A method for detecting complex vertebral malformation in Holstein

Document Sample
A method for detecting complex vertebral malformation in Holstein Powered By Docstoc
					    Journal of Veterinary Diagnostic
             Investigation                     http://vdi.sagepub.com/




A Method for Detecting Complex Vertebral Malformation in Holstein Calves using Polymerase Chain
                        Reaction −Primer Introduced Restriction Analysis
                     Yutaka Kanae, Daiji Endoh, Hajime Nagahata and Masanobu Hayashi
                                     J VET Diagn Invest 2005 17: 258
                                    DOI: 10.1177/104063870501700309

                                 The online version of this article can be found at:
                                    http://vdi.sagepub.com/content/17/3/258


                                                            Published by:

                                            http://www.sagepublications.com

                                                             On behalf of:




             Official Publication of the American Association of Veterinary Laboratory Diagnosticians, Inc.




          Additional services and information for Journal of Veterinary Diagnostic Investigation can be found at:

                                       Email Alerts: http://vdi.sagepub.com/cgi/alerts

                                     Subscriptions: http://vdi.sagepub.com/subscriptions

                                   Reprints: http://www.sagepub.com/journalsReprints.nav

                               Permissions: http://www.sagepub.com/journalsPermissions.nav

                                 Citations: http://vdi.sagepub.com/content/17/3/258.refs.html




                                             Downloaded from vdi.sagepub.com by guest on May 19, 2011
258                                                          Brief Communications


imentacion (Generallitat Valenciana). The authors thank
        ´                                                                        5. Galandiuk S, Fazio VW: 1986, Pneumatosis cystoides intestin-
Margot Ovenden for her assistance with the English edition                          alis. A review of the literature. Dis Colon Rectum 29:358–363.
and Joaquı Ortega for his technical assistance.
         ´n                                                                           ¨
                                                                                 6. Hoer J, Truong S, Virnich N, et al.: 1998, Pneumatosis cystoides
                                                                                    intestinalis: confirmation of diagnosis by endoscopic puncture a
                                                                                    review of pathogenesis, associated disease and therapy and a
               Sources and manufacturers                                            new theory of cyst formation. Endoscopy 30:793–799.
                                                                                 7. Jones TC, Hunt RD, King NW: 1997, Intestinal emphysema. In:
               ´
a. Dolethal , Vetoquinol SA, Lure, France.                                          Veterinary pathology, ed. Cann C, 6th ed., p. 1080. Williams &
                                                                                    Wilkins, Baltimore, MD.
                           References                                            8. Koss LK: 1952, Abdominal gas cysts (pneumatosis cystoides
                                                                                    intestinorum hominis): an analysis with a report of a case and
 1. Aziz EM: 1973, Neonatal pneumatosis intestinalis associated                     critical review of the literature. Arch Pathol 53:523–549.
    with milk intolerance. Am J Dis Child 125:560–562.                           9. McGavin MD, Carlton WW, Zachary JF: 2001, Intestinal em-
 2. Blas E, Gidenne T: 1998, Digestion of starch and sugars. In:                    physema. In: Thomson’s special veterinary pathology, ed.
    The nutrition of the rabbit, ed. Blas C, Wiseman J, pp. 17–38.                  Schrefer JA, 3rd ed., pp. 54–55. Mosby, St. Louis, MO.
    CAB International, London, United Kingdom.                                  10. Meyer RC, Simon J: 1977, Intestinal emphysema (pneumatosis
 3. De Blas C, Mateos GG: 1998, Feed formulation. In: The nutri-                    cystoids intestinalis) in a gnotobiotic pig. Can J Comp Med 41:
    tion of the rabbit, ed. Blas C, Wiseman J, pp. 241–253. CAB                     302–305.
    International, London, United Kingdom.                                      11. Yale CE: 1975, Etiology of pneumatosis cystoides intestinalis.
 4. De Blas C, Mateos GG, Rebollar PG: 2003, Tablas de compos-                      Surg Clin N Am 55:1297–1302.
    icion y valor nutritivo de alimentos para la fabricacion de pien-
       ´                                                  ´                     12. Yale CE, Balish E: 1992, The natural course of Clostridium
    sos compuestos. FEDNA (Fundacion Espanola para el desarrol-
                                       ´        ˜                                   perfringens. Induced pneumatosis cystoides intestinalis. J Med
    lo de la Nutricion Animal), Madrid, Spain.
                    ´                                                               23:279–288.




J Vet Diagn Invest 17:258–262 (2005)

      A method for detecting complex vertebral malformation in Holstein calves using
            polymerase chain reaction–primer introduced restriction analysis
                       Yutaka Kanae1, Daiji Endoh, Hajime Nagahata, Masanobu Hayashi
          Abstract. Complex vertebral malformation (CVM), a hereditary lethal disease in Holstein calves, is char-
       acterized by complex anomalies of the vertebral column and limbs in an aborted fetus and in prematurely born,
       stillborn, and neonatal calves. The mode of inheritance of CVM is autosomal recessive, and CVM is caused
       by a point mutation from G to T at nucleotide position 559 of the bovine solute carrier family 35 member 3
       (SLC35A3) gene. Although an allele-specific polymerase chain reaction (AS-PCR) is a useful method for di-
       agnosis of CVM, the AS-PCR requires selected DNA polymerases and strictly controlled reaction conditions
       to obtain reliable results. Therefore, an alternative screening method for the CVM gene would be useful.
       Polymerase chain reaction–primer introduced restriction analysis (PCR-PIRA) is a method that can be used for
       detecting a single nucleotide mutation in any gene without a restriction site around the mutation site. In this
       study, primers were designed to introduce PstI or EcoT22 sites into PCR products from the wild-type and CVM
       alleles, respectively. The wild-type allele, a heterozygote, and a homozygote of the CVM allele could be
       discriminated by restriction fragment length polymorphism analysis. Specific introduction of restriction sites
       into PCR products depending on the change in a single nucleotide of template was shown using a variety of
       DNA polymerases and PCR machines. Therefore, the PCR-PIRA technique using primers designed in this study
       might provide a more useful method for extensive screening of CVM.
         Key words:       Complex vertebral malformation; diagnosis; Holstein; PCR-PIRA.


  Complex vertebral malformation (CVM), a familial lethal                      aborted, and preterm calves.1 Affected calves are character-
syndrome in Holstein calves, has been reported in stillborn,                   ized by shortened cervical and thoracic regions of the ver-
                                                                               tebral column, bilateral symmetric contraction of the meta-
                                                                               tarsophalangeal joints, and symmetric arthogryposis.1,3,8,11
   From the Departments of Veterinary Radiology (Kanae, Endoh,                 Multiple hemivertebrae, scoliosis, and synostosis of the ver-
Hayashi) and Animal Health (Nagahata), School of Veterinary Med-
                                                                               tebral column have also been reported.1,3,8,11 Complex ver-
icine, Rakuno Gakuen University, 582 Bunkyodai-Midorimachi,
Ebetsu, Hokkaido 069-8501, Japan.                                              tebral malformation was first identified and characterized in
   1Corresponding Author: Yutaka Kanae, Department of Veterinary               Holstein cattle in Denmark.1 Two common ancestors in ped-
Radiology, School of Veterinary Medicine, Rakuno Gakuen Uni-                   igrees of CVM were found; both were elite sires of US Hol-
versity, Ebetsu, Hokkaido 069-8501, Japan.                                     stein origin. Because of the widespread international use of


                                                    Downloaded from vdi.sagepub.com by guest on May 19, 2011
                                                             Brief Communications                                                        259




  Figure 1. Schematic presentation of exon 4, depicted by a solid box, partial exon 4 sequences of wild-type and CVM SLC35A3 gene
around the 559th nucleotide of the gene, nucleotide sequences of PstI and EcoT22I forward primers, and introduced restriction sites. The
bold characters show mismatched sequences of primers for introduction of restriction sites.



semen from the sires in pedigrees of affected calves, it is                    cleotide of the SLC35A3 gene. Polymerase chain reaction–
expected that CVM will occur in many countries. Indeed,                        primer introduced restriction analysis (PCR-PIRA) is a
the occurrence of CVM in Holstein calves has been reported                     method for detection of single nucleotide mutations by in-
recently in the United States,3 the United Kingdom,11 and                      troducing artificial restriction endonuclease sites using prim-
Japan.8                                                                        ers containing mismatches.4 This method has been used for
   The Danish Institute of Agricultural Science has deter-                     detection of single nucleotide mutations of a variety of
mined that the mode of inheritance of CVM is autosomal                         genes.2,6,9 For CVM screening, 2 primer sets were designed.
recessive and that CVM is caused by a point mutation from                      One included an EcoT22I site in the amplified product from
G to T at nucleotide position 559 of the bovine solute carrier                 the CVM allele and the other included a PstI site in the
family 35 member 3 (SLC35A3) gene (Ministeriet for Fod-                        amplified product from the wild-type allele (Fig. 1). Both
ervarer, Landburg og Fiskeri Danmarks Jordbrugsforskining,                     primers were complementary to sequence from nucleotides
International Patent WO 02/40709 A2, 2002) and developed                       537 to 554 of the bovine SLC35A3 gene, but 2 nucleotides
a detection method using an allele-specific polymerase chain                    at the fourth and fifth positions from the 3 ends of the prim-
reaction (AS-PCR). They provide 2 primer sets complemen-                       ers were different. Three nucleotides at the 3 ends of both
tary to G for the normal allele and T for the CVM allele at                    primers were matched to nucleotides 556–558 of both the
nucleotide position 559 of the bovine SLC35A3 gene. Spe-                       wild-type and CVM alleles. The EcoT22I and PstI sites were
cific amplification can be obtained if the 3 end of the oli-                     introduced in PCR products depending on the nucleotide se-
gonucleotide matches the desired alleles, but a mismatched                     quences of templates (Fig. 1).
allele is poorly amplified if at all because mismatch prevents                     To examine the effects of mismatches of 2 nucleotides in
efficient elongation from the 3 ends of primers by DNA                          the primers on specific introduction of restriction sites, 2
polymerase. Wild-type and CVM alleles can be distin-                           clones were constructed. A total of 233 base pair (bp) frag-
guished by detection of amplified bands from either the                         ments including a part of exon 4 and intron 4 sequence (nu-
primer for G or the primer for T. The amplified bands can                       cleotides 536–637 of exon 4 and 132 bp of the intron 4
be resolved by agarose gel electrophoresis with no additional                  sequence) were amplified using 3 alteration primers in
manipulation.5,12 Although the AS-PCR is useful in the di-                     which the 559th nucleotide was G or T of the bovine
agnosis of CVM, it requires a selected DNA polymerase7                         SLC35A3 gene (5 cacaatttgtaggtctcatggca(t/g)3 ) and a re-
and strictly controlled reaction conditions to obtain reliable                 verse primer (5 cgatgaaaaaggaaccaaaaggg3 ) from genomic
results. Thus, the development of an alternative method may                    DNA of normal Holstein calves (GenBank accession num-
be necessary for extensive screening for the CVM gene.                         ber: AY 160683 and Ref. 8). The PCR for amplification of
   Polymerase chain reaction–restriction fragment length                       233-bp fragments from calf DNA was performed in a 30- l
polymorphism (PCR-RFLP) is a reliable method for detec-                        reaction mixture containing 10 mM Tris–HCl (pH 8.3 at 25
tion of single nucleotide mutations and genetic polymor-                       C), 50 mM KCl, 0.001% (wt/vol) gelatin, 300 ng genomic
phisms because digestibility by restriction endonucleases                      DNA, 0.01 units of Taq polymerase,c 0.2 mM deoxynucleo-
strictly depends on nucleotide sequences of PCR products.                      side triphosphate, 15 mM MgCl2, and 0.5 M each primer
However, there are no restriction sites around the 559th nu-                   using a thermal cyclerd under the following conditions: ini-


                                               Downloaded from vdi.sagepub.com by guest on May 19, 2011
260                                                        Brief Communications




  Figure 2. Effects of a variety of DNA polymerases and PCR machines on specific introduction of restriction sites. The PCR-PIRA
was performed as described in the text using G-233 (G) and T-233 (T) as templates. Three PCR machines (PCR machine 1,d 2,l and 3m)
and 5 types of polymerase, Taq polymeraseh (A), Hotstart Taq polymerasec (B), Hotstart Taq polymerasei (C), DNA polymerase having
proofreading activityj (D), and DNA polymerase having high proofreading activityk (E) were used. Eco represents amplified products using
EcoT22I forward primer, which were digested with EcoT22I. Pst represents amplified products using PstI forward primer, which were
digested with PstI. The digested PCR products were analyzed by agarose gel electrophoresis. M represents a molecular weight marker
(100-bp ladder markerp). NC represents a negative PCR control without a template.



tial denaturation at 94 C for 1 minute, 30 cycles of 94 C for                ber of amplification cycles was 25. The PCR products were
30 second, 56 C for 30 second, and 72 C for 30 second                        digested with EcoT22In or PstIo at 37 C for 1 hour in a 10-
followed by a final extension at 72 C for 2 minute. The PCR                     l reaction mixture containing 8- l PCR products, 5 mM
products were cloned into a plasmid vector.b Clones contain-                 Tris–HCl, pH 7.5, 1 mM MgCl2, 10 mM NaCl, 0.1 mM
ing 233-bp fragments from normal and CVM alleles were                        dithiothreitol, and 0.01 units of EcoT22I or PstI. The di-
designated as G-233 and T-233, respectively. Sequences of                    gested fragments were electrophoresed in Tris–borate–eth-
the clones were confirmed by the DYE terminater method                        ylenediaminetetraacetic acid, 3% (wt/vol) agarose gel g
using a cycle sequencing kite with an autosequencerf accord-                 stained with ethidium bromide and observed under an UV
ing to the manufacturer’s protocol.                                          transilluminator. Although all combinations of DNA poly-
   The PCR-PIRA was carried out using G-233 or T-233 as                      merases and PCR machines yielded 233-bp PCR products,
a template, 5 types of polymerasesc,h–k (1 normal Taq poly-                  EcoT22I digested only PCR products from T-233 and PstI
merase,h 2 hotstart Taq polymerases,c,i and 2 polymerasesj,k                 digested only PCR products from G-233, except for 1 DNA
that have proofreading activity) and 3 brands of PCR ma-                     polymerasek (Fig. 2) with a high proofreading activity. It is
chines.d,l,m The PCR reactions were carried out with 10- l                   possible the mismatched nucleotides between the template
reaction mixtures according to the manufacturer’s directions                 and the primer may be recognized by the high proofreading
except that the annealing temperature was 56 C and the num-                  activity and digested by the 3 –5 exonuclease activity of


                                                  Downloaded from vdi.sagepub.com by guest on May 19, 2011
                                                           Brief Communications                                                                261




  Figure 3. Analysis of CVM allele by the PCR-PIRA method. The PCR-PIRA was performed as described in the text using DNA
samples from normal, carrier, and CVM calves as templates. Eco represents amplified products using EcoT22I forward primer, which were
digested with EcoT22I. Pst represents amplified products using PstI forward primer, which were digested with PstI. The digested PCR
products were analyzed by agarose gel electrophoresis. M represents a molecular weight marker (100-bp ladder markerp).




that polymerase. These results showed that the CVM allele                    pan, for the generous donation of genomic DNA samples
can be detected by PCR-PIRA using the designed primers                       from normal and CVM-carrier calves.
despite the presence of 2 nucleotide mismatches and that Taq
polymerase and DNA polymerase lacking high proofreading                                             Sources and manufacturers
activity and widely used PCR machines can be used for the                    a. PUREGENE Genomic DNA Purification Kit, Gentra, Minneap-
detection.                                                                      olis, MN.
   The PCR-PIRA was performed with genomic DNA sam-                          b. pGEM-T Easy Vector Systems, Promega, Madison, WI.
ples extracted from the blood of Holstein calves as described                c. JumpStart Taq polymerase, SIGMA, St. Louis, MO.
above. Genomic DNA samples from 3 CVM-normal and 8                           d. iCycler, BIORAD, Hercules, CA.
CVM-carrier Holstein calves, which were diagnosed by AS-                     e. DYEnamic ET Terminator Cycle Sequencing Kit, Amersham
PCR method, were kindly provided by the Livestock Im-                           Bioscience, Piscataway, NJ.
                                                                             f. ABI prism 310, Applied Biosystems, Foster, CA.
provement Association of Japan. Genomic DNA from whole
                                                                             g. AGAROSE 3:1, AMRESCO, Solon, OH.
blood of a CVM-affected Holstein calf, which was also di-                    h. Taq polymerase, SIGMA, St. Louis, MO.
agnosed by AS-PCR method,9 was isolated using a DNA                          i. HotStarTaq polymerase, Qiagen, Hilden, Germany.
isolation kit.a The PCR products from normal calf DNA sam-                   j. Expand Hi Fidelity, Roche, Mannheim, Germany.
ples were digested by PstI but not by EcoT22I, and PCR                       k. KOD plus, TOYOBO, Osaka, Japan.
products from CVM calf DNA samples were digested by                          l. Takara Thermal Cycler PERSONAL, TAKARA, Shiga, Japan.
EcoT22I but not by PstI. The PCR products from CVM-                          m. T-Gradient, Biometra, Goettingen, Germany.
carrier calf DNA samples were digested by both EcoT22I                       n. EcoT22I, TOYOBO, Osaka, Japan.
and PstI (Fig. 3). These results showed that the PCR-PIRA                    o. PstI, TOYOBO, Osaka, Japan.
method using the primers designed in this study can be used                  p. Stable 100-bp DNA Ladder, SIGMA, St. Louis, MO.
for discrimination between wild-type and CVM alleles of                                                    References
Holstein calves.
   If cows and bulls that have a CVM gene are not used for                     1. Agerholm JS, Bendixen C, Andersen O, Arnbjerg J: 2001, Com-
breeding, the mutated gene can be removed from the cattle                         plex vertebral malformation in Holstein calves. J Vet Diagn In-
                                                                                  vest 13:283–289.
population in the same manner as a gene of bovine leukocyte
                                                                               2. Basolo F, Pisaturo F, Pollina LE, et al.: 2000, N-ras mutation in
adhesion deficiency has been successfully eliminated.10                            poorly differentiated thyroid carcinomas: correlation with bone
However, if the disease gene was linked to excellent traits                       metastases and inverse correlation to thyroglobulin expression.
such as high milk yield in Holstein cattle, elimination of the                    Thyroid 10:19–23.
disease gene might result in elimination of superior traits. It                3. Duncan RB Jr, Carrig CB, Agerholm JS, Bendixen C: 2001,
is well known that the mode of inheritance of most genetic                        Complex vertebral malformation in a Holstein calf: report of a
diseases is recessive. Therefore, control of the disease gene                     case in the USA. J Vet Diagn Invest 13:333–336.
might be preferable to its elimination. To control the disease                 4. Haliassos A, Chomel JC, Grandjouan S, et al.: 1989, Detection
gene, extensive screening is necessary for detection of car-                      of minority point mutations by modified PCR technique: a new
                                                                                  approach for a sensitive diagnosis of tumor-progression markers.
riers, especially cows. This study has shown that PCR-PIRA
                                                                                  Nucleic Acids Res 17:8093–8099.
is a reliable and useful method for extensive screening for                    5. Huang MM, Arnheim N, Goodman MF: 1992, Extension of base
the CVM allele using DNA polymerase and PCR machines                              mispairs by Taq DNA polymerase: implications for single nucle-
that are widely used in diagnostic laboratories.                                  otide discrimination in PCR. Nucleic Acids Res 20:4567–4573.
   Acknowledgement. Gratitude is expressed to the Livestock                    6. Jacobson DR, Moskovits T: 1991, Rapid, nonradioactive screen-
Improvement Association of Japan, Maebashi, Gunma, Ja-                            ing for activating ras oncogene mutations using PCR-primer in-



                                             Downloaded from vdi.sagepub.com by guest on May 19, 2011
262                                                         Brief Communications


    troduced restriction analysis (PCR-PIRA). PCR Methods Appl                     mutations in mesotheliomas from humans and rats exposed to
    1:146–148.                                                                     asbestos. Mutat Res 468:87–92.
 7. Kwok S, Kellogg DE, McKinney N, et al.: 1990, Effects of                   10. Powell RL, Norman HD, Cowan CM: 1996, Relationship of
    primer-template mismatches on the polymerase chain reaction:                   bovine leukocyte adhesion deficiency with genetic merit for per-
    human immunodeficiency virus type 1 model studies. Nucleic                      formance traits. J Dairy Sci 79:895–899.
    Acids Res 18:999–1005.                                                     11. Revell S: 2001, Complex vertebral malformation in a Holstein
 8. Nagahata H, Oota H, Nitanai A, et al.: 2002, Complex vertebral                 calf in the UK. Vet Rec 149:659–660.
    malformation in a stillborn Holstein calf in Japan. J Vet Med              12. Rust S, Funke H, Assmann G: 1993, Mutagenically separated
    Sci 64:1107–1112.                                                              PCR (MS-PCR): a highly specific one step procedure for easy
 9. Ni Z, Liu Y, Keshava N, et al.: 2000, Analysis of K-ras and p53                mutation detection. Nucleic Acids Res 21:3623–3629.




J Vet Diagn Invest 17:262–269 (2005)


                                       Gastrointestinal pythiosis in two cats

                               Pauline M. Rakich1, Amy M. Grooters, Kai-Ning Tang

         Abstract. Two young adult male Domestic Shorthair cats living in the southeastern United States were
      evaluated for signs attributable to partial intestinal obstruction. Physical examination indicated a palpable ab-
      dominal mass in each animal. Exploratory laparotomy revealed a large extraluminal mass involving the ileum
      and mesentery with adjacent mesenteric lymphadenopathy in cat No. 1 and an abscessed mass in the distal
      duodenum in cat No. 2. Mass resection and intestinal anastomosis were performed in both cats. Histologic
      evaluation indicated that the intestinal lesions involved primarily the outer smooth muscle layer and serosa and
      consisted of eosinophilic granulomatous inflammation with multifocal areas of necrosis. In Gomori methenamine
      silver–stained sections, broad (2.5–7.5 m), occasionally branching, infrequently septate hyphae were observed
      within areas of necrosis. A diagnosis of Pythium insidiosum infection was confirmed in both cats by immunoblot
      serology and by immunoperoxidase staining of tissue sections using a P. insidiosum–specific polyclonal anti-
      body. Cat No. 1 was clinically normal for 4 months after surgery but then died unexpectedly from an unknown
      cause. Cat No. 2 has been clinically normal for at least 9 months after surgery and appears to be cured on the
      basis of follow-up enzyme-linked immunosorbent assay serology.
         Key words:      Feline; fungal; intestine; oomycete; Pythium insidiosum.


   Pythiosis is a chronic, invasive, and frequently life-threat-              a mass measuring approximately 3          4 cm was palpated
ening infection caused by the oomycete Pythium insidiosum.                    within the abdomen. Abdominal radiography revealed a
The disease most commonly involves the skin of horses and                     mass in the region of the spleen. Hematologic and biochem-
dogs and the gastrointestinal (GI) tract of dogs.6 Pythiosis is               ical abnormalities included leukocytosis (30,000/ l) with a
rare in cats and, when it does occur, usually causes cutaneous                left shift ( 3,000 bands/ l as determined by an in-clinic
lesions.6,20 In addition, isolated cases of subcutaneous20 and                complete blood count [CBC]) and hyperglobulinemia (5.5 g/
nasopharyngeal/retrobulbar3 infections have been noted, but                   dl; reference upper limit, 5.1 g/dl). An extraluminal mass
GI infections have not been reported previously in cats. This                 involving the ileum and mesentery and measuring 12          8
report describes P. insidiosum infection of the GI tract in 2                    4 cm was found at surgery. An adjacent mesenteric lymph
cats.                                                                         node was enlarged. The mass was resected and intestinal
   Cat No. 1 was a 1.5-year-old castrated male Domestic                       anastomosis performed. Formalin-fixed tissue was submitted
Shorthair (DSH) from southeastern Georgia that was pre-                       for histologic examination with a presumptive diagnosis
sented to the referring veterinarian for vomiting of 2 days                   (based on the gross appearance) of lymphosarcoma.
duration and apparent weight loss. At physical examination,                      Histologic examination of multiple sections of the sub-
                                                                              mitted tissue consisted of small intestine with a nodular in-
   From the Athens Veterinary Diagnostic Laboratory, College of               flammatory reaction extending from the serosal surface (Fig.
Veterinary Medicine, University of Georgia, Athens, GA 30602-                 1A). The mucosa, submucosa, and inner portion of the
7383 (Rakich), Department of Veterinary Clinical Sciences, Loui-              smooth muscle wall appeared normal. The lesion consisted
siana State University, Baton Rouge, LA 70803 (Grooters), and An-
                                                                              of dense fibrous connective tissue stroma containing loosely
tech Diagnostics, 17672-A Cowan Avenue, Suite 200, Irvine, CA
92614 (Tang).                                                                 distributed eosinophils, macrophages, and fewer lymphoid
   1Corresponding Author: Pauline Rakich, Athens Veterinary Di-               cells without formation of distinct granulomas. Variably
agnostic Laboratory, College of Veterinary Medicine, University of            sized foci of necrosis composed of bright eosinophilic ma-
Georgia, Athens, GA 30602-7383.                                               terial and nuclear debris were scattered randomly throughout


                                                   Downloaded from vdi.sagepub.com by guest on May 19, 2011

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:29
posted:5/22/2011
language:English
pages:6