar transporter
probable sugar transporter
probable sugar transporter
probable sugar transporter
conserved hypothetical protein
pyrazinamide resistance/sensitivity
hypothetical protein
probable carboxylesterase
probable lipoprotein
conserved hypothetical protein
polyketide synthase (erythronolide synthase-like)
hypothetical protein
conserved hypothetical protein
probable membrane protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
30S ribosomal protein S18
30S ribosomal protein S14
50S ribosomal protein L33
50S ribosomal protein L28
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
cobalt insertion
hypothetical protein
percorrin reductase
precorrin isomerase
CobI-CobJ fusion protein
conserved hypothetical protein
class A [beta]-lactamase
ECF subfamily sigma subunit
precorrin reductase
precorrin-3 methylase
probable methyltransferase
probable oxidoreductase
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
lipoprotein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
putative transposase
putative transposase
putative transposase
serine-threonine protein kinase
cytoplasmic peptidase
partially similar to DNA polymerase I
potential transmembrane region
probable helicase, Ski2 subfamily
membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
PE_PGRS-family protein
PE_PGRS-family protein
conserved hypothetical protein
probable helicase, Snf2/Rad54 family
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
possible IS6110 transposase
possible IS6110 transposase
PE-family protein
PPE-family protein
proteasome [alpha]-type subunit 1
proteasome [beta]-type subunit 2
conserved hypothetical protein
conserved hypothetical protein
possible integral membrane protein
hypothetical protein
ATPase of AAA-family
lipoprotein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
ATP phosphoribosyltransferase
phosphoribosyl-AMP cyclohydrolase
PPE-family protein
5-methyltetrahydrofolate-homocysteine
conserved hypothetical protein
PE_PGRS-family protein
L-asparagine permease
hypothetical protein
putative oxidoreductase
cysteinyl-tRNA synthase
homologue of M.leprae cysQ
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative bacitracin resistance protein
conserved hypothetical protein
lipoprotein
dihydroorotate dehydrogenase
conserved hypothetical protein
ArgE/DapE/Acy1/Cpg2/yscS family
hypothetical protein
conserved hypothetical protein
probable transmembrane protein
antigen 84 (aka wag31)
hypothetical protein
hypothetical protein
conserved hypothetical protein
YFIH_STRGR P45496
circumferential ring, GTPase
ingrowth of wall at septum
UDP-N-acetyl-muramate-alanine ligase
transferase in peptidoglycan synthesis
membrane protein (shape determination)
UDP-N-acetylmuramoylalanine-D-glutamate ligase
phospho-N-acetylmuramoyl-pentapeptide transferase
D-alanine:D-alanine-adding enzyme
meso-diaminopimelate-adding enzyme
hypothetical protein
hypothetical protein
similar to alkanal monooxygenase beta chain
PE_PGRS-family protein
penicillin-binding protein 2
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
possible IS6110 transposase
possible IS6110 transposase
hypothetical protein
hypothetical protein
probable lipoprotein
hypothetical protein
geranylgeranyl pyrophosphate synthase
probable membrane protein
putative transcriptional regulator
serine-threonine protein kinase, truncated
hypothetical protein
DAHP synthase
hypothetical protein
probable integral membrane protein
probable integral membranemem protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
acyl-CoA synthase
conserved hypothetical protein
hypothetical protein
putative p60 homologue
similar to both PolC and UvrC proteins
anthranilate phosphoribosyltransferase
cytochrome c oxidase polypeptide III
cytochrome b/c component of ubiQ-cytB reductase
Rieske iron-sulphur component of ubiQ-cytB
cytochrome b component of ubiQ-cytB reductase
hypothetical protein
conserved small membrane protein
possible membrane protein
cytochrome c oxidase chain II
asparagine synthase B
carbohydrate kinase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
nicotinate-nucleotide-dimethylbenzimidazole
cobalamin (5'-phosphate) synthase
probable drug efflux protein
branched-chain-amino-acid transaminase
T protein of glycine cleavage system
conserved hypothetical protein
aminopeptidase A/I
probable epoxide hydrolase
dihydrolipoamide succinyltransferase
conserved hypothetical protein
lipoate biosynthesis protein B
lipoate biosynthesis protein A
hypothetical protein
glutamine synthase class I
glutamate-ammonia-ligase adenyltransferase
glutamine synthase class II
probable exported protease
probable exported protease
3-methyl-2-oxobutanoate hydroxymethyltransferase
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
aminotransferase
hypothetical protein
conserved hypothetical protein
low molecular weight protein-tyrosine-phosphatase
hypothetical protein
cobinamide synthase
conserved hypothetical protein
member of AhpC/TSA family
hypothetical protein
conserved hypothetical protein
pyruvate dehydrogenase E1 component
hypothetical protein
malonyl CoA-[ACP] transacylase
acyl carrier protein (meromycolate extension)
[beta]-ketoacyl-ACP synthase (meromycolate
[beta]-ketoacyl-ACP synthase (meromycolate
acetyl/propionyl CoA carboxylase [beta] subunit
conserved hypothetical protein
glycerol-3-phosphate dehydrogenase
putative transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
putative transcriptional regulator
putative alcohol dehydrogenase (Zn dependent)
conserved hypothetical protein
apolipoprotein N-acyltransferase-a
apolipoprotein N-acyltransferase-b
possible oxidoreductase
conserved hypothetical protein
putative integral membrane protein
Probable cytochrome P-450
hypothetical protein
Probable cytochrome P-450
hypothetical protein
possible lipoprotein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
Probable cytochrome P-450
possible glycerolphosphodiesterase
possible IS6110 transposase
possible IS6110 transposase
similar to D-lactate dehydrogenase
phosphate permease
transcriptional regulator (LysR family)
hypothetical protein
probable esterase
conserved hypothetical protein
conserved hypothetical protein
probable Na+/H+ exchanger
hypothetical protein
CDP-diacylglycerol phosphatidylhydrolase
probable lipoprotein
thiosulfate sulfurtransferase
hypothetical protein
hypothetical protein
aminotransferase
conserved hypothetical protein
halokane dehalogenase
hypothetical protein
conserved hypothetical protein
heat shock protein Hsp90 family
conserved hypothetical protein
probable cutinase
conserved hypothetical protein
similar to S. griseus macrotetrolide resistance
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
integrase
excisionase
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
sugar transport protein
sugar transport protein
sugar transport protein
hypothetical protein
arginine/ornithine transporter
ornithine aminotransferase
ornithine aminotransferase
conserved hypothetical protein
transcriptional regulator (Lrp/AsnC family)
conserved hypothetical protein
ABC transporter
conserved hypothetical protein
PE-family protein
probable nitrite extrusion protein
lipoprotein
hypothetical protein
probable malate oxidoreductase
probable tetracenomycin C resistance protein
cysteine synthase A
serine acetyltransferase
hypothetical protein
hypothetical protein
molybdopterin biosynthesis
conserved large membrane protein
PE-family protein
lipoprotein
hypothetical protein
DNA primase
probable deoxyguanosine triphosphate hydrolase
precursor of probable membrane protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
phospholipase C precursor
phospholipase C precursor
phospholipase C precursor
PPE-family protein
PPE-family protein
possible IS6110 transposase
possible IS6110 transposase
PPE-family protein
glycyl-tRNA synthase
transcriptional regulator (ArsR family)
ferric uptake regulatory protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative amidase
GTP-binding protein of Era/ThdF family
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
ATP-binding pho regulon component
hypothetical protein
conserved hypothetical protein
PE-family protein
conserved hypothetical protein
DnaJ homologue
heat-inducible transcription repressor
hypothetical protein
conserved hypothetical protein
mycobactin/exochelin synthesis
mycobactin/exochelin synthesis (lysine hydroxylase)
mycobactin/exochelin synthesis (lysine ligation)
mycobactin/exochelin synthesis (lysine ligation)
mycobactin/exochelin synthesis (polyketide
mycobactin/exochelin synthesis
mycobactin/exochelin synthesis (serine/threonine
mycobactin/exochelin synthesis (salicylate-AMP
probable acetyl-hydrolase
anthranilate synthase component I
conserved hypothetical protein
oxygen-independent coproporphyrinogen III oxidase
conserved hypothetical protein
conserved hypothetical protein
probable nitrite reductase/sulphite reductase
3'-phosphoadenylylsulfate (PAPS) reductase
conserved hypothetical protein
[gamma] -glutamyltranspeptidase precursor
probable membrane protein
PE_PGRS-family protein
sulphate transport ATP-binding protein
sulphate transport system permease protein
sulphate transport system permease protein
sulphate binding precursor
hypothetical protein
conserved hypothetical protein
lipoprotein
GTP-binding protein LepA
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
PE-family protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
30S ribosomal protein S20
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
putative phosphoglycerate mutase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
[gamma]-glutamyl phosphate reductase
alkyl hydroperoxide reductase
member of AhpC/TSA family
PPE-family protein
PE-family protein
hypothetical protein
hypothetical protein
probable membrane protein
hypothetical protein
ribokinase
conserved hypothetical protein
conserved hypothetical protein
glutamate 5-kinase
Obg GTP-binding protein
50S ribosomal protein L27
50S ribosomal protein L21
C4-dicarboxylate transport protein
similar at C-term to ribonuclease E
nucleoside diphosphate kinase
hypothetical protein
folylpolyglutamate synthase
valyl-tRNA synthase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
oxidoreductase, beta subunit
probable oxidoreductase alpha subunit
probable transmembrane transport protein
ATP-dependent Clp protease ATP-binding subunit ClpX
conserved hypothetical protein
probable drug efflux protein
ATP-dependent Clp protease proteolytic subunit
ATP-dependent Clp protease proteolytic subunit
chaperone protein, similar to trigger factor
probable esterase
probable DNA glycosylase, endonuclease VIII
phosphopentose isomerase
conserved hypothetical protein
probable aminopeptidase
hypothetical protein
conserved hypothetical protein
hemoglobin-like, oxygen carrier
probable maltase [alpha]-glucosidase
hypothetical protein
probable membrane protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
ABC-transporter ATP binding protein
hypothetical protein
possible IS6110 transposase
possible IS6110 transposase
hypothetical protein
glycerol-3-phosphate acyltransferase
possible transferase
conserved hypothetical protein
probable carboxlyesterase
enoyl-CoA hydratase/isomerase superfamily
PE_PGRS-family protein
transcriptional regulator (LuxR/UhpA family)
hypothetical protein
PE_PGRS-family protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
dihydrolipoamide acetyltransferase
pyruvate dehydrogenase E1 component [beta] subunit
pyruvate dehydrogenase E1 component [alpha] subunit
citrate lyase [beta] chain
putative aldehyde dehydrogenase
acyl-CoA dehydrogenase (aka mmgC)
acetyl/propionyl-CoA carboxylase, [alpha] subunit
acetyl/propionyl-CoA carboxylase, [beta] subunit
3-oxo acid:CoA transferase, [beta] subunit
3-oxo acid:CoA transferase, [alpha] subunit
acyl-CoA synthase
transcriptional regulator (TetR/AcrR family)
probable membrane spanning protein
possible membrane protein
putative oxidoreductase
conserved hypothetical protein
conserved hypothetical protein
possible IS1081 transposase
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
lipoprotein
PE-family protein
conserved hypothetical protein
bacterioferritin comigratory protein
conserved hypothetical protein
CoA:apo-[ACP] pantethienephosphotransferase
fatty acid synthase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
restriction system protein
hypothetical protein
conserved hypothetical protein
ornithine/arginine decarboxylase
hypothetical protein
N-utilisation substance protein B
elongation factor P
cytoplasmic peptidase
potential membrane protein
3-dehydroquinate dehydratase
3-dehydroquinate synthase
shikimate kinase I
chorismate synthase
hypothetical protein
conserved hypothetical protein
lipoprotein
lipoprotein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
shikimate 5-dehydrogenase
hypothetical protein
hypothetical protein
alanyl-tRNA synthase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probableproable membrane protein
hypothetical protein
hypothetical protein
possible membrane protein
probable ATP-binding transport protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
aspartyl-tRNA synthase
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
1,3,4,6-tetrachloro-1,4-cyclohexadiene hydrolase
histidyl-tRNA synthase
putative glyoxylase II
peptidyl-prolyl cis-trans isomerase
(p)ppGpp synthase I
adenine phosphoribosyltransferases
conserved hypothetical protein
protein-export membrane protein
protein-export membrane protein
conserved hypothetical protein
4-aminobutyrate aminotransferase
acyl-CoA synthase
PE_PGRS-family protein
Holliday junction binding protein
Holliday junction binding protein, DNA helicase
Holliday junction resolvase, endodeoxyribonuclease
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
spermidine synthase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
thioesterase II
conserved hypothetical protein
pyridoxamine 5'-phosphate oxidase
PPE-family protein
conserved hypothetical protein
glycosyltransferase
conserved hypothetical protein
CDP-diacylglycerol-glycerol-3-phosphate
conserved hypothetical protein
threonyl-tRNA synthase
PE-family protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
similar to SAM-dependent methyltransferase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
PE_PGRS-family protein
hypothetical protein
hypothetical protein
dedA family
conserved hypothetical protein
conserved hypothetical protein
transcriptional regulator (ArsR family)
conserved hypothetical protein
transcriptional regulator (ArsR family)
probable arsenical pump
hypothetical protein
hypothetical protein
phiRV2 integrase
phiRV2 phage related protein
possible IS6110 transposase
possible IS6110 transposase
phiRV2 phage related protein
phiRV2 prohead protease
phiRV2 phage related protein
phiRV2 phage related protein
phiRV2 phage related protein
phiRV2 phage related protein
phiRV2 phage related protein
similar to gp36 of mycobacteriophage L5
phiRV2 phage related protein
phiRV2 integrase
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
possible IS1081 transposase
similar to ClpC from M. leprae but shorter
hypothetical protein
putative transcriptional regulator
conserved hypothetical protein
probable riboflavin deaminase
putative exported protease
potential membrane protein
conserved hypothetical protein
putative methyltransferase
conserved hypothetical protein
protoporphyrinogen oxidase
uroporphyrinogen decarboxylase
enoyl-CoA hydratase/isomerase superfamily
conserved hypothetical protein
conserved hypothetical protein
1-deoxy-D-xylulose 5-phosphate synthase
conserved hypothetical protein
probable arsenical pump
probable arsenical pump
possible membrane protein
hypothetical protein
similar to transport ATP-binding proteins
weak similarity to RNA methyltransferases
possible transport protein
probable potassium uptake protein
probable potassium uptake protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
deoxyuridine triphosphatase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative extragenic suppressor protein
polyphosphate glucokinase
RNA polymerase sigma factor (aka MysA, RpoV)
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
RNA polymerase sigma factor (aka MysB)
iron dependent repressor, IdeR
hypothetical protein
probable dehydrogenase
conserved hypothetical protein
2-hydroxymuconic semialdehyde hydrolase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
LexA, SOS repressor protein
conserved hypothetical protein
hypothetical protein
probable membrane protein, tellurium resistance
acyl-CoA dehydrogenase
GTP-binding protein
diaminopimelate epimerase
tRNA [delta](2)-isopentenylpyrophosphate transferase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
regulatory protein for RecA
recombinase (contains intein)
conserved hypothetical protein
glycosyltransferase
conserved hypothetical protein
PE_PGRS-family protein
conserved hypothetical protein
conserved hypothetical protein
35-kd antigen
putative transcriptional regulator
CDP-diacylglycerol-glycerol-3-phosphate
conserved hypothetical protein
chromosome partitioning
conserved hypothetical protein
putative dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
dihydrodipicolinate synthase
conserved hypothetical protein
type I restriction/modification system specificity
type I restriction/modification system DNA
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
dihydrofolate reductase
thymidylate synthase
hypothetical protein
3-oxoacyl-[ACP] reductase
hypothetical protein
PPE-family protein
PE-family protein
PPE-family protein
hypothetical protein
hypothetical protein
dihydrodipicolinate reductase
hypothetical protein
hypothetical protein
probable oxidoreductase
hypothetical protein
conserved hypothetical protein
transcriptional regulator (Lrp/AsnC family)
L-alanine dehydrogenase
probable oxidoreductase
protease/peptidase, M16 family (insulinase)
pppGpp synthase and polyribonucleotide phosphorylase
lipoprotein
30S ribosomal protein S15
riboflavin kinase
conserved hypothetical protein
iron-dependent transcriptional repressor
acyl-CoA dehydrogenase
non-specific lipid transport protein
transposase
resolvase
tRNA pseudouridine 55 synthase
conserved hypothetical protein
hypothetical protein
lipoprotein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
probable truncated transposase
conserved hypothetical protein
low similarity to transposases
probable general secretion pathway protein
possible IS6110 transposase
possible IS6110 transposase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
similar to phage P1 phd gene
enoyl-CoA hydratase/isomerase superfamily
sn-glycerol-3-phosphate transport ATP-binding
sn-glycerol-3-phosphate-binding periplasmic
sn-glycerol-3-phosphate transport system protein
sn-glycerol-3-phosphate permease
DNA-damage-inducible protein F
conserved hypothetical protein
ribosome-binding factor A
initiation factor IF-2
conserved hypothetical protein
transcription termination factor
conserved hypothetical protein
hypothetical protein
hypothetical protein
prolyl-tRNA synthase
putative efflux protein
multifunctional enzyme, siroheme synthase
cobyrinic acid a,c-diamide synthase
cob(I)alamin adenosyltransferase
possible magnesium-chelatase
conserved hypothetical protein
conserved hypothetical protein
PE_PGRS-family protein
hypothetical protein
glutathione reductase homologue
probable nickel transport protein
putative dehydrogenase
aldehyde dehydrogenase phenylacetaldehyde
conserved hypothetical protein
proable glutamine synthase
methionine aminopeptidase
conserved hypothetical protein
conserved hypothetical protein
probable penicillin binding protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
essential gene of unknown function
probable integral membrane protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
surface lipoprotein Mpt83
integral membrane protein
major secreted immunogenic protein Mpt70 precursor
hypothetical protein
possible mercury resistance transport system
secreted protein Mpt53
conserved hypothetical protein
conserved hypothetical protein
phosphatidate cytidylyltransferase
ribosome recycling factor
uridylate kinase
two-component response regulator
transposase
resolvase
transcriptional regulator (MarR family)
putative amidase
elongation factor EF-Ts
30S ribosomal protein S2
hypothetical protein
PPE-family protein
similar to alkanal monooxygenase alpha chain
integrase/recombinase
similar to proteins involved in vibriobactin uptake
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
affects formate dehydrogenase-N
molybdopterin-containing oxidoreductase
hypothetical protein
ribonuclease HII
signal peptidase I
50S ribosomal protein L19
Slight similarity to beta-lactamase
tRNA (guanine-N1)-methyltransferase
16S rRNA processing protein
conserved hypothetical protein
30S ribosomal protein S16
conserved hypothetical protein
penicillin binding protein
transcriptional regulator (TetR/AcrR family)
probable D-amino acid aminohydrolase
serine-threonine protein kinase
conserved hypothetical protein
signal recognition particle protein
conserved hypothetical protein
uridylyltransferase
nitrogen regulatory protein
putative ammonium transporter
cell division protein FtsY
member of Smc1/Cut3/Cut14 family
conserved hypothetical protein
formamidopyrimidine-DNA glycosylase
RNAse III
hypothetical protein
conserved hypothetical protein
thioesterase
hypothetical protein
acyl-CoA synthase
phenolpthiocerol synthesis (pksB)
phenolpthiocerol synthesis (pksC)
phenolpthiocerol synthesis (pksD)
phenolpthiocerol synthesis (pksE)
phenolpthiocerol synthesis (pksF)
similar daunorubicin resistance ABC-transporter
similar daunorubicin resistance transmembrane
similar daunorubicin resistance transmembrane
PKS-associated protein, unknown function
mycocerosic acid synthase
acyl-CoA synthase
conserved large membrane protein
hypothetical protein
hypothetical protein
lipoprotein
polyketide synthase
polyketide synthase
acyl-CoA synthase
hypothetical protein
acyl-CoA synthase
putative oxidoreductase
glycosyltransferase
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
similarity to glycosyltransferases
similar to variety of glycosyltransferases
some similarity to methyltransferases
hypothetical protein
conserved hypothetical protein
similarity to variety of glycosyltransferases
integral membrane protein
formyltetrahydrofolate deformylase
lipopolysaccharide core biosynthesis protein
conserved hypothetical protein
pyruvate carboxylase
integral membrane protein
possible transmembrane domain
probable lipase/esterase
oxidoreductase of Aldo/keto reductase family
hypothetical protein
ATP-dependent DNA helicase
conserved hypothetical protein
conserved hypothetical protein
uracil-DNA glycosylase
probable thiamine-monophosphate kinase
transposase
resolvase
hypothetical protein
D-alanine-D-alanine ligase A
glycerol-3-phosphate dehydrogenase
conserved hypothetical protein
polyphosphate kinase
MutT homologue
DNA-binding protein II
3-isopropylmalate dehydratase small subunit
3-isopropylmalate dehydratase large subunit
transcriptional regulator (IclR family)
hypothetical protein
conserved hypothetical protein
glutamyl-tRNA synthase
conserved hypothetical protein
probable fluoroquinolone efflux protein
3-isopropylmalate dehydrogenase
D-3-phosphoglycerate dehydrogenase
putative dehydrogenase
hypothetical protein
lipoproteinhighly similar to MTCY19H5.18c
conserved hypothetical protein
ketol-acid reductoisomerase
acetolactate synthase I small subunit
acetolactate synthase I large subunit
hypothetical protein
conserved hypothetical protein
M. leprae lipoprotein MLCB637.17c
hypothetical protein
hypothetical protein
glu-tRNA-gln amidotransferase, subunit A
phosphofructokinase I
glu-tRNA-gln amidotransferase, subunit B
glu-tRNA-gln amidotransferase, subunit C
conserved hypothetical protein
DNA ligase
conserved hypothetical protein
lipoprotein
conserved hypothetical protein
PPE-family protein
similar to Esat6
PE-family protein
PPE-family protein
PPE-family protein
possible IS1081 transposase
conserved hypothetical protein
NifS-like protein
some similarity to acyltransferase Q59601
hypothetical protein
electron transfer flavoprotein [alpha] subunit
electron transfer flavoprotein [beta] subunit
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
probable secreted protein
hypothetical protein
hypothetical protein
enoyl-CoA hydratase/isomerase superfamily
hypothetical protein
ABC transporter protein
C-term similar to phosphoserine phosphatase
cytochrome c oxidase polypeptide I
putative FeIII-dicitrate transporter
alcohol dehydrogenase
conserved hypothetical protein
hypothetical protein
ribonucleoside-diphosphate small subunit
Probable monooxygenase
putative transcriptional regulator
ribonucleoside diphosphate reductase [alpha] chain
NrdI/YgaO/YmaA family
glutaredoxin electron transport component of NrdEF
conserved hypothetical protein
putative transcriptional regulator
DNA-damage-inducible protein
possible ketoacyl reductase
putative transcriptional regulator
possible lanosterol 14-alpha-demethylases
transcriptional regulator (GntR family)
acyl-CoA dehydrogenase
DNA ligase
starvation-induced stress response protein
conserved hypothetical protein
resistance to ethidium bromide
putative transcriptional regulator
conserved hypothetical protein
phosphoglucomutase
unknown membrane protein
unknown membrane protein (3 TM segments)
hypothetical protein
similar to alkanal monooxygenase beta chainschaims
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
proable arylsulfatase
unknown transport protein
probable monooxygenase
serine-threonine protein kinase
hypothetical protein
putative virulence regulating protein (AraC/XylS
probable monooxygenase
probable acetyl-hydrolase
short chain alcohol dehydrogenase
zinc-containing alcohol dehydrogenase
conserved hypothetical protein
conserved hypothetical protein
acyl-CoA synthase
hypothetical protein
hypothetical protein
possible membrane protein
hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
hypothetical protein
PE-family protein
hypothetical protein
hypothetical protein
probable small protein b
membrane protein
membrane protein
hypothetical protein
conserved hypothetical protein
peptide chain release factor 2
adrenodoxin and NADPH ferredoxin reductase
Some similarity to D-lactate dehydrogenase
hypothetical protein
molybdenum cofactor biosynthesis, protein A
molybdenum cofactor biosynthesis, protein B
molybdenum cofactor biosynthesis, protein C
molybdopterin converting factor subunit 1
hypothetical protein
hypothetical protein
possible IS1081 transposase
molybdopterin biosynthesis
thiosulfate sulfurtransferase
thiosulfate sulfurtransferase
molybdopterin-converting factor subunit 2
Slight similarity to methyltransferases
probable cytochrome p450
hypothetical protein
hypothetical protein
transcriptional regulator (AfsR/DndI/RedD family)
PPE-family protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
sensor histidine kinase
two-component response regulator
conserved hypothetical protein
PPE-family protein
PPE-family protein
probable monophosphatase
similar to pyruvate lyase activating protein
acyl-CoA dehydrogenase
acyl-CoA dehydrogenase
3-hydroxyacyl-CoA dehydrogenase
hypothetical protein
putative sensory transduction protein
PPE-family protein
NADH dehydrogenase chain A
NADH dehydrogenase chain B
NADH dehydrogenase chain C
NADH dehydrogenase chain D
NADH dehydrogenase chain E
NADH dehydrogenase chain F
NADH dehydrogenase chain G
NADH dehydrogenase chain H
NADH dehydrogenase chain I
NADH dehydrogenase chain J
NADH dehydrogenase chain K
NADH dehydrogenase chain L
NADH dehydrogenase chain M
NADH dehydrogenase chain N
PPE-family protein
putative transcriptional regulator
putative dioxygenasesdiooxygenases
probable membrane protein
possible membrane protein
transcriptional regulator, MoxR homologue
hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
conserved hypothetical protein
conserved hypothetical protein
Probable flavin-containing monoamine oxidase
probable non-heme haloperoxidase
hypothetical protein
transcriptional regulator (TetR/AcrR family)
putative oxidoreductase
Probable amidase
probable esterase/lipase
probable non-heme haloperoxidase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
possible IS6110 transposase
possible IS6110 transposase
possible IS6110 transposase
possible IS6110 transposase
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
probable integral membrane protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
probable ABC transporter
putative UvrD
conserved hypothetical protein
putative potassium channel
probable ATP-dependent DNA helicase
similar to UvrD proteins
probable lipase
probable methyltransferase
hypothetical protein
probably involved in molybdopterin biosynthesis
hypothetical protein
transcriptional regulator (TetR/AcrR family)
conserved hypothetical protein
hypothetical protein
probable ATP-dependent RNA helicase
hypothetical protein
possible role in chromosome segregation
weak similarity to many phosphoglycerate mutases
probable isochorismate synthase
possible acyltransferase
possible membrane protein
conserved hypothetical protein
WhiB transcriptional activator homologue
sensor histidine kinase
possible biotin carboxyl carrier
conserved hypothetical protein
ECF subfamily sigma subunit
putative oxidoreductases
probable aminoglycoside 3'-phosphotransferases
conserved hypothetical protein
3-phosphoshikimate 1-carboxyvinyl transferase
conserved hypothetical protein
acyl-[ACP] desaturase
similar to various oxygenases
hypothetical protein
alternative sigma factor for siderophore production
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
probable glutathione-regulated potassium-efflux
possible potassium channel protein
unknown, possible membrane protein
possible antibiotic efflux proteins
SecA, preprotein translocase subunit
member of S30AE ribosomal protein family
conserved hypothetical protein
hypothetical protein
lipoprotein
sensor histidine kinase
two-component response regulator
thymidylate kinase
adenosylhomocysteinase
transcriptional regulator (TetR/AcrR family)
rubredoxin B
rubredoxin A
possible alkane-1 monooxygenase
probable cationic amino acid transport
slight similarity to squalene
mannose-6-phosphate isomerase
hypothetical protein
phosphomannomutase
hypothetical protein
hypothetical protein
WhiB transcriptional activator homologue
conserved hypothetical protein
conserved hypothetical protein
probable DNA methylase
glucose-1-phosphate thymidyltransferase
dTDP-rhamnosyl transferase
dTDP-4-dehydrorhamnose reductase
conserved hypothetical protein
hypothetical protein
probable heat shock protein
cation transport ATPase
hypothetical protein
conserved hypothetical protein
C-term similar to carbonic anhydrase
acyl-CoA dehydrogenase
phosphoribosylaminoimidazole carboxylase
phosphoribosylaminoimidazole carboxylase ATPase
conserved hypothetical protein
conserved hypothetical protein
biotin apo-protein ligase
acetyl/propionyl CoA carboxylase [beta] subunit
conserved hypothetical protein
conserved hypothetical protein
thiosulfate sulfurtransferase
conserved hypothetical protein
acetyl/propionyl CoA carboxylase [alpha] subunit
ECF subfamily sigma subunit
anti-sigma B factor
conserved hypothetical protein
hypothetical protein
lysine-[epsilon] aminotransferase
transcriptional regulator (Lrp/AsnC family)
conserved hypothetical protein
aldehyde dehydrogenase
hypothetical protein
transcriptional regulator (TetR/AcrR family)
ATP-dependent helicase
probable endonuclease VIII
similar to MTCI376.03c
proable arylsulfatase
probable deaminase, riboflavin synthesis
phosphate transport system regulator
glycerol-3-phosphate dehydrogenase
dihydrolipoamide dehydrogenase
conserved hypothetical protein
probable aminohydrolase
probable aminohydrolase
probable purine nucleoside phosphorylase
phosphomannomutase
uracil phophoribosyltransferase
probable acid phosphatase
conserved hypothetical protein
conserved hypothetical protein
probable adenosine deaminase
thymidine phosphorylase
probable cytidine deaminase
succinate dehydrogenase C subunit
succinate dehydrogenase D subunit
succinate dehydrogenase A
succinate dehydrogenase B
conserved hypothetical protein
conserved hypothetical protein
molybdopterin-converting factor subunit 2
phosphoglycolate phosphatase
molybdenum cofactor biosynthesis, protein C
possible IS6110 transposase
possible IS6110 transposase
hypothetical protein
similar to SigI, ECF family
probable aminotransferase
probable penicillin binding protein
probable sugar transport protein
N-acetylglucosamine-6-P-deacetylase
hypothetical protein
transcriptional regulator (MerR family)
conserved hypothetical protein
tryptophanyl tRNA synthase
conserved hypothetical protein
conserved hypothetical protein
isocitrate dehydrogenase
cystathionine [beta]-lyase
homoserine o-acetyltransferase
conserved hypothetical protein
PPE-family protein
PE_PGRS-family protein
PE_PGRS-family protein
conserved hypothetical protein
PPE-family protein
weakly similar to transposases
hypothetical protein
PPE-family protein
conserved hypothetical protein
defective/truncated oxidoreductase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
methylenetetrahydrofolate dehydrogenase
conserved hypothetical protein
hypothetical protein
probable oxidoreductase
possible ABC transporter
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
probable rRNA methylase
PE_PGRS-family protein
conserved hypothetical protein
conserved hypothetical protein
DNA polymerase III [alpha] chain
conserved hypothetical protein
trehalose-6-phosphate phosphatase
enoyl-CoA hydratase/isomerase superfamily, N-term
enoyl-CoA hydratase/isomerase superfamily, C-term
probable amidase, v. similar MTCY50.19
conserved hypothetical protein
similar to many cyclases involved in steroid biosynthesis
hypothetical protein
unknown transketolase, interrupted by IS6110
possible IS6110 transposase
possible IS6110 transposase
LytB protein homologue
transfergeranyl, similar geranyl pyrophosphate
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS-family protein
putative dehydrogenase
lipoprotein
fatty acyl-CoA reductase
cyclopropane mycolic acid synthase 1
probable inosine-uridine preferring nucleoside
hypothetical protein
hypothetical protein
GMP synthase
phytoene synthase
geranylgeranyl pyrophosphate synthase
conserved hypothetical protein
probable [beta]-phosphoglucomutase
conserved hypothetical protein
possible involved in LPS synthesis
hypothetical protein
hypothetical protein
putative transcriptional regulator
putative dioxygenasediooxygenase
conserved hypothetical protein
conserved hypothetical protein
cholesterol oxidase
inosine-5'-monophosphate dehydrogenase
inosine-5'-monophosphate dehydrogenase
conserved hypothetical protein
hypothetical protein
ECF subfamily sigma subunit
conserved hypothetical protein
WhiB transcriptional activator homologue
60 kD chaperonin 1
10 kD chaperone
glycoprotease
ribosomal protein S18 acetyltransferase
conserved hypothetical protein
conserved hypothetical protein
alanine racemase
hypothetical protein
PPE-family protein
PPE-family protein
hypothetical protein
hypothetical protein
PPE-family protein
transposase
probable truncated transposase
glutamate decarboxylase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
glucosamine-fructose-6-phosphate aminotransferase
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
phosphoglucomutase or phosphomannomutase
30S ribosomal protein S9
50S ribosomal protein L13
conserved hypothetical protein
hypothetical protein
hypothetical protein
probable membrane protein
probable membrane protein
probable precursor of serine protease
probable membrane spanning protein
probable cutinase
probable cutinase precursor
hypothetical protein
some similarity to proline permeases
probable pseudouridylate synthase
50S ribosomal protein L17
[alpha] subunit of RNA polymerase
30S ribosomal protein S4
30S ribosomal protein S11
30S ribosomal protein S13
50S ribosomal protein L36
initiation factor IF-1
probable neuraminidase
dTDP-glucose 4,6-dehydratase
dTDP-4-dehydrorhamnose 3,5-epimerase
REP-family protein
REP-family protein
dTDP-glucose 4,6-dehydratase
probable 4-hydroxy-2-oxovalerate aldolase
acetolactate synthase large subunit
conserved hypothetical protein
possible acyl carrier protein
probable non-heme bromoperoxidase
possible IS6110 transposase
possible IS6110 transposase
sugar transport protein
PE-family protein
PPE-family protein
hypothetical protein
conserved hypothetical protein
possible membrane protein
unknown membrane protein
conserved hypothetical protein
cpsA,CpsA : Q50160
short-chain alcohol dehydrogenase family
conserved hypothetical protein
probable esterase
conserved hypothetical protein
hypothetical protein
probable [alpha],-trehalose-phosphate synthase
hypothetical protein
conserved hypothetical protein
hypothetical protein
part of mce4 operon
part of mce4 operon
part of mce4 operon
part of mce4 operon
part of mce4 operon
cell invasion protein
part of mce4 operon
part of mce4 operon
putative dehydrogenase
probable ferredoxin
acyl-CoA dehydrogenase
acyl-CoA dehydrogenase
acyl-CoA synthase
PE_PGRS-family protein
PE_PGRS-family protein
probable acetohydroxyacid synthase I large subunit
conserved hypothetical protein
PE_PGRS-family protein
PE_PGRS-family protein
acyl-CoA synthase
PE_PGRS-family protein
acyl-CoA synthase
enoyl-CoA hydratase/isomerase superfamily
conserved hypothetical protein
Probable Cytochrome P450 monooxygenasemonoxygenase
hypothetical protein
probable coenzyme F420-dependent enzyme
conserved hypothetical protein
putative transcriptional regulator
lipid carrier protein
possible membrane sensor protein
similar to ferripyochelin binding protein
putative phthalate oxygenase
hypothetical protein
hypothetical protein
conserved hypothetical protein
probable cis-diol dehydrogenase
hypothetical protein
PPE-family protein
PPE-family protein
4-hydroxy-2-oxovalerate aldolase
acetaldehyde dehydrogenase
aromatic hydrocarbon degradation
3-oxosteroid 1-dehydrogenase
unknown fatty acid methyltransferase
PE-family protein
non-specific lipid transport protein
hypothetical protein
hypothetical protein
acyl-CoA dehydrogenase
acyl-CoA dehydrogenase
cytochrome p450
acetyl-CoA C-acetyltransferase
conserved hypothetical protein
short-chain alcohol dehydrogenase family
short-chain alcohol dehydrogenase family
enoyl-CoA hydratase/isomerase superfamily
possible glutaconate CoA-transferase
hypothetical protein
similar to dioxygenasesdiooxygenases
ferredoxin
conserved hypothetical protein
acetyl-CoA C-acetyltransferase
transcriptional regulator (TetR/AcrR family)
PPE-family protein
short-chain alcohol dehydrogenase
acyl-CoA dehydrogenase
acyl-CoA synthase
acyl-CoA dehydrogenase
acyl-CoA dehydrogenase
acyl-CoA dehydrogenase
aspartate aminotransferase
N-hydroxyarylamine o-acetyltransferase
conserved hypothetical protein
putative dioxygenase
probable hydrolase
putative oxidoreductase
electron transfer component of
hypothetical protein
acyl-CoA dehydrogenase
transcriptional regulator (TetR/AcrR family)
transcriptional regulator (LacI family)
similar to ser-thr-protein kinases
hypothetical protein
probable arsenical pump
putative methyltransferase
cysteinyl-tRNA synthase
conserved hypothetical protein
conserved hypothetical protein
putative transcriptional regulator
lipoprotein
probable DNA repair RadA homologue
conserved hypothetical protein
hypothetical protein
putative carbonic anhydrase
probable DNA glycosylase
PE_PGRS-family protein
conserved hypothetical protein
conserved hypothetical protein
lipoprotein
hypothetical protein
PE_PGRS-family protein
ATP-dependent Clp protease
#NAME?
lysyl-tRNA synthase
hypothetical protein
conserved hypothetical protein
aspartate 1-decarboxylase
pantoate-[beta]-alanine ligase
hypothetical protein
unknown membrane protein
hypothetical protein
7,8-dihydro-6-hydroxymethylpterin pyrophosphokinase
may be involved in folate biosynthesis
dihydropteroate synthase
GTP cyclohydrolase I
inner membrane protein, chaperone
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable epoxide hydrolase
similar bacterial luciferase alpha chains
conserved hypothetical protein
conserved hypothetical protein
PPE-family protein
PE-family protein
similar OMP28
probable hypoxanthine-guanine
probable cell cycle protein
hypothetical protein
probable penicillin binding protein
probable inorganic pyrophosphatase
possible membrane protein
unknown membrane protein
possible glucosyltransferase
hypothetical protein
conserved hypothetical protein
dTDP-glucose 4,6-dehydratase
unknown transmembrane protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
probable transposase highly related to IS1081
possible cell division protein
hypothetical protein
hypothetical protein
similar in N-term to DNA polymerase III
probable transmembrane protein
DNA topoisomerase
hypothetical protein
cold shock protein, transcriptional regulator
ATP-dependent DNA/RNA helicase
PE-family protein
hypothetical protein
PE_PGRS-family protein
PE_PGRS-family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
probable transmembrane protein
similar to conjugal transfer proteins
involved in differentiation inhibition between
involved in differentiation inhibition between
hypothetical protein
probable ABC-transporter
probable peptide transport system permease
probable peptide transport system permease
probable peptide transport system permease
acetyl-CoA synthase
probable alkaline serine protease
hypothetical protein
probable epoxide hydrolase
probable serine protease
conserved hypothetical protein
protein disulphide oxidoreductase
probable endonuclease III
hypothetical protein
transcriptional regulator (Crp/Fnr family)
probable hydrolase
transcriptional regulator (LysR family)
possible anion transporter
probable anion transporter
WhiB transcriptional activator homologue
class A penicillin binding protein
conserved hypothetical protein
Probable lyase, cysteine metabolism
Probable cytochrome P-450
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
transcriptional regulator, MoxR homologue
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
ATP:glycerol 3-phosphotransferase
conserved hypothetical protein
hypothetical protein
Probable methyltransferase
probable acetyltransferase
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
possible [gamma]-glutamylcysteine synthase
hypothetical protein
hypothetical protein
conserved hypothetical protein
aspartate semialdehyde dehydrogenase
aspartokinase
2-isopropylmalate synthase
DNA polymerase III [epsilon] chain
conserved hypothetical protein
possible cobyric acid synthase
conserved hypothetical protein
RecBC-Independent process of DNA repair
conserved hypothetical protein
possible N-acetylmuramoyl-L-alanine amidase
hypothetical protein
conserved hypothetical protein
C-term similar to cyclopropane fatty acid synthases
DNA polymerase III, [gamma] (dnaZ) and t (dnaX)
hypothetical protein
hypothetical protein
probable cutinase precursor
putative oxidoreductase
Putative alcohol dehydrogenase, zinc-type
similar to phytoene dehydrogenase precursor
possible sugar transporter
probable transferase
conserved hypothetical protein
probable DNA ligase
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
transcriptional regulator (AraC/XylS family)
possible membrane protein
PPE-family protein
PPE-family protein
conserved hypothetical protein
possible monooxygenasemonoxygenase-a
possible monooxygenase-b
probable cation-transporting ATPase
transcriptional regulator (ArsR family)
conserved hypothetical protein
PE-family protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
excisionase
putative integrase
probable cytidine/deoxycytidylate deaminase
hypothetical protein
prephenate dehydrogenase
hypothetical protein
transport system permease
transport system permease
osmoprotection ABC transporter
similar to osmoprotection proteins
conserved hypothetical protein
acyl-CoA dehydrogenase
probable alkyl sulfatase
19 kDKD
sensor histidine kinase
two-component response regulator
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
histidinol-phosphate aminotransferase
conserved hypothetical protein
enoyl-CoA hydratase/isomerase superfamily
probable hydrolase
conserved hypothetical protein
3-Hydroxyacyl-CoA Dehydrogenase
conserved hypothetical protein
unknown membrane protein
hypothetical protein
ABC transporter
similar to rhamnosyl transferase
integral membranememebrane protein, ABC-2 SUBFAMILY
probable UDP-galactose 4-epimerase
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
putative oxidoreductase
putative oxidoreductase
unknown membrane protein
involved in arabinogalactan synthesis
involved in arabinogalactan synthesis
involved in arabinogalactan synthesis
proable arylsulfatase
acyl-CoA dehydrogenase
transposase
acetyl/propionyl CoA carboxylase [beta] subunit
polyketide synthase
acyl-CoA synthase
hypothetical protein
antigen MPT51, mycolyltransferase
antigen 85A, mycolyltransferase
weak similarity to integral membrane proteins
possible integral membrane protein
possible membrane protein
hypothetical protein
UDP-galactopyranose mutase
cell surface protein precursor (Erp protein)
secreted protein
PE_PGRS-family protein
conserved hypothetical protein
probable acyltransferase
probable acyltransferase
probable acyltransferase
probable aminoglycoside 3'-phosphotransferase
hypothetical protein
hypothetical protein
PKS-associated protein, unknown function
conserved hypothetical protein
conserved hypothetical protein
conserved large membrane protein
PKS-associated protein, unknown function
polyketide synthase
acyl-CoA synthase
transposase
resolvase
probable ketoacyl reductase
transcriptional regulator (TetR/AcrR family)
hypothetical protein
hypothetical protein
transcriptional regulator (AraC/XylS family)
seryl-tRNA synthase
hypothetical protein
hypothetical protein
putative phosphoglycerate mutase
prephenate dehydratase
hypothetical protein
putative transcriptional regulator
bacterioferritin
glycerophosphoryl diester phosphodiesterase
probable membrane protein
weakly similar to transposases; 100% id to Rv3348
hypothetical protein
superoxide dismutase
hypothetical protein
probable membrane proteinprot
hypothetical protein
hypothetical protein
hypothetical protein
HU-histone protein
S-adenosylmethionine:2-demethylmenaquinone
probable monooxygenase
putative transcriptional regulator
conserved hypothetical protein
hypothetical protein
small subunit of NADH-dependent glutamate synthase
ferredoxin-dependent glutamate synthase
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
PE-family protein
PPE-family protein
conserved hypothetical protein
early secretory antigen target
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
probable secreted protease
conserved hypothetical protein
hypothetical protein
protease
probable membrane protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PPE-family protein
PE-family protein
transmembrane ATP/GTP binding protein
conserved hypothetical protein
putative p60 homologue
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
membrane protein TM stretch
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
polynucleotide polymerase
conserved hypothetical protein
conserved hypothetical protein
possible membrane protein
probable sigma factor, similar to SigE
hypothetical protein
thioredoxin reductase
thioredoxin
hydrolase
conserved hypothetical protein
chromosome partitioning; DNA binding
possibly involved in chromosome partitioning
glucose inhibited division protein B
conserved hypothetical protein
unknown membrane protein
possible hemolysin
ribonuclease P protein component
50S ribosomal protein L34
 hypothetical protein
 hypothetical protein
 hypothetical protein
 hypothetical protein
 adenylate cyclase, putative
 4-hydroxyphenylpyruvate dioxygenase C terminal domain containing protein
 hypothetical protein
 hypothetical protein
 hypothetical protein
 hypothetical protein
 hypothetical protein
 PE_PGRS family protein
 hypothetical protein
 hypothetical protein
 hypothetical protein
 hypothetical protein
 hypothetical protein
 hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PPE family protein
hypothetical protein
glycosyl transferase
molybdopterin oxidoreductase
membrane protein, MmpL family
hypothetical protein
hypothetical protein
hypothetical protein
IS3 family transposase, degenerate
PE_PGRS family protein
hypothetical protein
hypothetical protein
PPE family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
DNA-binding protein, CopG family
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
lipoprotein, putative
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
PPE family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
molybdopterin cofactor biosynthesis protein A (moaA-3)
transcriptional regulator, AfsR/DnrI/RedD family
hypothetical protein
PPE family protein, authentic frameshift
PE_PGRS family protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
DNA-binding protein, CopG family
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PPE family protein
hypothetical protein
hypothetical protein
hypothetical protein
excisionase, putative
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
ribosomal protein L33 (rpmG-1)
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
mercuric reductase/transcriptional regulator, fusion
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
pterin-4-alpha-carbinolamine dehydratase
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
PE_PGRS family protein, authentic frameshift
hypothetical protein
ketoacyl-CoA thiolase-related protein
hypothetical protein
ribosomal protein L28 (rpmB-3)
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
GTGGTGGTAGTCGTTGG
         hypothetical protein
         hypothetical protein
         hypothetical protein
         PE_PGRS family protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         PE_PGRS family protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
CAGCGAAGTTCCCAC
 GGGGTACCTTTTATC
         hypothetical protein
         transcriptional regulator, TetR family, authentic frameshift
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
CTCTGTGAAGTCCGG
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         triose-phosphate isomerase, truncation
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         PE family protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         PE family protein
         hypothetical protein
         conserved hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         PE_PGRS family protein
         PE_PGRS family protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
         hypothetical protein
TGTGATCGGAT
         hypothetical protein

            hypothetical protein
            hypothetical protein
            hypothetical protein


 GCTGTGGCTGT
         hypothetical protein
         hypothetical protein
         hypothetical protein
TTGGAGAGGCT
CCCGGTGTTTC
         conserved hypothetical protein


            hypothetical protein
            hypothetical protein
            hypothetical protein
            hypothetical protein


         hypothetical protein
         hypothetical protein
         hypothetical protein
TCGCGATATCGT
         PE_PGRS family protein
         hypothetical protein

CCGCGATCT
 GCCCCCGAAC


         hypothetical protein
GGTCATGTCGC


            hypothetical protein

            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
            Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
hypothetical protein
conserved hypothetical protein
acyltransferase
succinate-semialdehyde dehydrogenase (gabD-1)
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
ubiquinone/menaquinone biosynthesis methlytransferase (ubiE)
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
sulfate adenylate transferase, subunit 2 (cysD)
mIHF
hypothetical protein
conserved hypothetical protein
hypothetical protein
PPE family protein
5-methyltetrahydrofolate-homocysteine methyltransferase (metH)
hypothetical protein
hypothetical protein
3-oxoacyl-(acyl-carrier-protein) synthase II (fabF-2)
hypothetical protein
hypothetical protein
conserved hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
conserved hypothetical protein
RNA polymerase sigma factor, putative
hypothetical protein
hypothetical protein
hypothetical protein
PPE family protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
RNA polymerase sigma-70 factor, ECF subfamily (sigM)
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
acylphosphatase
PE_PGRS family protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
conserved hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PE_PGRS family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
DNA-binding protein, CopG family
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
PPE family protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
pterin-4-alpha-carbinolamine dehydratase
transposase, degenerate
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
histidyl-tRNA synthetase (hisS)
RNA polymerase principal sigma factor SigB (sigB)
2-hydroxyhepta-2,4-diene-1,7-dioate isomerase, putative
6-O-methylguanine DNA methyltransferase, putative
hypothetical protein
transcriptional regulator, TetR family
conserved hypothetical protein
protease, putative, authentic frameshift
Alkylated DNA repair protein
hypothetical protein Rv0857
pstA1
hypothetical protein Rv1054
hypothetical protein Rv2232
Uncharacterized conserved protein
hypothetical protein Rv3337
PE_PGRS
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
30S ribosomal protein S6
50S ribosomal protein L9
30S ribosomal protein S13
50S ribosomal protein L36
50S ribosomal protein L34
glyceraldehyde 3-phosphate dehydrogenase
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
30S ribosomal protein S6
50S ribosomal protein L9
30S ribosomal protein S13
50S ribosomal protein L36
50S ribosomal protein L34
glyceraldehyde 3-phosphate dehydrogenase
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
30S ribosomal protein S6
50S ribosomal protein L9
30S ribosomal protein S13
50S ribosomal protein L36
50S ribosomal protein L34
glyceraldehyde 3-phosphate dehydrogenase
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
30S ribosomal protein S6
50S ribosomal protein L9
30S ribosomal protein S13
50S ribosomal protein L36
50S ribosomal protein L34
glyceraldehyde 3-phosphate dehydrogenase
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
30S ribosomal protein S6
50S ribosomal protein L9
30S ribosomal protein S13
50S ribosomal protein L36
50S ribosomal protein L34
glyceraldehyde 3-phosphate dehydrogenase
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
30S ribosomal protein S6
50S ribosomal protein L9
30S ribosomal protein S13
50S ribosomal protein L36
50S ribosomal protein L34
glyceraldehyde 3-phosphate dehydrogenase
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
30S ribosomal protein S6
50S ribosomal protein L9
30S ribosomal protein S13
50S ribosomal protein L36
50S ribosomal protein L34
glyceraldehyde 3-phosphate dehydrogenase
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family
30S ribosomal protein S6
50S ribosomal protein L9
30S ribosomal protein S13
50S ribosomal protein L36
50S ribosomal protein L34
glyceraldehyde 3-phosphate dehydrogenase
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
Negative control randomized 70mer
70 kD heat shock protein, chromosome replication
heat shock protein
heat shock protein Hsp90 family

				
DOCUMENT INFO