Docstoc

Expression of the glaucoma gene myocilin MYOC in the human optic

Document Sample
Expression of the glaucoma gene myocilin MYOC in the human optic Powered By Docstoc
					The FASEB Journal express article 10.1096/fj.00-0663fje. Published online March 5, 2001.


Expression of the glaucoma gene myocilin (MYOC) in the
human optic nerve head
Abbot F. Clark,* Kazuhide Kawase,† Sherry English-Wright,* Deborah Lane,* H. Thomas
Steely,* Tetsuya Yamamoto,† Yoshiaki Kitazawa,† Young H. Kwon,‡ John. H. Fingert,‡ Ruth E.
Swiderski,§ Robert F. Mullins, ‡ Gregory S. Hageman,‡ Wallace L. M. Alward, ‡ Val C.
Sheffield, §,¶, Edwin M. Stone‡
*
 Glaucoma Research, Alcon Research Ltd., Fort Worth, Texas 76134; †Department of
Ophthalmology, Gifu University, Gifu, Japan; and ‡Department of Ophthalmology and Visual
Sciences, §Department of Pediatrics, and ¶Howard Hughes Medical Institute, University of Iowa,
Iowa City, Iowa 52242-001

Corresponding author: A. F. Clark, Glaucoma Research R2-41, Alcon Research, Ltd., 6201
South Freeway, Fort Worth, Texas 76134. E-mail: abe.clark@alconlabs.com

ABSTRACT

Glaucoma is a leading cause of blindness in the world, and several glaucoma genes have been
recently identified. The glaucoma gene myocilin (MYOC) (also known as GLC1A and TIGR) is
responsible for juvenile open-angle glaucoma and a subset of adult-onset primary open-angle
glaucoma. Previous studies have shown that MYOC is expressed in the trabecular meshwork, an
ocular tissue involved in the development of ocular hypertension, which is often associated with
the development of glaucoma. Because all forms of glaucoma involve pathogenic changes to the
optic nerve head (ONH), including cupping, excavation, and collapse of the connective support
tissue, we sought to determine whether MYOC mRNA and protein are expressed in cells of the
human ONH. Reverse transcriptase PCR, in situ hybridization, immunofluorescent microscopy,
and immunoblotting of polyacrylamide gels were used to demonstrate that myocilin is expressed
in ONH tissue and cultured ONH cells. A secondary purpose was to determine whether MYOC
sequence variations are associated with a clinically significant fraction of normal tension
glaucoma (NTG), a form of glaucoma in which intraocular pressure is not appreciably elevated.
Nonconservative MYOC sequence variations were observed in only 6 of 307 patients with NTG
and 4 of 193 control individuals (P=1.0, Fisher’s exact test). Thus, although MYOC is expressed
in a pattern that is consistent with its involvement in NTG, variations in the MYOC coding
sequence are not commonly or significantly associated with this disease.

Key words: myocilin • MYOC • lamina cribrosa • ocular disease • glaucoma



G
        laucom is a term used to refer to a heterogeneous group of optic neuropathies that cause
        a progressive loss of vision. It is a prevalent disease (occurring in 1–2% of the world
        population over the age of 40 years) and a leading cause of blindness in the world (1, 2).
        Three specific regions of the eye are involved in the pathogenesis of glaucoma: the
trabecular meshwork (TM), the retinal ganglion cells, and the optic nerve head (ONH) (Fig. 1).
One of the major risk factors for glaucoma is increased pressure inside the eye, a condition
known as ocular hypertension. Elevated intraocular pressure (IOP) results from an increased
resistance to the outflow of aqueous humor from the anterior segment of the eye. This resistance
occurs at the junction of the iris and the cornea in the TM (Fig. 1). Elevated IOP, in addition to
other factors, damages the ONH and causes the selective and progressive death of retinal
ganglion cells (Fig. 1). The ONH is the region in the posterior portion of the eye where the
retinal ganglion cell axons converge to exit the eye and form the optic nerve. In the ONH, the
retinal ganglion cell axons are supported by a network of connective tissue that contains
astroglial cells of at least two subtypes: lamina cribrosa (LC) cells and type IB astrocytes.

A large number of cases of glaucoma are hereditary (4–6), and this fact has resulted in the
application of genetic methods to investigate the pathogenic mechanisms of the disease at the
molecular level. GLC1A was the first of several glaucoma loci to be mapped (7–18) and
harbored the first glaucoma gene to be identified (19). Mutations in this gene are responsible for
the development of juvenile open-angle glaucoma and a subset of adult-onset primary open-
angle glaucoma. The GLC1A gene has been referred to as TIGR (19–21) and MYOC (22). The
latter term was chosen by the Human Genome Organization as the preferred gene name.

The MYOC gene encodes a 57-kDa protein known as myocilin. Myocilin is expressed in the TM,
and its aberrant expression in the TM is thought to be responsible for the elevated IOP associated
with some forms of glaucoma. Glucocorticoids can induce the expression of myocilin in the TM
(20, 21, 23), and it has been suggested that myocilin is involved in glucocorticoid-induced ocular
hypertension (20, 21), a condition that occurs in certain individuals who receive topical ocular or
systemic glucocorticoid therapy (24, 25). However, a study of many steroid responders failed to
find evidence that mutations in MYOC or its promoter are responsible for the differences in the
steroid response observed in the general population (26).

Myocilin is found as discrete intracellular particles surrounding the TM cell nucleus (25, 27, 28).
It is secreted into tissue culture media and is also associated with the extracellular matrix (21).
Although no alternative splice variants of myocilin have been reported, there are several post-
translational modifications of myocilin that give rise to four or more isoforms of the myocilin
protein (20, 21).

Increased myocilin expression has been detected in the TM of patients with several different
types of glaucoma, including primary open-angle glaucoma, pigmentary glaucoma, and
pseudoexfoliation glaucoma (28). Another important subtype of glaucoma is normal tension
glaucoma (NTG), which is characterized by glaucomatous damage to the ONH and progressive
loss of vision in patients with normal IOP. The role of myocilin in the pathogenesis of NTG is
unknown.

Although most of the studies of MYOC expression to date have concentrated on the TM, it is
well known that a variety of ocular and nonocular tissues express myocilin (22, 29–32). We
report the expression of myocilin in the ONH. This finding raises the possibility that myocilin
plays a role in the pathogenesis of glaucomatous optic neuropathy; therefore, we screened many
NTG patients from two different populations for sequence variations in MYOC. However, as was
the case for steroid-induced glaucoma (26), coding sequence variations in MYOC do not appear
to cause a measurable number of cases of NTG.
MATERIALS AND METHODS

Culture of human ONH cells

LC cells and ONH astrocytes were grown from ONH explants as described previously (33–35).
LC cells were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine
serum, glutamine, and antibiotics. ONH astrocytes were grown in either Dulbecco’s modified
Eagle’s medium containing 10% fetal bovine serum, glutamine, and antibiotics or neural basal
media containing 10% fetal bovine serum, glutamine, and antibiotics.

LC cells and ONH astrocytes were grown on glass coverslips and rinsed in serum-free media
before processing. For staining extracellular myocilin, unfixed cells were incubated with
antimyocilin antibody for 60 min, washed in phosphate-buffered saline (PBS), and fixed in 4%
paraformaldehyde for 20 min at room temperature. After the cells were washed with PBS, they
were blocked with normal goat serum, incubated with primary antibodies, washed, and then
incubated with secondary antibodies. For intracellular staining, the cells were fixed as above and
permeabilized with 0.2% Triton X-100 for 5 min at room temperature before the addition of the
primary antibody. Primary antibodies (rabbit antimyocilin antibody 129, antiactin, and anti-–
COP) and secondary antibodies (conjugated with either Texas Red, Oregon Green, or Alexa-514
[Molecular Probes, Eugene, OR]) were diluted (1:100) in goat serum. Following
immunostaining, the cells were rinsed with PBS and examined by fluorescence microscopy. The
specificity of myocilin staining was determined by addition of excess myocilin peptide (amino
acids 156–171) during incubation with the primary antimyocilin antibody.

2-D PAGE and immunoblot analysis were performed as described previously (36). Proteins from
cultured LC and ONH cells were extracted using a solution of 9 M urea/4% NP-40. 2-D gel-
resolved LC and ONH protein samples were electrophoretically transferred to nitrocellulose for
Western immunoblotting using antimyocilin antibodies.

Reverse transcriptase PCR

Human donor eyes were received from regional eye banks ~ 20–24 h postmortem. Various
ocular tissues, including the optic nerve and the ONH were carefully dissected and were snap
frozen in liquid nitrogen. The tissues were stored at [minus]80°C until the RNA was extracted.

Total RNA was prepared from ocular tissues (ranging in weight from 20 to 100 mg) and from
cultured LC and ONH cells (~ 5×106 cells) using guanidine isothiocyanate and
phenol/chloroform extraction. cDNA was prepared using random primers and avian
myeloblastosis virus reverse transcriptase. PCR was performed as reported previously (37) using
Taq     polymerase       and      the     following      oligonucleotide    primers:   -actin,
AGGCCAACCGCGAGAAGATGACC for the forward and GAAGTCCAGGGCGACGTAGCAC for the reverse,
and     myocilin,     GCCAGTTTTTGAGTATGACCT                    for      the    forward      and
GTTTGTTCGAGTTCCAGATTC for the reverse. The actin and myocilin PCR products were
cloned and sequenced to validate the specificity of the PCR amplification.

In situ hybridization
Five human eyes from five donors 62–72 years of age were obtained within 6 h after death from
the Iowa Lions Eye Bank (Iowa City, IA). The donors had no known history of glaucoma or
other eye diseases. The ONH, together with the adjacent optic nerve, was dissected from the
enucleated globe, fixed in 4% paraformaldehyde, dehydrated in graded ethanols, and embedded
in paraffin.

Serial, 7-m sections were mounted onto Superfrost Plus slides (Fisher, Pittsburgh, PA) and
were hybridized with 35S-labeled sense and antisense MYOC riboprobes generated from a full-
length MYOC cDNA that was subcloned into pBluescript II SK- (Stratagene, La Jolla, CA),
linearized, and transcribed in vitro using T3 and T7 RNA polymerases. Hybridization with
labeled sense RNA riboprobes was used to control for nonspecific hybridization. In situ
hybridization was carried out as described by Swiderski and co-workers (32). Briefly, tissue
sections mounted on slides were hybridized overnight at 50°C in 50% formamide, 1× STE (0.3
M NaCl; 20 mM Tris, pH 8.0; 1 mM EDTA), 80 g/ml denatured salmon sperm DNA, 1×
Denhardt’s solution, 10% dextran sulfate, 500 g/ml yeast tRNA, and 0.1 M dithiothreitol.
Following hybridization, slides were washed twice in 5× standard saline citrate (SSC) and 0.01
M dithiothreitol at 50°C for 30 min each and once in 2× SSC and 50% formamide at 60°C for 30
min. After treatment with RNases A and T1, slides were further washed in 2× SSC at 37°C, 0.1×
SSC at 50°C, and 0.1× SSC at room temperature for 15 min each. After dehydration, slides were
dipped in NT2-B photographic emulsion (Kodak, Rochester, NY) and exposed for 1–2 weeks at
4°C. Slides were developed, counterstained with hematoxilin, and photographed with bright
field and dark field microscopy. The images were collected digitally on a Leitz Diaplan
(Wetzlar, Germany) light microscope with an Optronix (Goleta, CA) DEI-750 cooled CCD
camera. Images were converted to gray scale and sharpened and brightness was adjusted in
Adobe™ Photoshop. The montages were laid out in Showcase on a Silicon Graphics (Mountain
View, CA) Indy workstation. To detect the presence of myelin in optic nerve sections, luxol fast
blue staining was carried out according to Vaca (38) followed by hematoxilin and eosin
counterstaining.

Immunofluorescent staining

Human donor eyes were obtained from the Iowa Lions Eye Bank and were processed within 4 h
of death. Trephine punches (4 mm), centered on the ONH, were collected, embedded in optimal
cutting temperature compound (Miles, Elkhart, NY), and snap frozen in liquid nitrogen. Frozen
sections with a thickness of 6–10 m were subsequently collected on Superfrost plus slides.

For immunohistochemical detection of myocilin distribution in the human ONH, tissue sections
were blocked in 10 mM sodium phosphate, pH 7.4, containing 0.85% NaCl (PBS), with 1 mg/ml
globulin-free bovine serum albumin. Sections were then rinsed briefly in PBS and incubated for
1 h with antimyocilin antibody (Alcon 129), diluted 1:50 in PBS. Slides were rinsed in PBS (2×
for 10 min each) and were subsequently incubated for 30 min in antirabbit secondary antibody
conjugated to Alexa-488 (Molecular Probes, Eugene, OR) diluted at 1:100 to 1:200 in PBS.
Sections were then washed in PBS (2× for 10 min each) and coverslipped in Immumount
(Shandon, Pittsburgh, PA). For some experiments, sections were incubated with 0.5 M
propidium iodide (Molecular Probes) for 10 min after incubation in the secondary antibody and
then washed and coverslipped as above. Sections were then viewed on either a BH-2
fluorescence microscope (Olympus, Hyde Park, NY) or an MRC 1024 confocal laser scanning
microscope (BioRad, Hercules, CA). In some experiments, primary antibody was omitted from
adjacent sections to control for autofluorescence and nonspecific binding of secondary
antibodies.

Screening normal tension glaucoma patients for MYOC mutations

After informed consent was obtained, peripheral blood samples were collected from 307 patients
with NTG and 193 normal controls. Two hundred thirteen patients with NTG and 102 control
individuals were ascertained at the Gifu University Hospital in Gifu, Japan. The remaining 94
patients with NTG and 91 control individuals were ascertained at the University of Iowa in Iowa
City. The diagnostic criteria for NTG consisted of 1) normal open angles with untreated IOP
less than or equal to 21-mm Hg in both eyes at all times, 2) glaucomatous visual field defects in
at least one eye, 3) glaucomatous optic disc excavation, and 4) absence of intracranial
abnormalities. Normal control subjects had IOP less than or equal to 21-mm Hg, no
glaucomatous optic nerve changes, and no family history of glaucoma.

Proteinase K and saturated NaCl were used to purify the genomic DNA from the blood samples.
The genomic DNA from each study participant was amplified as previously described (39, 40),
with the exception that exon 1 was screened with four amplimers rather than six. This was done
in part so that the assay would no longer be confounded by the common non-disease-causing
polymorphism that lies 83 base pairs upstream from the transcription start site. The following
four sets of PCR primers were used for exon 1: IJ, TCCAGAGGAAGCCTCACC for the
forward       and       GATGACTGACATGGCCTGG                 for      the      reverse;     1K,
CAGTCCCAATGAATCCAGC for the forward and
CTCTCTGGTTTGGGTTTCCA for the reverse; 1L,TGACCTTGGACCAGGCTG for the
forward and
CCTGGCCAGATTCTCATTTT for the reverse; and 1M,TGGAGGAAGAGAAGAAGCGA for
the forward and
CTGCTGAACTCAGAGTCCCC for the reverse.

Single-strand conformation polymorphism analysis was used to screen these PCR products for
sequence variations (19, 39, 40). All single-strand conformation polymorphism variants were
confirmed and characterized by bidirectional automated DNA sequencing.

RESULTS

Analysis of MYOC mRNA expression using RT-PCR demonstrated that most tissues of the eye
express MYOC mRNA (Fig. 2A). In addition to the expected locations--the TM, the ciliary body,
and the retina (Fig. 2A)--MYOC was also found to be expressed in the optic nerve and the ONH
as well as in cultured human LC cells and ONH astrocytes (Fig. 2B).

To further investigate MYOC expression in the ONH, we localized MYOC transcripts in regions
of the ONH using in situ hybridization (Fig. 3). In sections of the optic nerve cut 100 m distal
to the prelaminar region of the ONH (the approximate region of the LC), MYOC transcripts
were found in high abundance in cells lining the laminar sheets, the surrounding sclera, the dura
mater, the arachnoid, the pia mater, and the perivascular connective tissue surrounding the
central retinal artery and vein (Fig. 3A). No signal was detected in any of these tissues by the
control sense riboprobe (Fig. 3B). Adjacent sections stained with luxol fast blue failed to detect
any myelination of the optic nerve axons (Fig. 3C), providing further evidence that these
sections were cut from within the ONH where the optic nerve is normally unmyelinated.

Human optic nerve and ONH tissues were also examined for myocilin expression by
immunofluorescence analysis. Intense labeling of the ONH, as well as the pial septa of the
postlaminar optic nerve, was detected with myocilin antibodies (Fig. 4A). This labeling
included, but was not restricted to, cells aligned horizontally at the LC. No labeling of the
choroid or sclera was apparent, with the exception of the smooth muscle cells that surrounded
some large vessels.

Two different types of cells were cultured from the ONH: LC cells and ONH astrocytes. LC
cells are broad, relatively flat cells with multiple overlapping processes. These cells do not
express glial fibrillar acidic protein. ONH astrocytes have large cell bodies with numerous long,
thin processes, and these cells do express glial fibrillar acidic protein. Both of these cell types
express MYOC mRNA (Fig. 2B) and myocilin protein (Figs. 4B–E). Myocilin was seen in a
punctate staining pattern in vesicular structures surrounding the nuclei of many, but not all, of
the cells (Figs. 4B, 4D, and 4E). The location of some of these vesicles appeared to overlap with
the Golgi protein -COP (Fig. 4D). Extracellular staining of myocilin could also be seen in
cultured LC cells and in ONH astrocytes (Figs. 4C and 4E). In many cases, LC cells and ONH
astrocytes expressed both intracellular and extracellular forms of myocilin (Fig. 4E).

The expression of myocilin in cultured ONH cells was confirmed by 2D-PAGE Western
immunoblot analysis (Fig. 5). Four to six different myocilin protein isoforms could be detected
in the media of cultured LC cells (Fig. 5A) as well as in lysates of cultured ONH astrocytes (Fig.
5B). The immunoblotted myocilin proteins showed isoforms varying in apparent mass from
55,000 to 57,000 with isoelectric points of ~ 5.2–5.3.

The fact that MYOC is expressed in the optic nerve prompted us to investigate whether mutations
in this gene are involved in NTG. Because of the high incidence of NTG in the Japanese
population, we screened the MYOC gene in 213 patients with NTG and 102 control subjects
from Japan and in 94 patients with NTG and 91 control subjects from Iowa. Overall, we
observed 98 instances of 22 different variations in the MYOC gene (Table 1). However, only 10
instances of 6 different sequence variations would be expected to alter the charge, size, or
polarity of the MYOC gene product. In total, these variations were equally divided between the
patients with NTG (6 of 307) and the control subjects (4 of 195), although three of these
changes-- Leu215Pro (n=2), Thr256Met (n=1), and Trp286Arg (n=1)--were seen only in patients
with NTG. Of the 22 sequence variants we observed, 9 were seen only in patients from Japan
and 10 were seen only in patients from Iowa.

DISCUSSION

Glaucomatous damage to the eye involves pathogenic changes in the TM, the ganglion cell layer
of the retina, and the ONH. In many glaucomatous eyes, a loss of TM cells and a buildup of
extracellular debris in the TM cause increased resistance to aqueous humor outflow and elevated
IOP. A backward bowing of the ONH combined with compression and remodeling of the LC
occurs in almost all eyes affected with glaucoma.

Myocilin plays a very important role in the pathogenesis of autosomal dominant juvenile
glaucoma and is also involved in a small but significant subset of adult-onset primary open-angle
glaucoma (19, 39, 41). The prevalence of probable disease-causing MYOC mutations in patients
with primary open-angle glaucoma with a family history of glaucoma is 4.0% (42) in the
Japanese population and 4.4% (19) in caucasian patients, whereas the frequency of mutations in
unselected patients with primary open-angle glaucoma ranges from 2.6 to 4.4% (39, 40). As a
result, the majority of work on the role of myocilin in glaucoma has concentrated on myocilin
expression in the TM and its association with elevated IOP.

This report demonstrates that myocilin is also expressed in the ONH and in cells derived from
this region. These observations raise the possibility that myocilin could be involved in
glaucomatous damage to the optic nerve at the level of the ONH. There are many parallels in the
expression of myocilin in ONH cells and in TM cells. Myocilin expression in cultured LC cells
and ONH astrocytes occurs in discrete, intracellular vesicle-like particles that surround the
nucleus. A similar intracellular localization of myocilin occurs in the TM (25, 27, 28). LC cells
and ONH astrocytes in the optic nerve are responsible for making and maintaining the complex
LC tissue structure, which structurally supports the retinal ganglion cell axons as they exit the
rigid scleral coating of the eye. In addition, these cells generate and secrete neurotrophic factors
that may provide trophic support to the retinal ganglion cell axons (43).

Although there has been a report of a MYOC mutation occurring in a patient with NTG (44), the
data in our study suggest that coding sequence variations in the MYOC gene are not commonly
involved in the NTG phenotype. Of course, this observation does not preclude a role for
myocilin in the pathogenesis of NTG. That is, it is possible that other genes or even nongenetic
factors act upstream from myocilin in the pathogenic pathway for NTG and that myocilin is a
critical intermediate in this process. In this context, it is noteworthy that MYOC coding sequence
variations are also extremely rare in patients with steroid-induced glaucoma (26) despite the
ample evidence for the glucocorticoid inducibility of the MYOC gene.

We do not know the precise role that myocilin plays in the pathogenesis of glaucoma. Additional
studies are underway to explore the effects of normal and mutant myocilin expression in
transfected cells and to determine the role of myocilin isoforms in the regulation of TM and
ONH functions.

ACKNOWLEDGMENTS

We are grateful to Dr. Jim J-C. Lin and Rebecca Reiter for use of the in situ hybridization
facility; to the Blodi Ocular Pathology Laboratory for tissue processing; and to Jean Ross,
Louisa Affatigato, and Benjamin Carroll for excellent technical assistance. We would like to
thank Hidea Uchida and Goji Tomita, Gifu University, for providing normal controls from
volunteers; Shuichi Jikihara, Prefectural Gifu Hospital, and Kenji Kawai, Ogaki Municipal
Hospital, for providing normal controls from nonglaucomatous patients; and Sohan S. Hayreh
for providing some of his patients with NTG for this study. This research was supported in part
by the National Institutes of Health (EY 10564), a Grant-in-Aid for scientific research from the
Ministry of Education of Japan (#09771421), the Roy J. Carver Endowment for Molecular
Ophthalmology, The Glaucoma Research Foundation, Research to Prevent Blindness, and Alcon
Research, Ltd. V.C.S. is an associate investigator of the Howard Hughes Medical Institute.

REFERENCES

1.    Quigley, H. A. (1993) Open-angle glaucoma. N. Engl. J. Med. 328, 1097–1106

2.    Quigley, H. A. (1996) Number of people worldwide with glaucoma. Br. J. Ophthalmol.
      80, 389–393

3.    Steely, H. T., and Clark, A. F. (1999) The use of proteomics in ophthalmic research.
      Pharmacogenomics 1, 267–280

4.    Becker, B., Kolker, A. E., and Roth F. D. (1960) Glaucoma family study. Am. J.
      Ophthalmol. 50, 557–567

5.    Francois, J., and Heintz-De Bree, C. (1966) Personal research on the heredity of chronic
      simple (open-angle) glaucoma. Am. J. Ophthalmol. 62, 1067–1071

6.    Craig, J. E., and Mackey, D. A. (1999) Glaucoma genetics: where are we? Where will we
      go? Curr. Opin. Ophthalmol. 10, 126–134
7.    Sheffield, V. C., Stone, E. M., Alward, W. L. M., Drack, A. V., Johnson, A. T., Streb, L.
      M., and Nichols, B. E. (1993) Genetic linkage of familial open angle glaucoma to
      chromosome 1q21-q31. Nature Genet. 4, 47–50

8.    Richards, J. E., Lichter, P. R., Boehnke, M., et al. (1994) Mapping of a gene for
      autosomal dominant juvenile-onset open-angle glaucoma to chromosome 1q. Am. J.
      Hum. Genet. 54, 62–70

9.    Sunden, S. L. F., Alward, W. L. M., Nichols, B. E., et al. (1996) Fine mapping of the
      autosomal dominant juvenile open angle glaucoma (GLC1A) region and evaluation of
      candidate genes. Genome Res. 6, 862–869

10.   Stoilova, D., Child, A., Trifan, O. C., Crick, R. P., Coakes, R. L., and Sarfarazi, M.
      (1996) Localization of a locus (GLC1B) for adult-onset primary open angle glaucoma to
      the 2cen-q13 region. Genomics 36, 142–150

11.   Wirtz, M. K., Samples, J. R., Kramer, P. L., Rust, P. L., Topinka, J. R., Yount, J., Koler,
      R. D., and Acott, T. S. (1997) Mapping a gene for adult-onset primary open-angle
      glaucoma to chromosome 3q. Am. J. Hum. Genet. 60, 296–304

12.   Trifan, O. C., Traboulsi, E. I., Stoilova, D., Alozie, I., Nguyen, R., Raja, S., and
      Sarfarazi, M. (1998) A third locus (GLC1D) for adult-onset primary open-angle
      glaucoma maps to the 8q23 region. Am. J. Ophthalmol.126, 17–28
13.   Sarfarazi, M., Child, A., Stoilova, D., Brice, G., Desai, T., Trifan, O. D., Poinoosawmy,
      D., and Crick, R. P. (1998) Localization of the fourth locus (GLC1E) for adult-onset
      primary open- angle glaucoma to the 10p15-p14 region. Am. J. Hum. Genet. 62, 641–652

14.   Wirtz, M. K., Samples, J. R., Rust, K., Lie, J., Nordling, L., Schilling, K., Acott, T. S.,
      and Kramer, P. L. (1999) GLC1F, a new primary open-angle glaucoma locus, maps to
      7q35-q36. Arch. Ophthalmol. 117, 237–241

15.   Nishimura, D. Y., Swiderski, R. E., Alward, W. L., et al. (1998) The forkhead
      transcription factor gene FKHL7 is responsible for glaucoma phenotypes which map to
      6p25. Nature Genetics 19, 140–147

16.   Stoilov, I., Akarsu, A. N., and Sarfarazi, M. (1997) Identification of three different
      truncating mutations in cytochrome P4501B1 (CYP1B1) as the principal cause of
      primary congenital glaucoma (Buphthalmos) in families linked to the GLC3A locus on
      chromosome 2p21. Hum. Mol. Genet. 6, 641–647

17.   Akarsu, A. N., Turacli, M. E., Aktan, S. G., Barsoum-Homsy, M., Chevrette, L., Sayli, B.
      S., and Sarfarazi, M. (1996) A second locus (GLC3B) for primary congenital glaucoma
      (Buphthalmos) maps to the 1p36 region. Hum. Mol. Genet. 5, 1199–1203

18.   Anderson, J. S., Pralea, A. M., DelBono, E. A., Haines, J. L., Gorin, M. B., Schuman, J.
      S., Mattox, C. G., and Wiggs, J. L. (1997) A gene responsible for the pigment dispersion
      syndrome maps to chromosone 7q35-q36. Arch. Ophthalmol. 115, 383–388

19.   Stone, E. M., Fingert, J. H., Alward, W. L. M., et al. (1997) Identification of a gene that
      causes primary open angle glaucoma. Science 275, 668–670

20.   Polansky, J. R., Fauss, D. J., Chen, P., Chen, H., Lutjen-Drecoll, E., Johnson, D., Kurtz,
      R. M., Ma, Z-D., Bloom, E., Nguyen, T. D. (1997) Cellular pharmacology and molecular
      biology of the trabecular meshwork inducible glucocorticoid response gene product.
      Ophthalmologia 211, 126–139

21.   Nguyen, T. D., Chen, P., Huang, W. D., Chen, H., Johnson, D., and Polansky, J. R.
      (1998) Gene structure and properties of TIGR, an olfactomedin-related glycoprotein
      cloned from glucocorticoid-induced trabecular meshwork cells. J. Biol. Chem. 273,
      6341–6350

22.   Kubota, R., Noda, S., Wang, Y., et al. (1997) A novel myosin-like protein (myocilin)
      expressed in the connecting cilium of the photoreceptor: molecular cloning, tissue
      expression, and chromosomal mapping. Genomics 41, 360–369

23.   Tamm, E. R., Russell, P., Epstein, D. L., Johnson, D. H., and Piatigorsky, J. (1999)
      Modulation of myocilin/TIGR expression in human trabecular meshwork. Invest.
      Ophthalmol. Vis. Sci. 40, 2577–2582
24.   Clark, A. F. (1995) Glucocorticoids, ocular hypertension, and glaucoma. J. Glaucoma 4,
      354–369

25.   Wordinger, R. J., and Clark, A. F. (1999) Effects of glucocorticoids on the trabecular
      meshwork: towards a better understanding of glaucoma. Prog. Ret. Eye Res.18, 629–667

26.   Fingert, J. H., Clark, A. F., Craig, J. E., Alward, W. L. M., Snibson, G. R., McLaughlin,
      M., Tuttle, L., Mackey, D., Sheffield, V. C., and Stone, E. M. (2000) Evaluation of the
      myocilin (MYOC) glaucoma gene in monkey and human steroid-induced ocular
      hypertension. Invest. Ophthalmol. Vis. Sci. In press

27.   Stamer, W. D., Roberts, B. C., Howell, D. N., and Epstein, D. L. (1998) Isolation,
      culture, and characterization of endothelial cells from Schlemm’s canal. Invest.
      Ophthalmol. Vis. Sci. 39, 1804–1812

28.   Lutjen-Drecoll, E., May, C. A., Polansky, J. R., Johnson, D. H., Bloemendal, H., and
      Nguyen, T. D. (1998) Localization of the stress proteins -crystallin and trabecular
      meshwork inducible glucocorticoid response protein in normal and glaucomatous
      trabecular meshwork. Invest. Ophthalmol. Vis. Sci. 39, 517–525

29.   Fingert, J. H., Ying, L., Swiderski, R. E., Nystuen, A., Arbour, N., Alward, W. L. M.,
      Sheffield, V. C., and Stone, E. M. (1998). Characterization and comparison of the human
      and mouse GLC1A glaucoma genes. Genome Research 8, 337–384

30.   Tomarev, S. I., Tamm, E. R., and Chang, B. (1998) Characterization of the mouse
      Myoc/Tigr gene. Biochem. Biophys. Res. Commun. 245, 887–893

31.   Karali, A., Russell, P., Stefani, F. H., and Tamm, E. R. (2000) Localization of
      myocilin/trabecular meshwork-inducible glucocorticoid response protein in the human
      eye. Invest. Ophthalmol. Vis. Sci. 41, 729–740

32.   Swiderski, R. E., Ross, J. L., Fingert, J. H., Clark, A. F., Alward, W. L. M., Stone, E. M.,
      and Sheffield, V. C. (2000) Localization of MYOC transcripts in human eye and optic
      nerve by in situ hybridization. Invest. Ophthalmol. Vis. Sci. In press

33.   Hernandez, M. R., Igoe, F., and Neufeld, A. H. (1988) Cell culture of the human lamina
      cribrosa. Invest. Ophthalmol. Vis. Sci. 29, 78–89

34.   Clark, A. F., Browder, S., Steely, H. T., Wilson, K., Cantu-Crouch. D., and McCartney,
      M. D. (1995) Cell Biology of the Human Lamina Cribrosa. In Optic Nerve in Glaucoma
      (Drance, S.M., ed), pp. 79–105, Kugler Publications, New York

35.   Kobayashi, S., Vidal, I., Pena, J. D., and Hernandez, M. R. (1997) Expression of neural
      cell adhesion molecule (NCAM) characterizes a subpopulation of type 1 astrocytes in
      human optic nerve head. Glia 20, 262–273
36.   Steely, H. T., English-Wright, S., and Clark, A. F. (2000) Similarity of the trabecular
      meshwork and lamina cribrosa. Exp. Eye Res. 70, 17–30

37.    Wordinger, R. J., Clark, A. F., Agarwal, R., Lambert, W., McNatt, L., Wilson, S. E., Qu,
      Z., and Fung, B. K-K. (1998) Cultured human trabecular meshwork cells express
      functional growth factor receptors. Invest. Ophthalmol. Vis. Sci. 39, 1575–1589

38.   Vaca, L. L. (1985) Laboratory Manual of Histochemistry, pp. 249–263, Raven Press,
      New York

39.   Alward, W. L. M., Fingert, J. H., Coote, M. A., et al. (1998) Clinical features associated
      with mutations in the chromosome 1 open-angle glaucoma gene (GLC1A). N. Engl. J.
      Med. 338, 1022–1027

40.   Fingert, J. H., Heon, E., Liebmann, J. M., et al. (1999) Analysis of myocilin mutations in
      1703 glaucoma patients from five different populations. Hum. Mol. Genet. 8, 899–905

41.   Adam, M. F., Belmouden, A., Binisti, P., Brezin, A. P., Valtot, F., Bechetoille, A.,
      Dascotte, J-C., Copin, B., Gomez, L., Chaventre, A., Bach, J-F., and Garchon, H-J.
      (1997) Recurrent mutations in a single exon encoding the evolutionary conserved
      olfactomedin-homology domain of TIGR in familial open-angle glaucoma. Hum. Mol.
      Genet. 6, 2091–2097

42.   Suzuki, Y., Shirato, S., Taniguchi, F., Ohara, K., Nishimaki, K., and Ohta, S. (1997)
      Mutations in the TIGR gene in familial primary open-angle glaucoma in Japan. Am. J.
      Hum. Genet. 61, 1202–1204

43.   Wordinger, R. J., Lambert, W., Agarwal, R., Talati, M., and Clark, A. F. (2000) Human
      trabecular meshwork cells secrete neurotrophins and express neurotrophin receptors.
      Invest. Ophthalmol. Vis. Sci. In press

44.   Mardin, C. Y., Velten, I., Ozbey, S., Rautenstrauss, B., and Michels-Rautenstrauss, K.
      (1999) A GLC1A gene Gln368Stop mutation in a patient with normal-tension open-angle
      glaucoma. J. Glaucoma 8, 154–156

      Received October 31; accepted December 15, 2000.
Table 1

Myocilin Sequence Variations in Normal Tension Glaucoma Patients and Controls



                                 Japanese-NTG       Japanese       Iowa-    Iowa-
                                                    Controls       NTG     Controls*
                                    N=213            N=102         N=94     N=96
Non-Conservative
(charge/size/polarity)
Thr256Met*                            1                0             0          0
Leu215Pro*                            2                0             0          0
Trp286Arg*                            0                0             1          0
Gly12Arg                              1                2             0          0
Ser203Phe                             0                0             0          1
Gln19His                              1                1             0          0
intron poly 19bp 3' to exon I         1                0             0          0
poly 83 bp 5' to ATG                 NT               NT            NT          22

Conservative
Asp208Glu                             1                0            0           0
Arg76Lys                              23               7            18          18
Lys398Arg                             0                0            0           4
Cys9Ser                               0                0            0           1
Asn73Ser                              0                0            0           1

Synonymous Codon Changes
Leu318Leu                             1                0             0          0
Glu96Glu                              0                1             0          0
Thr88Thr                              0                1             0          0
Tyr347Tyr                             0                0             7          8
Thr285Thr                             0                0             1          1
Thr325Thr                             0                0             1          1
Pro13Pro                              0                0             0          1
Leu159Leu                             0                0             0          1
Thr123Thr                             0                1             0          0
NT = not tested
* These control data have been
previously reported (39)
Fig. 1




Figure 1. Regions of the eye involved in the pathogenesis of glaucoma. Elevated intraocular pressure associated with
glaucoma is generally due to increased aqueous humor outflow resistance at the trabecular meshwork, a tissue located at
the junction of the cornea and the iris. Progressive damage to the optic nerve head and loss of retinal ganglion cells (RGC)
occur in all forms of glaucoma. Figure reprinted from (3) with permission from Ashley Publications Ltd.
Fig. 2




Figure 2A. Expression of MYOC mRNA in human ocular tissues. Total RNA was isolated and myocilin and actin gene
expression was determined by RT-PCR.

M = Molecular standard (100bp ladder)
1 = Trabecular meshwork
2 = Optic nerve
3 = Optic nerve head
4 = Ciliary body
5 = Choroid/RPE
6 = Retina
7 = Iris
8 = Corneal stroma
9 = Corneal endothelium
10 = Lens
11 = Negative control (H2O)


Figure 2B. Expression of MYOC mRNA in optic nerve head cells and tissues. Total RNA was isolated, and myocilin
and actin gene expression was determined by RT-PCR.

M = Size standard (100 bp ladder)
1 = Cultured lamina cribrosa cells
2 = Cultured optic nerve head astrocytes
3 = Optic nerve head tissue
4 = Optic nerve tissue
5 = Trabecular meshwork tissue
6 = Negative control (H20)
Fig. 3




Figure 3. Localization of MYOC transcripts in the lamina cribrosa region of the human optic nerve by in situ
hybridization. (A) MYOC mRNA expression was observed with the antisense probe in the lamina cribrosa, the sclera, the
dura mater, the arachnoid, the pia mater, and the perivascular connective tissue surrounding the central retinal vessels. (B)
No signal was observed using the MYOC sense probe. (C) Myelinization of the optic nerve axons was undetectable in
adjacent sections of the optic nerve following luxol fast blue staining. Dark field microscopy (A,B), bright field
microscopy (C). GS (glial septa); M (meninges); CRA (central retinal artery); CRV (central retinal vein).
Fig. 4




Figure 4. Immunofluorescent staining of myocilin in human optic nerve head tissues and in cells cultured from the
human optic nerve head. (A) Myocilin (green) expression in the ONH; nuclei are orange. Cells aligned horizontally at the
lamina cribrosa stain intensely for myocilin. (B) Immunofluorescent detection of intracellular myocilin (yellow) and actin
(green) expression in cultured human LC cells. (C) Immunofluorescent detection of extracellular myocilin expression
(green) in cultured human LC cells. (D) Immunofluorescent detection of intracellular myocilin (red) and β-COP (green)
expression in cultured human ONH astrocytes. (E) Immunofluorescent detection of intracellular (orange) and extracellular
(green) myocilin expression in cultured human ONH astrocytes.
Fig. 5




Figure 5. 2D-PAGE Western immunoblot analysis of (A) myocilin secreted into the media of cultured human LC cells.
The boxed region highlights the myocilin protein isoforms. (B) Cell-associated myocilin from lysates of cultured human
ONH astrocytes.

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:3
posted:5/21/2011
language:English
pages:17