Docstoc

POMPE'S DISEASE

Document Sample
POMPE'S DISEASE Powered By Docstoc
					QUESTION?


  What are the three types of alpha-
  glucosidase and what is the function
  of this enzyme function?
POMPE’S DISEASE


  PRESENTATION BY
  FATOU NJIE
WHAT IS POMPE’S DISEASE?
 Pompe’s disease also referred to as
  Glycogen Storage Disease Type II or aicd
  maltase deficiency, is an autosomal
  recessive disorder of glycogen metabolism
  caused by a deficiency of the lysosomal
  enzyme acid glucosidase.
 People affected with this disease are unable
  to degrade glycogen stored in the lysosome
  and thus leading to the accumulation of
  glycogen in lysosomal storage vacuoles.
HISTORY OF THE DISEASE
 Existence of the disease was first
  described in 1932 by Dr JC Pompe.
 The disease is a rare neuromuscular
  genetic disorder that occurs in babies,
  children and adults who inherit a
  defective gene from each of their
  parents.
HISTORY (CONT.)
 Pompe’s disease is the most devastating
  glycogen storage disease. The disease has
  been divided into three forms defined by
  age of onset and progression of symptoms.
 The three forms include infantile onset,
  juvenile onset and adult onset.
 In the infantile form of the disease, patients
  display cardiac impairment, which is fatal
  before two years of life.
HISTORY(CONT.)
 Patients with juvenile or adult forms
  can present diaphragm involvement
  leading to respiratory failure.
 The adult onset symptoms involve
  generalized muscle weakness and
  wasting of respiratory muscles in the
  trunk, lower limbs, and diaphragm.
WHAT MAKES UP GLYCOGEN
 Glycogen is mostly found in the liver
  and skeletal muscles.
 It is a polymer of 120,000 glucose
  residues and is a primary
  carbohydrate storage form in
  animals.
WHAT MAKES UP
GLYCOGEN(CONT)
 The polymer is composed of units of
  glucose linked α-1-4 with branches
  occurring at a-1-6, approximately
  every 8-12 residues.
 The end of the molecule containing a
  free carbon number one on glucose is
  called a reducing end. The other
  ends are all called non-reducing ends
SIZE OF GLYCOGEN
 Glycogen molecules are very large in
  size
 Therefore inability to degrade them
  results to a large accumulation of
  normal structure in the lysosomes of
  all cells. The excess storage of
  glycogen in the vacuoles is the
  consequence of defects in the
  lysosomal hydrolase.
STRUCTURE OF GLYOGEN




http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=stryer.figgrp.2912
ALPHA-GLUCOSIDASE
 The acid a-glucosidase normally designated
  as GAA gene resides on chromosome
  17q25, spanning 20 kb and composed of 20
  exons.
 Glycogen storage disease type II has been
  shown to be caused by missense, nonsense
  and splice-site mutations, partial deletions
  and insertions. Some mutations are specific
  to certain ethnic groups.
FORMS OF α-GLUCOSIDASE
 There are three common allelic forms
  of acid a-glucosidase that segregate
  in the general population.
 These forms are designated GAA1,
  GAA2 and GAA4. The normal
  function of acid a-glucosidase is to
  hydrolyze both a-1,4- and a-1,6-
  glucosidic linkages at acid Ph.
ACTIVITY OF α-GLUCOSIDASE
 The activity of the enzyme leads to
  the complete hydrolysis of glycogen
  which is its natural substrate.
 As would be expected from this
  activity, deficiency in acid a-
  glucosidase leads to the accumulation
  of structurally normal glycogen in
  numerous tissues, most notably in
  cardiac and skeletal muscle.
METABOLISM OF GLYCOGEN




 www.google.com
Activity of α-1,4-glucosidase in
Lysosomal α-glucosidase
 The lysosomal α-1,4-glucosidase was found
  to be active at pH 4. However, its activity
  is not present in the liver, heart and
  skeletal muscles of children with pompe’s
  disease.
 Although the lysosomal α-1,4-glucosidase is
  often referred to as maltase, the enzyme is
  known to have a broader specificity in that
  it acts also on the outer chains of glycogen.
ACTIVITY (CONT.)
 Studies have shown that α-1,4-
  glucosidase is able to catalyze the
  total degradation of glycogen to
  glucose.
 Also, its activity towards glycogen can
  be greatly stimulated by monovalent
  and divalent cations, and that the
  degree of stimulation is dependent
  upon pH.
ACTIVITY (CONT.)
 The effect is so pronounced at pH 4
  that the possibility might be
  considered that intralysosomal
  glycogen catabolism in vivo could be
  regulated within the organelle.
 Glucosidase has been purified from
  rat liver enzyme and was found to
  posses the ability to catalyze various
  transglucosylation reactions.
ACTIVITY (CONT.)
 However, there is no evidence as to
  whether these transglucosylaton reactions
  should be regarded as having any
  physiological importance within the
  lysosome.
 It clearly shows that α-1,4-glucosidase is
  present in lysosome from rat liver but its
  ability to debranch glycogen granules is
  unknown.
Kinetics of α-glucosidase
 Studies done on the kinetics of α-
  glucosidase shows differences in its
  response to cation concentration and pH.
 This suggested that the enzyme have more
  than one catalytically active binding site as
  well as at least one separate inhibitory site.
 One of the two catalytic sites could bind
  maltose, as well as other maltosidically
  linked oligosaccharides of low molecular
  weight.
STRUCTURE OF MALTOSE(a
glucosyl-glucose disaccharide)




 www.google.com
Kinetics of α-glucosidase(cont.)
 The same binding site also have affinity for
  the α-1,6-glucosidasidically linked
  isomaltase since it is a competitive inhibitor
  of maltose hydrolysis.
 The other catalytic binding sites might bind
  polysaccharide substrate such as glycogen
  and would be the locus of α-1,4-glucosidase
  action on such molecules.
Catalytic Site of Lysosomal a-
Glucosidase
 The primary structure of lysosomal α-
  glucosidase was studied through
  molecular cloning and analysis of
  cDNA and genomic sequences.
 It was found that the cDNA codes for
  a protein of 952 amino acids with an
  apparent molecular mass of 110 kDa.
Catalytic Site of Lysosomal a-
Glucosidase(cont)
 The residues that were found in the
  catalytic site of this enzyme were
  located in a peptide extending from
  Asp-513 to Asn-520 in mammalian
  cells.
 These amino acid substitutions were
  made by site-directed mutagenesis.
Hermans, M. P. Monique; Kroos, A. Marian; van Beeurnens; Oostra, A. Ben;
ReuserSll, J.J. Arnold. Human Lysosomal a-Glucosidase: CHARACTERIZATION OF THE CATALYTIC SITE. Jbc. 1991, 266, 13507-13512.


       Oligonucleotides used for
       mutagenesis
            D518                            5'         ATGTGGATTGACATGAACGAG                             3'
                                                                  Asp
            G518                            5'         ATGTGGATTGGCATGAACGAG                             3'
                                                                  Gly
            N518                            5'         ATGTGGATTAACATGAACGAG                             3'
                                                                  Asn
            E518                            5'         ATGTGGATTGAAATGAACGAG                             3'
                                                                  Glu
            R516                            5'         GACGGCATGCGGATTGACATG                             3'
                                                                  Arg
            E513                            5'         GCCCTTCGAAGGCATGTGGAT                             3'
                                                              Glu
        Hermans, M. P. Monique; Kroos, A. Marian; van Beeurnens;
        Oostra, A. Ben; ReuserSll, J.J. Arnold. Human Lysosomal a-
        Glucosidase: CHARACTERIZATION OF THE CATALYTIC SITE. Jbc.
        1991, 266, 13507-13512.
MUTATION AT THE CATALYTIC SITE
 Substitutions were made at positions
  Asp-513, Trp-516, and Asp-518 to
  obtain direct information on the role
  of potentially important residues in
  the catalytic site region.
MUTATION AT THE CATALYTIC
SITE(CONT.)
 The substitution of Asp-513 by Glu-
  513 had the most dramatic effect as
  it causes the blockage of both the
  posttranslational modification and the
  intracellular transport of α-
  glucosidase.
MUTATION AT THE CATALYTIC
SITE(CONT.)
 The substitution of Trp-516 by Arg-
  516 leads to loss of catalytic function.
 Tryptophan has a non-polar side
  chain and practically no acidic or
  basic properties. Thus the inactivation
  is more likely due to an altered
  charge distribution.
Regulation of GAA
 The regulation of GAA may be quite
  complex according to analysis of results
  obtained from resent experiments.
 Therefore this lysosomal enzyme may have
  still unrecognized physiological roles in
  development.
 The discovery of the GAA gene however,
  has led to rapid progress in understanding
  the biological mechanisms and properties of
  the enzyme.
Treatment
 An enzyme replacement called
  myozyme has been shown to be a
  safe and effective treatment for
  Pompe disease.
 Researchers are still working on
  having a better understanding of the
  mechanism behind the uptake and
  degradation of glycogen by GAA .
QUESTIONS?

				
DOCUMENT INFO