Docstoc

Fems Microbiology letters

Document Sample
Fems Microbiology letters Powered By Docstoc
					FEMS Microbiology Letters
Volume 245, Issue 1, Pages 1-193 (1 April 2005)




1.   Editorial board • EDITORIAL BOARD
     Pages iii-vi

2.       AvrPtoB: A bacterial type III effector that both elicits and suppresses
         programmed cell death associated with plant immunity • SHORT SURVEY
         Pages 1-8
         Robert B. Abramovitch and Gregory B. Martin

3.       Powdery mildew susceptibility and biotrophic infection strategies • SHORT
         SURVEY
         Pages 9-17
         Ralph Hückelhoven

4.       Genotypic characterization of Burkholderia cenocepacia strains by rep-
         PCR and PCR–RFLP of the fliC gene • SHORT COMMUNICATION
         Pages 19-24
         Sang-Tae Seo and Kenichi Tsuchiya

5.   DNA array analysis of Candida albicans gene expression in response to
     adherence to polystyrene • SHORT COMMUNICATION
     Pages 25-32
     Véronique Marchais, Marie Kempf, Patricia Licznar, Corinne Lefrançois, Jean-
     Philippe Bouchara, Raymond Robert and Jane Cottin

6.       Role of superoxide in the germination of Bacillus anthracis endospores •
         SHORT COMMUNICATION
         Pages 33-38
         Les Baillie, Stephen Hibbs, Pei Tsai, Guan-Liang Cao and Gerald M. Rosen
7.    Meiothermus timidus sp. nov., a new slightly thermophilic yellow-pigmented
      species • SHORT COMMUNICATION
      Pages 39-45
      Ana Luisa Pires, Luciana Albuquerque, Igor Tiago, M. Fernanda Nobre, Nuno
      Empadinhas, António Veríssimo and Milton S. da Costa

8.        The Photorhabdus Pir toxins are similar to a developmentally regulated
          insect protein but show no juvenile hormone esterase activity • SHORT
          COMMUNICATION
          Pages 47-52
          Nicholas Waterfield, Shizuo George Kamita, Bruce D. Hammock and Richard
          ffrench-Constant

9.        DNA methylation modulates Salmonella enterica serovar Typhimurium
          virulence in Caenorhabditis elegans • SHORT COMMUNICATION
          Pages 53-59
          Javin P. Oza, Jimmy B. Yeh and Norbert O. Reich

10.        Allophanate hydrolase of Oleomonas sagaranensis involved in an ATP-
           dependent degradation pathway specific to urea • SHORT
           COMMUNICATION
           Pages 61-65
           Takeshi Kanamori, Norihisa Kanou, Shingo Kusakabe, Haruyuki Atomi and
           Tadayuki Imanaka

11.        A hyperactive, Ca2+-dependent antifreeze protein in an Antarctic
           bacterium • SHORT COMMUNICATION
           Pages 67-72
           Jack A. Gilbert, Peter L. Davies and Johanna Laybourn-Parry

12.        Construction and use of an stx1 transcriptional fusion to gfp • SHORT
           COMMUNICATION
           Pages 73-77
           Abram Aertsen, Rob Van Houdt and Chris W. Michiels

13.        Restriction site polymorphisms in the genes encoding new members of
           group 3 outer membrane protein family of Brucella spp. • SHORT
           COMMUNICATION
           Pages 79-84
           D. García-Yoldi, C.M. Marín and I. López-Goñi

14.        A phylogenetic study of commercial Chinese truffles and their allies:
           Taxonomic implications • SHORT COMMUNICATION
           Pages 85-92
           Li-fang Zhang, Zhu L. Yang and D.S. Song
15.   CTX-M and SHV-12 β-lactamases are the most common extended-spectrum
      enzymes in clinical isolates of Escherichia coli and Klebsiella pneumoniae
      collected from 3 university hospitals within Korea • SHORT COMMUNICATION
      Pages 93-98
      Jungmin Kim, Yu-Mi Lim, Insoo Rheem, Yeonhee Lee, Je-Chul Lee, Sung-Yong
      Seol, Yu-Chul Lee and Dong-Taek Cho

16.       Orbilia querci sp. nov. and its knob-forming nematophagous anamorph •
          SHORT COMMUNICATION
          Pages 99-105
          Bin Liu, Xing-Zhong Liu and Wen-Ying Zhuang

17.       Disruption of a gene encoding glycerol 3-phosphatase from Candida
          albicans impairs intracellular glycerol accumulation-mediated salt-
          tolerance • SHORT COMMUNICATION
          Pages 107-116
          Jinjiang Fan, Malcolm Whiteway and Shi-Hsiang Shen

18.       Direct transformation of a clinical isolate of Candida parapsilosis using a
          dominant selection marker • SHORT COMMUNICATION
          Pages 117-121
          Attila Gácser, Siegfried Salomon and Wilhelm Schäfer

19.       Chemiluminescence of enterococci isolates from freshwater • SHORT
          COMMUNICATION
          Pages 123-129
          Philippe Andre, Catherine Metzger, Sophie Petey, Daniel Muller and
          Dominique J.-M. Vidon

20.       Identification of mature appressorium-enriched transcripts in
          Magnaporthe grisea, the rice blast fungus, using suppression subtractive
          hybridization • SHORT COMMUNICATION
          Pages 131-137
          Jian-Ping Lu, Tong-Bao Liu and Fu-Cheng Lin

21.       Competition among symbiotic cyanobacterial Nostoc strains forming
          artificial associations with rice (Oryza sativa) • SHORT COMMUNICATION
          Pages 139-144
          Malin Nilsson, Ulla Rasmussen and Birgitta Bergman
22.   Diversity of carbazole-degrading bacteria having the car gene cluster:
      Isolation of a novel gram-positive carbazole-degrading bacterium •
      SHORT COMMUNICATION
      Pages 145-153
      Kengo Inoue, Hiroshi Habe, Hisakazu Yamane, Toshio Omori and Hideaki
      Nojiri

23.   Interactive optical trapping shows that confinement is a determinant of
      growth in a mixed yeast culture • SHORT COMMUNICATION
      Pages 155-159
      Nils Arneborg, Henrik Siegumfeldt, Grith H. Andersen, Peter Nissen, Vincent
      R. Daria, Peter John Rodrigo and Jesper Glückstad

24.   Evidence for functional laccases in the acidophilic ascomycete Hortaea
      acidophila and isolation of laccase-specific gene fragments • SHORT
      COMMUNICATION
      Pages 161-168
      Larissa Tetsch, Jutta Bend, Martina Janßen and Udo Hölker

25.   Genetic modification of essential fatty acids biosynthesis in Hansenula
      polymorpha • SHORT COMMUNICATION
      Pages 169-178
      Kobkul Laoteng, Rawisara Ruenwai, Morakot Tanticharoen and Supapon
      Cheevadhanarak

26.   Multilocus sequence typing reveals that Bacillus cereus strains isolated
      from clinical infections have distinct phylogenetic origins • SHORT
      COMMUNICATION
      Pages 179-184
      Margaret Barker, Bishan Thakker and Fergus G. Priest

27.   The prevalence of the Staphylococcus aureus tst gene among community-
      and hospital-acquired strains and isolates from Wegener’s
      Granulomatosis patients • SHORT COMMUNICATION
      Pages 185-189
      Ruud H. Deurenberg, Rutger F. Nieuwenhuis, Christel Driessen, Nancy
      London, Frank R. Stassen, Frank H. van Tiel, Ellen E. Stobberingh and
      Cornelis Vink
28.   A critical step for relative quantification of mRNAs is selecting the
      correct internal controls • CORRESPONDENCE
      Pages 191-192
      Haluk Vahaboglu

29.    Corrigendum to: “Tyramine functions as a toxin in honey bee larvae
       during Varroa-transmitted infection by Melissococcus pluton” [FEMS
       Microbiol. Lett. 234 (2004) 149–154] • ERRATUM
       Page 193
       G. Kanbar, W. Engels, G.J. Nicholson, R. Hertle and G. Winkelmann
                                               MICROBIOLOGY LETTERS

Volume 245, 2005

Chief Editor
J.A. Cole, School of Biosciences, University of Birmingham, Edgbaston, B15 2TT Birmingham, United Kingdom. Tel: +44-121-414 5440; Fax: +44-
121-414 5925; E-mail: fems-letters@bham.ac.uk

MiniReviews Editors
R.I. Aminov, Gut Immunology and Microbiology, Rowett Research Institute, Greenburn Road, Bucksburn, AB21 9SB Aberdeen, Scotland, United
Kingdom. Tel: +44-1224-716 643; Fax: +44-1224-716 687; E-mail: r.aminov@rowett.ac.uk
Phylogeny; Molecular ecology; Antibiotic resistance; Bacterial genetics; Intestinal microbiology and microbial genomics
I. Henderson, Bacterial Pathogenesis and Genomics Unit, Division of Immunity and Infection, The Medical School, University of Birmingham,
Edgbaston, B15 2TT Birmingham, United Kingdom. Tel: +44-121-414 4368; Fax: +44-121-414 3599; E-mail: i.r.henderson@bham.ac.uk
Microbial pathogenesis; Gram-negative bacteria; Infection; Cellular microbiology; Autotransporter proteins; Protein secretion
R.C. Staples, Boyce Thompson Institute, Cornell University, Tower Road, NY 14850 Ithaca, United States of America. Tel: +1-607-257 4889; Fax:
+1-607-254 1242; E-mail: rcs8@cornell.edu
Development, physiology, cell biology and molecular biology of filamentous fungi including fungal pathogens of plants and animals


Editors and their specialist fields
BIOTECHNOLOGY
                                                                       `                              `
S. Casella, Dipartimento di Biotecnologie Agrarie, Agripolis, Universita di Padova, Via dell’Universita 16, 35020 Legnaro Padova, Italy.
Tel: +39-049-827 2922; Fax: +39-049-827 2929; E-mail: sergio.casella@unipd.it
Microbial physiology; Microbial biotechnology; Soil microbiology; Plant-bacteria interaction; Nitrogen metabolism
W. Kneifel, Department of Food Science and Technology, BOKU-University of Natural Resources and Applied Life Sciences, Muthgasse 18,
A-1190 Vienna, Austria. Tel: +43-1-36006-6290; Fax: +43-136006-6266; E-mail: wolfgang.kneifel@boku.ac.at
Food fermentation; Lactic acid bacteria; Microbiological quality criteria of foods; Bacterial strain safety and virulence; product development and
quality assessment of functional foods (pro- and prebiotics); Food safety (hygiene issues)
                          ¨                                     ¨ ¨
D. Mattanovich, Institut fur Angewandte Mikrobiologie, Universitat fur Bodencultur Wien, Muthgasse 18, A-1190 Vienna, Austria. Tel: +43-1-360-
066 569; Fax: +43-1-369 7615; E-mail: diethard.mattanovich@boku.ac.at
Biotechnology, especially recombinant protein production with bacteria; Yeasts and filamentous fungi; Physiology of production strains; Metabolic
engineering


ENVIRONMENTAL MICROBIOLOGY; PLANT-MICROBE INTERACTIONS
E. Baggs, School of Biological Sciences, University of Aberdeen, Cruickshank Building, St Machar Drive, Aberdeen, AB24 3UU, United Kingdom.
Tel: +44 (0)-122-427 2691; Fax: +44 (0)-122-427 2703 ; E-mail: e.baggs@abdn.ac.uk
Soil bacterial ecology, particularly in relation to nitrogen and carbon cycling; Functional genes involved in denitrification; Impacts of soil
management, pollution or climate change
C. Edwards, Division of Microbiology and Genomics, School of Biological Sciences, University of Liverpool, The Biosciences Building, L69 7ZB
Liverpool, United Kingdom. Tel: +44-151 795 4573; Fax: +44-151 795 4410; E-mail: kj26@liv.ac.uk
Molecular ecology of micro-organisms; Novel methods for monitoring bacterial activity and biodiversity; Biogeochemical cycles (particularly
methane cycling bacteria); Bioremediation and environmental biotechnology; Extreme environments; Molecular methods
H-P.E. Kohler, Environmental Microbiology and Molecular Ecotoxicology, EAWAG, Ueberlandstrasse 133, CH-8600 Duebendorf, Switzerland.
Tel: +41-1-823 5521; Fax: +41-1-823 5547; E-mail: kohler@eawag.ch
Microbial degradation and environmental fate of organic pollutants; Biochemistry of mono- and dioxygenases; Microbial transformation of chiral
compounds
Y. Okon, Dept. of Plant Pathology & Microbiology, Faculty of Agricultural, Food & Environmental Quality Sciences, The Hebrew University of
Jerusalem, The Rehovot Campus, 76100 Rehovot, Israel. Tel: 972-8-948 9216; Fax: 972-8-946 6794; E-mail: okon@agri.huji.ac.il
Plant growth promoting bacterial-rhizosphere associations; Symbiotic and non-symbiotic biological nitrogen fixation; Physiology and ecology of
Azospirillum as a model system for rhizosphere studies
A. Oren, The Institute of Life Sciences, The Hebrew University of Jerusalem, 91904 Jerusalem, Israel. Tel: +972-2-658 4951; Fax: +972-2-652
8008; E-mail: orena@shum.cc.huji.ac.il
Microbial ecology and physiology; Halophilic micro-organisms; Photosynthetic prokaryotes


EUKARYOTIC CELLS
L.F. Bisson, Dept of Viticulture and Enology, 1311 Haring Hall, University of California at Davis, One Shields Avenue, CA 95616-8749 Davis,
United States of America. Tel: +1-530-752 1717; Fax: +1-530-752 0382; E-mail: lfbisson@ucdavis.edu
Molecular biology, genetics, biochemistry, physiology, ecology and applications of yeasts
R. Fischer, Applied Microbiology, University of Karlsruhe, Hertzstrasse 16, D-76187 Karlsruhe, Germany. Tel: 49-721-608-4630; Fax: 49-721-
608-8932; E-mail: reinhard.fischer@bio.uka.de
Cellular and molecular biology of filamentous fungi, especially polarized growth and development; Cytoskeleton, molecular motors and organelle
movement; Spore formation; Aspergillus nidulans
G.M. Gadd, Division of Environmental and Applied Biology, Biological Sciences Institute, School of Life Sciences, University of Dundee, DD1 4HN
Dundee, Scotland, United Kingdom. Tel: +44-1382-344 765; Fax: +44-1382-348 216; E-mail: g.m.gadd@dundee.ac.uk
Yeast and fungal physiology, ecology and differentiation; Metal-microbe interactions; Heavy metals and toxicology
N. Gunde-Cimerman, Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna Pot 111, 1000 Ljubljana, Slovenia. Tel: +386-1-
423 3388; Fax: +386-1-257 3390; E-mail: nina.gunde-cimerman@bf.uni-lj.si
Physiology, ecology and biodiversity of fungi, especially in extreme (hypersaline and cold) environments; Biotechnologically important fungi and
production of extracellular enzymes and secondary metabolites; Pathogenic fungi and medicinal mushrooms; Culture collections and strain
preservation.
                         ´ ´                                               ´
M. Jacquet, Institut de Genetique et Microbiologie, UMR8621 CNRS, Universite Paris-Sud, Bat 400, 91405 Orsay Cedex, France. Tel: +33-16915
7963; Fax: +33-16915 4629; E-mail: michel.jacquet@igmors.u-psud.fr
Yeast molecular and cell biology; Signal transduction in fungus
                                                                                ´
B. Paul, Laboratoire des Sciences de la Vigne, Institut Jules Guyot, Universite de Bourgogne, BP 27877, 21078 Dijon, France. Tel: +33-380-
396326; Fax: +33-380-396326; E-mail: bernard.paul@u-bourgogne.fr
Mycology, in particular biological control of plant diseases; The genera Botrytis and Pythium; Aquatic phycomycetes
B.A. Prior, Department of Microbiology, University of Stellenbosch, Private Bag XI, 7602 Matieland, South Africa. Tel: +27-21-808 5856; Fax: +27-
21-808 5846; E-mail: bap@sun.ac.za
Stress responses by yeast to the environment; Microbial solute channels; Fungal biotechnology; Hemicellulose biodegradation by fungi
C. Remacle, Genetics of Microorganisms, Department of Life Sciences B22, University of Liege, Bld du Rectorat 27, B-4000 Liege, Belgium.
Tel: +32-4366 3812; Fax: +32-4366 3840; E-mail: c.remacle@ulg.ac.be
Genetics and molecular biology of lower eukaryotes with emphasis on cell organelles; The function and biogenesis of mitochondria and
chloroplasts
P. Schaap, Division of Cell and Developmental Biology, University of Dundee, MSI/WTB Complex, Dow Street, Dundee DD1 5EH, UK. Tel: +44
1382 348 078; Fax: +44 1382 345 386; E-mail: p.schaap@dundee.ac.uk
Cellular and developmental biology of social amoebae; Signal transduction, especially the role of cyclic nucleotide signalling pathways in the
regulation of developmental decisions, sporulation and responses to stress; Evolutionary relationships between eukaryote cyclic nucleotide
signalling proteins and their prokaryote ancestors
D.P. Wakelin, High Street (Kirtlands), WR12 7AL Broadway, Worcestershire, United Kingdom. Tel: +44-1386-852 747; E-mail: DP2716@aol.com
Parasitology; Helminthology; Host immunity; Intestinal immunity; Intestinal inflammation; Immunoepidemiology; Genetics of resistance



GENETICS AND MOLECULAR BIOLOGY
R.S. Buxton, Division of Mycobacterial Research, National Institute for Medical Research, The Ridgeway, Mill Hill, NW7 1AA London,
United Kingdom. Tel: 020 8816 2225; Fax: 020 8906 4477; E-mail: rbuxton@nimr.mrc.ac.uk
Mycobacteria, especially pathogenesis; Microbial genetics and molecular biology; Gene regulation; Two-component signal transduction
                           ¨                                                             ¨
K. Forchhammer, Institut fur Mikrobiologie und Molekularbiologie, Justus-Liebig-Universitat, Heinrich-Buff-Ring 26-32, D-35392 Giessen,
Germany. Tel: +49-641-9935 545; Fax: +49-641-9935 549; E-mail: Karl.Forchhammer@mikro.bio.uni-giessen.de
Physiology and molecular genetics of cyanobacteria; Microbial nitrogen control; Bacterial signal transduction through serine/threonine phos-
phorylation/dephosphorylation
R.P. Gunsalus, Department of Microbiology and Molecular Genetics, 1602 MSB, University of California (UCLA), CA 90095 Los Angeles, United
States of America. Tel: +1-310-206 8201; Fax: +1-310-206 5231; E-mail: robg@microbio.ucla.edu
Molecular genetics; Microbial physiology; Methanogenesis; Anaerobic cell function; Electron transport; Metabolism
D.J. Jamieson, School of Life Sciences, Heriot-Watt University, Riccarton, EH14 4AS Edinburgh, Scotland, United Kingdom. Tel: +44-131-451
3644; Fax: +44-131-451 3009; E-mail: d.j.jamieson@hw.ac.uk
Molecular biology; Genetics and biochemistry of yeasts
           ´                            ´
A. Klier, Dept des Biotechnologies, Unite de Biochemie Microbienne, Institut Pasteur, 25 Rue du Docteur Roux, 75724 Paris, Cedex 15, France.
Tel: +33-1-44 27 6995; Fax: +33-1-44 27 6995; E-mail: aklier@pasteur.fr
Molecular biology, genetics, biochemistry and physiology of gram-positive bacteria
E. Ricca, Dipartimento di Fisiologia Generale ed Ambientale, Universita’ Federico II, Via Mezzocannone 16, 80134 Napoli, Italy. Tel: +39-81-253
4636; Fax: +39-81-551 4437; E-mail: ericca@cds.unina.it
Bacterial differentiation; Sporulation; Gene expression in gram-positives; Bacteria as vaccine vehicles and as probiotics; Display of molecules on
bacterial surfaces
                                               ¨
W. Schumann, Institute of Genetics, Universitat Bayreuth, D-95440 Bayreuth, Germany. Tel: +49-921-552 708; Fax: +49-921-552 710; E-mail:
wschumann@uni-bayreuth.de
Bacterial genetics, especially stress genes; Bacteriophages; Transposition
M.R. Soria, Professor of Biochemistry and Molecular Biology, Department of Experimental & Clinical Medicine "G. Salvatore", Magna Graecia
University School of Medicine, Via T.Campanella 115, 88100 Catanzaro, Italy. Tel: +39-961-770 880; Fax: +39-961-777 435;
E-mail: soria@unicz.it
Functional genomics of host-parasite interactions; Regulation of gene expression; Angiogenesis
GENOMICS AND BIOINFORMATICS
M.Y. Galperin, National Center for Biotechnology Information, National Library of Medicine, National Institute of Health, Building 38A,
Room 507, Maryland 20894 Bethesda, United States of America. Tel: +1-301-435 5910; Fax: +1-301-435-7794;
E-mail: galperin@ncbi.nlm.nih.gov
Microbial genomics; Bio-informatics; Modelling of metabolic pathways; Evolution of metabolism
O.P. Kuipers, Dept. for Genetics, Rijksuniversiteit Groningen, Kerklaan 30, 9751 HN Laren, Netherlands. Tel: +31-50-3632093/2092;
Fax: +31-5-3632348; E-mail: o.p.kuipers@biol.rug.nl
Genetics and biotechnological applications of gram-positive bacteria (lactid acid bacteria, bacilli); Functional genomics; Bacteriocins;
Protein engineering


PATHOGENICITY INCLUDING VETERINARY MICROBIOLOGY
P.W. Andrew, Department of Infection, Immunity and Inflammation, University of Leicester, PO Box 138 (University Road), LE1 9HN Leicester,
United Kingdom. Tel: +44-116-252 2941; Fax: +44-116-252 5030; E-mail: pwa@le.ac.uk
Microbial pathogenicity; Intracellular parasites
M.J. Bidochka, Department of Biological Sciences, Brock University, Glenridge Ave 500, ON L2S 3A1 St. Catharines, Canada. Tel: +1-905-688
5550 ext 3392; Fax: +1-905-688 1855; E-mail: bidochka@spartan.ac.brocku.ca
Microbial pathogenicity, especially pathogenic fungi; Microbial population genetics and phylogeography
T.H. Birkbeck, Division of Infection and Immunity, Institute of Biomedical & Life Sciences, Joseph Black Building, University of Glasgow,
G12 8QQ Glasgow, Scotland, United Kingdom. Tel: +44-141-330 5843; Fax: +44-141-330 4600; E-mail: h.birkbeck@bio.gla.ac.uk
Microbial toxins and pathogenicity in human and animal diseases; Immunochemistry; Fish disease
H.B. Deising, Faculty of Agriculture, Phytopathology and Plant Protection, Martin-Luther University Halle-Wittenberg, Ludwig-Wucherer Strasse 2,
D-06099 Halle, Germany. Tel: +49-345-552 2660; Fax: +49-345-552 7120; E-mail: holger.deising@landw.uni-halle.de
Fungal pathogenicity and virulence; Fungus-plant interactions, especially biochemistry and molecular biology of fungus-plant interactions; Fungal
morphogenesis, especially infection structure differentiation; Fungicide resistance
R. Delahay, Institute of Infection, Immunity & Inflammation, University of Nottingham, Floor C, West Block, Queen’s Medical Centre, Nottingham,
NG7 2UH. Tel: +44 (0) 115 924 9924 Ext 42449; Fax: +44 (0) 115 970 9923; E-mail: rob.delahay@nottingham.ac.uk
Microbial pathogenicity, especially enteric pathogens; enteropathogenic Escherichia coli; Helicobacter; Host-pathogen interaction; Bacterial
virulence secretion systems (Type III and IV in particular); Protein–protein interaction
J.-I. Flock, Department of Laboratory Medicine, Division of Clinical Bacteriology, Karolinska Institutet, Huddinge University Hospital F82, SE-141
86 Stockholm, Sweden. Tel: +46-8-5858 1169; Fax: +46-8-711 3918; Email: jan-ingmar.flock@labmed.ki.se
Genetics and virulence factors of Staphylococci; Adherence of gram-positive bacteria; Experimental infection models in animals;
Function of antibodies against surface structures of gram-positive bacteria; Microbial immunity and vaccines against gram-positive bacteria
                                                          ¨ ¨                                          ¨
K. Hantke, Mikrobiologie/Membranphysiologie, Universitat Tubingen, Auf der Morgenstelle 28, D-72076 Tubingen, Germany. Tel: +49-7071-297
4645; Fax: +49-7071-295 843; E-mail: hantke@uni-tuebingen.de
Bacterial metal transport and regulation, especially iron, manganese and zinc; Functions of outer membrane and periplasmic proteins of gram-
negative bacteria; Colicins and microcins; Pathogenicity and iron
J.M. Ketley, Department of Genetics, University of Leicester, University Road, LE1 7RH Leicester, United Kingdom. Tel: +44-116-252 3434; Fax:
+44-116-252 3378; E-mail: ket@leicester.ac.uk
Vibrio cholerae; Campylobacters; Pathogenic enteric bacteria; Pathogenesis; Microbial genomics; Gene regulation
R.Y.C. Lo, Department of Microbiology, University of Guelph, ON, N1G 2W1 Guelph, Canada. Tel: +1-519-824 4120; Fax: +1-519-837 1802;
E-mail: rlo@uoguelph.ca
Microbial pathogenicity; Bacterial genetics; Physiology and biochemistry
M. Mitsuyama, Department of Microbiology, Graduate School of Medicine (Rm203, Bldg D), Kyoto University, Yoshida-Konoe-cho, Sakyo-ku,
606-8501 Kyoto, Japan. Tel: +81-75-753 4441; Fax: +81-75-753 4446; E-mail: mituyama@mb.med.kyoto-u.ac.jp
Bacterial pathogenicity; Medical bacteriology; Intracellular bacteria; Immune response to infection
M. Schembri, School of Molecular and Microbial Sciences, University of Queensland, Building 76, QLD 4072 Brisbane, Australia. Tel: +61-7-3365
3306; Fax: +61-7-3365 4699; E-mail: m.schembri@uq.edu.au
Microbial pathogenicity, especially gram-negative bacteria; Bacterial adhesins; Biofilms; Bacterial gene regulation and DNA microarrays; Bacterial
display systems; Vaccine development
                                                                                                                                ¨
S. Schwarz, Molecular Microbiology and Diagnostics, Institute for Animal Breeding, Federal Agricultural Research Centre (FAL), Holtystr. 10,
D-31535 Neustadt-Mariensee, Germany. Tel: +49-5034-871-241; Fax: +49-5034-871-246; E-mail: stefan.schwarz@fal.de
Molecular biology of Staphylococci; Antibiotic resistance mechanisms; Mobile genetic elements and horizontal gene transfer; Pathogenicity;
Molecular epidemiology; Gram-positive cocci; Pasteurellaceae (Pasteurella, Mannheimia, Actinobacillus) and Enterobacteriaceae (Salmonella,
Escherichia), Bordetella
S. Smith, Department of Microbiology, Moyne Institute, Trinity College, 2 Dublin, Ireland. Tel: +353-1-6083713; Fax: +353-1-6799294;
E-mail: sgsmith@tcd.ie
Microbial pathogenicity; Gram-negative bacteria; Bacterial adhesion and invasion; Outer membrane proteins; Fimbriae and pili; Proteomics and
genomics; Bacterial gene regulation
A.H.M. van Vliet, Department of Gastroenterology and Hepatology (L-459), Erasmus MC, Dr. Molewaterplein 40, 3015 GD Rotterdam,
Netherlands. Tel: +31-10-463 5944; Fax: +31-10-463 2793; E-mail: a.h.m.vanvliet@erasmusmc.nl
Microbial pathogenesis and genetics, especially of Helicobacter and Campylobacter; Bacterial gene regulation; Microbial metal metabolism
W. Wade, Department of Microbiology, Dental Institute, King’s College London, Guy’s Hospital, Floor 28, Guy’s Tower, SE1 9RT London,
United Kingdom. Tel: +44-20-7188 3872; Fax: +44-20-7188 3871; E-mail: william.wade@kcl.ac.uk
Clinical microbiology; Oral microbiology; Molecular microbial ecology; Molecular diagnostics; Bacterial systematics; Anaerobic bacteria
P.H. Williams, Department of Genetics, University of Leicester, University Road, LE1 7RH Leicester, United Kingdom. Tel: +44 116 252 3436;
Fax: +44 116 252 3378; E-mail: phw2@le.ac.uk
Molecular genetic and cell biological analysis of the pathogenesis of infectious diseases, especially the role of microbial iron uptake, both in
infection and in the survival, persistence and resuscitation of severely stressed micro-organisms; Virulence mechanisms of enteric pathogens

PHYSIOLOGY AND BIOCHEMISTRY
                          ¨                                        ¨
J.R. Andreesen, Institut fur Mikrobiologie, Martin-Luther-Universitat Halle-Wittenberg, Kurt-Mothes-Straße 3, D-06120 Halle, Germany. Tel: +49-
345-552 6350; Fax: +49-345-552 7010; E-mail: j.andreesen@mikrobiologie.uni-halle.de
Physiology and biochemistry of anaerobic bacteria; Metal(oids) involved in biochemical reactions (Mo, W, Se, Te, Zn) but not transport
R.A. Bonomo, Infectious Diseases Section, Louis Stokes Cleveland Veterans Affairs Medical Center, East Blvd 10701, Ohio 44106 Cleveland,
United States of America. Tel: +1-216-791-3800x4399; Fax: +1-216-231-3482; E-mail: robert.bonomo@med.va.gov
Beta-lactamases; Resistance to beta-lactams; Mechanisms of antimicrobial resistance
R.A. Burne, Department of Oral Biology, College of Dentistry (Room D5-18), University of Florida, 1600 S.W. Archer Road, FL 32610 Gainesville,
United States of America. Tel: +1-352-392 4370; Fax: +1-352-392 7357; E-mail: rburne@dental.ufl.edu
Oral microbiology; Environmental regulation of bacterial gene expression; Stress tolerance; Biofilms; Streptococci
J.A. Cole, School of Biosciences, University of Birmingham, Edgbaston, B15 2TT Birmingham, United Kingdom. Tel: +44-121-414 5440; Fax: +44-
121-414 5925; E-mail: J.A.Cole@bham.ac.uk
Microbial physiology, especially the regulation of anaerobic metabolism of enteric bacteria; Nitrate and nitrite reduction by bacteria; Microbial
pathogenicity of gonococci; Bacterial cytochrome biosynthesis and electronic transfer pathways
                   ¨                                                                           ¨
C. Dahl, Institut fur Mikrobiologie und Biotechnologie, Rheinische Friedrich-Wilhelms Universitat Bonn, Meckenheimer Allee 168, vD-53115 Bonn,
Germany. Tel: +49-228-732 119; Fax: +49-228-737 576; E-mail: ChDahl@uni-bonn.de
Physiology, biochemistry, molecular biology and genetics of anoxygenic phototropic bacteria; Microbial sulfur metabolism; Electron transport
A.M. George, Dept of Cell and Molecular Biology, University of Technology, Sydney, PO Box 123 (Broadway), NSW 2007 Sydney, Australia.
Tel: +61-2-9514 4158; Fax: +61-2-9514 4003; E-mail: tony.george@uts.edu.au
Molecular biology and biochemistry of multidrug resistance in bacteria and higher organisms; Bacterial resistance to antibiotics; Membrane
transport; ABC transporters
                              ´                    ´                    ´           ´
J.A. Gil, Dept de Microbiologıa, Facultad de Biologıa, Universidad de Leon, 24071 Leon, Spain. Tel: +34-987-291 503; Fax: +34-987-291 479;
E-mail: degjgs@unileon.es
Antibiotic biosynthesis and resistance; Actinomycetes and corynebacteria
D. Jahn, Institute for Microbiology, Technical University of Braunschweig, Spielmannstr. 7, 38106 Braunschweig, Germany. Tel: +49-531-391
5804; Fax: +49-531-391 5854; E-mail: d.jahn@tu-bs.de
Bacterial biochemistry and bioenergetics; Enzyme mechanisms; Tetrapyrroles; Control of bacterial gene expression
W.J. Mitchell, School of Life Sciences, Heriot-Watt University, Riccarton, EH14 4AS Edinburgh, Scotland, United Kingdom. Tel: +44-131-451
3459; Fax: +44-131-451 3009; E-mail: w.j.mitchell@hw.ac.uk
Regulation of bacterial gene expression; Solute transport, particularly the bacterial phosphotransferase system
S. Mongkolsuk, Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, 10210 Bangkok, Thailand. Tel: (662) 574-0623 ext. 3816;
Fax: (662) 574-2027; E-mail: skorn@tubtim.cri.or.th
Bacterial biochemistry, physiology and genetics of stresses and metals; Regulation of gene expression; Environmental microbiology; Plant-
microbe interactions
M. Moracci, Institute of Protein Biochemistry -CNR, Via P. Castellino 111, 80131 Naples, Italy. Tel: +39 081 613 2271; Fax: +39 081 613 2277;
E-mail: m.moracci@ibp.cnr.it
Physiology and biochemistry of hyperthermophilic Bacteria and Archaea; Control of gene expression in thermophilic Archaea; Biotechnological
applications of enzymes from extremophiles
                               ´                                                         ´                              ´
S. Rimsky, Enzymologie et Cinetique Structurale, LBPA, UMR 8113, Ecole Normale Superieure de Cachan/CNRS, Universite Paris XI, Avenue du
   ´
President Wilson 61, 94235 Cachan Cedex, France. Tel: +33-1-4740 7676; Fax: +33-1-4740 7684; E-mail: Sylvie.rimsky@lbpa.ens-cachan.fr
Protein-DNA interaction; Bacterial chromatin organisation; Protein-protein interaction (non-membrane); DNA chemical/enzymatic reactivity
S. Silver, Department of Microbiology and Immunology, Room E-704, University of Illinois, S. Wolcott Avenue 835, IL-60612-7344 Chicago, United
States of America. Tel: +1-312-996 9608; Fax: +1-312-996 6415; E-mail: simon@uic.edu
Bacterial membrane transport; Molecular genetics and biochemistry; Metal-resistance mechanisms; Gram-positive bacteria and pseudomonads
J. Simon, School of Biological Sciences, University of East Anglia, NR4 7TJ Norwich, United Kingdom. Tel: +44-1603-593 250; Fax: +44-1603-592
250; E-mail: j.simon@uea.ac.uk
Bacterial metabolism and bioenergetics, especially anaerobic respiration; Maturation of electron transport enzymes
         ¨                ¨                                                    ¨                         ¨                            ¨
A. Steinbuchel, Institut fur Molekulare Mikrobiologie und Biotechnologie, Westfalische Wilhelms-Universitat, Correnstraße 3, D-48149 Munster,
Germany. Tel: +49-251-833 9821; Fax: +49-251-833 8388; E-mail: steinbu@uni-muenster.de
Metabolism and biotechnological production of biopolymers (Polyesters, Cyanophycin and other poly(amino acids)); Microbial degradation of
rubber
B. Ward, ICMB, Darwin Building, Kings Buildings, University of Edinburgh, EH9 3JR Edinburgh, Scotland, United Kingdom. Tel: +44-131 650
5370; E-mail: b.ward@ed.ac.uk
Microbial physiology of gram-negative bacteria important in medicine or food; Campylobacter jejuni
A. Yokota, Laboratory of Microbial Resources and Ecology, Graduate School of Agriculture, Hokkaido University, 060-8589 Sapporo, Japan.
Tel: +81-11-706 2501; Fax: +81-11-706 4961; E-mail: yokota@chem.agr.hokudai.ac.jp
Energy metabolism in gram-positive bacteria and Escherichia coli; Lactic acid bacteria and bifidobacteria as probiotics
                                                FEMS Microbiology Letters 245 (2005) 1–8
                                                                                                                    www.fems-microbiology.org

                                                                 MiniReview

     AvrPtoB: A bacterial type III effector that both elicits and
  suppresses programmed cell death associated with plant immunity
                                     Robert B. Abramovitch, Gregory B. Martin                              *

                        Boyce Thompson Institute for Plant Research, Cornell University, Tower Rd., Ithaca, NY 14853, USA
                                  Department of Plant Pathology, Cornell University, Ithaca, NY 14853, USA

                         Received 24 January 2005; received in revised form 20 February 2005; accepted 21 February 2005

                                                       First published online 14 March 2005

                                                               Edited by R.C. Staples




Abstract

   Pseudomonas syringae pv. tomato DC3000 is a model pathogen for studying the molecular basis of plant immunity and disease
susceptibility in tomato and Arabidopsis. DC3000 uses a type III secretion system to inject effector proteins into the plant cell. Type
III effectors are thought to promote bacterial virulence by suppressing plant defenses and enhancing access to nutrients trapped in
the plant cell. The AvrPtoB type III effector elicits immunity-associated programmed cell death (PCD) when expressed in tomato
plants carrying the Pto resistance protein. However, in the absence of Pto, AvrPtoB functions to suppress PCD and immunity in
tomato. Here, we review current research examining the molecular basis of AvrPtoB-mediated elicitation and suppression of plant
PCD. In addition, the ‘‘trump model’’ is proposed to explain how resistance proteins successfully elicit immunity-associated PCD in
response to effectors that suppress PCD.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Plant immunity; Plant disease susceptibility; Programmed cell death; Bacterial pathogenesis; Type III secretion system




1. Introduction                                                                 Plants have evolved mechanisms to detect the pres-
                                                                             ence of bacterial pathogens and activate defenses that
   Plant pathogenic bacteria must overcome plant de-                         delay or arrest disease formation. For example, plants
fenses and gain access to nutrients trapped inside the                       can activate basal defenses upon detection of bacterial
plant cell in order to colonize the host, multiply and                       flagellin or lipopolysacharrides [3–5]. Basal defenses,
cause disease. Many phytobacteria require a type III                         such as cell wall reinforcements and expression of de-
secretion system (TTSS) to mount a successful attack                         fense-associated proteins, are slowly induced and func-
on a host. The TTSS functions like a syringe and is                          tion to delay pathogen growth; however, basal defenses
used by phytobacteria to inject virulence proteins into                      do not completely prevent disease formation. Plants
the host cell. These type III effector proteins are be-                       have also evolved intracellular resistance (R) proteins
lieved to promote disease by altering the normal phys-                       that can detect the presence of specific type III effectors
iology of the plant to benefit the pathogen (reviewed                         inside the plant cell [6]. Pathogen recognition by R pro-
in [1,2]).                                                                   teins quickly activates defenses and results in plant
                                                                             immunity. A key phenomenon associated with R pro-
 *
     Corresponding author. Tel.: +1 607 254 1208; fax: +1 607 255 6695.      tein-mediated immunity is the hypersensitive response
     E-mail address: gbm7@cornell.edu (G.B. Martin).                         (HR), a process involving rapidly induced programmed

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.025
2                           R.B. Abramovitch, G.B. Martin / FEMS Microbiology Letters 245 (2005) 1–8

cell death (PCD) in cells near the site of infection [7].          that these effectors are likely the only elicitors of Pto-
HR-based PCD is believed to limit pathogen spread                  mediated immunity in tomato [13].
by killing the pathogen along with infected plant cells.              AvrPtoB belongs to a gene family whose founding
Together, basal and HR-based defenses are a formida-               member is VirPphA. VirPphA was identified as a viru-
ble barrier to bacterial pathogenesis and present a                lence factor residing on a large Pph plasmid [20].
strong selective pressure for pathogens to evolve mech-            Although AvrPtoB and VirPphA share approximately
anisms to avoid or suppress these defenses.                        51% sequence identity, the regions of identity are dis-
   Pseudomonas syringae pv. tomato DC3000                          persed throughout the proteins, suggesting AvrPtoB
(DC3000) causes bacterial speck disease on tomato                  and VirPphA are related but divergent proteins [21].
and Arabidopsis and is the subject of intensive study              VirPphA homologs identified from P. savastanoi pv.
as a model bacterial plant pathogen. The DC3000 gen-               savastanoi and P. syringae pv. glycinea have 98% and
ome has been sequenced and over 30 type III effectors               95% amino acid sequence identity to VirpPhA, respec-
have been identified [8,9]. DC3000 elicits HR-based                 tively [21]. In contrast, several AvrPtoB homologs have
immunity when inoculated on tomato plants carrying                 been identified from P. syringae strains that have 64–
the Pto R protein. Pto is a serine/threonine protein ki-           67% amino acid sequence identity to AvrPtoB and only
nase that elicits PCD and immunity when it interacts               24–30% identity with VirPphA (N. Lin and G. Martin,
with the DC3000 effector proteins AvrPto or AvrPtoB                 unpublished data). Therefore, AvrPtoB and VirPphA
[10]. Pto also requires a second protein, Prf, to signal           belong to distinct subgroups of proteins and may not
HR-based PCD [11]. On tomato plants lacking Pto,                   be homologous proteins. Indeed, differing HR-eliciting
however, both AvrPto and AvrPtoB promote bacterial                 activities for VirPphA and AvrPtoB have been observed
growth [12–14] through mechanisms that have only re-               [21]. Other distinct members of this gene family exist,
cently been identified. For example, AvrPto suppresses              including the P. syringae pv. maculicola (Pma) effectors
cell wall-based defenses in Arabidopsis [15], and Avr-             HopPmaL and HolPmaN [22]. The HopPmaL and
PtoB promotes DC3000 virulence by suppressing                      HolPmaN effectors are truncated AvrPtoB-like proteins
HR-based PCD [14]. The purpose of this review is                   with sequences similar to the N-terminal 354 and 156
to examine the AvrPtoB effector as an elicitor of                   acids of AvrPtoB, respectively. Recent phylogenetic
HR-based PCD and as a prototypical effector with cell               analyses of AvrPtoB-like proteins have led to the pro-
death suppressor (CDS) activity. Other potential viru-             posal of the HopAB gene family [23]. The HopAB fam-
lence functions of AvrPtoB will also be discussed.                 ily includes three subgroups of effectors, with proteins
Additionally, we will propose a model examining                    related to VirPphA, AvrPtoB or HopPmaL belonging
how plants successfully elicit HR-based PCD in re-                 to the HopAB1, HopAB2 and HopAB3 effector sub-
sponse to effectors with CDS activity.                              groups, respectively [23].
                                                                      Substantial differences exist between the AvrPtoB
                                                                   and AvrPto proteins. For example, AvrPtoB has a pre-
2. AvrPtoB elicits Pto-mediated programmed cell death              dicted mass three times that of AvrPto and the proteins
and immunity                                                       only share limited sequence similarity [19]. The Avr-
                                                                   PtoB–Pto interaction, however, shows striking similari-
    The search for AvrPtoB was instigated by early stud-           ties to the AvrPto–Pto interaction. For example, in a
ies of AvrPto in P. syringae. It was observed that a               yeast two-hybrid system, interaction of Pto with both
P. syringae strain with avrPto deleted from its genome             AvrPto and AvrPtoB is dependent on Pto residue thre-
still elicited HR-based immunity on Pto-expressing to-             onine 204 [19,24]. Further mutagenesis studies of Pto
mato plants [16], suggesting that P. syringae might carry          have demonstrated nearly identical interaction patterns
a second elicitor that is recognized by Pto. Because Avr-          between Pto and AvrPto or AvrPtoB [25]. Interestingly,
Pto and Pto interact in a yeast two-hybrid system                  two Pto mutations were identified that abolished the
[17,18], it was reasoned that the unidentified elicitor             AvrPtoB–Pto interaction, but not the AvrPto–Pto inter-
might also interact with Pto. To isolate AvrPtoB, a                action, indicating that minor differences might exist be-
cross-kingdom yeast two-hybrid screen was undertaken,              tween how these effectors dock on Pto [25]. Another
using a Pto bait protein to screen multiple DC3000 prey            interesting similarity between AvrPto and AvrPtoB is
libraries [19]. From this screen, an interacting protein           the conservation of the GINP motif in both proteins.
was identified that showed sequence similarity to the               Mutations in the AvrPto GINP motif disrupt the Avr-
P. syringae pv. phaseolicola (Pph) type III effector                Pto–Pto interaction [12]; in particular, AvrPto residue
VirPphA. This VirPphA-like protein elicited Pto- and               isoleucine 96 is critical for the AvrPto–Pto interaction
Prf-dependent HR-based PCD in tomato leaves, demon-                [26]. The solution structure of AvrPto was recently
strating the interactor was AvrPtoB. Deletion of both              solved and revealed that the GINP motif lies in a solvent
avrPto and avrPtoB from DC3000 results in a virulent               exposed X loop that is well suited for interacting with
pathogen that no longer elicits host immunity, showing             Pto [26]. Mutations introduced into the AvrPtoB GINP
                                  R.B. Abramovitch, G.B. Martin / FEMS Microbiology Letters 245 (2005) 1–8                         3

     1                              308 GINP             509 553          is conserved in N. benthamiana [28–30]. Therefore, it was
                                                                          expected that transient co-expression of AvrPtoB and
   N-      Pto/Rsb-mediated PCD         Cell death suppression -C         Pto in N. benthamiana would also result in HR-based
                                                                          PCD. However, cell death was not observed when Avr-
Fig. 1. AvrPtoB is a modular protein. The N-terminus of AvrPtoB,          PtoB and Pto were co-expressed in N. benthamiana
from amino acids 1–308, is sufficient for interaction with Pto in a yeast
two-hybrid system, and for eliciting Pto- or Rsb-mediated HR-based        leaves. Because VirPphA was known to target HR-based
PCD in tomato and Nicotiana benthamiana. The C-terminus, from             PCD, it was hypothesized that Pto recognized AvrPtoB
amino acids 308–553, is sufficient to suppress HR-based PCD. The            in N. benthamiana, but that AvrPtoB suppressed the
GINP motif from amino acids G325-P328 is not required for the             PCD signaled by Pto. Several experiments supported this
AvrPtoB–Pto interaction, however, in the context of intact AvrPtoB it     hypothesis. For example, PCD elicited by a constitutively
is required to elicit Pto-mediated HR. The final 44 amino acids of
AvrPtoB, indicated by the arrow, are necessary for AvrPtoB cell death     active mutant of Pto, Pto(Y207D) [31], was suppressed
suppression in tomato, and when deleted, truncated AvrPtoB elicits        by co-expression of AvrPtoB. AvrPtoB also suppressed
both Pto- and Rsb-mediated HR-based PCD.                                  PCD elicited by the Cf9 resistance protein [32] and the
                                                                          pro-apoptotic mouse protein Bax [33], indicating that
                                                                          AvrPtoB did not specifically target Pto-mediated PCD,
loop also interfere with the AvrPtoB–Pto interaction                      but acted as a general cell death suppressor. AvrPtoB also
and abolish Pto-mediated recognition of AvrPtoB in to-                    suppresses stress-induced PCD in yeast, revealing that
mato [19]. However, these mutations do not completely                     AvrPtoB targets a component of eukaryotic PCD that
eliminate the interaction with Pto, as weak interactions                  is conserved between the plant and fungal kingdoms.
are observed in the yeast two-hybrid system [19]. Fur-                        The PCD eliciting and CDS activities of AvrPtoB
thermore, a deletion mutant of AvrPtoB, missing 245                       have been mapped to distinct regions of the protein
amino acids of the C-terminus and completely removing                     (Fig. 1). The N-terminus of AvrPtoB, from amino acids
the GINP motif, still interacted strongly with Pto in a                   1–308, is sufficient for interacting with Pto in a yeast
yeast two-hybrid system ([14], Fig. 1). Therefore, the                    two-hybrid system, eliciting Pto-mediated HR in tomato
AvrPtoB GINP motif is not required for the Avr-                           and, significantly, this mutant gains the ability to elicit
PtoB–Pto interaction; rather, the GINP motif might                        Pto-mediated HR on N. benthamiana [14]. This observa-
play a role in maintaining the global structure of intact                 tion hinted that CDS activity resided in the C-terminus
AvrPtoB.                                                                  and, indeed, the AvrPtoB C-terminus from amino acids
                                                                          308–553 was determined to be sufficient for CDS activ-
                                                                          ity. Therefore, AvrPtoB is a modular protein with cell
3. AvrPtoB suppresses programmed cell death                               death eliciting and suppressing activity in the N- and
                                                                          C-termini, respectively.
   VirPphA was first identified as a virulence factor that                      Further mutagenesis of AvrPtoB revealed that delet-
allows Pph to evade HR-based immunity [20]. In this                       ing as few as 44 amino acids from the C-terminus causes
study, a Pph strain carrying a large native plasmid                       a loss of CDS activity. Unexpectedly, an AvrPtoB mu-
caused disease on bean; however, removal of the plas-                     tant lacking CDS activity caused Pto-independent
mid from Pph caused this strain to elicit HR-based                        PCD in both tomato and N. benthamiana. This gain of
immunity on bean, suggesting that a factor on the plas-                   PCD suggested that AvrPtoB CDS activity was sup-
mid allowed Pph to evade HR-based defenses. This fac-                     pressing PCD triggered by a normally hidden R gene;
tor was determined to be VirPphA. When expressed by                       this R gene was named Rsb for Resistance suppressed
Pph, VirPphA and AvrPtoB both cause a water-soaking                       by the avrPtoB C-terminus. We have determined that a
phenotype on bean pods, hinting that these proteins                       fragment of AvrPtoB from amino acids 1–308 is suffi-
share a conserved virulence activity that may target                      cient to elicit Rsb-mediated HR (Fig. 1; F. Xiao and
HR-based defenses [21].                                                   G.B. Martin, unpublished data).
   The discovery that AvrPtoB acts inside the plant cell                      We exploited this hidden elicitor activity to link
to suppress PCD was the result of a serendipitous obser-                  AvrPtoB CDS activity with DC3000 pathogenesis.
vation in the wild tobacco species Nicotiana benthamiana.                 DC3000 expressing wild type AvrPtoB causes disease
N. benthamiana is used as a model system for studying                     on RG-pto11 tomato plants that lack a functional
HR-based PCD because of its robust cell death pheno-                      pto gene [34]. A DC3000 mutant, DC3000::mut5, was
type in response to elicitor proteins expressed by Agro-                  constructed with a chromosomal, C-terminal trunca-
bacterium-mediated transformation. When AvrPto and                        tion of AvrPtoB that abolished CDS activity; this mu-
Pto are transiently expressed in N. benthamiana leaves,                   tant elicited HR-based immunity in the previously
macroscopic tissue collapse and cell death are observed                   susceptible RG-pto11 plants. Re-introduction of intact
in the transformed leaf [14,18,27]. Like tomato, N. benth-                AvrPtoB in trans restored virulence of DC3000::mut5
amiana requires an endogenous Prf protein to signal Pto-                  on RG-pto11. Therefore, loss of AvrPtoB CDS
mediated PCD, indicating that the Pto signaling pathway                   activity causes a gain of host immunity to DC3000,
4                                 R.B. Abramovitch, G.B. Martin / FEMS Microbiology Letters 245 (2005) 1–8

and restoration of CDS activity with intact AvrPtoB                      near isogenic line RG-PtoS does not exhibit Rsb-medi-
induces disease susceptibility in an otherwise resistant                 ated resistance [14]; the primary difference between
plant. In these experiments, the importance of CDS                       RG-pto11 and RG-PtoS is the Pto locus, although, it
activity in pathogenesis was observed without protein                    is possible other unidentified differences exist between
overexpression because both mutant and intact Avr-                       these lines. Finally, virus-induced gene silencing using
PtoB were expressed from native promoters and deliv-                     a Pto fragment, designed to silence all Pto family mem-
ered by the pathogen, demonstrating that CDS activity                    bers, abrogates Rsb-mediated resistance and HR-based
observed by overexpression of AvrPtoB in heterolo-                       PCD in tomato and N. benthamiana, respectively (R.B.
gous systems, such as N. benthamiana and yeast, is bio-                  Abramovitch and G.B. Martin, unpublished data). To-
logically relevant at physiologically expressed levels                   gether, these data strongly suggest that two distinct
during the DC3000–tomato interaction. These findings                      Pto family members recognize AvrPtoB. Once Rsb is
reveal that the compatible interaction between DC3000                    cloned it will be interesting to determine if AvrPtoB
and RG-pto11 is successful because AvrPtoB is sup-                       interacts with Rsb, and if so, comparisons can be made
pressing HR-based PCD (Fig. 2).                                          between AvrPtoB–Pto and AvrPtoB–Rsb interactions.
   The discovery of the hidden R gene Rsb reveals that
AvrPtoB is recognized by two resistance genes. The
Pto R gene belongs to a gene family composed of 5–6                      4. The trump model
Pto family members. These Pto family members, along
with Prf, are clustered together on a 30 kb region of to-                   Several other DC3000 type III effectors have since
mato chromosome 5 [10,35,36]. Several lines of evidence                  been demonstrated to have CDS activity, including
indicate that a Pto family member encodes Rsb. First,                    HopPtoD2, HopPtoE, HopPtoF, HopPtoN, AvrPphE
Rsb-mediated resistance is Prf dependent, like Pto and                   and AvrPpiB1 [38–41]. As well, it is possible that Pph
the fenthion-sensitivity gene Fen/PtoB [37]. Second,                     effectors that block the HR, such as AvrPphC and
Rsb is likely present on the Pto locus because RG-                       AvrPphF [42], may also have CDS activity. Interest-
pto11 plants exhibit Rsb-mediated resistance, while the                  ingly, the CDS activity of these effectors is not specific
                                                                         as they suppress HR-based PCD elicited by several R
                                                                         proteins. A puzzling observation regarding CDS effec-
                                                                         tors is that many CDS effectors were first identified by
                                                                         their ability to elicit the HR, demonstrating that there
                                                                         exists cultivar specificity to their HR eliciting or sup-
                                                                         pressing activities. In a simple model, R proteins can
                                                                         dominantly elicit HR-based PCD in response to CDS
                                                                         effectors and CDS activity is only observed in the ab-
                                                                         sence of the cognate R protein. Observations of Avr-
                                                                         PtoB, however, do not support this simple model. For
                                                                         example, AvrPtoB can suppress Pto-mediated PCD in
                                                                         N. benthamiana but not tomato [14]; therefore, Pto can-
                                                                         not always elicit PCD in response to AvrPtoB. And to-
                                                                         mato is not completely impervious to AvrPtoB CDS
                                                                         activity, because in the absence of Pto, AvrPtoB sup-
                                                                         presses PCD in tomato. These observations reveal that
                                                                         a factor might act in conjunction with Pto to suppress
                                                                         AvrPtoB CDS activity.
Fig. 2. A model for AvrPtoB induced disease susceptibility in RG-           Based on our observations with AvrPtoB PCD elicit-
pto11 tomato leaves. RG-pto11 plants lack a functional Pto protein       ing and CDS activities, we propose a model that ac-
and are susceptible to DC3000 infection. AvrPtoB is a modular            counts for how R proteins successfully elicit HR-based
protein, where the N-terminus (shown as a blue oval) elicits Rsb-        PCD in response to effectors that suppress HR-based
mediated HR-based PCD and the C-terminus (presented as a red
                                                                         PCD (Fig. 3). In this model, CDS effector-elicited HR
hexagon) suppresses HR-based PCD. DC3000 uses a type III secretion
system to deliver AvrPtoB into the plant cell, where the Rsb R protein   might require both the cognate R protein and a second
(shown as a green box) can recognize the N-terminus of AvrPtoB. The      factor that can suppress, or trump, the CDS activity of
C-terminus of AvrPtoB, however, suppresses PCD signaled by Rsb,          the effector. We propose that a trump (T) factor may
possibly by binding a host component required for PCD (shown as an       act with a cognate R protein to mount HR-based immu-
orange box) enabling DC3000 to infect the host. Once disease
                                                                         nity in response to a CDS effector. Some premises of this
susceptibility is induced, the N-terminus of AvrPtoB, which also
exhibits virulence activity, is proposed to bind a host susceptibility   model include: (i) an R protein without a specific T fac-
factor (shown as a blue box) that allows DC3000 to enhance disease       tor can recognize its cognate CDS effector, but the HR is
symptoms or increase bacterial growth.                                   dominantly suppressed by the CDS effector (Fig. 3A),
                                       R.B. Abramovitch, G.B. Martin / FEMS Microbiology Letters 245 (2005) 1–8                           5

 A                                     B                                       dominant or recessive gene or even a complex trait.
                                                                               One could imagine a T factor acts by altering the local-
       ApB                      ApB             ApB                    ApB
                                                                               ization of the R protein complex, performing a post-
                                                                               translational modification of the effector or R protein
       Pto                     Rsb              Pto          T         Rsb
                                                                               (e.g., phosphorylation, proteolysis, ubiquitination,
                                                                               etc.), or by enhancing R protein-mediated PCD. For
                                                        X          X
                                                                               example, in the case of AvrPtoB, a simple explanation
                   ApB                                      ApB                for dominant Pto-mediated immunity elicited by Avr-
                                                                               PtoB is that HR-based PCD is ‘‘stronger’’ in tomato
     No HR                     No HR            HR                     HR      than N . benthamiana, and therefore tomato can over-
                                                                               come AvrPtoB CDS activity. In this case, the T factor
                                                                               may be a gene or complex trait that enables tomato to
 C                                     D
                         ApB
                                                            Effector genes     achieve a more sensitive, ‘‘hair-trigger’’ PCD response,
                         Rsb
                                           Plant genes CDS1+Avr2        Avr2   analogous to the barley gene MLO [43]. In barley, the
             T
                                            R1,T1,R2          HR        HR     MLO protein acts to downregulate PCD and cell wall-
                                                                               based defenses and plants expressing MLO are suscepti-
                                             R1,t1,R2       No HR       HR
                                                                               ble to Blumeria graminis f. sp. hordei [44] . However,
             ApB
                                             r1,T1,R2       No HR       HR     mutations in mlo result in enhanced disease resistance,
                                             r1,t1,R2       No HR       HR     owing to enhanced cell wall-based defense and a more
                     No HR
                                                                               sensitive PCD response that enables arrest of Bgh before
Fig. 3. The Trump Model. The trump model, as described in the text,            it can establish a successful infection. Perhaps, in toma-
is proposed to explain observations of AvrPtoB HR-eliciting and                to, the T factor is an mlo-like mutation that causes a
suppressing activity. The model describes experimental observations
involving AvrPtoB, where a cell death suppressing AvrPtoB (ApB,
                                                                               stronger, more rapid cell death response that enables
show as a red hexagon with blue oval) is recognized by its cognate R-          Pto to successfully activate immunity in response to
protein Pto (brown box) and a truncated AvrPtoB lacking CDS                    AvrPtoB. Identification of T factors might enable plant
activity (blue oval), is recognized by Rsb (green box). The trump              breeders to develop more durable resistance to plant
factor, T (yellow box), is proposed as a factor that suppresses CDS            pathogens and increase the repertoire of functional R
activity in conjunction with Pto. (A) In Nicotiana benthamiana
expressing Pto and Rsb but lacking a T factor, AvrPtoB can suppress
                                                                               proteins by discovering and employing normally hidden
HR-based PCD elicited by both R proteins. (B) In Pto- and Rsb-                 effector–R protein interactions.
expressing tomato, however, AvrPtoB elicits HR-based PCD, because                  The proposed trump model helps describe observa-
a trump factor acts in conjunction with Pto to suppress AvrPtoB-               tions of AvrPtoB HR eliciting and suppressing activities.
mediated CDS activity. (C) In RG-pto11 plants that do not express              However, for other CDS effectors, alternate models may
Pto, AvrPtoB can suppress Rsb-mediated HR-based PCD because the
trump factor requires Pto to suppress CDS activity. (D) A generic
                                                                               be proposed to explain how a plant mounts a successful
model describing how removing a CDS effector can shift a susceptible            HR in response to a CDS effector. For example, CDS
interaction (no HR) to an immunity-eliciting interaction (HR). CDS1            effectors may target specific PCD signalling pathways,
is recognized by a cognate protein R1 and Avr2 is a non-CDS effector            and therefore, R proteins using an unaffected PCD sig-
recognized by cognate R protein R2. T1 is a trump factor that acts             naling pathway can effectively elicit the HR upon recog-
together with R1 to inhibit CDS1-mediated suppression of PCD.
Capitalized genes are present in the plant, lower case genes are absent.
                                                                               nition of the CDS effector.
Note. T1 is presented as a dominant gene for this example; however,
T1 could be a recessive gene or a complex trait.
                                                                               5. Other potential AvrPtoB virulence activities

(ii) an R protein with a specific T factor can recognize its                       On susceptible tomato plants AvrPtoB likely has
cognate CDS effector and dominantly elicit the HR (Fig.                         other virulence activities in addition to its ability to sup-
3B); and (iii) a T factor without its cognate R protein                        press HR-based PCD. For example, the DC3000::mut5
will not suppress the CDS activity of the cognate CDS                          mutant lacking CDS activity exhibits a 10-fold decrease
effector, and consequently, CDS activity from this effec-                        in growth on susceptible RG-prf3 tomato plants [14].
tor can suppress HR-based PCD elicited by a distinct                           Plants with the prf3 mutation cannot mount Pto- or
effector/R-protein pair (Fig. 3C). This ‘‘trump model’’                         Rsb-mediated immunity; therefore, CDS activity might
accounts for how some effector–R protein interactions                           also act as a quantitative virulence factor in the absence
are hidden and how removing an effector from a patho-                           of HR-based immunity.
gen can reveal normally hidden resistance phenotypes                              Deletion of both avrPto and avrPtoB from DC3000
(Fig. 3D; [14,20,42]).                                                         also supports the hypothesis that AvrPtoB quantitatively
    The proposed T factors may be specific for a particu-                       increases pathogen growth and disease formation on sus-
lar effector–R protein pair or may target multiple effec-                        ceptible tomato plants [13]. A DC3000::DavrPtoB mu-
tor–R protein pairs. A T factor may be a single                                tant causes reduced speck number on susceptible
6                           R.B. Abramovitch, G.B. Martin / FEMS Microbiology Letters 245 (2005) 1–8

tomato leaves, however, this deletion does not reduce              outcome. By exploring the mechanisms of AvrPtoB
pathogen growth. This observation suggests that Avr-               CDS activity we hope to elucidate processes that are
PtoB promotes disease symptom formation, possibly                  essential for plant immunity. Identification of PCD
by inducing speck-associated cell death. In fact, AvrPtoB          components required for plant immunity and discover-
has been observed to activate ethylene production in to-           ing ‘‘trump factors’’ that act as counter defenses to
mato to cause enhanced disease-associated cell death (J.           CDS effectors may enable novel approaches for breeding
Cohn and G.B Martin, unpublished data). It is perhaps              crops with durable resistance to pathogens.
surprising the AvrPtoB would both suppress and induce
cell death during pathogenesis, however, we have pro-
posed a model where effectors suppress PCD early in                 Acknowledgments
infection to enable the pathogen to avoid HR-based
immunity and then, once infection is established, induce              We are grateful to Nai-Chun Lin, Josh Cohn and
host PCD to gain access to nutrients or aid pathogen dis-          Fangming Xiao for sharing data prior to publication.
semination [1]. This model is supported by observations            This research is supported by grants from the National
of the animal pathogen Salmonella, where depending on              Science Foundation, United States Department of Agri-
its stage of growth it uses type III effectors to induce or         culture and the Triad Foundation. RBA was supported
suppress PCD [45,46]. The DC3000::DavrPto/avrPtoB                  by a fellowship from the Natural Sciences and Engineer-
double mutant causes fewer specks and also grows more              ing Research Council of Canada.
slowly on susceptible RG-prf3 plants, indicating that
AvrPto and AvrPtoB likely contribute additively to
DC3000 virulence [13]. Addition of avrPtoB on a broad              References
host range plasmid to the DC3000::DavrPto/DavrPtoB
                                                                    [1] Abramovitch, R.B. and Martin, G.B. (2004) Strategies used by
double mutant causes a significant increase in growth
                                                                        bacterial pathogens to suppress plant defenses. Curr. Opin. Plant
and speck number on RG-prf3, further supporting the                     Biol. 7 (4), 356–364.
existence of a quantitative AvrPtoB virulence function              [2] Alfano, J.R. and Collmer, A. (2004) Type III secretion system
on susceptible tomato plants.                                           effector proteins: double agents in bacterial disease and plant
    Evidence exists for a virulence activity attributable               defense. Annu. Rev. Phytopathol. 42, 385–414.
                                                                    [3] Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D.,
to the AvrPtoB N-terminus that is independent of C-
                                                                        Felix, G. and Boller, T. (2004) Bacterial disease resistance in
terminal CDS activity. In nature, truncated versions of                 arabidopsis through flagellin perception. Nature 428 (6984), 764–
AvrPtoB, such as HopPmaL, have been identified that                      767.
only contain sequence similar to the N-terminus of Avr-             [4] Zeidler, D., Zahringer, U., Gerber, I., Dubery, I., Hartung, T.,
PtoB. Maintenance of HopPmaL in Pma suggests that                       Bors, W., Hutzler, P. and Durner, J. (2004) Innate immunity in
                                                                        arabidopsis thaliana: lipopolysaccharides activate nitric oxide
this protein may promote bacterial virulence activity.
                                                                        synthase (NOS) and induce defense genes. Proc. Natl. Acad. Sci.
Phylogenetic analyses indicate that HopAB family mem-                   USA 101 (44), 15811–15816.
bers, including HopPmaL, are undergoing positive                    [5] Nurnberger, T., Brunner, F., Kemmerling, B. and Piater, L.
selection in the N-terminus, demonstrating that this re-                (2004) Innate immunity in plants and animals: striking similarities
gion of AvrPtoB is diversifying, possibly to promote                    and obvious differences. Immunol. Rev. 198, 249–266.
                                                                    [6] Martin, G.B., Bogdanove, A.J. and Sessa, G. (2003) Understand-
pathogen virulence or avoid detection by Pto-like R-
                                                                        ing the functions of plant disease resistance proteins. Annu. Rev.
proteins [47]. Indeed, we have observed virulence activ-                Plant Biol. 54, 23–61.
ity for the N-terminus of AvrPtoB when it is delivered              [7] Greenberg, J.T. and Yao, N. (2004) The role and regulation of
by a DC3000::DavrPtoB mutant (F. Xiao and G.B.                          programmed cell death in plant–pathogen interactions. Cell.
Martin, unpublished data). Together, these data suggest                 Microbiol. 6 (3), 201–211.
                                                                    [8] Buell, C.R., Joardar, V., Lindeberg, M., Selengut, J., Paulsen,
that the N-terminus of AvrPtoB acts as a virulence fac-
                                                                        I.T., Gwinn, M.L., Dodson, R.J., Deboy, R.T., Durkin, A.S.,
tor, independent of its C-terminal CDS activity (Fig. 2).               Kolonay, J.F., Madupu, R., Daugherty, S., Brinkac, L., Beanan,
                                                                        M.J., Haft, D.H., Nelson, W.C., Davidsen, T., Zafar, N., Zhou,
                                                                        L., Liu, J., Yuan, Q., Khouri, H., Fedorova, N., Tran, B., Russell,
6. Conclusion                                                           D., Berry, K., Utterback, T., Van Aken, S.E., Feldblyum, T.V.,
                                                                        DÕAscenzo, M., Deng, W.L., Ramos, A.R., Alfano, J.R., Cartin-
                                                                        hour, S., Chatterjee, A.K., Delaney, T.P., Lazarowitz, S.G.,
   The discovery that AvrPtoB both elicits and sup-                     Martin, G.B., Schneider, D.J., Tang, X., Bender, C.L., White, O.,
presses HR-based PCD in tomato provides a glimpse                       Fraser, C.M. and Collmer, A. (2003) The complete genome
into the co-evolution of a bacterial plant pathogen and                 sequence of the Arabidopsis and tomato pathogen Pseudomonas
its host. Suppression of PCD by AvrPtoB highlights                      syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. USA 100 (18),
                                                                        10181–10186.
PCD as a vital front in the battle between the pathogen
                                                                    [9] Collmer, A., Lindeberg, M., Petnicki-Ocwieja, T., Schneider, D.J.
and the host. In some cases, the ability of the pathogen                and Alfano, J.R. (2002) Genomic mining type III secretion system
to suppress PCD or the plant to trump effector CDS                       effectors in Pseudomonas syringae yields new picks for all TTSS
activity can be the deciding factor determining disease                 prospectors. Trends Microbiol. 10 (10), 462–469.
                                    R.B. Abramovitch, G.B. Martin / FEMS Microbiology Letters 245 (2005) 1–8                                          7

[10] Pedley, K.F. and Martin, G.B. (2003) Molecular basis of Pto-                    regulation of immune signaling by tomato Pto kinase. Plant Cell
     mediated resistance to bacterial speck disease in tomato. Annu.                 16 (10), 2809–2821.
     Rev. Phytopathol. 41, 215–243.                                           [26]   Wulf, J., Pascuzzi, P.E., Fahmy, A., Martin, G.B. and Nicholson,
[11] Salmeron, J.M., Oldroyd, G.E.D., Rommens, C.M.T., Scofield,                      L.K. (2004) The solution structure of type III effector protein
     S.R., Kim, H.-S., Lavelle, D.T., Dahlbeck, D. and Staskawicz,                   AvrPto reveals conformational and dynamic features important
     B.J. (1996) Tomato Prf is a member of the leucine-rich repeat class             for plant pathogenesis. Structure (Camb.) 12 (7), 1257–1268.
     of plant disease resistance genes and lies embedded within the Pto       [27]   Sessa, G., DÕAscenzo, M. and Martin, G.B. (2000) Thr38 and
     kinase gene cluster. Cell 86, 123–133.                                          Ser198 are Pto autophosphorylation sites required for the
[12] Shan, L., He, P., Zhou, J.M. and Tang, X. (2000) A cluster of                   AvrPto–Pto-mediated hypersensitive response. EMBO J. 19
     mutations disrupt the avirulence but not the virulence function of              (10), 2257–2269.
     AvrPto. Mol. Plant Microbe Interact. 13 (6), 592–598.                    [28]   Peart, J.R., Lu, R., Sadanandom, R., Malcuit, I., Moffett, P.,
[13] Lin, N. and Martin, G.B. (2005) An avrPto/avrPtoB mutant of                     Brice, D.C., Schauser, L., Jaggard, D.A., Xiao, S., Coleman,
     Pseudomonas syringae pv. tomato DC3000 does not elicit Pto-                     M.J., Dow, M., Jones, J.D.G., Shirasu, K. and Baulcombe, D.C.
     mediated resistance and is less virulent on tomato. Mol. Plant-                 (2002) Ubiquitin ligase-associated protein SGT1 is required for
     Microbe Interact. 18 (1), 43–51.                                                host and nonhost disease resistance in plants. Proc. Natl. Acad.
[14] Abramovitch, R.B., Kim, Y.J., Chen, S., Dickman, M.B. and                       Sci. USA 99 (16), 10865–10869.
     Martin, G.B. (2003) Pseudomonas type III effector AvrPtoB                 [29]   del Pozo, O., Pedley, K.F. and Martin, G.B. (2004) MAPKKKa is
     induces plant disease susceptibility by inhibition of host pro-                 a positive regulator of cell death associated with both plant
     grammed cell death. EMBO J. 22 (1), 60–69.                                      immunity and disease. EMBO J. 23 (15), 3072–3082.
[15] Hauck, P., Thilmony, R. and He, S.Y. (2003) A Pseudomonas                [30]   He, X., Anderson, J.C., del Pozo, O., Gu, Y.Q., Tang, X. and
     syringae type III effector suppresses cell-wall based extracellular              Martin, G.B. (2004) Silencing of subfamily I of protein phospha-
     defense in susceptible arabidopsis plants. Proc. Natl. Acad. Sci.               tase2A catalytic subunits results in activation of plant defense
     USA 100 (14), 8577–8582.                                                        responses and localized cell death. Plant J. 38 (4), 563–577.
[16] Ronald, P.C., Salmeron, J.M., Carland, F.M. and Staskawicz,              [31]   Rathjen, J.P., Chang, J.H., Staskawicz, B.J. and Michelmore,
     B.J. (1992) The cloned avirulence gene avrPto induces disease                   R.W. (1999) Constitutively active Pto induces a Prf-dependent
     resistance in tomato cultivars containing the Pto resistance gene.              hypersensitive response in the absence of avrPto. EMBO J. 18
     J. Bacteriol. 174, 1604–1611.                                                   (12), 3232–3240.
[17] Tang, X., Frederick, R.D., Zhou, J., Halterman, D.A., Jia, Y. and        [32]   Van der Hoorn, R.A., Laurent, F., Roth, R. and De Wit, P.J.
     Martin, G.B. (1996) Initiation of plant disease resistance by physical          (2000) Agroinfiltration is a versatile tool that facilitates compar-
     interaction of AvrPto and Pto kinase. Science 274, 2060–2063.                   ative analyses of Avr9/Cf-9-induced and Avr4/Cf-4-induced
[18] Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle,               necrosis. Mol. Plant Microbe Interact. 13 (4), 439–446.
     D.T., Michelmore, R.W. and Staskawicz, B.J. (1996) Molecular             [33]   Lacomme, C. and Santa Cruz, S. (1999) Bax-induced cell death in
     basis of gene-for-gene specificity in bacterial speck disease of                 tobacco is similar to the hypersensitive response. Proc. Natl.
     tomato. Science 274, 2063–2065.                                                 Acad. Sci. USA 96 (14), 7956–7961.
[19] Kim, Y.J., Lin, N.C. and Martin, G.B. (2002) Two distinct                [34]   Salmeron, J.M., Barker, S.J., Carland, F.M., Mehta, A.Y. and
     Pseudomonas effector proteins interact with the Pto kinase and                   Staskawicz, B.J. (1994) Tomato mutants altered in bacterial
     activate plant immunity. Cell 109 (5), 589–598.                                 disease resistance provide evidence for a new locus controlling
[20] Jackson, R.W., Athanassopoulos, E., Tsiamis, G., Mansfield,                      pathogen recognition. Plant Cell 6 (4), 511–520.
     J.W., Sesma, A., Arnold, D.L., Gibbon, M.J., Murillo, J., Taylor,        [35]   Michelmore, R.W. and Meyers, B.C. (1998) Clusters of resistance
     J.D. and Vivian, A. (1999) Identification of a pathogenicity island              genes in plants evolve by divergent selection and a birth-and-
     which contains genes for virulence and avirulence on a large                    death process. Genome Res. 8 (11), 1113–1130.
     native plasmid in the bean pathogen Pseudomonas syringae                 [36]   Riely, B.K. and Martin, G.B. (2001) Ancient origin of pathogen
     pathovar phaseolicola.. Proc. Natl. Acad. Sci. USA 96 (19),                     recognition specificity conferred by the tomato disease resistance
     10875–10880.                                                                    gene Pto. Proc. Natl. Acad. Sci. USA 98 (4), 2059–2064.
[21] Jackson, R.W., Mansfield, J.W., Ammouneh, H., Dutton, L.C.,               [37]   Loh, Y.-T. and Martin, G.B. (1995) The disease resistance gene
     Wharton, B., Ortiz-Barredo, A., Arnold, D.L., Tsiamis, G.,                      Pto and the fenthion-sensitivity gene Fen are closely related,
     Sesma, A., Butcher, A., Boch, J., Kim, Y.J., Martin, G.B., Tegli,               functional protein kinases. Proc. Natl. Acad. Sci. USA 92, 4181–
     S., Murillo, J. and Vivian, A. (2002) Location and activity of                  4184.
     members of a family of virPphA homologues in pathovars of                [38]   Bretz, J.R., Mock, N.M., Charity, J.C., Zeyad, S., Baker, C.J. and
     Pseudomonas syringae and P. savastanoi. Mol. Plant Pathol. 3 (4),               Hutcheson, S.W. (2003) A translocated protein tyrosine phospha-
     205–216.                                                                        tase of Pseudomonas syringae pv. tomato DC3000 modulates plant
[22] Guttman, D.S., Vinatzer, B.A., Sarkar, S.F., Ranall, M.V.,                      defence response to infection. Mol. Microbiol. 49 (2), 389–400.
     Kettler, G. and Greenberg, J.T. (2002) A functional screen for the       [39]   Espinosa, A., Guo, M., Tam, V.C., Fu, Z.Q. and Alfano, J.R.
     type III (hrp) secretome of the plant pathogen Pseudomonas                      (2003) The Pseudomonas syringae type III-secreted protein
     syringae. Science 295 (5560), 1722–1726.                                        HopPtoD2 possesses protein tyrosine phosphatase activity and
[23] Lindeberg, M., Stavrinides, J., Chang, J.H., Alfano, J.R.,                      suppresses programmed cell death in plants. Mol. Microbiol. 49
     Collmer, A., Dangl, J.L., Greenberg, J.T., Mansfield, J.W. and                   (2), 377–387.
     Guttman, D.S. (2005) Proposed guidelines for a unified nomen-             [40]   Jamir, Y., Guo, M., Oh, H.S., Petnicki-Ocwieja, T., Chen, S.,
     clature and phylogenetic analysis of type III hop effector proteins              Tang, X., Dickman, M.B., Collmer, A. and Alfano, J.R. (2004)
     in the plant pathogen Pseudomonas syringae. Mol. Plant-Microbe                  Identification of Pseudomonas syringae type III effectors that can
     Interact., in press.                                                            suppress programmed cell death in plants and yeast. Plant J. 37
[24] Frederick, R.D., Thilmony, R.L., Sessa, G. and Martin, G.B.                     (4), 554–565.
     (1998) Recognition specificity for the bacterial avirulence protein       [41]   Lopez-Solanilla, E., Bronstein, P.A., Schneider, A.R. and Coll-
     AvrPto is determined by Thr-204 in the activation loop of the                   mer, A. (2004) HopPtoN is a Pseudomonas syringae Hrp (type III
     tomato Pto kinase. Mol. Cell 2 (2), 241–245.                                    secretion system) cysteine protease effector that suppresses path-
[25] Wu, A.J., Andriotis, V.M., Durrant, M.C. and Rathjen, J.P.                      ogen-induced necrosis associated with both compatible and
     (2004) A patch of surface-exposed residues mediates negative                    incompatible plant interactions. Mol. Microbiol. 54 (2), 353–365.
8                                R.B. Abramovitch, G.B. Martin / FEMS Microbiology Letters 245 (2005) 1–8

[42] Tsiamis, G., Mansfield, J.W., Hockenhull, R., Jackson, R.W.,             responsive to biotic and abiotic stress stimuli. Plant Physiol. 129
     Sesma, A., Athanassopoulos, E., Bennett, M.A., Stevens, C.,             (3), 1076–1085.
     Vivian, A., Taylor, J.D. and Murillo, J. (2000) Cultivar-specific   [45] Knodler, L.A. and Finlay, B.B. (2001) Salmonella and apoptosis:
     avirulence and virulence functions assigned to avrPphF in               to live or let die?. Microbes Infect. 3 (14–15), 1321–1326.
     Pseudomonas syringae pv. phaseolicola, the cause of bean halo-     [46] Knodler, L.A., Finlay, B.B. and Steele-Mortimer, O. (2005) The
     blight disease. EMBO J. 19 (13), 3204–3214.                             Salmonella effector protein SopB protects epithelial cells from
[43] Schulze-Lefert, P. and Panstruga, R. (2003) Establishment of            apoptosis by sustained activation of Akt. J. Biol. Chem. 280 (10),
     biotrophy by parasitic fungi and reprogramming of host cells for        9058–9064.
     disease resistance. Annu. Rev. Phytopathol. 41, 641–667.           [47] Rohmer, L., Guttman, D.S. and Dangl, J.L. (2004) Diverse
[44] Piffanelli, P., Zhou, F., Casais, C., Orme, J., Jarosch, B.,             evolutionary mechanisms shape the type III effector virulence
     Schaffrath, U., Collins, N.C., Panstruga, R. and Schulze-Lefert,         factor repertoire in the plant pathogen Pseudomonas syringae.
     P. (2002) The barley MLO modulator of defense and cell death is         Genetics 167 (3), 1341–1360.
                                              FEMS Microbiology Letters 245 (2005) 9–17
                                                                                                                    www.fems-microbiology.org

                                                                  MiniReview

     Powdery mildew susceptibility and biotrophic infection strategies
                                                       Ralph Huckelhoven
                                                              ¨                          *

       Institute of Phytopathology and Applied Zoology, Justus-Liebig-University Giessen, Heinrich-Buff Ring 26-32, D-35392 Giessen, Germany

                            Received 24 January 2005; received in revised form 1 March 2005; accepted 1 March 2005

                                                      First published online 19 March 2005

                                                                Edited by R.C. Staples




Abstract

   Plants are resistant to most potentially pathogenic microbes. This forces plant pathogens to develop sophisticated strategies to
overcome basic plant resistance, either by masking intrusion or by suppression of host defences. This is particularly true for fungal
pathogens, which establish long lasting interactions with living host tissue, without causing visible damage to invaded cells. The
interactions of cereal crops and Arabidopsis with powdery mildew fungi are model systems for understanding host resistance.
Currently, these systems are also promoting the understanding of fungal infection by identifying fungal pathogenicity and virulence
factors and host target sites. This minireview focuses on recent findings about host susceptibility and the way powdery mildew fungi
might induce it.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Cell death regulation; Compatibility; Cytoskeleton; MLO; Pathogenesis associated molecular patterns




1. Introduction                                                               and the degree to which they contribute to resistance
                                                                              may depend on the individual plant–microbe interac-
   Plants are immobile and face a regularly changing                          tion. Major mechanisms of basic incompatibility are
environment. This forces plants to cope with many                             non-recognition of a plant by a pathogen, defects in
kinds of stresses, including pathogenic microbes. Never-                      the pathogen that limit its ability to overcome pre-
theless, plants are resistant to the majority of potential                    formed penetration barriers, and recognition of an inap-
pathogens that they are in constant contact with. This                        propriate pathogen by the plant followed by effective
kind of plant disease resistance is called basic resistance,                  defence reactions. Alternatively, the latter can be inter-
basic incompatibility or nonhost resistance. The latter                       preted as an inability of the pathogen to avoid recogni-
term reflects the fact that incompatibility is most often                      tion or to suppress plant defence. This interpretation
provoked by specialization of a pathogen species to a                         gained acceptance once it was understood that
narrow host range [1]. It is possible that specialization                     apparently all pathogens invading a plant are accompa-
is a consequence of co-evolution with plants that were                        nied by pathogenesis-associated molecular patterns
constantly forced to improve their resistance qualities.                      (PAMPs). Such PAMPs are generally recognized by
To date, it is not fully understood how nonhost resis-                        the plant as non-self molecules, which is comparable
tance is constituted [2]. It works via several mechanisms,                    to innate immunity in mammals. PAMPs can be con-
                                                                              served vital pathogen structures such as bacterial flagella
 *
     Tel.: +49 641 9937494; fax: +49 641 9937499.                             peptides or fungal cell-wall polysaccharides [3–5]. Since
     E-mail address: ralph.hueckelhoven@agrar.uni-giessen.de.                 PAMP recognition seems to be common in plants, a

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.03.001
10                                 R. Huckelhoven / FEMS Microbiology Letters 245 (2005) 9–17
                                       ¨

pathogenic microbe either has to (i) mask its PAMPs,               host defence gene expression [13–15]. Importantly, living
(ii) bypass recognition, or (iii) suppress defence, in order       haustorium-containing cells show enhanced accessibility
to be pathogenic on its host plant.                                to subsequent penetration by normally incompatible
    Little is known about the way pathogens overcome               PM fungi [16]. Additionally, different host cell types dif-
basic resistance of their host plants. It is thought that          fer remarkably in their ability to prevent fungal penetra-
pathogens have evolved various strategies. Pathogens               tion [17]. Together, the outcome of a fungal penetration
might avoid PAMP recognition by release of so-called               attempt on a susceptible host depends on fungal aggres-
suppressors that can derive from the plant or the path-            siveness, its ability to suppress host defence and the
ogen. Such suppressors might directly impair PAMP                  physiological status of the attacked cell.
recognition by competing with a PAMP for binding by                    The fact that leaf cell-death regulation and powdery
a PAMP receptor. Alternatively, suppressors might bind             mildew development are linked is evident from the
an independent target, which subsequently interferes               observation that PM fungi induce a Ôgreen island effectÕ
with PAMP signal transduction [6,7]. A second strategy             on infected leaves. The leaf tissue surrounding a fungal
of pathogenic microbes to achieve and maintain com-                colony remains green whilst the rest of the leaf shows
patibility appears to be targeted suppression of active            chlorosis. This indicates semi-systemic cell death sup-
host defence [8–10].                                               pression at infection sites and redefinition of invaded tis-
    Given that microbes need to overwhelm basic resis-             sues as a nutrient sink. Accordingly, an Arabidopsis
tance mechanisms to be infectious, understanding both              invertase and a monosaccharide sugar transporter nor-
sites of compatibility, the pathogenic strategy and the            mally expressed in sink tissues are activated in source
host target site, ought to be useful in re-establishing            leaves by PM infection [18]. Monosaccharides are most
resistance by pharmacological or biotechnological                  likely to be taken up by PM fungi [19].
means.                                                                 Besides these principal and structural prerequisites
                                                                   for plant infection, the development of highly special-
                                                                   ized infection structures is regulated by sophisticated
2. Powdery mildew infection                                        signalling cascades. Since PM fungi do not grow in axe-
                                                                   nic culture, they are difficult to study on the molecular
   Powdery mildew (PM) fungi are pathogens infecting               level. Transformation of PM fungi is possible [20], but
aerial parts of higher plants. They cause the PM disease           still challenging. Hopefully, future gene disruption strat-
of wild and crop plants that may depress yield by up to            egies will help to identify pathogenicity and virulence
30%. PM fungi are true ascomycete fungi, forming the               factors of PM fungi. Random EST sequencing and dif-
order of Erysiphales with only one family, the Erysipha-           ferential gene expression studies have provided sequence
ceae. They are subdivided into five tribes (Erysipheae,             information for Blumeria graminis f.sp. hordei (Bgh), the
Golovinomycetinae, Cystotheceae, Phyllactinieae, Blu-              barley PM fungus, and candidate genes for functional
merieae) and further subtribes, and more than 10 genera            analyses [21–27]. Cyclic AMP-dependent protein kinase
[11].                                                              A signalling appears to be involved in early appressorial
   The PM fungi are biotrophic parasites invading only             germ tube differentiation [22]. Best evidence for involve-
epidermal cells. After a conidial spore lands on the host          ment of protein kinase A in appressoria formation stems
surface, the PM fungus needs to attach to the surface              from heterologous complementation experiments per-
and to penetrate the host cuticle and cell wall. The fungi         formed in the non-obligate plant pathogenic fungus
build one or two germ tubes, depending on the genera               Magnaporthe grisea. A M. grisea disruption mutant
[12]. The so-called appressorial germ tube swells at its           lacking cAMP-dependent protein kinase A subunit c
tip to build an appressorium that is the essential pene-           shows delayed and ineffective appressorium develop-
tration organ. The fungus directly penetrates the host             ment, and could be complemented to full pathogenicity
cell wall apparently by means of both enzymatic and                by transformation with the homologous Bka1 gene from
mechanical power [12]. After breakdown of the cell wall            Bgh [28]. Furthermore, gene expression and pharmaco-
barrier, PM fungi develop a haustorium. This organ                 logical evidence suggest that a mitogen-activated protein
invaginates the host plasma membrane, which serves                 kinase (MAPK) pathway is also crucial for appressoria
to supply the invader with nutrients, whilst the invaded           formation. Pharmacological analyses suggest a signal-
cell remains intact. During penetration, the fungus has            ling branch downstream of a heterotrimeric G-protein,
to cope with cell wall-associated defence of the host.             and parallel but cooperative action of MAP kinase
Hence, even on a susceptible host, only a certain portion          and cAMP in appressoria formation [29].
of germinated spores succeed in penetration. This also                 Bgh accumulates the redox-active substance 3-
suggests that speed of penetration, or individual spore            hydroxykynurenine during interaction with barley. The
ability to locally suppress host defence, or both, are cru-        role of this chemical is not clear, but it could participate
cial for access to host cells. There is accumulating evi-          in either cross-linking the fungus with the host surface
dence for the ability of cereal PM fungi to suppress               or it might have redox activity [30]. Additionally, Bgh
                                    R. Huckelhoven / FEMS Microbiology Letters 245 (2005) 9–17
                                        ¨                                                                                     11

expresses an apparently secreted catalase during host               nutrient uptake after haustoria formation. A few model
infection, which potentially has a role in removing                 systems for the interaction of plants and PM fungi are
H2O2 produced by the host, probably to cross-link its               established. Among them, the interaction of cereals
cell wall for penetration resistance [27,31].                       and Arabidopsis thaliana with PM fungi are the best
   Fungal avirulence factors (AVR) determine the abil-              studied in several aspects. Penetration resistance to the
ity of certain host cultivars to recognize the attacking            PM fungi is normally characterized by formation of cell
fungus in a race-specific manner by corresponding resis-             wall appositions (CWAs) that are believed to build
tance proteins. AVRs are also believed to be involved in            mechanical and chemical barriers against hydrolytic
pathogenicity on susceptible hosts. This dual role makes            and osmotic pressure from fungal appressoria. CWAs
cloning of AVR-genes from biotrophs one of the great-               are composed of altered cell wall material, which com-
est challenges in plant pathology [32]. Recently, Christo-          prises inter alia 1,3-glucans (callose), silicon, phenolics,
pher Ridout from James BrownÕs group [33] has cloned                and diverse cell wall proteins [37]. The particular role
candidate AVRK1 and AVRA10 from Bgh, which trigger                  of these constituents in penetration resistance is not fully
resistance gene dependent host defences. Since Bgh                  understood. Likewise, the role of low molecular weight
AVRs lack typical signal peptides and the corresponding             antibiotics in penetration resistance is not clear. Barley
host resistance proteins seem to be expressed in the cyto-          mlo-genotypes accumulate comparatively high contents
plasm, it will be interesting to learn whether and how              of the phytoalexin p-coumaroyl-hydroxyagmatine in
AVRs cross the plasma membrane of the parasite and                  response to PM inoculation. Since p-coumaroyl-
the host.                                                           hydroxyagmatine has antifungal activity on Bgh, it
                                                                    could contribute to stopping early fungal development
                                                                    [38]. It is currently believed that PM fungi cannot dis-
3. Genetics of plant resistance to powdery mildew fungi             solve lignin-like material. Blue and yellow autofluores-
                                                                    cent lignin-like material is generally integrated in grass
   Once a microbe has overcome basic resistance, basic              CWAs, and it has been observed that such material is
compatibility is achieved and the virulent pathogen                 insensitive to saponification earlier in resistant barley
can amplify on the susceptible host. However, normally              mlo -mutant genotypes than in susceptible Mlo-geno-
not every host genotype is equally susceptible to a cer-            types [38]. Additionally, H2O2 accumulation, protein
tain race of a pathogen. The aggressiveness of a patho-             cross-linking and immobilization was observed in
gen genotype, together with the background resistance               CWAs induced by Bgh [31]. Both lignification and pro-
of a susceptible host plant, determine the severity of dis-         tein cross-linking depend on H2O2 as an oxidant [39,40].
ease. Little is known about the molecular basis of these            H2O2 accumulation in CWAs is observed extremely fre-
quantitative traits [34,35]. Quantitative (synonym: par-            quently in resistant mlo-barley, whereas susceptible Mlo-
tial, horizontal) resistance is little understood and is usu-       genotypes accumulate little H2O2 [41–43]. Intriguingly,
ally expressed as a polygenic trait. Single genes                                             Å
                                                                    in contrast to H2O2, O2À seems to play a much more
contributing to quantitative resistance usually act addi-           complex role and might even be involved in cellular
tively [36].                                                        accessibility [44–46]. This is supported by the observa-
   Complete host powdery mildew resistance is mono-                 tion that single cell dsRNA interference to knock down
genic and can be dominantly or recessively inherited.               a potentially OÅÀ generating barley NADPH oxidase
                                                                                      2
Major race-specific barley MLA and non-specific Ara-                  homologue led to enhanced background resistance in a
bidopsis RPW8 powdery mildew resistance genes have                  susceptible host [47]. This might be explained by the
been isolated, and currently resistance proteins and                contribution of OÅÀ to cell wall polymer loosening
                                                                                         2
downstream signalling are under intensive investigation             [45,46,48]. Alternatively, NADPH oxidase might have
(for a comprehensive review see [5]). Barley Mlo-mutant             a role in negative control of independent defence
alleles (mlo) mediate broad spectrum-resistance to PM,                                              Å
                                                                    pathways. In Arabidopsis, O2À is monitored via LSD1
which has been durable in spring-barley breeding for                for negative control of cell death and defence gene
more than 20 years [36]. Recessive mlo-mediated resis-              expression [49].
tance is extremely efficient. However, it is accompanied                 Local formation of CWAs and secretion of toxic
by spontaneous leaf cell death in older leaves, and is              compounds requires polarization of the cellular defence
sometimes limited in extreme environments.                          machinery, which involves cytoskeleton reorganization.
                                                                    It has been shown that the actin cytoskeleton massively
                                                                    rearranges in barley cells under attack from PM fungi
4. Plant defence mechanisms                                         to form a polarized pattern focused towards the site of
                                                                    attempted penetration [50–52]. This appears crucial in
  Effective plant defence against PM fungi is usually or-            penetration defence, because plants show less actin
ganized in different sequential steps. Early defence pre-            polarization during compatible interactions [51]. When
vents penetration, and a second line of defence inhibits            cowpea was treated with the actin polymerization
12                                       R. Huckelhoven / FEMS Microbiology Letters 245 (2005) 9–17
                                             ¨

inhibitor cytochalasin E after inoculation with the                        grammed cell death (PCD) of the attacked cell and/or
inappropriate plantain PM fungus, local H2O2 accumu-                       a few surrounding cells. As in penetration resistance,
lation was reduced and, simultaneously, fungal pene-                       H2O2 accumulates during execution of HR [31,41,46].
tration efficiency was greatly enhanced [53]. Similarly,                     In fact, H2O2 might contribute in two ways to HR.
nonhost resistance of barley coleoptiles to Erysiphe pisi                  First, H2O2 acts as a signal for PCD. Second, H2O2
and of Arabidopsis enhanced disease susceptibility 1                       might be fungitoxic and hence prevents the fungus from
mutants to B. graminis f.sp. tritici could be partially                    suppressing cell death.
breached by cytochalasins [50,54].                                            Post-penetration defence appears not to be restricted
   ROR1 and ROR2 are two barley host resistance fac-                       to HR. Quantitative resistance of mildew host plant
tors that are required for full mlo-mediated resistance                    genotypes is often observed as a slow-disease phenotype
(identified as independent loci in a mlo-re-mutagenesis                     or mild disease severity without leaf necrosis e.g. [61].
screen) and additionally are involved in nonhost resis-                    The factors restricting fungal development in these cases
tance and background resistance to B. graminis but                         are largely unknown, and corresponding quantitative
not in race-specific resistance [55–58]. While the                          trait loci have not been isolated yet.
ROR1-gene is not yet characterized, ROR2 and its Ara-
bidopsis ortholog PEN1, which was identified in a
screen for nonhost resistance to Bgh, were recently                        5. Host susceptibility factors – forward and reverse
isolated [55]. ROR2 and PEN1 proteins are SNARE-                           genetics
family plasma membrane syntaxins, which seem to be
involved in local vesicle dynamics. Barley ROR2                               Host proteins apparently contribute to PM suscepti-
interacts with barley SNAP34 (a SNAP25 homologue),                         bility (Table 1, Fig. 1). This has been shown by barley
possibly building a binary SNARE complex for vesi-                         and Arabidopsis mutagenesis leading to isolation of mu-
cle-mediated exocytosis [55]. Green fluorescent protein                     tants, which have broad spectrum resistance to PM fungi,
(GFP)-PEN1 and yellow fluorescent protein (YFP)-                            but not to other pathogens. Some of these mutants
ROR2 fusions focally accumulate at CWAs induced                            do not show constitutive expression of defence but in-
by Bgh [59,60]. Hence, both actin and membrane polar-                      stead show post-inoculation defence or fail to support
ization appear to build a subcellular domain crucial for                   fungal development [5,62–65]. This indicates that target
pre-haustorial defence against PM fungi.                                   gene products function as negative controls of PM de-
   As an additional or second line of defence, the host                    fence or are required to provide substrates for PM fungi.
can prevent nutrient uptake by disturbing haustorial                       For instance, the Arabidopsis powdery mildew resistant 6
function. The most prominent way to achieve this is                        (pmr6) mutant shows a defence phenotype against PM
by the hypersensitive reaction (HR), including pro-                        fungi that is independent of HR, and common defence

Table 1
Host proteins allowing or enhancing PM susceptibility identified by either forward or reverse genetics
Gene                        Proven or potential protein function   Forward     Reverse    Over-expression    Mutation or          Ref.
                                                                   genetics    genetics   induces enhanced   knock-down
                                                                                          susceptibility     induces resistance
AtPMR1                      Unknown                                +                      n.d.a.             +                    [63]
AtPMR2; AtMLO2              MLO-family member                      +           +          n.d.a.             +                    [63,78]
AtPMR3                      Unknown                                +                      n.d.a.             +                    [63]
AtPMR4; AtGLS5              Glucan synthase 5                      +           +          n.d.a.             +                    [63,67,68]
AtPMR5                      Cell expansion                         +                      n.d.a.             +                    [63,65]
AtPMR6                      Pectate-lyase like protein             +                      n.d.a.             +                    [63,64]
AtEDR1                      MAP kinase kinase kinase               +           +          n.d.a.             +                    [62,69,70]
AtCEV1                      Cellulose synthase A3                  +                      n.d.a.             +                    [66]
HvMLO                       Receptor-like membrane protein         +           +          +                  +                    [71,73,75,87]
HvBI-1                      Potential cell death inhibitor                     +          +a                 Àa                   [77,83]
HvRACB                      small RAC/ROP GTPase                               +          +b                 +                    [85,86]
HvRBOHa                     NADPH oxidase                                      +          n.d.a.             +                    [47]
HvWRKY (WRKY9-10)           Transcription factor                               +          +c                 +                    [80]
HvRLK (Hv8a14)              Receptor-like kinase (LRK1-like)                   +          n.d.a.             +                    [80]
HvWIR1                      Unknown                                            +          +                  n.d.a.               [87]
HvPRX7                      Vacuolar peroxidase                                +          +                  n.d.a.               [81]
n.d.a., presently no data available.
  a
    HvBI-1 over-expression also breaches mlo-mediated resistance and nonhost penetration resistance to wheat PM fungus [77,83]. Standard
transient BI-1 RNAi has low resistance inducing capability [83].
  b
    Over-expression of wild type RACB has no effect whereas the constitutively activated mutant RACB-G15V induces super-susceptibility.
  c
    Christina Eckey, University Giessen, Germany, personal communication.
                                           R. Huckelhoven / FEMS Microbiology Letters 245 (2005) 9–17
                                               ¨                                                                                      13

                                                                            resistance accompanied by cell death. The EDR1 pro-
                                                                            tein is a putative mitogen activated kinase kinase kinase
                                                                            that possibly acts early in negative regulation of SA-
                                                                            dependent defence [62,69,70]. However, edr1, like cev1,
                                                                            is not PM-specific but a more generally resistant mutant,
                                                                            which distinguishes edr1 from most pmr- and barley
                                                                            mlo-mutants [5,62]. The specificity of some mutation in-
                                                                            duced resistance against PM fungi supports the view
                                                                            that the corresponding genes encode host susceptibility
                                                                            factors required for basic compatibility [5]. Further evi-
                                                                            dence for this assumption comes from experiments with
                                                                            barley mlo. The dominant Mlo gene was isolated by
                                                                            Buschges et al. [71]. The gene encodes a deduced 60
                                                                               ¨
                                                                            kDa protein with seven transmembrane domains remi-
                                                                            niscent of a G-protein coupled receptor [71,72]. Despite
Fig. 1. Host and PM fungus proteins potentially involved in compat-         this topology, MLO function in susceptibility to Bgh ap-
ibility. Fungal proteins are likely to be required for appressorium         pears to be independent from heterotrimeric G-proteins.
development whereas host proteins were shown to be either required          Instead, MLO interacts with calmodulin to fulfill its
for full susceptibility or to promote it when over-expressed or both (see   function in susceptibility [60,73,74]. Transient single cell
Table 1). Host proteins are depicted at their subcellular location that
                                                                            over-expression of the dominant Mlo cDNA provokes
was either predicted or experimentally demonstrated: BI, BAX
inhibitor-1; CAM, calmodulin; ER, endoplasmatic reticulum; Gabr,            breakdown of mlo-resistance and of nonhost penetra-
heterotrimeric G-protein; for further abbreviations see Table 1 and         tion resistance of both barley and wheat to the respec-
text.                                                                       tive inappropriate forma specialis of B. graminis
                                                                            [75–77]. Astonishingly, the barley mlo-phenotype, upon
                                                                            PM challenge, is mimicked in the Arabidopsis
pathways which involve salicylic acid (SA), jasmonate or                    Atmlo2-mutant pmr2 and independently identified Atm-
ethylene signalling. The PMR6 protein is similar to pec-                    lo2 insertion mutants, demonstrating that MLO is a PM
tate lyases, and is likely to be associated with the extra-                 susceptibility factor both in monocots and dicots. In
cellular site of the plasma membrane via a                                  barley and Arabidopsis mlo-mutants, fungal penetration
glycosylphosphatidylinositol anchor. PMR6 seems to                          is totally restricted [5,63,78, and Chiara Consonni, Matt
function in cell-wall modelling since pmr6 has altered                      Humphrey, Andreas Hartmann, Paul Schulze-Lefert,
cell wall components. PMR6 is considered to be a PM                         Ralph Panstruga, and Shauna Somerville, personal
specific host susceptibility factor, although its biochem-                   communication of unpublished results]. Interestingly,
ical function has still to be determined [64]. The pheno-                   barley mlo-mutants show some pleiotropic effects in old-
type of Arabidopsis pmr5 mutants, affected in a gene                         er plants under sterile conditions. This includes sponta-
encoding a plant specific predicted ER- and/or plasma                        neous formation of CWAs and an early senescence-like
membrane associated protein of unknown function, is                         phenotype finally leading to leaf cell death [43,57,79].
very similar to that of pmr6, highlighting the role of cell                 Thus, MLO is both a host susceptibility factor and a cell
wall composition in susceptibility to PM fungi [65]. This                   death control element underscoring a link between host
is also supported by the finding that the broad spectrum                     cell survival and susceptibility to the biotrophic fungus
and PM resistant Arabidopsis mutant constitutive                            Bgh. However, the molecular basis of how the barley
expressor of vegetative storage protein 1, cev1, is affected                 PM fungus takes advantage of MLO is not understood
in the cellulose synthase gene A3 [66]. Arabidopsis pmr4                    [5]. Together with other findings, the fact that Bgh grows
mutants differ substantially from pmr5 and pmr6 mu-                          on null-mlo ror genotypes indicates that MLO is not
tants in that resistance includes late cell death reactions,                simply a factor needed by Bgh to recognize its host,
defence gene expression and SA signalling [62,67].                          but rather a negative regulator of local defence
PMR4 is a glucan synthase, also independently identi-                       responses triggered by Bgh [56]. Recently, barley YFP-
fied as GLS5. PMR4 is responsible for callose deposi-                        labelled MLO was shown to accumulate focally beneath
tion at wound sites and in CWAs. Thus, PMR4 itself                          fungal appressoria, where it interacts in planta with cal-
seems to down-regulate SA-dependent defence. It might                       modulin. MLO accumulation appeared independently
be that appropriate PM fungi have evolved a strategy to                     of actin, supporting the view that it accumulates early
utilize PMR4 to suppress intracellular defence signal-                      in plasma membrane microdomains, thus defining an
ling, which is derepressed in the absence of PMR4                           entry gate for Bgh [60].
[67,68].                                                                         Additionally, some reverse genetics strategies have
    The Arabidopsis enhanced disease resistant 1 (edr1)                     been successful in identifying potential host susceptibil-
mutant also shows SA-dependent late acting mildew                           ity factors. Candidate genes (Table 1, Fig. 1) were
14                                 R. Huckelhoven / FEMS Microbiology Letters 245 (2005) 9–17
                                       ¨

either identified by differential expression analyses in             defence or to promote haustorium establishment in sus-
plants, or intuitively. Candidates were either transiently         ceptible backgrounds, or both [51].
knocked down or over-expressed in susceptible barley                  Studying the complex interaction of plants with PM
or wheat backgrounds. This led to modulation of acces-             fungi draws a fascinating picture of cell biology and
sibility to B. graminis. Some genes, including a vacuolar          molecular interplay of host and parasite. In particular,
peroxidase, a WRKY transcription factor, a potential               host genetics and in planta functional analyses have re-
membrane protein (WIR1), and a receptor-like kinase,               cently provided fascinating views of susceptibility fac-
were found to enhance accessibility when over-                     tors. Future research will hopefully provide more
expressed or to reduce accessibility when knocked down,            insights into the mechanisms of susceptibility and the
or both [80–83,85–87]. Since the majority of genes                 parasiteÕs strategy to target host factors for establish-
tested have no effect in this complex system, these genes           ment and maintenance of compatibility.
can be considered as potential host susceptibility fac-
tors (Table 1). Out of the genes tested, barley RACB
and BAX Inhibitor-1 (BI-1) are the ones studied most               Acknowledgements
intensively with regard to the mechanism of induced
susceptibility. Barley BI-1 cDNA was isolated in an ap-               I am grateful to Holger Schultheiss for critical read-
proach seeking cell-death suppressor proteins, which               ing of the manuscript and to Ralph Panstruga (Max
might regulate PM resistance similar to MLO. Since                 Planck Institute for Plant Breeding Research, Cologne,
post-penetration cell survival is linked with induced              Germany) John Vogel (USDA Western Regional Re-
accessibility even in mlo-genotypes [16], cell survival            search Center, Albany, USA), Shauna Somerville
factors such as BI-1 might be involved in cellular acces-          (Department of Plant Biology, Carnegie Institution,
sibility. Leaf BI-1 expression was found to be up-regu-            Stanford, USA,), Christopher Ridout (John Innes Cen-
lated by Bgh and systemically down-regulated after                 tre, Norwich, UK) and Christina Eckey (University of
root treatment with the chemical resistance inducer                Giessen, Germany) for communicating unpublished re-
2,6-dichloroisonicotinic acid [83]. Single cell transient          sults. I apologize for the arbitrary selection of literature
over-expression of BI-1 rendered cells more accessible             cited but limited space forced me to restrict references to
to penetration by Bgh and restored accessibility in resis-         some recent publications. I refer the willing reader to
tant mlo-lines [83]. Until now, direct evidence of a role          more general surveys as published, for instance, in the
for endogenously expressed BI-1 in susceptibility is                                                                   ´
                                                                   book ‘‘The Powdery Mildews’’ edited by R.R. Belanger,
lacking, since transient BI-1 knock down is only slightly          W.R. Bushnell, A.J. Dik, and T.L.W. Carver, and pub-
effective [83]. However BI-1, like MLO over-expression,             lished in St. Paul, Minnesota, USA.
partially breached barley nonhost resistance to the
wheat PM fungus B. graminis f.sp. tritici, and this could
not be further enhanced by simultaneous over-expres-               References
sion of both proteins [77]. Together, this led to the
assumption that BI-1 over-expression substitutes for                [1] Heath, M.C. (1981) A generalized concept of host–parasite
MLO functions in barley B. graminis interactions, and                   specificity. Phytopathology 71, 1121–1123.
                                                                    [2] Thordal-Christensen, H. (2003) Fresh insights into processes of
might act independently or downstream of MLO as a
                                                                        nonhost resistance. Curr. Opin. Plant Biol. 6, 351–357.
suppressor of penetration resistance [77,83].                       [3] Gomez-Gomez, L. and Boller, T. (2002) Flagellin perception: a
   Small RAC/ROP GTPases, such as barley RACB,                          paradigm for innate immunity. Trends Plant Sci. 7, 251–256.
are involved in hormone signalling, regulation of OÅÀ    2          [4] Nurnberger, T. and Brunner, F. (2002) Innate immunity in plants
                                                                          ¨
generating NADPH oxidases, Ca2+ signalling and actin                    and animals: emerging parallels between the recognition of
                                                                        general elicitors and pathogen-associated molecular patterns.
remodelling [84]. Transiently induced gene silencing of
                                                                        Curr. Opin. Plant Biol. 5, 318–324.
barley RACB enhanced penetration resistance to Bgh                  [5] Schulze-Lefert, P. and Panstruga, R. (2003) Establishment of
[85,86]. In contrast, single-cell over-expression of consti-            biotrophy by parasitic fungi and reprogramming of host cells for
tutively activated RACB mutant RACB-G15V en-                            disease resistance. Annu. Rev. Phytopathol. 41, 641–667.
hanced accessibility to Bgh [86]. Both knock down and               [6] Beißmann, B. and Kogel, K.H. (1992) Identification and charac-
RACB-G15V mutant effects on susceptibility were                          terization of suppressors In: Modern Methods in Plant Analysis
                                                                        (Linskens, H.F. and Jackson, J.F., Eds.), vol. 13, pp. 259–275.
dependent on either ROR1 or MLO, which suggests that                    Springer, Berlin, Heidelberg, New York.
RACB modulates an intrinsic defence pathway [85,86].                [7] Moerschbacher, B.M., Mierau, M., Graessner, B., Noll, U. and
Furthermore, activated RACB partly inhibited actin fil-                  Mort, A.J. (1999) Small oligomers of galacturonic acid are
ament focusing towards sites of attempted penetration                   endogenous suppressors of disease resistance reactions in wheat
                                                                        leaves. J. Exp. Bot. 50, 605–612.
whereas RACB knock down and mlo-mutations pro-
                                                                    [8] Abramovitch, R.B., Kim, Y.J., Chen, S., Dickman, M.B. and
moted it [51]. Since actin remodelling takes part in                    Martin, G.B. (2003) Pseudomonas type III effector AvrPtoB
CWA formation and haustoria establishment, Bgh                          induces plant disease susceptibility by inhibition of host pro-
might have corrupted RACB to antagonize local                           grammed cell death. EMBO J. 22, 60–69.
                                          R. Huckelhoven / FEMS Microbiology Letters 245 (2005) 9–17
                                              ¨                                                                                               15

 [9] Bouarab, K., Melton, R., Peart, J., Baulcombe, D. and Osbourn, A.    [26] Zhang, Z., Priddey, G. and Gurr, S.J. (2001) The barley powdery
     (2002) A saponin-detoxifying enzyme mediates suppression of plant         mildew protein kinase C gene, pkc 1 and pkc-like gene are
     defences. Nature 418, 889–892.                                            differentially expressed during morphogenesis. Mol. Plant Pathol.
[10] Shiraishi, T., Yamada, T., Ichinose, Y., Kiba, A., Toyoda, K.,            2, 327–337.
     Kato, T., Murakami, Y. and Seki, H. (1999) Suppressor as a           [27] Zhang, Z., Henderson, C. and Gurr, S.J. (2004) Blumeria graminis
     factor determining plant–pathogen specificity In: Plant–Microbe            secretes an extracellular catalase during infection of barley:
     Interactions (Stacey, G. and Keen, N.T., Eds.), vol. 4, pp. 121–          potential role in suppression of host defence. Mol. Plant Pathol.
     161. APS Press, St. Paul, Minnesota.                                      5, 537–547.
[11] Braun, U., Cook, R.T.A., Imman, A.J. and Shin, H.D. (2002) The       [28] Bindslev, L., Kershaw, M.J., Talbot, N.J. and Oliver, R.P. (2001)
     taxonomy of the powdery mildew fungi. In: The Powdery                     Complementation of the Magnaporthe grisea deltacpkA mutation
                  ´
     Mildews (Belanger, R.R., Bushnell, W.R., Dik, A.J. and Carver,            by the Blumeria graminis PKA-c gene: functional genetic analysis
     T.L.W. Eds.), pp. 13–55. St. Paul, Minnesota.                             of an obligate plant pathogen. Mol. Plant–Microbe Interact. 14,
[12] Green, J.R., Carver, T.L.W. and Gurr, S.J. (2002) The formation           1368–1375.
     and function of infection structures. In: The Powdery Mildews        [29] Kinane, J. and Oliver, R.P. (2003) Evidence that the appressorial
        ´
     (Belanger, R.R., Bushnell, W.R., Dik, A.J. and Carver, T.L.W.             development in barley powdery mildew is controlled by MAP
     Eds.), pp. 66–82. St. Paul, Minnesota.                                    kinase activity in conjunction with the cAMP pathway. Fungal
[13] Caldo, R.A., Nettleton, D. and Wise, R.P. (2004) Interaction-             Genet. Biol. 39, 94–102.
     dependent gene expression in MLA-specified response to barley         [30] Wilson, T.J., Thomsen, K.K., Petersen, B.O., Duus, J.A. and ˜
     powdery mildew. Plant Cell 16, 2514–2528.                                 Oliver, R.P. (2003) Detection of 3-hydroxykynurenine in a plant
[14] Gjetting, T., Carver, T.L., Skot, L. and Lyngkjaer, M.F. (2004)           pathogenic fungus. Biochem. J. 371, 783–788.
     Differential gene expression in individual papilla-resistant and      [31] Thordal-Christensen, H., Zhang, Z., Wei, Y. and Collinge, D.B.
     powdery mildew-infected barley epidermal cells. Mol. Plant–               (1997) Subcellular localization of H2O2 in plants. H2O2 accumu-
     Microbe Interact. 17, 729–738.                                            lation in papillae and hypersensitive response during the barley–
[15] Waspi, U., Schweizer, P. and Dudler, R. (2001) Syringolin
        ¨                                                                      powdery mildew interaction. Plant J. 11, 1187–1194.
     reprograms wheat to undergo hypersensitive cell death in a           [32] Dodds, P.N., Lawrence, G.J., Catanzariti, A.M., Ayliffe, M.A.
     compatible interaction with powdery mildew. Plant Cell 13, 153–           and Ellis, J.G. (2004) The Melampsora lini AvrL567 avirulence
     161.                                                                      genes are expressed in haustoria and their products are recognized
[16] Lyngkjær, M.F. and Carver, T.L.W. (2000) Conditioning of                  inside plant cells. Plant Cell 16, 755–768.
     cellular defence responses to powdery mildew in cereal leaves by     [33] Ridout, C.J. (2004) How powdery mildew becomes virulent. In:
     prior attack. Mol. Plant Pathol. 1, 41–49.                                Proceedings of the 11th International Cereal Rusts and Powdery
[17] Koga, H., Bushnell, W.R. and Zeyen, R.J. (1990) Specificity of             Mildews Conference, Norwich, England, 22–27 August 2004,
     cell type and timing of events associated with papilla formation          abstract 1.45, Cereal Rusts and Powdery Mildews Bulletin.
     and the hypersensitive reaction in leaves of Hordeum vulgare              [Available from: www.crpmb.org/icrpmc11/abstracts.htm].
     attacked by Erysiphe graminis f.sp. hordei. Can. J. Bot. 68, 2344–   [34] Backes, G., Madsen, L.H., Jaiser, H., Stougaard, J., Herz, M.,
     2352.                                                                     Mohler, V. and Jahoor, A. (2003) Localisation of genes for
[18] Fotopoulos, V., Gilbert, M.J., Pittman, J.K., Marvier, A.C.,              resistance against Blumeria graminis f.sp. hordei and Puccinia
     Buchanan, A.J., Sauer, N., Hall, J.L. and Williams, L.E. (2003)           graminis in a cross between a barley cultivar and a wild barley
     The monosaccharide transporter gene, AtSTP4, and the cell-wall            (Hordeum vulgare ssp. spontaneum) line. Theor. Appl. Genet. 106,
     invertase, Atbetafruct1, are induced in Arabidopsis during                353–362.
     infection with the fungal biotroph Erysiphe cichoracearum. Plant     [35] Wilson, I.W., Schiff, C.L., Hughes, D.E. and Somerville, SC.
     Physiol. 132, 821–829.                                                    (2001) Quantitative trait loci analysis of powdery mildew disease
[19] Sutton, P.N., Henry, M.J. and Hall, J.L. (1999) Glucose, and not          resistance in the Arabidopsis thaliana accession kashmir-1. Genet-
     sucrose, is transported from wheat to wheat powdery mildew.               ics 158, 1301–1309.
     Planta 208, 426–430.                                                 [36] Jørgensen, J.H. (1994) Genetics of powdery mildew resistance in
[20] Chaure, P., Gurr, S.J. and Spanu, P. (2000) Stable transformation         barley. Crit. Rev. Plant Sci. 13, 97–119.
     of Erysiphe graminis an obligate biotrophic pathogen of barley.      [37] Zeyen, R.J., Carver, T.L.W. and Lyngkjaer, M.F. (2002) Epider-
     Nat. Biotechnol. 18, 205–207.                                                                                                 ´
                                                                               mal cell papillae. In: The Powdery Mildews (Belanger, R.R.,
[21] Hall, A.A., Bindslev, L., Rouster, J., Rasmussen, S.W., Oliver,           Bushnell, W.R., Dik, A.J. and Carver, T.L.W. Eds.), pp. 107–124.
     R.P. and Gurr, S.J. (1999) Involvement of cAMP and protein                St. Paul, Minnesota.
     kinase A in conidial differentiation by Erysiphe graminis f.sp.       [38] von Ropenack, E., Parr, A. and Schulze-Lefert, P. (1998)
                                                                                       ¨
     hordei. Mol. Plant–Microbe Interact. 12, 960–968.                         Structural analyses and dynamics of soluble and cell wall-bound
[22] Hall, A.A. and Gurr, S.J. (2000) Initiation of appressorial germ          phenolics in a broad spectrum resistance to the powdery mildew
     tube differentiation and appressorial hooking: distinct morpho-            fungus in barley. J. Biol. Chem. 272, 9013–9022.
     logical events regulated by cAMP signalling in Blumeria graminis     [39] Bradley, D.J., Kjellbom, P. and Lamb, C.J. (1992) Elicitor- and
     f.sp. hordei. Physiol. Mol. Plant Pathol. 56, 39–46.                      wound-induced oxidative cross-linking of a proline-rich plant cell
[23] Thomas, S.W., Rasmussen, S.W., Glaring, M.A., Rouster, J.A.,              wall protein: a novel rapid defense response. Cell 70, 21–30.
     Christiansen, S.K. and Oliver, R.P. (2001) Gene identification in     [40] Olson, P.D. and Varner, J.E. (1993) Hydrogen peroxide and
     the obligate fungal pathogen Blumeria graminis by expressed               lignification. Plant J. 4, 887–892.
     sequence tag analysis. Fungal Genet. Biol. 33, 195–211.              [41] Huckelhoven, R., Fodor, J., Preis, C. and Kogel, K.-H. (1999)
                                                                                  ¨
                                              ˆ
[24] Both, M., Eckert, S.E., Csukai, M., Muller, E., Dimopoulos, G.            Hypersensitive cell death and papilla formation in barley
     and Spanu, P.D. (2005) Transcript profiles of Blumeria graminis            attacked by the powdery mildew fungus are associated with
     development during infection reveal a cluster of genes that are           H2O2 but not with salicylic acid accumulation. Plant Physiol.
     potential virulence determinants. Mol. Plant–Microbe Interact.            119, 1251–1260.
     18, 125–133.                                                         [42] Huckelhoven, R., Trujillo, M. and Kogel, K.-H. (2000) Mutations
                                                                                  ¨
[25] Zhang, Z. and Gurr, S.J. (2001) Expression and sequence analysis          in Ror1 and Ror2 genes cause modification of hydrogen peroxide
     of the Blumeria graminis mitogen-activated protein kinase genes,          accumulation in mlo-barley under attack from the powdery
     mpk1 and mpk2. Gene 266, 57–65.                                           mildew fungus. Mol. Plant Pathol. 1, 287–292.
16                                          R. Huckelhoven / FEMS Microbiology Letters 245 (2005) 9–17
                                                ¨

[43] Piffanelli, P., Zhou, F., Casais, C., Orme, J., Jarosch, B.,                    Somerville, H. and Thordal-Christensen, H. (2004) The PEN1
     Schaffrath, U., Collins, N.C., Panstruga, R. and Schulze-Lefert,                Syntaxin defines a novel cellular compartment upon fungal attack
     P. (2002) The barley MLO modulator of defense and cell death is                and is required for the timely assembly of papilla. Mol. Biol. Cell.
     responsive to biotic and abiotic stress stimuli. Plant Physiol. 129,           15, 5118–5129.
     1076–1085.                                                              [60]   Bhat, R.A., Miklis, M., Schmelzer, E., Schulze-Lefert, P. and
[44] Huckelhoven, R. and Kogel, K.-H. (1998) Tissue-specific super-
        ¨                                                                           Panstruga, R. (2005) Recruitment and interaction dynamics of
     oxide generation at interaction sites in resistant and susceptible             plant penetration resistance components in a plasma membrane
     near-isogenic barley lines attacked by the powdery mildew fungus               micro-domain. Proc. Natl. Acad. Sci. USA 102, 3135–3140.
     (Erysiphe graminis f.sp. hordei). Mol. Plant–Microbe Interact. 11,      [61]   Rubiales, D., Niks, R.E., Carver, T.L., Ballesteros, J. and Martin,
     292–300.                                                                       A. (2001) Prospects for exploitation of disease resistance from
[45] Huckelhoven, R. and Kogel, K.-H. (2003) Reactive oxygen
        ¨                                                                           Hordeum chilense in cultivated cereals. Hereditas 135, 161–169.
     intermediates in plant–microbe interactions: who is who in              [62]   Frye, C.A. and Innes, R.W. (1998) An Arabidopsis mutant with
     powdery mildew resistance?. Planta 216, 891–902.                               enhanced resistance to powdery mildew. Plant Cell 10, 947–956.
[46] Trujillo, M., Kogel, K.-H. and Huckelhoven, R. (2004) Superox-
                                         ¨                                   [63]   Vogel, J. and Somerville, S. (2000) Isolation and characterization
     ide and hydrogen peroxide play different roles in non-host                      of powdery mildew-resistant Arabidopsis mutants. Proc. Natl.
     interactions of cereals and inappropriate formae speciales of                  Acad. Sci. USA 97, 1897–1902.
     Blumeria graminis. Mol. Plant–Microbe Interact. 17, 304–312.            [64]   Vogel, J.P., Raab, T.K., Schiff, C. and Somerville, S.C. (2002)
[47] Patent WO 2004009820. (2004) Methods for obtaining the                         PMR6 a pectate lyase-like gene required for powdery mildew
     pathogenic resistance in plants.                                               susceptibility in Arabidopsis. Plant Cell 14, 2095–2106.
[48] Liszkay, A., Kenk, B. and Schopfer, P. (2003) Evidence for the          [65]   Vogel, J.P., Raab, T.K., Somerville, C.R. and Somerville, S.C.
     involvement of cell wall peroxidase in the generation of hydroxyl              (2004) Mutations in PMR5 result in powdery mildew resistance
     radicals mediating extension growth. Planta 217, 658–667.                      and altered cell wall composition. Plant J. 40, 968–978.
[49] Jabs, T., Dietrich, R.A. and Dangl, J.L. (1996) Initiation of           [66]   Ellis, C., Karafyllidis, I., Wasternack, C. and Turner, J.G. (2002)
     runaway cell death in an Arabidopsis mutant by extracellular                   The Arabidopsis mutant cev1 links cell wall signaling to jasmo-
     superoxide. Science 273, 1853–1856.                                            nate and ethylene responses. Plant Cell 14, 1557–1566.
[50] Kobayashi, Y., Kobayashi, I., Funaki, Y., Fujimoto, S., Takem-          [67]   Nishimura, M.T., Stein, M., Hou, B.H., Vogel, J.P., Edwards, H.
     oto, T. and Kunoh, H. (1997) Dynamic reorganization of                         and Somerville, S.C. (2003) Loss of a callose synthase results in
     microfilaments and microtubules is necessary for the expression                 salicylic acid-dependent disease resistance. Science 301, 969–972.
     of non-host resistance in barley coleoptile cells. Plant J. 11, 525–    [68]   Jacobs, A.K., Lipka, V., Burton, R.A., Panstruga, R., Strizhov,
     537.                                                                           N., Schulze-Lefert, P. and Fincher, G.B. (2003) An Arabidopsis
[51] Opalski, K.S., Schultheiss, H., Kogel, K.-H. and Huckelhoven, R.
                                                           ¨                        callose synthase, GSL5, is required for wound and papillary
     (2005) The receptor-like MLO protein and the RAC/ROP family                    callose formation. Plant Cell 15, 2503–2513.
     G-protein RACB modulate actin reorganization in barley                  [69]   Frye, C.A., Tang, D. and Innes, R.W. (2001) Negative regulation
     attacked by the biotrophic powdery mildew fungus Blumeria                      of defense responses in plants by a conserved MAPKK kinase.
     graminis f.sp. hordei. Plant J. 41, 291–303.                                   Proc. Natl. Acad. Sci. USA 98, 373–378.
[52] Takemoto, D. and Hardham, A.R. (2004) The cytoskeleton as a             [70]   Tang, D. and Innes, R.W. (2002) Overexpression of a kinase-
     regulator and target of biotic interactions in plants. Plant Physiol.          deficient form of the EDR1 gene enhances powdery mildew
     136, 3864–3876.                                                                resistance and ethylene-induced senescence in Arabidopsis. Plant
[53] Mellersh, D.G., Foulds, I.V., Higgins, V.J. and Heath, M.C.                    J. 32, 975–983.
     (2002) H2O2 plays different roles in determining penetration             [71]   Buschges, R., Hollricher, K., Panstruga, R., Simons, G., Wolter,
                                                                                      ¨
     failure in three diverse plant–fungal interactions. Plant J. 29, 257–          M., Frijters, A., van Daelen, R., van der Lee, T., Diergaarde, P.,
     268.                                                                           Groenendijk, J., Topsch, S., Vos, P., Salamini, F. and Schulze-
                                                                                                          ¨
[54] Yun, B.W., Atkinson, H.A., Gaborit, C., Greenland, A., Read,                   Lefert, P. (1997) The barley Mlo gene: a novel control element of
     N.D., Pallas, J.A. and Loake, G.J. (2003) Loss of actin cytoskel-              plant pathogen resistance. Cell 88, 695–705.
     etal function and EDS1 activity, in combination, severely com-          [72]   Devoto, A., Piffanelli, P., Nilsson, I., Wallin, E., Panstruga, R.,
     promises non-host resistance in Arabidopsis against wheat                      von Heijne, G. and Schulze-Lefert, P. (1999) Topology, subcel-
     powdery mildew. Plant J. 34, 768–777.                                          lular localisation, sequence diversity of the Mlo family in plants. J.
[55] Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S.,                    Biol. Chem. 274, 34993–35004.
     Kombrink, E., Qiu, J.-L., Huckelhoven, R., Stein, M., Fre-
                                      ¨                                      [73]   Kim, M.C., Panstruga, R., Elliott, C., Muller, J., Devoto, A.,
     ialdenhoven, A., Somerville, S.C. and Schulze-Lefert, P. (2003)                Yoon, H.W., Park, H.C., Cho, M.J. and Schulze-Lefert, P. (2002)
     SNARE-protein-mediated disease resistance at the plant cell wall.              Calmodulin interacts with MLO protein to regulate defence
     Nature 425, 973–977.                                                           against mildew in barley. Nature 416, 447–451.
[56] Freialdenhoven, A., Peterhansel, C., Kurth, J., Kreuzaler, F. and
                                  ¨                                          [74]   Elliott, C., Muller, J., Miklis, M., Bhat, R.A., Schulze-Lefert, P.
                                                                                                    ¨
     Schulze-Lefert, P. (1996) Identification of genes required for the              and Panstruga, R. (2005) Conserved extracellular cysteine resi-
     function of non-race-specific mlo resistance to powdery mildew in               dues and cytoplasmic loop–loop interplay are required for
     barley. Plant Cell 8, 5–14.                                                    functionality of the heptahelical MLO protein. Biochem J. 385,
[57] Peterhansel, C., Freialdenhoven, A., Kurth, J., Kolsch, R. and
            ¨                                                                       243–254.
     Schulze-Lefert, P. (1997) Interaction analyses of genes required        [75]   Shirasu, K., Nielsen, K., Piffanelli, P., Oliver, R. and Schulze-
     for resistance responses to powdery mildew in barley reveal                    Lefert, P. (1999) Cell-autonomous complementation of mlo
     distinct pathways leading to leaf cell death. Plant Cell 9, 1397–              resistance using a biolistic transient expression system. Plant J.
     1409.                                                                          17, 293–300.
[58] Trujillo, M., Troeger, M., Niks, R., Kogel, K-H. and Huckelho-
                                                                  ¨          [76]   Elliott, C., Zhou, F., Spielmeyer, W., Panstruga, R. and Schulze-
     ven, R. (2004) Mechanistic and genetic overlap of barley host and              Lefert, P. (2002) Functional conservation of wheat and rice Mlo
     non-host resistance to Blumeria graminis. Mol. Plant Pathol. 5,                orthologs in defense modulation to the powdery mildew fungus.
     389–396.                                                                       Mol. Plant–Microbe Interact. 15, 1069–1077.
[59] Assaad, F.F., Qiu, J.L., Youngs, H., Ehrhardt, D., Zimmerli, L.,        [77]   Eichmann, R., Schultheiss, H., Kogel, K.-H. and Huckelhoven,
                                                                                                                                            ¨
     Kalde, M., Wanner, G., Peck, S.C., Edwards, H., Ramonell, K.,                  R. (2004) The barley apoptosis suppressor homologue Bax
                                            R. Huckelhoven / FEMS Microbiology Letters 245 (2005) 9–17
                                                ¨                                                                                               17

       Inhibitor-1 compromises nonhost penetration resistance of barley      [82] Schweizer, P., Pokorny, J., Abderhalden, O. and Dudler, R.
       to the inappropriate pathogen Blumeria graminis f.sp. tritici. Mol.        (1999) A transient assay system for the functional assessment of
       Plant–Microbe Interact. 17, 484–490.                                       defense-related genes in wheat. Mol. Plant–Microbe Interact. 12,
[78]   Consonni, C., Hartmann, H.A., Schulze-Lefert, P. and Panstruga,            647–654.
       R. (2004) An Arabidopsis Mlo knock-out mutant phenocopies the         [83] Huckelhoven, R., Dechert, C. and Kogel, K.-H. (2003) Overex-
                                                                                    ¨
       barley mlo broad-spectrum powdery mildew resistance pheno-                 pression of barley BAX inhibitor 1 induces breakdown of mlo-
       type. In: Proceedings of the 11th International Cereal Rusts and           mediated penetration resistance to Blumeria graminis. Proc. Natl.
       Powdery Mildews Conference, Norwich, England, 22–27 August                 Acad. Sci. USA 100, 5555–5560.
       2004, abstract 2.56, Cereal Rusts and Powdery Mildews Bulletin.       [84] Gu, Y., Wang, Z. and Yang, Z. (2004) ROP/RAC GTPase: an old
       [Available from: www.crpmb.org/icrpmc11/abstracts.htm].                    new master regulator for plant signaling. Curr. Opin. Plant Biol.
[79]   Wolter, M., Hollricher, K., Salamini, F. and Schulze-Lefert, P.            7, 527–536.
       (1993) The mlo resistance alleles to powdery mildew infection in      [85] Schultheiss, H., Dechert, C., Kogel, K.-H. and Huckelhoven, R.
                                                                                                                                        ¨
       barley trigger a developmentally controlled defence mimic                  (2002) A small GTP-binding host protein is required for entry of
       phenotype. Mol. Gen. Genet. 239, 122–128.                                  powdery mildew fungus into epidermal cells of barley. Plant
[80]   Eckey, C., Korell, M., Leib, K., Biedenkopf, D., Jansen, C.,               Physiol. 128, 1447–1454.
       Langen, G. and Kogel, K.-H. (2004) Identification of powdery           [86] Schultheiss, H., Dechert, C., Kogel, K.H. and Huckelhoven, R.
                                                                                                                                        ¨
       mildew-induced barley genes by cDNA-AFLP: functional assess-               (2003) Functional analysis of barley RAC/ROP G-protein family
       ment of an early expressed map kinase. Plant Mol. Biol. 55, 1–15.          members in susceptibility to the powdery mildew fungus. Plant J.
[81]   Kristensen, B.K., Ammitzbøll, H., Rasmussen, S.K. and Nielsen,             36, 589–601.
       K.A. (2001) Transient expression of a vacuolar peroxidase             [87] Schweizer, P., Pokorny, J., Schulze-Lefert, P. and Dudler, R.
       increases susceptibility of epidermal barley cells to powdery              (2000) Double-stranded RNA interference with gene function at
       mildew. Mol. Plant Pathol. 2, 311–317.                                     the single-cell level in cereals. Plant J. 24, 895–903.
                                            FEMS Microbiology Letters 245 (2005) 19–24
                                                                                                                   www.fems-microbiology.org




      Genotypic characterization of Burkholderia cenocepacia strains
             by rep-PCR and PCR–RFLP of the fliC gene
                                          Sang-Tae Seo 1, Kenichi Tsuchiya                        *

                     Division of Microbiology, National Institute for Agro-Environmental Sciences, Tsukuba 305-8604, Japan

                          Received 7 July 2004; received in revised form 19 October 2004; accepted 8 February 2005

                                                     First published online 2 March 2005

                                                            Edited by C.W. Penn




Abstract

   Thirty-five strains of Burkholderia cenocepacia from clinical and environmental sources were characterized genotypically by
repetitive sequence PCR (ERIC- and BOX-PCR) and polymerase chain reaction–restriction fragment length polymorphism
(PCR–RFLP) analysis of the flagellin gene (fliC). In cluster analysis based on the repetitive PCR profiles the strains were composed
of five clusters, of which clusters 1, 2 and 3 were more closely related to each other than to clusters 4 and 5. It has been reported that
the majority of Burkholderia cepacia complex strains can be separated into two types on the basis of fliC size (types I and II cor-
respond to 1.4 and 1.0 kb, respectively). When the strains were analysed by PCR of fliC, all strains yielded amplified products of
1.0 kb except for three strains. The latter strains gave PCR products of 0.7 kb (atypical type), which belonged to repetitive PCR
cluster 5. These results indicated that the majority of B. cenocepacia strains belonged to flagellin type II. In the RFLP analysis
of the large fliC amplicons with HaeIII, 10 patterns were observed indicating remarkable variation. Strains grouping in repetitive
PCR cluster 4 had a unique fliC RFLP pattern. The results of repetitive PCR typing and PCR–RFLP analysis of fliC showed a
strong correlation. Strains belonging to the repetitive PCR clusters 4 or 5 were distinctly different from other B. cenocepacia strains
as shown by PCR–RFLP analysis of the fliC gene and phenotypic assays.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Burkholderia cenocepacia; Rep-PCR; RFLP; fliC




1. Introduction                                                           (genomovar I), Burkholderia multivorans (genomovar
                                                                          II), Burkholderia cenocepacia (genomovar III), Burk-
   Bacteria belonging to the Burkholderia cepacia com-                    holderia stabilis (genomovar IV), Burkholderia vietnami-
plex are important opportunist pathogens, particularly                    ensis (genomovar V), B. cepacia genomovar VI,
in relation to patients suffering from cystic fibrosis                      Burkholderia ambifaria (genomovar VII), Burkholderia
(CF) [1,2]. B. cepacia complex strains could also be con-                 anthina (genomovar VIII) and Burkholderia pyrrocinia
sidered as a possible agent of biocontrol or bioremedia-                  (genomovar IX) [6–9]. Although all the species have
tion [3–5]. The B. cepacia complex comprises at least                     been isolated from clinical specimens, infection with B.
nine closely related species or genomovars: B. cepacia                    cenocepacia represents a significant clinical risk to pa-
                                                                          tients with CF [10,11]. Two distinct recA-based phyloge-
 *
                                                                          netic subgroups were found within B. cenocepacia (III-A
   Corresponding author. Tel.:/fax: +81 29 838 8268.
   E-mail address: kentsuch@affrc.go.jp (K. Tsuchiya).
                                                                          and III-B subgroups) [12]. Recent studies have shown
 1
   Present address: Horticultural Environment Division, National          that B. cenocepacia is also present in various environ-
Horticultural Research Institute, Suwon 441-440, Korea.                   mental niches [13].

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.020
20                                   S.-T. Seo, K. Tsuchiya / FEMS Microbiology Letters 245 (2005) 19–24

   It is important to determine the diversity of B. ceno-                tionships between 35 strains, identified as B. cenocepacia
cepacia from clinical and environmental origin for                       by RFLP analysis of 16S rRNA and recA genes, and
assessing the risk associated with the use of environmen-                recA-based genomovar specific-PCR, isolated from clin-
tal isolates as an agent of biocontrol or bioremediation.                ical and environmental sources [19]. Subsequently,
However, little information is available on the degree of                strains were analyzed by phenotypic tests and the results
phenotypic and genetic diversity among B. cenocepacia                    were compared to each other.
strains of different origin, especially in Asia. A number
of methods have been used to establish relationships
within the B. cepacia complex, including phenotypic as-                  2. Materials and methods
says and PCR-based fingerprinting techniques including
repetitive sequence PCR (rep-PCR) and restriction frag-                  2.1. Bacterial strains
ment length polymorphism (RFLP) [14–18].
   In the present study, we compared results obtained                      The bacterial strains used in this study are listed in
with rep-PCR (ERIC-PCR and BOX-PCR) and PCR–                             Table 1. Strains were maintained by freezing in a med-
RFLP of the flagellin gene (fliC) for establishing rela-                   ium containing 10% skimmed milk supplemented with


Table 1
Strains of Burkholderia cenocepacia used in this study
Straina           Sourceb                                     Geographical origin    recA RFLPc     esmRc    rep-PCR clusterd    fliC RFLPe
Pc C-61           Clinical (Shigeta, S., FMU)                 Japan                  G              +        1                    1
Pc 1712           Clinical, urine (Yabuuchi, E., GUSM)        Japan                  G              +        1                    1
Pc 1751           Clinical, pus (Yabuuchi, E.)                Japan                  G              +        1                    1
Pc C-88           Clinical (Shigeta, S., FMU)                 Japan                  G              +        1                    2
Pc 2046           Clinical, spinal fluid (Yabuuchi, E.)        Japan                  G              +        1                    2
Pc 1115           Unknown (Yabuuchi, E.)                      Japan                  G              +        1                    2
Pc 1115R          Colony mutant of Pc 1115 (Tsuchiya, K.)     Japan                  G              +        1                    2
Pc 1151           Clinical, sputum (Yabuuchi, E.)             Japan                  G              +        1                    3
Pc KF1            Clinical (Nakazawa, T., YUSM)               Japan                  H              +        2                    4
Pc-1              Lettuce rhizosphere (Tsuchiya, K.)          Japan                  H              +        2                    4
MAFF 302528       Rice rhizosphere                            Japan                  H              +        2                    4
Pc 3018           Clinical, blood (Yabuuchi, E.)              Japan                  H              +        2                    5
Pc 3021           Clinical, blood (Yabuuchi, E.)              Japan                  H              +        2                    5
Pc 3030           Clinical, spinal fluid (Yabuuchi, E.)        Japan                  H              +        2                    5
nao 12            Onion (Takikawa, Y., SU)                    Japan                  H              À        2                    5
nao 13            Onion (Takikawa, Y.)                        Japan                  H              À        2                    5
Pc 342-43         Onion (DOA)                                 Thailand               H              À        2                    6
Pc 342-45         Onion (DOA)                                 Thailand               H              À        2                    6
Pc 342-46         Onion (DOA)                                 Thailand               H              À        2                    6
Pc 342-47         Onion (DOA)                                 Thailand               I              +        2                    8
Pc 342-48         Onion (DOA)                                 Thailand               I              +        2                    8
Pc-3              Lettuce rhizosphere                         Japan                  I              +        2                    9
Pc 722            Forest soil (Yabuuchi, E.)                  Japan                  I              +        2                   10
Pc A1             Cymbidium (Tsuchiya, K.)                    Japan                  H              +        3                    5
Pc A2             Cymbidium (Tsuchiya, K.)                    Japan                  H              +        3                    5
Pc A4             Cymbidium (Tsuchiya, K.)                    Japan                  H              +        3                    5
Pc A10            Cymbidium (Tsuchiya, K.)                    Japan                  H              +        3                    5
Pc A11            Cymbidium (Tsuchiya, K.)                    Japan                  H              +        3                    5
Pc JN1            Clinical (Nakazawa, T.)                     Japan                  H              À        4                    7
Pc JN6            Clinical (Nakazawa, T.)                     Japan                  H              À        4                    7
Pc JN25           Clinical (Nakazawa, T.)                     Japan                  H              À        4                    7
Pc 1211           Clinical, thermal injury (Yabuuchi, E.)     Japan                  H              À        4                    7
Pc 342-41         Onion (DOA)                                 Thailand               H              À        5                   À
Pc 342-42         Onion (DOA)                                 Thailand               H              À        5                   À
Pc 342-42W        Colony mutant of Pc342-42 (Tsuchiya, K.)    Thailand               H              À        5                   À
 a
    MAFF, Ministry of Agriculture, Forestry and Fisheries Genebank, Japan.
 b
    FMU, Fukushima Medical University (Fukushima, Japan); GUSM, Department of Microbiology, Gifu University (Japan); YUSM, Yamaguchi
University School of Medicine (Ube, Japan); SU, Shizuoka University (Shizuoka, Japan); DOA, Bacteriology Division, Department of Agriculture
(Bangkok, Thailand).
  c
    Data from Seo and Tsuchiya [19].
 d
    Cluster analysis on the basis of rep-PCR (ERIC- and BOX-PCR). See Fig. 1.
  e
    RFLP analysis of flagellin gene (fliC). See Fig. 2.
                               S.-T. Seo, K. Tsuchiya / FEMS Microbiology Letters 245 (2005) 19–24                         21

1.5% sodium glutamate at À70 °C. When required, each               3. Results and discussion
bacterial strain was cultured aerobically on YPDA
(yeast extract 3 g, peptone 0.6 g, dextrose 3 g, agar                  To our knowledge, this is the first extensive study in
15 g, in 1 l distilled water, pH 7.2) for 2 days at 28 °C.         which B. cenocepacia from clinical and environmental
                                                                   sources in Asia has been subjected to genetic fingerprint-
                                                                   ing to assess intraspecific diversity. Repetitive sequence
2.2. Molecular characterization
                                                                   PCR (rep-PCR) has increasingly been used for typing
                                                                   the B. cepacia complex [16]. In the present study, a
   Genomic DNA was prepared using InstaGene
                                                                   dendrogram of the 35 B. cenocepacia strains was con-
DNA purification matrix (Bio-Rad) according to man-
                                                                   structed based on the rep-PCR (ERIC- and BOX-
ufacturerÕs instructions. The rep-PCR method em-
                                                                   PCR) profiles (Fig. 1). Cluster analysis separated the
ployed was adapted from Louws et al. [20]. The
                                                                   strains into five clusters at squared distance 100 (Fig. 1
Enterobacterial Repetitive Intergenic Consensus
                                                                   and Table 1). Cluster 1 was composed of all 8 strains
(ERIC) and BOXA subunit (BOX) primer sets were
                                                                   belonging to recA RFLP pattern G. Cluster 2 contained
synthesized by Amersham Pharmacia Biotech (Tokyo,
                                                                   15 strains, which shared recA RFLP patterns H and I.
Japan). Amplification was performed in a total vol-
                                                                   Cluster 3 was composed of all five strains isolated from
ume of 25 ll containing 10 mM Tris–HCl (pH 8.3),
                                                                   Cymbidium. The five strains were first reported as a cau-
50 mM KCl, 1.5 mM MgCl2, 0.2 mM each dNTP,
                                                                   sal bacterium of bacterial brown spot disease of Cymbid-
50 pmol each primer, 2.5 units of DNA polymerase
                                                                   ium species [23]. Clusters 4 and 5 comprised 4 and 3
Takara Taq (Takara, Japan), and 2 ll of each DNA
                                                                   strains, which were isolated from clinical and environ-
sample prepared with matrix. PCR reactions were per-
                                                                   mental sources, respectively. All strains of clusters 3, 4
formed with a DNA thermal cycler (GeneAmp 9600,
                                                                   and 5 belonged to recA RFLP pattern H. Clusters 1, 2
Perkin–Elmer Applied Biosystems) under the following
                                                                   and 3 were more closely related to each other than to
conditions: 95 °C for 5 min for the first cycle, followed
                                                                   clusters 4 and 5 (Fig. 1). There was some concordance
by 30 cycles of 94°C for 1 min, 52°C for 1 min, and
                                                                   between recA RFLP patterns and rep-PCR clusters;
65°C for 8 min with a final extension step of 65°C
                                                                   for example, all strains of recA RFLP pattern G be-
for 15 min. PCR products were separated on 1.5%
                                                                   longed to rep-PCR cluster 1.
(w/v) agarose gels in 0.5 · Tris–Borate–EDTA (pH
                                                                       The fliC gene encoding the flagellin protein is a
8.0). Cluster analysis of the rep-PCR profiles was con-
                                                                   highly variable biomarker and has been used in epide-
ducted using the site http://aoki2.si.gunma-u.ac.jp/
                                                                   miologic studies [15,18]. Hales et al. [24] reported that
BlackBox.
                                                                   the majority of isolates of B. cepacia could be sepa-
   PCR–RFLP of the fliC gene was performed using
                                                                   rated into two types (types I and II) on the basis of fla-
primers BVF and fliCR [18]. The volume and content
                                                                   gellin protein size. Amplicon sizes of types I and II
of amplification reactions were as described above.
                                                                   were 1.4 and 1.0 kb, respectively. Atypical amplicon
Amplification was performed under the following condi-
                                                                   sizes (0.7, 1.6 and 1.9 kb) of the fliC genes have also
tions; 30 cycles of 1 min at 94 °C, 1 min at 58 °C, and
                                                                   been reported [18,24]. In this study, when the 35 strains
2 min at 72 °C. The amplification cycles were preceded
                                                                   were analyzed by PCR using primers BVF and fliCR,
by a denaturation step of 5 min at 95 °C and followed
                                                                   all strains yielded amplified products of ca. 1.0 kb (type
by an elongation step of 10 min at 72 °C. Amplified
                                                                   II) with the exception of three strains (Pc 342-41, Pc
product samples were digested with the restriction en-
                                                                   342-42 and Pc 342-42W), which gave PCR products
zyme HaeIII under the conditions recommended by
                                                                   of ca. 0.7 kb (atypical type) (Table 1). These three
the supplier (TOYOBO, Japan). The RFLP products
                                                                   strains all belonged to rep-PCR cluster 5. The results
were analyzed by electrophoresis in 2% (w/v) agarose
                                                                   of the fliC PCR indicated a predominance of type II
gels.
                                                                   flagellins in B. cenocepacia strains used in this study.
                                                                   RFLP analysis of the Type II amplicons with HaeIII
2.3. Phenotypic assays                                             separated 32 B. cenocepacia strains into 10 patterns
                                                                   (Fig. 2). Although only one endonuclease was used in
   Sodium dodecyl sulfate–polyacrylamide gel electro-              this study, there was a remarkable degree of variation
phoresis (SDS–PAGE) of the whole-cell proteins was                 in the fliC gene of B. cenocepacia. These results sup-
performed in a vertical slab gel with LaemmliÕs discon-            ported the idea that flagellin genotyping is a highly dis-
tinuous buffer system [21] and 12% polyacrylamide gels              criminatory method and can be used as an
(Perfect NT Gel, DRC, Tokyo, Japan). Preparation of                epidemiological tool for identification of isolates in
whole-cell proteins and SDS–PAGE were performed                    the B. cepacia complex [25].
as described previously [22]. Tests in the API 20NE were               In general, RFLP patterns of the fliC were largely
performed according to manufacturerÕs instructions                 in agreement with the grouping obtained by cluster
(BioMerieux, Marcy lÕEtoile, France).                              analysis of rep-PCR (Table 1). Strains grouping in
22                                     S.-T. Seo, K. Tsuchiya / FEMS Microbiology Letters 245 (2005) 19–24




Fig. 1. Illustration of genotyping methods with representative B. cenocepacia strains. ERIC-PCR (a), BOX-PCR (b) and dendrogram (c) were
produced as described in the text. Scale bar indicates squared distance. Lanes: 1, Pc C-61; 2, Pc 1712; 3, Pc 1751; 4, Pc 2046; 5, Pc 1151; 6, Pc C-88; 7,
Pc 1115; 8, Pc 1115R; 9, Pc KF1; 10, Pc 3018; 11, Pc 3021; 12, MAFF 302528; 13, nao 12; 14, nao 13; 15, Pc 342-43; 16, Pc 342-45; 17, Pc 342-46; 18,
Pc 3030; 19, Pc-1; 20, Pc A2; 21, Pc A4; 22, Pc A10; 23, Pc A1; 24, Pc A11; 25, Pc JN1; 26, Pc JN6; 27, Pc JN25; 28, Pc 1211; 29, Pc 342-41; 30, Pc 342-
42; 31, Pc 342-42W; 32, Pc 342-47; 33, Pc 342-48; 34, Pc 722 and 35, Pc-3. M, DNA size standard (100-bp ladder, Bayou Biolabs). The Roman
number above the lane numbers indicates the recA RFLP pattern of each strain.

rep-PCR cluster 1 belonged to fliC RFLP patterns 1, 2                            ing in rep-PCR cluster 4 had very similar random
and 3. Strains of rep-PCR cluster 4 showed a unique                             amplified polymorphism DNA patterns (data not
fliC RFLP pattern (pattern 7). The four strains group-                           shown). Interestingly, of all tested strains, only three
                                      S.-T. Seo, K. Tsuchiya / FEMS Microbiology Letters 245 (2005) 19–24                                            23

                                                                               cenocepacia strains (Fig. 3). Strains of rep-PCR clusters
                                                                               2 and 3 shared fliC RFLP pattern 5. Winstanley [18]
                                                                               reported that relationships shown by RFLP typing
                                                                               based on recA and fliC did not generally correlate with
                                                                               each other. However, our results showed a good rela-
                                                                               tionship between RFLP typing of recA and fliC (Table
                                                                               1); eight strains of recA RFLP pattern G belonged to
                                                                               fliC RFLP pattern 1, 2 and 3; 20 strains of recA RFLP
                                                                               pattern H belonged to fliC RFLP pattern 4, 5, 6 and 7;
                                                                               and 4 strains of recA RFLP pattern I belonged to fliC
                                                                               RFLP pattern 8, 9 and 10. From phenotypic and geno-
                                                                               typic characterization of the rep-PCR cluster 4 and 5
                                                                               strains, it became clear that these strains could belong
                                                                               to a distinct group within B. cenocepacia. Further stud-
                                                                               ies are required to clarify the status of these strains
                                                                               within the B. cepacia complex.
Fig. 2. RFLP analysis of the fliC gene amplified from B. cenocepacia                Previous studies indicated that strains of B. cepacia
strains. The DNA products of the fliC gene were digested with                   isolated from the rhizosphere differ markedly from their
restriction enzyme HaeIII. Lanes: 1, Pc C-61; 2, Pc C-88; 3, Pc 1751; 4,       clinical counterparts in various respects [14,17]. In our
Pc KF1; 5, Pc 3018; 6, Pc 342-43; 7, Pc JN1; 8, Pc 342-47; 9, Pc-3 and
                                                                               study, however, no obvious differences were detected be-
10, Pc 722. M, DNA size standard (100-bp ladder, Invitrogen). The
alphabetical recA RFLP types are shown above the lanes.                        tween B. cenocepacia from clinical and environmental
                                                                               sources. For example, rep-PCR cluster 2 comprised both
                                                                               clinical and environmental strains. Similarly, fliC RFLP
strains (Pc JN1, Pc JN6 and Pc JN25) belonging to                              patterns 4 and 5 contained strains representing different
cluster 4 were positive for assimilation of maltose. Sub-                      sources. Moreover, no distinct characteristics were de-
sequently, these strains showed a unique pattern on the                        tected among them based on the results of the API
basis of comparison of SDS–PAGE profiles of whole-                              20NE tests (data not shown). Therefore, their use as
cell proteins (lanes 25, 26 and 27 in Fig. 3). On the ba-                      an agent of biocontrol or bioremediation should be
sis of the protein profiles, no significant differences                           avoided, until accurate relationships between environ-
were detected between clinical and environmental B.                            mental and clinical strains are conclusively established.




Fig. 3. SDS–PAGE of whole-cell proteins of B. cenocepacia strains. Lanes: 1, Pc C-61; 2, Pc 1712; 3, Pc 1751; 4, Pc 2046; 5, Pc 1151; 6, Pc C-88; 7, Pc
1115; 8, Pc 1115R; 9, Pc KF1; 10, Pc 3018; 11, Pc 3021; 12, MAFF 302528; 13, nao 12; 14, nao 13; 15, Pc 342-43; 16, Pc 342-45; 17, Pc 342-46; 18, Pc
3030; 19, Pc-1; 20, Pc A2; 21, Pc A4; 22, Pc A10; 23, Pc A1; 24, Pc A11; 25, Pc JN1; 26, Pc JN6; 27, Pc JN25; 28, Pc 1211; 29, Pc 342-41; 30, Pc 342-42;
31, Pc 342-42W; 32, Pc 342-47; 33, Pc 342-48; 34, Pc 722 and 35, Pc-3. Molecular mass markers are indicated in kDa (Protein ladder, Invitrogen). The
alphabetical recA RFLP patterns are shown above the lanes.
24                                    S.-T. Seo, K. Tsuchiya / FEMS Microbiology Letters 245 (2005) 19–24

Acknowledgement                                                                  fibrosis: virulent transmissible strains of genomovar III can
                                                                                 replace Burkholderia multivorans. Clin. Infect. Dis. 33, 1469–1475.
                                                                          [12]   Mahenthiralingam, E., Bischof, J., Byrne, S.K., Radomski, C.,
   This work was supported in part by a Grant-in-Aid                             Davies, J.E., Av-Gay, Y. and Vandamme, P. (2000) DNA-based
for Scientific Research (B) (No.16380224) from the Ja-                            diagnostic approaches for the identification of Burkholderia
pan Society for the Promotion of Science.                                        cepacia complex, Burkholderia vietnamiensis, Burkholderia multiv-
                                                                                 orans, Burkholderia stabilis, Burkholderia cepacia genomovars I
                                                                                 and III. J. Clin. Microbiol. 38, 3165–3171.
                                                                          [13]   Balandreau, J., Viallard, V., Cournoyer, B., Coenye, T., Laevens,
References                                                                       S. and Vandamme, P. (2001) Burkholderia cepacia genomovar III
                                                                                 is a common plant-associated bacterium. Appl. Environ. Micro-
 [1] Govan, J.R.W. and Deretic, V. (1996) Microbial pathogenesis in              biol. 67, 982–985.
     cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia       [14]   Bevivino, A., Tabacchioni, S., Chiarini, L., Carusi, M.V., Del
     cepacia. Microbiol. Rev. 60, 539–574.                                       Gallo, M. and Visca, P. (1994) Phenotypic comparison between
 [2] Govan, J.R.W., Hughes, J.E. and Vandamme, P. (1996) Burk-                   rhizosphere and clinical isolates of Burkholderia cepacia. Micro-
     holderia cepacia: medical, taxonomic and ecological issues.                 biology 140, 1069–1077.
     J. Med. Microbiol. 45, 395–407.                                      [15]   Coenye, T. and LiPuma, J.J. (2002) Multilocus restriction typing:
 [3] Cartwright, D.K., Chilton, W.S. and Benson, D.M. (1995)                     a novel tool for studying global epidemiology of Burkholderia
     Pyrrolnitrin and phenazine production by Pseudomonas cepacia,               cepacia complex infection in cystic fibrosis. J. Infect. Dis. 185,
     strain 5.5B, a biocontrol agent of Rhizoctonia solani. Appl.                1454–1462.
     Microbiol. Biotechnol. 43, 211–216.                                  [16]   Coenye, T., Spilker, T., Martin, A. and LiPuma, J.J. (2002)
 [4] Huang, Y. and Wong, P.T.W. (1998) Effect of Burkholderia                     Comparative assessment of genotyping methods for epidemiol-
     (Pseudomonas) cepacia and soil type on the control of crown rot in          ogic study of Burkholderia cepacia genomovar III. J. Clin.
     wheat. Plant Soil 203, 103–108.                                             Microbiol. 40, 3300–3307.
 [5] Juhasz, A.L., Britz, M.L. and Stanley, G.A. (1996) Degradation       [17]   Wigley, P. and Burton, N.F. (1999) Genotypic and pheno-
     of high molecular weight polycyclic aromatic hydrocarbons by                typic relationships in Burkholderia cepacia isolated from cystic
     Pseudomonas cepacia. Biotechnol. Lett. 18, 577–582.                         fibrosis patients and the environment. J. Appl. Microbiol. 86,
 [6] Coenye, T., LiPuma, J.J., Henry, D., Hoste, B., Van-                        460–468.
     demeulebroecke, K., Gillis, M., Speert, D.P. and Vandamme, P.        [18]   Winstanley, C. (2003) Improved flagellin genotyping in the
     (2001) Burkholderia cepacia genomovar VI, a new member of the               Burkholderia cepacia complex. FEMS Microbiol. Lett. 229, 9–14.
     Burkholderia cepacia complex isolated from cystic fibrosis            [19]   Seo, S.T. and Tsuchiya, K. (2004) PCR-based identification and
     patients. Int. J. Syst. Evol. Microbiol. 51, 271–279.                       characterization of Burkholderia cepacia complex bacteria from
 [7] Coenye, T., Mahenthiralingam, E., Henry, D., LiPuma, J.J.,                  clinical and environmental sources. Lett. Appl. Microbiol. 39,
     Laevens, S., Gillis, M., Speert, D.P. and Vandamme, P. (2001)               413–419.
     Burkholderia ambifaria sp. nov., a novel member of the Burk-         [20]   Louws, F.J., Fulbright, D.W., Stephens, C.T. and de Brujin, F.J.
     holderia cepacia complex including biocontrol and cystic fibrosis            (1994) Specific genomic fingerprint of phytopathogenic Xantho-
     related isolates. Int. J. Syst. Evol. Microbiol. 51, 1481–1490.             monas and Pseudomonas pathovars and strains generated with
 [8] Vandamme, P., Henry, D., Coenye, T., Nzula, S., Vancanneyt,                 repetitive sequences and PCR. Appl. Environ. Microbiol. 60,
     M., LiPuma, J.J., Speert, D.P., Govan, J.R.W. and Mahenthir-                2286–2295.
     alingam, E. (2002) Burkholderia anthina sp. nov., Burkholderia       [21]   Laemmli, U.K. (1970) Cleavage of structural proteins during the
     pyrrocinia, two additional Burkholderia cepacia complex bacteria,           assembly of the head of bacteriophage. Nature 22, 680–685.
     may confound results of new molecular diagnostic tools. FEMS         [22]   Seo, S.T., Tsuchiya, K. and Murakami, R. (2004) Characteriza-
     Immunol. Med. Microbiol. 33, 143–149.                                       tion and differentiation of Erwinia carotovora strains from
 [9] Vandamme, P., Holmes, B., Coenye, T., Goris, J., Mahenthira-                mulberry trees. J. Gen. Plant Pathol. 70, 120–123.
     lingam, E., LiPuma, J.J. and Govan, J.R.W. (2003) Burkholderia       [23]   Tsuchiya, K., Akhter, T., Takasaki, T., Tanaka, S. and Wakim-
     cenocepacia sp. nov.-a new twist to an old story. Res. Microbiol.           oto, S. (1986) Bacterial brown spot disease of Cymbidium spp.
     154, 91–96.                                                                 caused by Pseudomonas cepacia. Ann. Phytopathol. Soc. Japan
[10] Holmes, A., Nolan, R., Taylor, R., Finley, R., Riley, M., Jiang,            52, 825–834.
     R.Z., Steinbach, S. and Goldstein, R. (1999) An epidemic of          [24]   Hales, B.A., Morgan, J.A.W., Hart, C.A. and Winstanley, C.
     Burkholderia cepacia transmitted between patients with and                  (1998) Variation in flagellin genes and proteins of Burkholderia
     without cystic fibrosis. J. Infect. Dis. 179, 1197–1205.                     cepacia. J. Bacteriol. 180, 1110–1118.
[11] Mahenthiralingam, E., Vandamme, P., Campbell, M.E., Henry,           [25]   Winstanley, C., Detsika, M.G., Glendinning, K.J., Parsons, Y.N.
     D.A., Gravelle, A.M., Wong, L.T., Davidson, A.G., Wilcox,                   and Hart, C.A. (2001) Flagellin gene PCR–RFLP analysis of a
     P.G., Nakielna, B. and Speert, D.P. (2001) Infection with                   panel of strains from the Burkholderia cepacia complex. J. Med.
     Burkholderia cepacia complex genomovars in patients with cystic             Microbiol. 50, 728–731.
                                             FEMS Microbiology Letters 245 (2005) 25–32
                                                                                                                   www.fems-microbiology.org




           DNA array analysis of Candida albicans gene expression in
                    response to adherence to polystyrene
        Veronique Marchais *,1, Marie Kempf 1, Patricia Licznar, Corinne Lefrancois,
         ´                                                                     ¸
                  Jean-Philippe Bouchara, Raymond Robert, Jane Cottin
                                          ˆ                                                                     ´                 ´
         Groupe dÕEtude des Interactions Hote-Parasite, UPRES EA 3142, UFR des Sciences Pharmaceutiques et dÕIngenierie de la Sante,
                                                  16 Bd Daviers, 49045 Angers Cedex, France

                        Received 2 December 2004; received in revised form 20 January 2005; accepted 8 February 2005

                                                      First published online 8 March 2005

                                                           Edited by M.J. Bidochka




Abstract

   Candidiasis is often initiated by the colonization of inert surfaces. In order to elucidate the mechanisms involved in this adherence
process, DNA macroarrays were used to analyze the transcriptome of Candida albicans, the main causative agent of this mycoses, in
a simple adherence model using germ tubes produced in polystyrene Petri dishes. Non-adherent germ tubes produced on glass sur-
face were used as a control. Analysis of gene expression displayed 77 genes identified as statistically overexpressed in adherent germ
tubes. Among these genes, some encoded enzymes participating in metabolism of lipids (such as LIP6), of proteins (such as SAP1)
or of carbohydrates (like PGI1, PMI40 and PSA1. Some of these genes have already been reported as playing a role in pathogenesis
of C. albicans. However, functions were unknown for a large part (45.5%) of the overexpressed genes which will be analyzed further
in order to define their relationship with adherence.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Candida albicans; Macroarrays; Adherence; Polystyrene




1. Introduction                                                           are still not well understood, but several attributes re-
                                                                          lated to the cell wall such as the ability to undergo
   Candida albicans which is the major fungal pathogen                    dimorphic transition, as well as the production of extra-
in humans, is a dimorphic fungus capable to cause                         cellular proteinases and adherence, have been thought to
superficial mucosal infections, as well as systemic infec-                 contribute to its virulence [1,3–5].
tions in immunocompromised individuals [1]. During                           Adherence of the pathogens to the host cells is con-
the past two decades, the prevalence of candidiasis has                   sidered as an essential step in the establishment of
increased markedly and C. albicans has now become                         infection. C. albicans has been shown to adhere to a
one of the most important cause of nosocomial infec-                      large variety of epithelial cells, as well as to endothelial
tions [2]. The factors responsible for its pathogenesis                   cells, but also to medical implants such as catheters
                                                                          and protheses. Multiple adherence mechanisms have
 *
                                                                          been proposed for this yeast. The molecular interac-
   Corresponding author. Tel.: +33 2 4122 6600; fax: +33 2 4148 6733.
   E-mail address: veronique.marchais@univ-angers.fr (V. Marchais).
                                                                          tions involved in adherence may be classified into
 1
    ´
   Veronique Marchais and Marie Kempf contributed equally to this         non-specific (electrostatic or hydrophobic) interactions
work.                                                                     and specific ligand–receptor interactions [6,7]. These

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.014
26                               V. Marchais et al. / FEMS Microbiology Letters 245 (2005) 25–32

specific interactions, enhanced by morphogenetic tran-              through 1.2-lm-pore size filters (Fisher Labosi). Cells
sition from budding yeast to hyphae, are governed by               were then washed in sterile distilled water, and finally
multifunctional adhesins which are mannoproteins                   resuspended in extraction buffer (Tris–HCl 100 mM
localized at the fungal surface [8]. Several studies have          pH 7.5 containing 100 mM LiCl and 1 mM EDTA) to
established the role of some fungal proteins in adher-             reach a cell density of 5 · 107 cells mlÀ1. After centrifu-
ence to the host tissues. Among them, a hyphal wall                gation at 2350g for 10 min at 4 °C, pellets were stored at
protein (Hwp1p) and two agglutinin-like proteins                   À80 °C until use.
(Als1p and Ala1p) have been suggested to be involved
in adherence to epithelial and endothelial cells [9,10]. In        2.2. RNA extraction and purification
addition, previous works from our group have been fo-
cused on the role of some cell wall mannoproteins of                  Extraction of total RNA from germ tube pellets was
C. albicans in its interactions with plastic surfaces              performed with an equal volume of extraction buffer
and with some plasma or matrix adhesive proteins. A                and a mix of phenol pH 5–chloroform–isoamyl alcohol
set of three mannoproteins of 60, 68 and >200 kDa                  (25:24:1 v/v; Sigma– Aldrich). SDS 20% (5 ll) and ice-
has been suggested to mediate the adherence of the                 cold glass beads (mix 1:1 of 0.25 and 1-mm diameter
yeast to inert surfaces, but also the binding of laminin           glass beads; Braun) were then added to the samples
and fibrinogen [11–13]. For others, interactions with               which were vortexed vigorously for 8 · 30 s with peri-
fibrinogen are mediated by a 58-kDa mannoprotein en-                odic chilling of 30 s on ice. After centrifugation at
coded by the fibrinogen binding protein 1 gene (FBP1)               2350g for 5 min at 4 °C, the supernatants were extracted
[14].                                                              twice with 0.5 ml phenol–chloroform–isoamyl alcohol.
    In order to get a better understanding of the adher-           Total RNA was precipitated from supernatants with
ence process, we have used an adherence model of                   0.3 M sodium acetate (Sigma–Aldrich) and 2.5 volumes
C. albicans germ tubes to polystyrene surface. Gene                absolute ethanol, then washed with 80% ethanol, dried
expression was analyzed using DNA macroarrays                      and dissolved in 20 ll sterile distilled water. Total
containing 2002 Open Reading Frames (ORF) of the                   RNA concentration was calculated from the absorbance
C. albicans genome [15], and non-adherent germ tubes               at 260 nm.
produced on glass substrate as the control. These
macroarrays enabled us to characterize a large part of             2.3. cDNA labelling and hybridization to DNA arrays
the C. albicans transcriptome in response to adherence
to plastic surfaces. Therefore, this study provides the               cDNA probes were synthesized and labelled according
first analysis of C. albicans gene regulation during the            to the Yeast GeneFiltersÒ Microarrays protocol (www.
early steps of the development of candidiasis.                     invitrogen.com/content/sfs/manuals/genefilteryeast.pdf).
                                                                      To do this, 1 lg of total RNA was mixed with 2 ll of
                                                                   oligo dT (Invitrogen Life Technologies) and heated at
2. Materials and methods                                           70 °C for 10 min. After chilling on ice, 1.5 ll of dNTP
                                                                   mixture containing dATP, dGTP and dTTP (Amersham
2.1. Strain and culture conditions                                 Pharmacia Biotech, 20 mM each), 1 ll DTT 0.1 M
                                                                   (Invitrogen Life Technologies), 6 ll of 33P dCTP
   C. albicans ATCC 66396 was used throughout. This                (10 mCi mlÀ1 with a specific activity of 3000 Ci mmolÀ1)
strain was routinely maintained by biweekly passages               (Perkin–Elmer NEN Life Sciences) and 1.5 ll reverse
on Sabouraud dextrose agar containing chlorampheni-                transcriptase (SuperscriptTM II RNase Transcriptase;
col 1 mg mlÀ1. For germ tube production, 24-h-old                  Invitrogen Life Technologies) were added to the solu-
blastoconidia were suspended in medium 199 pH 7 at                 tion which was then incubated at 37 °C for 90 min.
a final concentration of 2 · 106 cells mlÀ1. The fungal             The volume was adjusted to 100 ll with standard so-
suspension was then distributed in 140-mm neutral poly-            dium citrate buffer 1 · [(SSC) 0.15 M NaCl, 0.015 M cit-
styrene Petri dishes (Fisher Labosi) or in 110-mm neu-             rate tri-sodique] and the free nucleotides were removed
tral glass Petri dishes (DuranÒ – Fisher Labosi), at the           by gel filtration through a Sephadex Bio-SpinÒ P-6 col-
rate of 50 ml or 31 ml per dish, respectively and incu-            umn (Bio-Rad).
bated for 2 h 30 at 37 °C. Under these conditions, over               DNA arrays used for hybridization experiments were
90% of the organisms produced germ tubes that adhered              purchased from Eurogentec. They consisted of
to the plastic surface [13].                                       7 · 11 cm nylon membranes on which 2002 PCR-ampli-
   Germ tubes were removed from the plastic surface                fied open reading frames (ORFs) of the C. albicans gen-
with a rubber policeman and resuspended in culture                 ome were printed in duplicate. These ORFs were a
supernatant. The obtained suspension as well as germ               random representation of the whole genome of C. albi-
tube suspension obtained in glass Petri dishes were sep-           cans. Negative controls, consisting of PCR amplified
arately isolated from culture medium by filtration                  DNA of Bacillus subtilis genome, were deposited on
                                 V. Marchais et al. / FEMS Microbiology Letters 245 (2005) 25–32                            27

the arrays as well as positive controls which corre-               (Promega) were added to the mix, together with 2 ll of
sponded to dilutions of C. albicans genomic DNA.                   10 mM dNTPs (Sigma–Aldrich), 1 ll of 40 U llÀ1 re-
   The membranes were washed for 5 min in boiling                  combinant RNasin ribonuclease inhibitor (Promega),
0.5% SDS and prehybridized for 2 h at 42 °C using roller           1 ll of 200 U llÀ1 M-MLV reverse transcriptase (Pro-
bottles (Thermo Hybaid) with 5 ml MicroHyb solution                mega) and 21 ll of distilled water. The samples were
(Invitrogen Life Technologies) containing 5 ll of Poly             incubated at 37 °C for 1 h. cDNAs were purified with
A (Invitrogen Life Technologies). The labelled cDNA                the QIAquick PCR purification kit (Qiagen) and stored
probes were denatured for 10 min at 70 °C and added                at À20 °C until use.
to the prehybridization mixture. Hybridization was car-               Quantitative PCR reactions were carried out in a
ried out for 16–18 h at 42 °C. Then, each membrane was             M · 4000 sequence detection system (Stratagene) with
washed twice for 20 min at 50 °C with 30 ml of 2 · SSC             BrilliantÒ SYBRÒ Green QPCR Master Mix
supplemented with 1% SDS and once for 15 min at                    (Stratagene), in a 25-ll final volume. Each reaction con-
room temperature with 0.5 · SSC containing 1% SDS.                 tained 150 nM of each upstream and downstream prim-
The membranes were finally wrapped in plastic bags                  ers and 2.5 mM MgCl2. PCR was optimized by following
(Kapak) and exposed to a PhosphorImager screen                     the recommendations of the manufacturer (Stratagene).
(MP; Perkin–Elmer Life Sciences) for 24 h. For subse-              PCR cycling conditions were as follows: initial denatur-
quent utilization, arrays were stripped with 1 l of boiling        ation at 95 °C for 10 min, followed by 40 cycles of 30 s
dehybridation solution (0.5% SDS) for 1 h.                         at 95 °C, 1 min at a temperature adapted for each primer
                                                                   set used for annealing, and 30 s at 72 °C for extension.
2.4. Experimental design, image acquisition and data               The identity of the PCR products was checked by melt-
analysis                                                           ing curve analysis on the Mx4000.
                                                                      Transcript levels of a housekeeping gene (ACT1) were
   In our experimental design, macroarray hybridiza-               evaluated to normalize the values, and data were ana-
tions were performed nine times, using for each experi-            lyzed by using the CT comparative method.
ment, new cDNA probes derived from independent
cell preparations. All filters were used up to three times.
   Exposed PhosphorImager screens were scanned on a                3. Results and discussion
PhosphorImager (CycloneÒ Storage Phosphor System;
Packard) to obtain a digital image of the membranes,                  Macroarrays with the C. albicans cDNA probes al-
and analyzed by the ArrayVisionTM 6.0 commercial soft-             lowed us to investigate global changes in gene expres-
ware (Imaging Research, Inc.). To determine induction              sion associated with adherence to polystyrene. Results
or repression of gene expression, all spots intensities            were not strictly identical between the nine different bio-
were compared between the filters corresponding to                  logical experiments, but normalization of each spot and
both culture conditions (cultures on plastic or glass sur-         then statistical analysis using the Wilcoxon non-para-
faces). Data were analyzed after normalization of each             metric test allowed comparisons between the experi-
spot. The normalized value of a spot was calculated                ments. In addition, no differences in gene expression
from the spot signal minus the background level of                 between the two culture conditions (adherent germ tubes
hybridization (determined from the intensity of the sig-           produced on plastic surface compared to non-adherent
nal surrounding the entire filter), divided by the median           organisms obtained on glass surface) were seen for neg-
value of all the signals detected on the filter.                    ative controls (Bacillus subtilis DNA) nor for positive
   Statistical evaluation of the data was performed on             controls (C. albicans genomic DNA) in the nine
SPSS software version 10.1 using the Wilcoxon non-                 experiments.
parametric test, based on the ranks of the paired differ-
ences between the two samples (cultures on plastic or glass        3.1. Gene expression on plastic surface versus glass
surfaces). A p value <0.05 was considered significant.              surface

2.5. Reverse transcription and quantitative PCR                        The Wilcoxon T test displayed a total of 77 C. albicans
                                                                   genes statistically overexpressed in adherent germ tubes
   The differential gene expression revealed by macroar-            versus non-adherent cells, and 40 genes were identified
ray hybridization was confirmed by reverse transcription            as statistically underexpressed. These genes, presented in
and quantitative PCR (RT-PCR) for some of the genes.               Table 1, were assigned to functional categories on the ba-
   In this aim, 2 lg of DNAse-treated total RNA was                sis of homology with S. cerevisiae genes (http://www.pas-
mixed with 1 ll (2.65 lg llÀ1) of random hexamers                  teur.fr/recherche/unites/RIF//transcriptdata/index.html).
(Amersham Pharmacia biotech) and completed to                          Among genes identified as statistically overexpressed
15 ll with distilled water. After heating at 70 °C for             on plastic surface, 22% played a role in cellular organi-
5 min and chilling on ice, 10 ll of 5X first strand buffer           zation and intracellular transport, 10.4% were involved
28                                     V. Marchais et al. / FEMS Microbiology Letters 245 (2005) 25–32

Table 1
Genes of C. albicans differentially expressed (p < 0.05) in germ tubes produced on plastic surfaces compared to glass surfaces
Gene/IPF*                                                   Description of gene product                                         p value
Amino acid and protein metabolisms
Overexpressed
 CaYML6                                                     Mitochondrial ribosomal protein                                     0.038
 CaEFT3                                                     Translation elongation factor                                       0.021
 CaMRPL19                                                   Ribosomal protein                                                   0.038
 CaFMT1                                                     Methionyl-tRNA transformylase                                       0.036
 CaTRM1                                                     N2,N2-dimethylguanine tRNA methyltransferase                        0.021
 IPF 56 homolog of ScNAS6                                   Nas6p subunit of 26S proteasome                                     0.038
 CaSAP1                                                     Secreted aspartyl protease                                          0.038
 CaHYU1                                                     Hydantoin utilization protein A                                     0.038
Underexpressed
 CaODC1                                                     Ornithine decarboxylase                                             0.021
 IPF 8591 homolog of ScCAR1                                 Putative arginase family member                                     0.011
 1036IPF 96 homolog of ScITT1                               C3HC4type zinc finger protein                                        0.011

Lipid, fatty acid metabolism
Overexpressed
  CaLIP6                                                    Secretory lipase 6                                                  0.028
  CaACH1                                                    Acetyl-CoA hydrolase                                                0.038
  CaCOQ5                                                    C-methyltransferase                                                 0.011
  Homolog of ScSPO14                                        Phospholipase D                                                     0.021
Underexpressed
 CaGUT1                                                     Glycerol kinase                                                     0.038

Carbohydrate metabolism
Overexpressed
  CaPMI40                                                   Phosphomannose isomerase                                            0.038
  CaPSA1                                                    GDP-mannose pyrophosphorylase                                       0.021
  CaPGI1                                                    Glucose-6-phosphate isomerase                                       0.011
  CaCDC19                                                   Pyruvate kinase                                                     0.015
  CaARA1                                                    D-arabinose dehydrogenase                                           0.021
Underexpressed
 CaMDH1                                                     Mitochondrial malate dehydrogenase                                  0.038

Cellular organization and transport
Overexpressed
  CaATS1                                                    a-Tubulin suppressor                                                0.038
  CaARP1                                                    Centractin                                                          0.035
  CaTUB4                                                    c-Tubulin                                                           0.028
  CaHTB1                                                    Histone H2B                                                         0.028
  CaCDC28                                                   Cell-division control protein 28-protein kinase                     0.021
  IPF 3355 homolog of ScCDC1                                Cell division control protein                                       0.011
  IPF 11212 homolog of ScBUB2                               Cell cycle arrest protein                                           0.028
  CaTOP1                                                    Canal DNA topoisomerase I                                           0.021
  IPF 4085 homolog of ScAPG1P                               Essential for autophagocytosis                                      0.028
  CaSSC1                                                    Mitochondrial heat shock protein 70-related protein                 0.011
  CaVPS35                                                   Protein-sorting protein, vacuolar                                   0.011
  CaVPS1                                                    Member of the dynamin family of GTPases                             0.021
  CaMIR1                                                    Phosphate transport protein, mitochondrial (MCF)                    0.011
  CaZRT1                                                    High affinity zinc transport protein                                  0.021
  CaDJP1                                                    DnaJ-like protein involved in peroxisome biogenesis                 0.038
  IPF 13042 homolog of ScIMH1                               Vesicular-mediated transport                                        0.011
  IPF 11873 homolog of ScSWA2                               Swa2p clathrin binding protein                                      0.008
Underexpressed
 CaMYO5                                                     Myosin I                                                            0.011
 CaVRP1                                                     Verprolin                                                           0.011
 CaGTT1                                                     Glutathione S-transferase                                           0.038
 CaSAC7                                                     GAP for RHO1                                                        0.011
 Homolog of ScSIM11                                         Cell cycle regulation                                               0.038
 CaPHR2                                                     PH-regulated protein 2                                              0.028
 CaSEC4                                                     GTP-binding protein                                                 0.008
                                     V. Marchais et al. / FEMS Microbiology Letters 245 (2005) 25–32                                             29

Table 1 (continued)
Gene/IPF*                                          Description of gene product                                                         p value
  CaVPS24                                          Endosomal Vps protein complex subunit                                               0.028
  CaVPS8                                           Vacuolar sorting protein                                                            0.043
  IPF 4537 homolog of ScAVT7                       V1 small nuclear ribonucleoprotein                                                  0.011

Transcription
Overexpressed
   CaSMD3                                          Core snRNP protein                                                                  0.008
   CaPRP5                                          Pre-mRNA processing RNA-helicase                                                    0.017
   CaPRP22                                         RNA-dependent ATPase                                                                0.028
  CaRPA12                                          DNA-directed RNA polymerase I                                                       0.011
Underexpressed
 CaCTA4                                            Probable transcription factor                                                       0.043
 CaSPT20                                           Transcription factor, member of the histone acetyltransferase                       0.011
 CaBDF1                                            Transcriptor regulator activity                                                     0.008

Energy production
Overexpressed
  CaABC1                                           Ubiquinol-cytochrome-c reductase                                                    0.021
  CaCYC3                                           Cytochrome c heme lyase                                                             0.038

Others
Overexpressed
  CaCBP1                                           Corticosteroid binding protein                                                      0.008
  CaHOG1                                           Ser/thr protein kinase of MAP kinase family                                         0.038
Underexpressed
 CaSBP1                                            RNA binding protein like                                                            0.021
 CaMAK32                                           Sugar kinase                                                                        0.028
 CaCTA1                                            Catalase A, peroxisomal                                                             0.015
 IPF 8044 homolog of ScSNP1                        Similar to ScSnp1p                                                                  0.028

Among the genes differentially expressed, 53 (35 overexpressed and 18 underexpressed) were of unknown function.
 *
   IPF : Individual Protein File.


in amino acid and protein metabolism, 6.5% in carbohy-                                  Amino acid and protein
                                                                                        metabolism (10.4%)
drate metabolism, 5.2% in lipid and fatty acid metabo-
lism, 5.2% in transcription, and functions were
                                                                                                                               Lipid, fatty acid
unknown for 45.5% of these genes (Fig. 1). Differential                                                                       metabolism (5.2%)
expression of genes LIP6, SAP1, PMI40 and of two
genes with unknown function (IPF17021 and IPF2147)                                                                               Carbohydrate
was confirmed by quantitative RT-PCR (Table 2). The                                                                           metabolism (6.5%)
agreement between data from RT-PCR and the macro-
array transcription profile underlined the relevance of
the macroarray data in these experimental conditions.
The distribution of the 40 genes underexpressed on plas-
tic surface versus glass surface among the different func-
tional categories was equivalent to that observed for the
overexpressed genes (data not shown).                                     Unknown                                          Cellular organization
                                                                          function (45.5%)                                  and transport (22%)
    Thus these results indicate a differential expression of
some genes associated with adherence to polystyrene.
The main changes concerned genes involved in cellular                               Others (2.6%)              Transcription (5.2%)
                                                                                                    Energy
organization and transport since 27 genes (17 overex-                                          production (2.6%)
pressed and 10 underexpressed) were found to be differ-                   Fig. 1. Pie chart presenting the genes overexpressed on plastic surface
entially expressed. Among them, genes involved in                        versus glass surface grouped in functional classes (n = 77); functions of
cytoskeletal modification such as ATS1, ARP1, TUB4                        45.5% of the overexpressed genes are unknown.
were overexpressed in our study while MYO5 was
underexpressed. Other overexpressed genes like HTB1,                     siae SIM11 was underexpressed. Four VPS genes
CDC28, IPF 3355 and IPF 11212 play a role in cell divi-                  encoding proteins required for the sorting of vacuolar
sion or cell regulation, but a gene homolog of S. cerevi-                proteins presented a differential gene expression. VPS1
30                                     V. Marchais et al. / FEMS Microbiology Letters 245 (2005) 25–32

Table 2                                                                  SAP2 and SAP3 which have also been suggested to be
Confirmation by quantitative RT-PCR of the differential expression of      involved in virulence [26], was not modified between
some genes identified by macroarray hybridization
                                                                         the two culture conditions, suggesting that the corre-
Gene                          2-(DDCt)a                     p valueb     sponding enzymes do not play any role in adherence
SAP1                          5.8                           0.038        to inert surfaces.
PSA1                          1.23                          0.021           Regarding genes involved in carbohydrate metabo-
LIP6                          1.35                          0.028
IPF 17021                     2.68                          0.028
                                                                         lism, three of the overexpressed genes encode enzymes
IPF 2147                      6.10                          0.028        directly involved in the GDP-mannose synthesis path-
  a
    DDCt was obtained by substracting the average Ct value of the
                                                                         way: the gene PGI1 encoding the phosphoglucose isom-
housekeeping gene ACT1 from the average Ct value of the gene             erase involved in the synthesis of fructose-6-phosphate;
studied and DDCt was the difference between DCt obtained for C.           the gene PMI40 encoding the phosphomanose isomer-
albicans germ tubes produced in adherence condition (polystyrene         ase, an enzyme involved in mannose catabolism, but
surface) and DCt obtained for C. albicans germ tubes obtained in non-    also in the production of the GDP-D-mannose which is
adherence condition (glass surface).
  b
    Data were calculated from the results obtained by DNA macro-
                                                                         necessary for protein mannosylation; and the gene
array analysis.                                                          PSA1 encoding a GDP-mannose pyrophosphorylase in-
                                                                         volved in the synthesis of GDP-mannose which is essen-
and VPS35 were overexpressed while VPS8 and VPS24                        tial for the addition of mannose residues. [28–31]. These
appeared underexpressed. However, all the VPS gene                       results suggest that adherence to polystyrene is associ-
products do not play the same role in sorting and/or                     ated with an increased synthesis of GDP-mannose, lead-
in delivery of proteins to the vacuole [16–18]. For exam-                ing to an increased synthesis of mannoproteins or to an
ple, trafficking in the endosomal system was analyzed by                   increased mannosylation. Interestingly, previous studies
monitoring the movement of a plasma membrane ATP-                        from our laboratory [13] have demonstrated at the sur-
ase in several vps mutants defective in vacuolar protein                 face of germ tubes adherent to polystyrene, the presence
sorting. These experiments showed that the biosynthetic                  of an outermost fibrillar layer, mannoproteinic in nature
membrane traffic follows different routes in vps8 and                       and allowing the interconnections germ tubes–substrate.
vps1 mutants. For instance, in vps8, in contrast to                      In contrast, this network was not detected at the surface
vps1, the plasma membrane ATPase moves to the sur-                       of non-adherent germ tubes produced on glass surface.
face via endosomal intermediates, implicating an endo-
some-to-surface traffic pathway [18]. Thus one may                         3.2. Analysis of genes involved in adherence phenomenons
speculate that some Vps proteins could be involved in
the transfer of some mannoproteins mediating the                            In the present study, a simple experimental model
adherence to inert surfaces or synthesized in response                   was used to analyze the expression of genes associated
to adherence.                                                            with adherence to inert surfaces. In this model, adherent
   In addition, some of the overexpressed genes encode                   germ tubes of C. albicans were produced in neutral poly-
general components of the transcriptional machinery,                     styrene Petri dishes and compared to non-adherent cells
particularly components involved in pre-mRNA splicing                    produced on glass surface. This enabled us to analyze
(SMD3, PRP22, PRP5) [19–22]. Likewise, other overex-                     gene expression during the early steps of infection con-
pressed genes encode enzymes participating in lipid, pro-                trary to previously published works studying later states
tein or carbohydrate metabolisms and some of them                        in the development of candidiasis, for example the gene
have already been described as playing a role in patho-                  expression pattern in C. albicans biofilms obtained after
genesis of C. albicans. For example, expression of the                   a 48–72-h incubation [32]. In addition, due to the use of
gene LIP6 which encodes one of C. albicans lipases                       non-adherent germ tubes as the control, this study was
[23], was enhanced in germ tubes adhering to polysty-                    focused on the expression of genes associated with
rene. It has been shown that the lipolytic activity of                   adherence, independently of hyphal development. Be-
these enzymes could increase hydrophobic interactions                    sides, genes involved in filamentation such as ALS1,
through the release of fatty acids [22,24,25]. Therefore,                CPH1 or EFG1 [33] were not overexpressed in our
one may speculate that these enzymes play a role in                      experimental model.
the colonization of prosthetic devices [23].                                The macroarrays used here were the only tools avail-
   Genes encoding enzymes participating in protein                       able at the beginning of this study. However, these ar-
metabolism may also be involved in pathogenesis. For                     rays covered only about one third of the 6000 genes
example, the relationship between the production of                      expected in the whole C. albicans genome. Thus, some
the secreted aspartic proteinase Sap1p and invasiveness                  genes suggested to be involved in adherence such as
of C. albicans is well known [26,27]. Here we showed                     FBP1, and MNT1 which encodes an a-1-2 mannosyl-
that the expression of SAP1 which is regulated during                    transferase adding a second mannose to singly man-
the yeast to mycelium transition, is also enhanced during                nosylated hydroxy amino acids, were not present on
the adherence process. In contrast, the expression of                    the array filters [14,34]. In contrast, other genes involved
                                         V. Marchais et al. / FEMS Microbiology Letters 245 (2005) 25–32                                         31

in adherence and deposited on the array filters were not                      [5] Navarro-Garcia, F., Sanchez, M., Nombela, C. and Pla, J. (2001)
found to be overexpressed on plastic versus glass sur-                           Virulence genes in the pathogenic yeast Candida albicans. FEMS
                                                                                 Microbiol. Rev. 25, 245–268.
faces. For example, the expression of HWP1 and                               [6] Chaffin, W.L., Lopez-Ribot, J.L., Casanova, M., Gozalbo, D.
ALS1 was clearly unchanged in our adherence model                                and Martinez, J.P. (1998) Cell wall and secreted proteins of
to inert surface [34,35]. If it is not surprising that                           Candida albicans: identification, function, and expression. Micro-
HWP1 was not among the overexpressed genes, since                                biol. Mol. Biol. Rev. 62, 130–180.
it is likely to be involved in covalent binding to epithelial                [7] Fukazawa, Y. and Kagaya, K. (1997) Molecular bases of
                                                                                 adherence of Candida albicans. J. Med. Vet. Mycol. 35, 87–99.
cells [36], an overexpression of ALS genes has been re-                      [8] Tronchin, G., Poulain, D. and Vernes, A. (1984) Cytochemical
ported in biofilm populations [32,37]. One may speculate                          and ultrastructural studies of Candida albicans. III. Evidence for
that the expression of ALS1 was not altered in our                               modifications of the cell wall coat during adherence to human
adherence model due to the short cultivation time                                buccal epithelial cells. Arch. Microbiol. 139, 221–224.
whereas fungal biofilm formation requires a longer incu-                      [9] Calderone, R., Suzuki, S., Cannon, R., Cho, T., Boyd, D., Calera,
                                                                                 J., Chibana, H., Herman, D., Holmes, A., Jeng, H.W., Kaminishi,
bation of 48–72-h.                                                               H., Matsumoto, T., Mikami, T., OÕSullivan, J.M., Sudoh, M.,
    In conclusion, this study provides a better knowledge                        Suzuki, M., Nakashima, Y, Tanaka, T., Tompkins, G.R. and
of the molecular mechanisms associated with the coloni-                          Watanabe, T. (2000) Candida albicans: adherence, signaling and
zation of inert surfaces which may have important clin-                          virulence. Med. Mycol. 38 (Suppl. 1), 125–137.
ical involvements. Indeed, after adherence to medical                       [10] Sundstrom, P. (2002) Adherence in Candida spp. Cell. Microbiol.
                                                                                 4, 461–469.
devices, the yeast may contribute to deterioration of                       [11] Annaix, V., Bouchara, J.P., Tronchin, G., Senet, J.M. and
the devices and/or initiate an acute disseminated infec-                         Robert, R. (1990) Structures involved in the binding of human
tion. Organisms adhering to plastic may also be less sus-                        fibrinogen to Candida albicans germ tubes. FEMS Microbiol.
ceptible to antifungal drugs. In addition, the apparent                          Immunol. 64, 147–153.
lack of overexpression of known adhesin genes, joint                        [12] Bouchara, J.P., Tronchin, G., Annaix, V., Robert, R. and Senet,
                                                                                 J.M. (1990) Laminin receptors on Candida albicans germ tubes.
to the overexpression of LIP6 and genes involved in                              Infect. Immun. 58, 48–54.
mannosylation of proteins further support the impor-                        [13] Tronchin, G., Bouchara, J.P., Robert, R. and Senet, J.M. (1988)
tance of hydrophobic interactions in the adherence of                            Adherence of Candida albicans germ tubes to plastic: ultrastruc-
C. albicans to inert surfaces. Our objective is now to                           tural and molecular studies of fibrillar adhesins. Infect. Immun.
study the genes with unknown function which were                                 56, 1987–1993.
                                                                            [14] Lopez-Ribot, J.L., Sepulveda, P., Cervera, A.M., Roig, P.,
found to be overexpressed on plastic. The deduced ami-                           Gozalbo, D. and Martinez, J.P. (1997) Cloning of a cDNA
no acid sequences of these genes will be analyzed by                             fragment encoding part of the protein moiety of the 58-kDa
using a bioinformatic approach to select putative cell-                          fibrinogen-binding mannoprotein of Candida albicans. FEMS
surface proteins. Potentially interesting genes will be dis-                     Microbiol. Lett. 157, 273–278.
rupted and the obtained mutants will be studied in vitro                    [15] Murad, A.M., dÕEnfert, C., Gaillardin, C., Tournu, H., Tekaia,
                                                                                 F., Talibi, D., Marechal, D., Marchais, V., Cottin, J. and Brown,
in our adherence model.                                                          A.J. (2001) Transcript profiling in Candida albicans reveals new
                                                                                 cellular functions for the transcriptional repressors CaTup1,
                                                                                 CaMig1 and CaNrg1. Mol. Microbiol. 42, 981–993.
Acknowledgements                                                            [16] Paravicini, G., Horazdovsky, B.F. and Emr, S.D. (1992) Alter-
                                                                                 native pathway for the sorting of soluble vacuolar proteins in
                                                                                 yeast: a vps35 null mutant missorts and secretes only a subset of
   The authors wish to thank Jean-Michel Camadro                                 vacuolar hydrolases. Mol. Biol. Cell. 3, 415–427.
(UMR 7592 CNRS, Institut Jacques Monod, Paris,                              [17] Nothwehr, S.F., Conibear, E. and Stevens, T.H. (1995) Golgi and
France), Claude Gaillardin (CNRS URA 1925 INRA                                   vacuolar membrane proteins reach the vacuole in vps1 mutant
UR 216, Thiverval-Grignon), and Bruno Vielle (CHU,                               yeast cells via the plasma membrane. J. Cell Biol. 129, 35–46.
                                                                            [18] Luo, W.J. and Chang, A. (2000) An endosome-to-plasma
Angers, France) for their expert assistance. This work                           membrane pathway involved in trafficking of a mutant plasma
                             `
was supported by the Ministere de la Recherche et de                             membrane ATPase in yeast. Mol. Biol. Cell. 11, 579–592.
                 ´
la Technologie (Reseau Infections fongiques).                               [19] Roy, J., Zheng, B., Rymond, B.C. and Woolford Jr., J.L. (1995)
                                                                                 Structurally related but functionally distinct yeast Sm D core
                                                                                 small nuclear ribonucleoprotein particle proteins. Mol. Cell. Biol.
                                                                                 15, 445–455.
References                                                                  [20] Company, M., Arenas, J. and Abelson, J. (1991) Requirement of
                                                                                 the RNA-helicase-like protein PRP22 for release of mRNA from
 [1] Shepherd, M.G., Poulter, R.T. and Sullivan, P.A. (1985) Candida             the spliceosomes. Nature 349, 463–464.
     albicans: biology, genetics, and pathogenicity. Annu. Rev. Micro-      [21] OÕDay, C.L., Dalbadie-Mc Farland, G. and Abelson, J. (1996)
     biol. 39, 579–614.                                                          The Saccharomyces cerevisiae Prp5 protein has RNA-dependent
 [2] Jarvis, W.R. and Martone, W.J. (1992) Predominant pathogens in              ATPase activity with specificity for U2 small nuclear RNA. J.
     hospital infections. J. Antimicrob. Chemother. 39 (Suppl. A), 19–24.        Biol. Chem. 271, 33261–33267.
 [3] Calderone, R.A. and Braun, P.C. (1991) Adherence and receptor                                                                        ´
                                                                            [22] Stehr, F., Felk, A., Gacser, A., Kretschmar, M., Mahnh, B,
     relationships of Candida albicans. Microbiol. Rev. 55, 1–20.                Neuber, K., Hube, B. and Schafer, W. (2004) Espression analysis
                                                                                                                 ¨
 [4] Odds, F.C. (1994) Pathogenesis of Candida infections. J. Am.                of the Candida albicans lipase gene family during experimental
     Acad. Dermatol. 31, S2–S5.                                                  infections and in patient samples. FEMS Yeast Res. 4, 401–408.
32                                      V. Marchais et al. / FEMS Microbiology Letters 245 (2005) 25–32

[23] Hube, B., Stehr, F., Bossenz, M., Mazur, A., Kretschmar, M. and      [30] Jensen, S.O. and Reeves, P.R. (1998) Domain organisation in
     Schafer, W. (2000) Secreted lipases of Candida albicans: cloning,         phosphomannose isomerases (type I and II). Biochim. Biophys.
     characterization and expression analysis of a new gene family with        Acta 1382, 5–7.
     at least ten members. Arch. Microbiol. 174, 362–374.                 [31] Garami, A. and Ilg, T. (2001) Disruption of mannose activation in
[24] Gottlich, E., de Hoog, G.S., Yoshida, S., Takeo, K., Nishimura,
        ¨                                                                      Leishmania mexicana: GDP mannose pyrophosphorylase is required
     K. and Miyaji, M. (1995) Cell-surface hydrophobicity and                  for virulence, but not for viability. EMBO J. 20, 3657–3666.
     lipolysis as essential factors in human tinea nigra. Mycoses 38,     [32] Garcia-Sanchez, S., Auberst, S., Iraqui, I., Janbon, G., Ghigo,
     489–494.                                                                  J.M. and DÕEnfert, C. (2004) Candida albicans biofilms: a
[25] Stehr, F., Kretschmar, M., Kroger, C., Hube, B. and Schafer, W.
                                     ¨                         ¨               development state associated with specific and stable gene
     (2003) Microbial lipases as virulence factors. J. Mol. Catal. B           expression patterns. Eukaryot. Cell 3, 536–545.
     Enzym. 22, 347–355.                                                  [33] Fu, Y., Ibrahim, A.S., Sheppard, D.C., Chen, Y.C., Franch, S.W.,
[26] Hube, B., Sanglard, D., Odds, F.D., Hess, D., Monod, M.,                  Cutler, J.E., Filler, S.G. and Edwards Jr., J.E. (2002) Candida
     Schafer, W., Brown, A.J.P. and Gow, N.A. (1997) Disruption of
          ¨                                                                    albicans Als1p: an adhesin that is a downstream effector of the
     each of the secreted aspartyl proteinase genes SAP1, SAP2, and            EFG1 filamentation pathway. Mol. Microbiol. 44, 61–72.
     SAP3 of Candida albicans attenuates virulence. Infect. Immun. 65,    [34] Sundstrom, P. (1999) Adhesins in Candida albicans. Curr. Opin.
     3529–3538.                                                                Microbiol. 2, 353–357.
[27] Macdonald, F. and Odds, F.C. (1983) Virulence for mice of a          [35] Staab, J.F., Bradway, S.D., Fidel, P.L. and Sundstrom, P. (1999)
     proteinase-secreting strain of Candida albicans and a proteinase-         Adhesive and mammalian transglutaminase substrate properties
     deficient mutant. J. Gen. Microbiol. 129, 431–438.                         of Candida albicans Hwp1. Science 283, 1535–1538.
[28] Warit, S., Zhang, N., Short, A., Walmsley, R.M., Oliver, S.G. and    [36] Staab, J.F., Ferrer, C.A. and Sundstrom, P. (1996) Developmen-
     Stateva, L.I. (2000) Glycosylation deficiency phenotypes resulting         tal expression of a tandemly repeated proline-and glutamine-rich
     from depletion of GDP-mannose pyrophosphorylase in two yeast              amino acid motif on hyphal surfaces of Candida albicans. J. Biol.
     species. Mol. Microbiol. 36, 1156–1166.                                   Chem. 271, 6298–6305.
[29] Dickinson, J.R. (1991) Biochemical and genetic studies on the        [37] Chandra, J., Kuhn, D.M., Mukherjee, P.K., Hoyer, L.L,
     function of, and relationship between, the PGI1- and CDC30-               McCormick, T. and Ghannoum, M.A. (2001) Biofilm formation
     encoded phosphoglucose isomerases in Saccharomyces cerevisiae.            by the fungal pathogen Candida albicans: development, architec-
     J. Gen. Microbiol. 137, 765–770.                                          ture, and drug resistance. J. Bacteriol. 183, 5385–5394.
                                                 FEMS Microbiology Letters 245 (2005) 33–38
                                                                                                                      www.fems-microbiology.org




                                  Role of superoxide in the germination of
                                       Bacillus anthracis endospores
                                      a,b,*
                  Les Baillie               , Stephen Hibbs a, Pei Tsai a,c,d, Guan-Liang Cao                                a,c,d
                                                                                                                                 ,
                                                     Gerald M. Rosen a,c,d
                     a
                       Medical Biotechnology Center, University of Maryland Biotechnology Institute, Baltimore, MD 21201, USA
                         b
                         Biological Defense Research Directorate Naval Medical Research Center, Silver Spring, MD 20910, USA
                  c
                    Department of Pharmaceutical Sciences, University of Maryland School of Pharmacy, Baltimore, MD 21201, USA
            d
                Center for EPR Imaging for In Vivo Physiology, University of Maryland School of Pharmacy, Baltimore, MD 21201, USA

                             Received 1 December 2004; received in revised form 7 February 2005; accepted 10 February 2005

                                                          First published online 3 March 2005

                                                                  Edited by E. Ricca




Abstract

    The spore forming Gram-positive bacterium Bacillus anthracis, the causative agent of anthrax, has achieved notoriety due to its
use as a bioterror agent. In the environment, B. anthracis exists as a dormant endospore. Germination of endospores during their
internalization within the myeloid phagocyte, and the ability of those endospores to survive exposure to antibacterial killing mech-
anisms such as superoxide ðOÅÀ Þ, is a key initial event in the infective process. We report herein that endospores exposed to fluxes of
                              2
OÅÀ typically found in stimulated phagocytes had no effect on viability. Further endospores of the Sterne strain of B. anthracis were
  2
found to scavenge OÅÀ , which may enhance the ability of the bacterium to survive within the hostile environment of the phagoly-
                     2
                                                                                                            Å
sosome. Most intriguing was the observation that endospore germination was stimulated by a flux of O2À as low as 1 lM/min. Data
presented herein suggest that B. anthracis may co-opt O2    ÅÀ which is produced by stimulated myeloid phagocytes and is an essential
element of host immunity, as a necessary step in productive infection of the host.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Anthrax; Endospores; Superoxide; Germination




1. Introduction                                                               that the spore may play a direct role in virulence. For
                                                                              instance, spore coat extract from two serovars of Bacil-
    The ability to form an impervious spore is the key                        lus thuringiensis have been reported to be toxic for the
survival strategy of members of the bacillus family                           Indian meal moth [2]. B. thuringiensis belongs to a
[1]. Once formed the spore enables the organism to re-                        group of genetically related organisms which include
main dormant until the local environment has im-                              B. cereus and the mammalian pathogen Bacillus anthra-
proved to a level that will support active growth. The                        cis [3]. All members of this group form endospores with
spore also confers considerable resistance to chemical                        a structurally similar outer layer called the exosporium.
and thermal insult. There is also evidence to suggest                         This layer is chemically complex, consisting of protein,
                                                                              amino and neutral polysaccharides and lipids [4]. More
 *
     Corresponding author. Tel.: +1 301 321 6715; fax: +1 301 231 6799.       recently, it has been shown that glycoproteins, which
     E-mail address: bailliel@nmrc.navy.mil (L. Baillie).                     appear to be specific to the outer surface layers of the

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.016
34                                L. Baillie et al. / FEMS Microbiology Letters 245 (2005) 33–38

spore, are synthesized by B. thuringiensis [5], B. cereus           examined during this study. The organism was stored
[6] and B. anthracis [7].                                           in 10% glycerol L broth at À20 °C. Difco L agar and
    Preliminary studies have identified proteins in the              Difco L broth were obtained from Becton Dickinson
exosporium that play a role in insect pathogenicity                 and Company (Becton Drive, Franklin Lakes, NJ) and
(i.e., immune inhibitor A, a zinc metalloprotease, which            made up as per the manufacturers instructions. Isolation
degrades components of the insects immune system),                  Agar was formulated as follows; 6 g Oxoid Nutrient
regulate germination (i.e., alanine racemase, inosine pre-          broth No. 2 (Oxoid Ltd, NY), 12 g Oxoid Agar No. 3,
ferring nucleoside hydrolase) and control intracellular             300 mg/L MnSO4 (JT Baker, NJ) 0.25 g NaH2PO4
survival of B. anthracis (i.e., iron/manganese superoxide           (Omnipur EM Science) and 1 L sterile distilled water.
dismutase), the key early event in anthrax [8–11].                  The pH was adjusted to 6.7 and the agar was sterilized
    In their quiescent state, macrophages are metaboli-             by autoclaving at 121 °C for 15 min. Brain Heart Infu-
cally subdued. Yet upon encountering a microorganism,               sion Broth (Difco) was used as a general growth media.
these cells become stimulated, resulting in sequestration           To examine the role of specific germinants the following
of the invading microbe into an enclosed vacuole, the               mixtures were used: L-alanine solution contained
                              Å
phagosome, into which O2À is secreted and proteins                  100 mM L-alanine (Calbiochem), 100 mM NaCl (Omni-
and proteases are released following fusion of lysosomes            pur EM Science) and 10 mM NaH2PO4 at pH 7.2 [17].
to form the phagolysosome [12,13]. Studies with mouse               The inosine mixture contained 5 mM inosine (Calbio-
alveolar macrophages have demonstrated that for an-                 chem), 100 mM NaCl and 10 mM NaH2PO4. The
thrax spores germination occurs within the phagolyso-               combined alanine/inosine mixture contained 100 mM
some [14].                                                          L-alanine, 5 mM inosine, 100 mM NaCl and 10 mM
    Thus to survive within this harsh environment the               NaH2PO4 at pH 7.2 [17].
bacterium must possess mechanisms, such as superoxide
dismutase (SOD) and catalase, to circumvent the toxic               2.2. Spore production
events initiated by OÅÀ and hydrogen peroxide (H2O2),
                      2
produced by and the result of the oxidative burst, by                  A single colony harvested from an overnight culture
scavenging these oxidants.                                          grown on L agar at 37 °C was used to inoculate
    Microorganisms have developed a number of strate-               100 mL of L-broth in a 250 mL Duran. The culture
gies to deal with oxidants: avoidance, neutralization               was incubated at 37 °C on an orbital shaker (200 rpm)
and prevention of production [15]. For example, the                 for 6 h. At the end of this period, 3 mL of culture was
identification of a spore surface located SOD raises the             transferred to a 225 cm3 vented tissue flask (Corning
possibility that endospores can control the availability            Inc) containing 12 mL isolation agar. Following inocu-
       Å
of O2À , generated by stimulated macrophages, which                 lation flasks were incubated at 30 °C until 99–100% of
would otherwise mediate cell killing [16]. Thus, prior              the organisms had formed endospores (microscopic
to germination the spore represents a target against                examination/phase contrast). The % spore yield was
which antibacterial factors can expend their efforts with-           determine by comparing colony counts of heated
out having any adverse effect on the dormant organism.               (70 °C for 20 min) and unheated samples. Endospores
    This study addresses two critical questions. First, can         were harvested by adding 20 mL of sterile phosphate
the spore protect the organism from physiologically rel-            buffered saline (PBS) to the flask. The re-suspended
evant levels of OÅÀ enabling germination to proceed?
                   2                                                endospores from 20 flasks were pooled and centrifuged
Second, what impact does the oxidant environment, typ-              at 4200 rpm for 10 min at 4 °C. The resulting pellet
ically found within the phagolysosome have on the rate              was resuspended in 200 mL of sterile PBS and centri-
of spore germination? To address these questions, endo-             fuged again. To determine the effect of repeated wash-
spores of the Sterne strain of B. anthracis were exposed            ings on spore activity, endospores were washed either
to a continuous flux of OÅÀ at a rate typically found in
                            2                                       as total of 3 or 10 times with the endospores being resus-
stimulated phagocytes [12,13]. The degree of OÅÀ scav-
                                                  2                 pended in a final volume of 50 mL, which was refriger-
enging, spore survival, and subsequent rate of germina-             ated at 4 °C until required. The final endospore
tion was determined.                                                concentration was determined to be 1 · 109 endo-
                                                                    spores/mL.

2. Materials and methods                                            2.3. Spin trap experiments

2.1. The bacterial strain and media                                    Prior to the commencement of each experiment, endo-
                                                                    spores were heat activated at 56 °C for 30 min. This rela-
   The Sterne, 34F2 strain of B. anthracis (Colorado                tively low temperature was employed through out the
Serum Company, Denver, CO, USA) an attenuated var-                  study to minimize heat-induced inactivation of surface
iant employed extensively as an animal vaccine, was                 located enzymes such as SOD and alanine racemase.
                                          L. Baillie et al. / FEMS Microbiology Letters 245 (2005) 33–38                                       35

    Spin trapping of OÅÀ was conducted by mixing endo-
                       2                                                    mum temperature for B. anthracis spore germination
spores, ranging from 0.5 · 104 to 0.5 · 107 endospores/                     [11]. Samples (100 lL) were taken at times 0 and
mL, with 5-tert-butoxycarbonyl-5-methyl-1-pyrroline                         40 min and counts were performed. The percentage ger-
N-oxide (BMPO, 50 mM, see Fig. 1), in PBS (pH 7, con-                       mination was calculated as follows; (1 À (heat resistant
taining diethylenetriaminepentaacetic acid, DTPA,                           count/ heat sensitive count)) · 100.
1 mM) and hypoxanthine (400 lM). The generation of
OÅÀ was initiated by the addition of xanthine oxidase
  2                                                                         2.5. Bacterial counts
to the reaction mixture such that the rate of OÅÀ was
                                                   2
1 lM/min, as determined by the SOD-inhibitive reduc-                           The concentration of vegetative phase organisms and
tion of ferricytochrome c (80 lM) at 550 nm using an                        endospores were determined as follows: samples were
extinction coefficient of 21 mMÀ1 cmÀ1 [18]. Electron                         serially diluted in sterile PBS and 100 lL of each dilu-
paramagnetic resonance (EPR) spectra were recorded                          tion was plated onto a previously dried L-agar plate.
(Varian Associates model E-109 spectrometer) at room                        The inoculated plate was incubated overnight at 37 °C
temperature, 3 min after the addition of xanthine oxi-                      and the resulting colonies at each dilution were deter-
dase. Instrumental settings were: microwave power,                          mined. Each count was repeated at least twice. To deter-
20 mW; modulation frequency, 100 kHz; modulation                            mine the number of endospores present, the samples
amplitude, 0.5 G; sweep time, 12.5 G/min; response                          were first incubated at 56 °C for 30 min, conditions
time, 0.5 s; and the receiver gain, 10 · 104. As a control                  which had previously been shown to inactive vegetative
experiment, we monitor the formation of uric acid at                        B. anthracis.
290 nm in the presence of the endospore. We found that
there was no inhibition in xanthine oxidase activity. 5-
tert-Butoxycarbonyl-5-methyl-1-pyrroline N-oxide was                        3. Results
prepared according to the method described by Stolze
et al. [19].                                                                3.1. Superoxide scavenging by endospores

2.4. Viability and germination studies                                         In an initial series of experiments, we used spin trap-
                                                                            ping/EPR spectroscopy to measure the inhibitory prop-
                                              Å
   To determine if exposure to a low flux of O2À had any                     erties of endospores (Fig. 1). Endospores of the Sterne
effect on endospore viability and subsequent germina-                        vaccine strain of B. anthracis were exposed to OÅÀ flux,
                                                                                                                               2
                                                   Å
tion, heat shocked endospores were exposed to O2À , at                      from xanthine/xanthine oxidase, at 1 lM/min for
a rate of 1 lM/min, generated from xanthine/xanthine
oxidase, for either 1 or 10 min at which point SOD
                                     Å
(30 U/mL) was added to eliminate O2À from the reaction
mixture. Following exposure, counts were performed to
determine the number of viable organisms that survived.
As a control, endospores were placed in the same reac-
                                  Å
tion mixture in the absence of O2À .
   To determine if O2 ÅÀ stimulated germination, endo-
spores were incubated in the following media, BHI
broth, L-alanine and inosine. A total of 0.5 mL of endo-
spore suspension was added to 2.5 mL of germination
mixture (final spore concentration 1.8 · 105 spore/mL)
and incubated at room temperature (21 °C) the opti-



                                     H+                  H

                    +    +   O2- •                       OOH
                    N                               N
      (H3C)3CO2C                      (H3C)3CO2C
                                                    •
                    O-                              O


                   BMPO                            BMPO-OOH
                                                                                                              Å
                                                                            Fig. 2. A representative plot of O2À , spin trapped by BMPO, in the
                                          Å
Fig. 1. The nitrone, BMPO, reacts with O2À , affording BMPO-OOH              presence of B. anthracis endospores, washed 10 times. Data show a
that is measurable by EPR spectroscopy at ambient temperatures. This        decrease in the first low-field peak height, arrows in the inset, of the
                                                                Å
analytical method, spin trapping allows real time detection of O2À in       EPR spectrum of BMPO-OOH as a function of spore concentration.
the presence of spores.                                                     Data are the average of three independent experiments.
36                                       L. Baillie et al. / FEMS Microbiology Letters 245 (2005) 33–38

3 min, typically found in stimulated phagocytes (4). The
            Å
degree of O2À scavenging is shown in Fig. 2.
    Two observations are worth noting from data pre-
sented in Fig. 2. First, even at a very low concentration
of endospores, e.g., 5000 spores, the spin trapping of
  Å
O2À by BMPO was modestly inhibited as compared to
control. As we increased the number of spores in the
                           Å
experiment exposed to O2À , the percentage inhibition in-
creased, reaching nearly 60% at 500,000 spores. Second,
there was no significant difference in the OÅÀ scavenging
                                            2
properties of these endospores, whether they were
washed three times (data not shown) or 10 times. These
findings suggest that there is a SOD or a SOD mimic
                                                                           Fig. 4. The percent germination of washed (3·) B. anthracis
that is tightly bound to or associated with the endo-                                              Å
                                                                           endospores exposed to O2À at 1 lM/min for 1 min following 40 min
spore, as extensive washing did not alter the ability of                   incubation in germination medium at room temperature (21 °C).
the endospore to scavenge O2À .Å                                           Each assay was repeated three times. * Statistically different results
                                                                           (p > 0.05).
               Å
3.2. Effect of O2À on endospore viability
                                                                           range of levels reflecting differences in spore treatment
   Endospores of the Sterne strain of B. anthracis                         and germination medium as can be seen in Fig. 4.
                                    Å
(0.5 · 106/mL) were exposed to O2À fluxes of either 1                           The degree of spore washing was found to have little
or 10 lM/min for 10 min (n = 4 for each group). Endo-                                                 Å
                                                                           effect on the rate of O2À induced germination, with
spore survival was assessed as the number of viable col-                   spores washed three times giving similar results to those
ony forming units (cfu)/mL following exposure to OÅÀ .
                                                     2                     washed 10 times (data not shown). These data suggest
As shown in Fig. 3, there was no measurable decrease                       that the phenomenon was not due to contaminating veg-
in endospore viability in the presence of OÅÀ as com-
                                            2                              etative cell debris.
pared to endospores that were not exposed to this free                         The most pronounced germination (80%) was seen
radical.                                                                   when spores where incubated in BHI. That there was
                                                                                                      Å
                                                                           no difference between O2À treated and control spores
               Å
3.3. Effect of O2À on germination                                           (p 7.6) was not particularly surprising given that BHI
                                                                           contains a range of germination triggers.
                        Å
    While exposure to O2À had no discernable effect on                          In the case of L-alanine, a strong, independent germi-
endospore viability, we hypothesized that low fluxes of                     nant of B. anthracis, germination was significantly great-
  Å
O2À may actually promote spore germination. The crit-                      er by 69% (paired student t-test) after treatment with
ical role of macrophages in promoting B. anthracis                         OÅÀ as compared to untreated endospores (50%,
                                                                             2
propagation during infection suggests that the organism                    p = 0.038) after 40 min. While these data were similar
may co-opt host defenses as a necessary part of the                        to those reported by Titball and Manchee [11], they dif-
organismÕs pathogenesis.                                                   fered markedly to those reported by Ireland and Hanna,
    Percentage of endospores, which germinated follow-                     who found that spores of the DSterne variant strain of
ing exposure to OÅÀ flux of 1 lM/min for 1 min, was com-
                  2                                                        B. anthracis germinated extremely rapidly in L-alanine,
pared to that of unexposed controls. While there was no                    >90% in 10 min at room temperature [17].
evidence of germination at time 0, however, by 40 min be-                      The ability of inosine to enhance the activity of ala-
tween 25% and 80% of the spores had germinated, the                        nine has been reported previously [17,20]. In this study,
                                                                           we found that germination levels of 73% (control) and
                                                                                    Å
                                                                           89% (O2À treated) where achieved and that significantly
                                                                           greater germination was observed in the OÅÀ exposed
                                                                                                                          2
                                                                           group (p = 0.0007). Finally, the ability of inosine alone
                                                                           to stimulate germination in these studies, all be it at
                                                                           low levels compared to the other groups, again con-
                                                                           tradicted the results of Ireland and Hanna [17].


                                                                           4. Discussion

Fig. 3. The number of viable organisms follows exposure of endo-              It was not unexpected that endospores of B. anthracis
spores of B. anthracis to OÅÀ at two different rates of OÅÀ production.
                           2                            2                  survived exposure to physiological relevant levels of
                                   L. Baillie et al. / FEMS Microbiology Letters 245 (2005) 33–38                                           37

OÅÀ , given that the endospore is designed to provide
   2                                                                 thought to occur when germinants such as alanine and
protection under much harsher environments. However,                 inosine traverse the outer layers of the endospore and
at some point endospores must germinate into vegeta-                 interact with spore-germination receptor proteins of
tive bacilli in order to replicate. Oxidants, proteases,             the GerA family, which are located at the inner mem-
and other macrophage products are more likely to be                  brane of the endospore [20]. Studies with B. cereus, a
successful in targeting the metabolically active vegeta-             close relative of B. anthracis, which is also reported to
tive bacilli. One source of potential protection for germi-          germinate in the presence of alanine and inosine, have
nating B. anthracis may be endospore remnants that act               to date identified three germination operons, the gerL
as scavengers of biologic oxidants, such as OÅÀ and 2                operon, which recognizes alanine, the gerQ operon
H2O2. In the case of the Leishmania donovani, LPG                    which responses to inosine and gerI operon which re-
(lipophosphoglycan), a surface expressed glycoprotein,               sponds primarily to inosine but it also has some activity
protects the parasite from cytotoxic effects of the macro-            in the presence of alanine [20].
phage by scavenging OÅÀ generated during the respira-
                           2                                            It is fascinating to speculate that these enzymes may
tory burst [21]. The presence of SOD in the                          play a role in regulating germination by preventing the
exosporium, which surrounds the endospore, may play                  access of alanine and inosine and that their activities
a role in protecting the germinating bacilli from oxida-             are influenced by the conditions found inside the macro-
tive injury during a sensitive period until the bacillus             phage, principally radical production. Further studies
fully matures.                                                       will be required to define the roles of these surface lo-
     The observation that low fluxes of OÅÀ can promote
                                           2                         cated enzymes.
germination may explain why endospores need to be
phagocytosed by macrophages before germination can
proceed [22,23]. In this theory, once the endospore is in-           Acknowledgements
side the phagolysosome, NADPH-oxidase secretes O2À        Å
which triggers germinations. This hypothesis is consis-                 This research was supported in part by a grant from
tent with the studies of Weiner and Hanna who reported               the National Institutes of Health, EB-2034, and the Mid
that germination of B. anthracis endospores was dra-                 Atlantic Regional Center for Biodefense and Emerging
matically enhanced as the result of spore/macrophage                 Infectious Diseases (NIH NIAID U54 AI057168).
interaction [23]. While these authors did not offer a
mechanism by which macrophages increased the rate
of spore germination, the possibility that OÅÀ is the trig-
                                              2                      References
gering event cannot be discounted.
     The rates of germination observed in these studies mir-          [1] Driks, A. (2002) Maximum shields: the assembly and function of
rored those reported by Titball and Manchee but differed                   the bacterial spore coat. Trends Microbiol. 10 (6), 251–254.
                                                                      [2] Johnson, D.E., Oppert, B. and McGaughey, W.H. (1998) Spore
from those of Ireland and Hanna who reported signifi-                      protein synergizes Bacillus thuringiensis crystal toxicity for the
cantly faster germination with >90% of endospore germi-                   Indian meal Moth (Plodia interpunctella). Curr. Microbiol. 36,
nating within 10 min [17]. These conflicting results may                   278–282.
reflect differences in assay conditions and the strains                 [3] Helgason, E., Okstad, O.A., Caugant, D.A., Johansen, H.A.,
                                                                          Fouet, A., Mock, M., Hegna, I. and Kolsto (2000) Bacillus
used, unlike the Sterne strain employed in this study,
                                                                          anthracis, Bacillus cereus, and Bacillus thuringiensis – one species
and the fully virulent strains examined by Titball and                    on the basis of genetic evidence. Appl. Environ. Microbiol. 66,
Manchee [11], the DSterne strain used by Ireland and                      2627–2630.
Hanna lacked pXO1, a plasmid known to encode at least                 [4] Matz, L.L., Beaman, C. and Gerhardt, P. (1970) Chemical
one germination operon, gerX, which has been shown to                     composition of exosporium from spores of Bacillus cereus. J.
play a role in germination within macrophages [17,24].                    Bacteriol. 101 (1), 196–201.
                                                                      [5] Garcia-Patrone, M. and Tandecarz, J.S. (1995) A glycoprotein
     Interestingly, Ireland and Hanna also reported that                  multimer from Bacillus thuringiensis sporangia: dissociation into
germination in L-alanine did not require the presence                     subunits and sugar composition. Mol. Cell Biochem. 145, 29–37.
of OCDS, an inhibitor of alanine racemase, an enzyme                  [6] Charlton, S., Moir, A.J.G., Baillie, L. and Moir, A. (1999)
which inhibits germination of B. anthracis and B.cereus                   Characterization of the exosporium of Bacillus cereus. J. Appl.
endospores by converting L-alanine to D-alanine, an iso-                  Microbiol. 87, 241–245.
                                                                      [7] Sylvestre, P., Couture-Tosi, E. and Mock, M. (2002) A collagen-
mer that is not recognized by germination receptors                       like surface glycoprotein is a structural component of the Bacillus
[11,20,25]. This mechanism is thought to enable the                       anthracis exosporium. Mol. Microbiol. 45 (1), 169–178.
organism to control germination when large numbers                    [8] Steichen, C., Chen, P., Kearney, J.F. and Turnbough Jr., C.L.
of spores are present in the same environment [11].                       (2003) Identification of the immunodominant protein and other
                                                                          proteins of the Bacillus anthracis exosporium. J. Bacteriol. 185 (6),
     Recent proteomic studies have demonstrated the
                                                                          1903–1910.
presence of alanine racemase and an inosine preferring                [9] Todd, S.J., Moir, A.J., Johnson, M.J. and Moir, A. (2003) Genes
nucleoside hydrolase in the endospore exosporium, the                     of Bacillus cereus and Bacillus anthracis encoding proteins of the
outer most layer of the spore [8–11,26]. Germination is                   exosporium. J. Bacteriol. 185 (11), 3373–3378.
38                                      L. Baillie et al. / FEMS Microbiology Letters 245 (2005) 33–38

[10] Lai, E.M., Phadke, N.D., Kachman, M.T., Giorno, R., Vazquez,         [19] Stolze, K., Udilova, N., Rosenau, T., Hoifinger, A. and Nohl, H.
     S., Vazquez, J.A., Maddock, J.R. and Driks, A. (2003) Proteomic           (2003) Synthesis and characterization of EMPO-derived 5,5,-
     analysis of the spore coats of Bacillus subtilis and Bacillus             disubstituted 1-pyrroline N-oxides as spin traps forming excep-
     anthracis. J. Bacteriol. 185 (4), 1443–1454.                              tionally stable superoxide spin adducts. Biol. Chem. 384, 493–500.
[11] Titball, R.W. and Manchee, R.J. (1987) Factors affecting the          [20] Barlass, P.J., Houston, C.W., Clements, M.O. and Moir, A.
     germination of spores of Bacillus anthracis. J. Appl. Microbiol.          (2002) Germination of Bacillus cereus spores in response to L-
     62, 269–273.                                                              alanine and to inosine: the roles of gerL and gerQ operons.
[12] Babior, B.M., Kipnes, R.S. and Curnutte, J.T. (1973) Biological           Microbiology 148 (Pt 7), 2089–2095.
     defense mechanisms: the production by leukocytes of superoxide,      [21] Adams, L.B., Hibbs Jr., J.B., Taintor, R.R. and Krahenbuhl, J.L.
     a potential bactericidal agent. J. Clin. Invest. 52, 741–744.             (1990) Microbiostatic effect of murine-activated macrophages for
[13] Babior, B.M. (1999) NADPH oxidase – an update. Blood 93,                  Toxoplasma gondii: role for synthesis of inorganic nitrogen oxides
     1464–1476.                                                                from L-arginine. J. Immunol. 144, 2725–2729.
[14] Guidi-Rontani, C., Weber-Levy, M., Labruyere, E. and Mock,           [22] Ireland, J.A.W. and Hanna, P.C. (2002) Marcophage-enhanced
     M. (1999) Germination of B.anthracis spores within alveolar               germination of Bacillus anthracis endospores requires gerS. Infect.
     macrophages. Mol. Microbiol. 31 (1), 9–17.                                Immun. 70, 5870–5872.
[15] Chan, J., Fujiwara, T., Brennan, P., McNeil, M., Turco, S.J.,        [23] Weiner, M.A. and Hanna, P.C. (2003) Macrophage-mediated
     Sibille, J.C., Snapper, M., Aisen, P. and Bloom, B.R. (1989)              germination of Bacillus anthracis requires the gerH operon. Infect.
     Microbial glycolipids: possible virulence factors that scavenge           Immun. 71 (7), 3954–3959.
     oxygen radicals. Proc. Natl. Acad. Sci. USA 86 (7), 2453–2457.       [24] Guidi-Rontani, C., Pereira, Y., Puffle, S., Sirard, J.-C., Weber-
[16] Miller, R.A. and Britigan, B.E. (1997) Role of oxidants in                Levy, M. and Mock, M. (1999) Identification and characteriza-
     microbial pathophysiology. Clin. Microbiol. Rev. 10, 1–18.                tion of a germination operon on the virulence plasmid pXO1 of
[17] Ireland, J.A. and Hanna, P.C. (2002) Amino acid- and purine               Bacillus anthracis. Mol. Microbiol. 33 (2), 407–414.
     ribonucleoside-induced germination of Bacillus anthracis Delta       [25] Gould, G.W. (1966) Stimulation of L-alanine induced germination
     Sterne endospores: gerS mediates responses to aromatic ring               of Bacillus cereus spores by D-cycloserine and O-carbamyl-D-
     structures. J. Bacteriol. 184.                                            serine. J. Bacteriol. 92, 1261–1262.
[18] Kuthan, H., Ullrich, V. and Estabrook, W. (1982) A quantitative      [26] Redmond, C., Baillie, L.W., Hibbs, S., Moir, A.J. and Moir, A.
     test for superoxide radicals produced in biological systems.              (2004) Identification of proteins in the exosporium of Bacillus
     Biochem. J. 203, 551–558.                                                 anthracis. Microbiology 150 (Pt 2), 355–363.
                                               FEMS Microbiology Letters 245 (2005) 39–45
                                                                                                                     www.fems-microbiology.org




                Meiothermus timidus sp. nov., a new slightly thermophilic
                               yellow-pigmented species
        Ana Luisa Pires a, Luciana Albuquerque b, Igor Tiago a, M. Fernanda Nobre a,
              Nuno Empadinhas b, Antonio Verıssimo a, Milton S. da Costa b,*
                                        ´      ´
            a
                                                           ˆ
             Departamento de Zoologia and Centro de Neurociencias e Biologia Celular, Universidade de Coimbra, 3004-517 Coimbra, Portugal
        b
                                 ´                           ˆ
            Departamento de Bioquımica and Centro de Neurociencias e Biologia Celular, Universidade de Coimbra, 3001-401 Coimbra, Portugal

                          Received 28 December 2004; received in revised form 7 February 2005; accepted 10 February 2005

                                                        First published online 2 March 2005

                                                                 Edited by A. Oren




Abstract

   Several yellow-pigmented isolates, with optimum growth temperatures between 55 and 60 °C, were recovered from hot springs in
Central Portugal and the Azores. Phylogenetic analysis of the 16S rDNA showed that these organisms represented a new species of
the genus Meiothermus. The new isolates could be distinguished from other strains of the species of the genus Meiothermus by bio-
chemical characteristics and the fatty acid composition because they had very high levels of iso C15:0 and iso C17:0 and very low
levels of anteiso C17:0 and iso C16:0. On the basis of the results presented here we propose the name Meiothermus timidus for the
new species represented by strains SPS-243T (=LMG 22897T = CIP 108604T), RQ-10 and RQ-12.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Meiothermus; Meiothermus timidus sp. nov.; Thermaceae




1. Introduction                                                              Meiothermus taiwanensis [10] form, based on 16S rDNA
                                                                             sequence analysis, a separate line of descent within the
   The species of the genera Thermus and Meiothermus,                        genera of the family Thermaceae with which they share
along with the recently described species of Marinither-                     85.2–86.6% sequence similarity [4,11]. One species
mus [1], Vulcanithermus [2] and Oceanithermus [3,4], the                     named ‘‘Meiothermus rosaceus’’, isolated from hot
latter of which were isolated from abyssal hyperthermal                      springs in China, has not been validly described but ap-
vents, currently form the family Thermaceae [5]. The                         pears to be extremely closely related to M. ruber [12].
species Meiothermus ruber was initially included in the                         The species of the genus Meiothermus have only been
genus Thermus, but the description of other ‘‘low-tem-                       isolated from fresh water heated environments and have
perature’’ species, clearly showed that these organisms                      a lower growth temperature range than those of the
belonged to a distinct genus, which was named Meio-                          genera Thermus, Marinithermus and Vulcanithermus
thermus [6]. The species of the genus Meiothermus,                           [1–5,11]. The former have growth temperatures ranges
namely M. ruber [7], Meiothermus silvanus [8], Meiother-                     between about 35 and 68 °C, while the latter grow be-
mus chliarophilus [8], Meiothermus cerbereus [9] and                         tween about 40 and 83 °C. Only a few strains of the
                                                                             genus Thermus possess 3-OH iso- or anteiso-fatty acids,
 *
     Corresponding author. Tel: +351 239824024; fax: +351 239826798.         but 2-OH fatty acids have never been encountered in
     E-mail address: milton@ci.uc.pt (M.S. da Costa).                        strains of this genus [13]. The species of the genera

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.011
40                                 A.L. Pires et al. / FEMS Microbiology Letters 245 (2005) 39–45

Marinithermus [1], Vulcanithermus [2] and Oceanither-                stored at À70 °C in Thermus medium with 15% (w/v)
mus [3,4] appear not to possess hydroxy-fatty acids.                 glycerol. The type strains of M. chliarophilus ALT-8
However, 2-OH and 3-OH fatty acids have always been                  (=DSMZ 9957) and M. ruber Loginova 21 (=DSMZ
detected in Meiothermus strains [14]. The strains of the             1279) were used for comparative purposes.
species of the genus Thermus possess one major glyco-
lipid designated GL-1 and a major phospholipid desig-                2.2. Morphology, growth, biochemical and physiological
nated PL-2 [13], although all strains of the species of              characteristics
the genus Meiothermus examined possess two major gly-
colipid variants on thin-layer chromatography, desig-                    Cell dimensions and motility were determined by
nated GL-1a and GL-1b, that differ due to the                         phase contrast microscopy during exponential growth
presence of amide-linked 2-OH fatty acids in GL-1a                   in Thermus liquid medium. The growth temperature
and amide-linked 3-OH iso-branched or an iso-branched                range of the strains was examined by measuring the tur-
fatty acid in GL-1b [14]. The species of Meiothermus are             bidity (610 nm) of cultures incubated in 300-ml metal-
generally red-pigmented, except for the three known                  capped Erlenmeyer flasks, containing 100 ml of Thermus
strains of M. chliarophilus, which are yellow-pigmented.             medium in a reciprocal water-bath shaker. The pH
On the other hand, the other genera of the family Therm-             range for growth was examined at 50 °C as described
aceae consist of yellow- or non-pigmented strains.                   previously [8].
                                  ˜
   The hydrothermal spring at Sao Pedro do Sul in Cen-                   Unless otherwise stated, all biochemical and toler-
tral Portugal has yielded many strains of the genus Ther-            ance tests were performed, as described previously
mus [5], as well as strains closely related to the type              [8], in Thermus liquid medium or Thermus agar at
strain of M. ruber [6]. Recently, we isolated one yel-               50 °C for up 5 days. Single-carbon source assimilation
low-pigmented strain of the genus Meiothermus that                   tests were performed in a minimal medium composed
was clearly distinct from the strains of the other species           of Thermus basal salts with 0.1 g per litre of yeast ex-
of this genus. A few months later we also isolated several           tract containing filter-sterilized ammonium sulfate
yellow-pigmented strains of the genus Meiothermus                    (0.5 g lÀ1) and the carbon source (2.0 g lÀ1). Growth
                       ˜
from the Island of Sao Miguel in the Azores that be-                 was examined daily by measuring the turbidity of cul-
longed to the same new species. Phylogenetic analysis                tures incubated in 20 ml screw capped tubes contain-
of the 16S rRNA gene sequence, physiological and bio-                ing 10 ml of medium for a total of 5 days. Positive
chemical characteristics clearly indicate that strains SPS-          and negative control cultures were grown in Thermus
243T, RQ-10 and RQ-12 belong to a new species of the                 medium and the minimal medium without carbon
genus Meiothermus for which we propose the name                      source. Anaerobic growth was assessed in cultures
Meiothermus timidus.                                                 grown in Thermus medium incubated in anaerobic
                                                                     chambers with an H2/CO2 atmosphere (BioMerieux,
                                                                     Marcy lÕEtoile, France).
2. Materials and methods
                                                                     2.3. Lipid and fatty acid analyse
2.1. Isolation and bacterial strains
                                                                        The cultures used for polar lipid analysis were
   Strain SPS-243T (T = type strain), SPS-217, SPS-241               grown in 1 l Erlenmeyer flasks containing 200 ml of
and SPS-242 were isolated from biofilm samples in the                 Thermus medium at 50 °C in a reciprocal water-bath
                                       ˜
effluent water of the hot spring at Sao Pedro do Sul,                  shaker until the late exponential phase of growth.
in Central Portugal. Samples were transported without                Harvesting of the cultures, extraction of the lipids
temperature control and filtered the same day through                 and single dimensional thin-layer chromatography
membrane filters (Gelman type GN-6; pore size                         were performed as described previously [17]. Lipoqui-
0.45 lm; diameter 47 mm). The filters were placed on                  nones were extracted from freeze-dried cells and were
the surface of Thermus medium solidified with agar                    purified by thin-layer chromatography, and separated
[15] or buffered charcoal yeast extract (BCYE) which                  by high performance liquid chromatography as de-
is normally used for the isolation and growth of Legion-             scribed previously [18]. Cultures for fatty acid analysis
ella spp. [16]. Strains RQ-10, RQ-12, RQ-18, RQ-21,                  were grown on solidified Thermus medium, in sealed
TU-1 and TU-2, were isolated from the Island of Sao   ˜              plastic bags submerged in a water bath at 50 °C for
Miguel, in the Azores, by filtering water samples main-               24 h. Fatty acid methyl esters (FAMEs) were obtained
tained for six days at room temperature. Filters were                from fresh wet biomass by saponification, methylation
placed on the surface of Thermus agar. All plates, with              and extraction and the fatty acids identified and quan-
the filters were wrapped in plastic bags and incubated                tified with the standard MIS Library Generation Soft-
at 50 °C for up to 4 days. Cultures were purified by                  ware (Microbial ID Inc., Newark, DE, USA) as
sub-culturing on Thermus medium and the isolates                     described by the manufacturer.
                                 A.L. Pires et al. / FEMS Microbiology Letters 245 (2005) 39–45                                          41

2.4. Determination of G+C content of DNA and 16S                   later after enrichments at 50 °C in an attempt to recover
rRNA gene sequence determination and phylogenetic                  other yellow-pigmented Meiothermus strains. Several
analyses                                                           yellow-pigmented strains, namely RQ-10, RQ-12, RQ-
                                                                   18, RQ-21, TU-1 and TU-2 were recovered from ther-
   The DNA for the determination of the G+C content                mal sites at Ribeira Quente and Furnas, where the water
of the DNA was isolated as described previously [19].              temperature varied between 47 and 60 °C and the pH
The G+C content of DNA was determined by high-                     was about 7.3. These organisms possessed nearly identi-
performance liquid chromatography as described by                  cal fatty acid profiles as well as 2-OH fatty acids and
Mesbah et al. [20].                                                three strains (RQ-10, RQ-12 and RQ-18) were chosen
   The extraction of genomic DNA for 16S rRNA gene                 for 16S rRNA gene sequence analysis and further
sequence determination, PCR amplification of the 16S                characterization.
rRNA gene and sequencing of the purified PCR prod-
ucts were carried out as described previously [21]. Puri-          3.2. Biochemical and physiological characteristics
fied reactions were electrophoresed using a model 310
Genetic Analyzer (Applied Biosystems, Foster City,                    Strain SPS-243T had an optimum growth temperature
Ca.). The quality of 16S rRNA gene sequences was                   in the neighborhood of 55–60 °C and did not grow at
checked manually using the BioEdit sequence editor                 70 °C; the other red-pigmented isolates from Sao Pedro
                                                                                                                 ˜
[22] and aligned against representative reference se-              do Sul had slightly higher optimum growth temperatures
quences of members of the family Thermaceae, obtained              of about 60 °C. The yellow-pigmented strain SPS-217
from EMBL, using the multiple-alignment CLUSTAL                    had an optimum growth temperature around 70 °C.
X software package [23]. The method of Jukes and Can-
tor [24] was used to calculate evolutionary distances;             Table 1
phylogenetic dendrograms were constructed using the                Phenotypic characteristics of the new isolates and their phylogeneti-
neighbor-joining method [25], and trees topologies were            cally closest relative Meiothermus chliarophilus
evaluated by performing bootstrap analysis [26] of 1000            Characteristicsa     Strains
data sets using the MEGA2 package [27].                                                 SPS-243T      RQ-10       RQ-12    M. chliarophilusT
                                                                   Pigmentation         Yellow        Yellow      Yellow   Yellow
2.5. Nucleotide sequence Accession Nos.
                                                                   Presence of:
                                                                     Catalase           +             +           +        À
   The 16S rRNA gene sequences determined in this                    Oxidase            +             +           +        +
study were deposited in EMBL data library under the
                                                                   Hydrolysis of:
Accession   No.    SPS-243T   (AJ871168),   RQ-10                   Elastin             +             +           +        +
(AJ871169), RQ-12 (AJ871171), RQ-18 (AJ871170),                     Starch              +             +           +        +
SPS-217 (AJ871174), SPS-241 (AJ871172) and SPS-242                  Casein              +             +           +        +
(AJ871173).                                                        Reduction of         +             +           +        +
                                                                     NOÀ to NOÀ
                                                                        3       2

                                                                   Utilization of:
3. Results                                                           D-Glucose          +             +           +        +
                                                                     D-Fructose         +             +           +        +
3.1. Isolation of strains                                            D-Xylose           +             +           +        +
                                                                     L-Arabinose        +             +           +        À
                                                                     D-Trehalose        +             +           +        +
    Buffered charcoal yeast extract medium was used to                D-Cellobiose       +             +           +        +
isolate organisms from biofilms, along runoffs (temp.                  D-Melibiose        +             +           +        +
49.5 °C, pH 8.3) of the hot spring at Sao Pedro do
                                             ˜                       D-Raffinose          +             +           +        +
Sul, in an attempt to isolate organisms that might not               L-Rhamnose         À             À           À        À
                                                                     Sucrose            +             +           +        +
grow on some of the conventional media used for the
                                                                     D-Sorbitol         +             +           +        +
isolation of thermophilic aerobes. All isolates recovered,           D-Mannitol         +             +           +        +
during enrichments in BCYE at 50 °C, were subse-                     Ribitol            À             À           À        À
quently found to grow very well on Thermus medium                    Glycerol           À             À           À        +
and did not have a requirement for any of the compo-                 Pyruvate           +             +           +        +
                                                                     Succinate          +             +           +        À
nents of this medium. Strains SPS-241 and SPS-242
                                                                     L-Proline          +             +           +        +
formed rod-shaped and filamentous cells, and red colo-                L-Serine           +             +           +        +
nies. Strains SPS-243T and SPS-217 were morphologi-                  L-Asparagine       +             +           +        +
cally similar, but formed yellow-pigmented colonies. A               L-Arginine         +             +           +        +
large number of isolates from hot springs on the Is. of              L-Glutamine        +             +           +        +
                                                                    a
  ˜
Sao Miguel in the Azores were obtained several months                   +, Positive result; À, negative result.
42                                        A.L. Pires et al. / FEMS Microbiology Letters 245 (2005) 39–45

The optimum pH of strain SPS-243T was between 7.0                           strains was menaquinone 8 (MK-8). The fatty acids were
and 8.0. Strains SPS-243T, RQ-10 and RQ-12 were oxi-                        predominantly iso- and anteiso-branched fatty acids; 2-
dase positive and catalase positive (Table 1). These                        OH and 3-OH fatty acids were detected in the Meiother-
organisms, like other strains of the genus Meiothermus,                     mus strains. Strains SPS-243T and all the Ribeira Quente
used carbohydrates, organic acids and amino acids as                        strains had higher levels of iso C15:0 and iso C17:0 and
single carbon and energy sources, however the carbon                        low levels of anteiso C17:0 and iso C16:0 than the strains
source assimilation patterns were almost identical to                       of any of the other species of the genus Meiothermus
those of M. chliarophilus. Nitrate was reduced to nitrite,                  (Table 2).
but anaerobic growth in the presence or absence of ni-
trate was not observed.                                                     3.4. 16S rRNA gene sequence comparison and G+C
                                                                            content of DNA
3.3. Polar lipids, respiratory quinones and fatty acids
                                                                               Partial 16S rRNA gene sequences comprising 1455–
   The polar lipid pattern of strains SPS-241, SPS-242,                     1500 nucleotides were determined for strains SPS-243T,
and SPS-243T was composed of one major phospholipid                         RQ-10, RQ-12, RQ-18, SPS-217, SPS-241 and SPS-
(PL-2) and two major glycolipid variants (GL-1a and                         242. Comparison of these sequences with representatives
GL-1b) migrating close to each other on TLC plates;                         of the main lines of descent within the domain Bacteria
the polar lipid pattern of strain SPS-217 had only one                      indicated that these strains were members of the family
glycolipid (GL-1) similar to other Thermus strains (re-                     Thermaceae (Fig. 1). Isolate SPS-217 was clearly a
sults not shown). The major respiratory quinone of all                      member of the genus Thermus with highest sequence


Table 2
Mean faty acid composition of the strains belonging to the genus Meiothermus grown at 50 °C
Fatty acidsb            Percentage of the total in:
                        M. ruber         M. silvanus     M. chliarophilus     M. cerbereus     M. taiwanensis     New isolatesa
                                                                                                                  SPS 243T        Azorean strains
                        (13 strains)c    (5 strains)     (3 strains)          (6 strains)      (2 strains)                        (6 strains)
13:0 Iso                 0.6              0.8             1.5                  1.4              0.7                1.3             1.7
14:0 Iso                 0.7              0.7             1.7                  2.7              0.7               –d               0.5
14:0                     0.6              0.3             0.7                 –                –                  –                0.5
13:0 Iso 30H             0.4              0.8            –                    –                 1.1                0.5             0.4
15:1 Iso x9c             2.7             –               –                     3.8              0.3               –               –
15:0 Iso                33.0             25.6            42.1                 34.6             38.4               46.5            49.3
15:0 Anteiso             5.5             26.5             8.1                 11.1              2.9                3.0             3.3
15:0                     1.8              0.4             2.1                  1.6              2.0                0.5             1.1
16:1 Alcohol             0.8             –               –                     1.9             –                  –               –
16:0 Iso                 2.9              1.5             2.5                  4.0              2.6                0.8             0.6
15:0 Iso 2OH             0.7              0.9             0.5                 –                 0.7                1.1             0.7
16:0                     7.6              6.4             9.1                  4.5              6.1                6.4             6.8
Unknown diol             1.1              2.5             0.7                 –                 0.4               –               –
15:0 Iso 3OH            –                –                1.0                 –                –                   2.5             2.9
17:1 Iso x9c             6.5             –               –                     4.8              1.1               –               –
17:1 Anteiso x9c         1.0             –               –                    –                –                  –               –
17:0 Iso                13.3             10.0            16.4                  5.8             17.4               27.6            23.2
17:0 Anteiso             3.7              6.4             2.7                  2.5              2.4                1.8             1.8
17:1 x8c                 0.8             –               –                    –                –                  –               –
17:1 x6c                 0.8              1.3             0.7                 –                 0.3               –               –
17:0                     0.8              0.3             1.2                 –                 1.7                0.3             0.5
16:0 2OH                 0.6              0.5             0.4                 –                 1.0               –               –
17:0 Iso 2OH             7.8              9.6             7.3                  3.3             12.0                6.9             4.7
17:0 Anteiso 2OH         0.4              3.0             0.6                 –                 0.2               –               –
17:0 Iso 3OH             1.1             –               –                     4.7             –                   0.8             1.1
19:0 Iso                –                 2.6            –                    –                –                  –               –
19:0 Anteiso            –                 1.6            –                    –                –                  –               –
17:0 Anteiso 3OH         0.6             –               –                     1.4             –                  –               –
18:0 Iso diol           –                 1.6            –                    –                 4.5                1.6             0.7
 a
     The fatty acid composition of the type strain is listed separated from those of Azorean RQ and TU strains.
 b
     Values for fatty acids present at levels of less than 0.5% in all strains are not shown.
 c
     Number of strains examined.
 d
     Not detected.
                                          A.L. Pires et al. / FEMS Microbiology Letters 245 (2005) 39–45                                            43

                                                                                Meiothermus taiwanensis DSM 14542T (AF418001)
                                                                           SPS-241 (AJ871172)
                                                                   97     SPS-242 (AJ871173)
                                                              100          “Meiothermus rosaceus” CCTCC AB200291T (AF312766)
                                                                    94 Meiothermus ruber DSM 1279T (L09672)

                                                                            Meiothermus cerbereus DSM 11376T (Y13594)
                                    97
                                                                            SPS-243T (AJ871168)
                                                                            RQ-10 (AJ871169)
                                                                      100
                                                                            RQ-12 (AJ871171)
                                                                            RQ-18 (AJ871170)
                                           100
                                                                            Meiothermus chliarophilus DSM 9957T (X84212)
                                                                          Meiothermus silvanus DSM 9946T (X84211)
                                                                    100      Thermus scotoductus DSM 8553T (Y18410)
                                                        90
                                                                                SPS-217 (AJ871174)
                                                   84
                                                                          Thermus aquaticus DSM 625T (L09663)
                                                                      Thermus thermophilus DSM 579T (M26923)
                                            95
                                                                             Thermus filiformis DSM 4687T (L09667)
                                                                              Thermus oshimai ATCC 700435T (Y18416)
                                                                               Vulcanithermus mediatlanticus DSM 14978T (AJ507298)
                            100                               Marinithermus hydrothermalis DSM 14884T (AB079382)
                                                                  Oceanithermus profundus DSM 14977T (AJ430586)
                                                        100     Oceanithermus desulfurans DSM 15757T (AB107956)

                             0.01


Fig. 1. Phylogenetic dendrogram based on a comparison of the 16S rDNA sequences of strains SPS-243T, RQ-10, RQ-12, RQ-18, SPS-241, SPS-242
and SPS-217 and the representative type strains of the family Thermaceae. The trees were created using the neighbour-joining method. The numbers
on the tree indicate the percentages of bootstrap sampling, derived from 1000 replications. Isolates characterized in this study are indicated in bold.
Scale bar, 10 inferred nucleotide substitutions per 100 nucleotides.



similarity to the type strain of Thermus scotoductus                            ilarity. The two most closely related organisms of this
(98.8%), while the remainder of the isolates represented                        clade were M. ruber and ‘‘M. rosaceus’’, which share
lineages of the genus Meiothermus. The pairwise 16S                             99.8% sequence similarity. However, M. rosaceus is re-
rRNA gene sequence similarity determined between                                ported to have a DNA:DNA reassociation value of
strains SPS-241 and SPS-242 was 99.9% with each other                           62.9% with the type strain of M. ruber indicating that
and 98.4–99.8% within the M. ruber/M. taiwanensis/‘‘M.                          this organism represents a distinct genomic species [12].
rosaceus’’ clade (Fig. 1). The 16S rRNA gene sequence                              We initially thought that the yellow-pigmentation of
similarity between strains SPS-243T, RQ-10, RQ-12                               the M. chliarophilus strains, which have only been iso-
and RQ-18 varied from 99.8% to 100%. This group of                              lated from the hot spring at Alcafache in Central Portu-
strains showed highest pairwise similarity (93.0%) with                         gal, was not a stable characteristic of this species and
the type strain of M. chliarophilus. The G+C content                            that other strains from different geographical areas
of the DNA of strain SPS-243T was 65.1 mol%.                                    could be red-pigmented, like all other Meiothermus
                                                                                strains described previously [8–10]. The isolation of
                                                                                strain SPS-243T from the hot spring at S. Pedro do
4. Discussion                                                                   Sul indicated that the genus Meiothermus comprises spe-
                                                                                cies where yellow-pigmentation could be a stable charac-
   Strains SPS-243T, RQ-10 and RQ-12 clearly belong                             teristic. The isolation of strain SPS-243T induced us to
to the genus Meiothermus based on the phylogenetic                              attempt to isolate yellow-pigmented Meiothermus
analysis of 16S rRNA gene sequence, the low growth                              strains from hot springs on the Is. of S. Miguel, at an
temperature range, the presence of two glycolipid vari-                         enrichment temperature of 50 °C, leading to the isola-
ants and 2-OH fatty acids. The phylogenetic analysis                            tion of strains belonging to the same species as strain
shows that the new species represented by strain SPS-                           SPS-243T and the demonstration that yellow-pigmented
243T, RQ-10, and RQ-12 is most closely related to M.                            Meiothermus strains are more common than previously
chliarophilus although these two species share only                             expected. It is very likely that yellow-pigmented isolates
about 93.0% 16S rRNA gene sequence similarity. Two                              of the genus Meiothermus recovered from enrichments
red-pigmented isolates from the hot spring at Sao Pedro
                                               ˜                                of water samples at 50–60 °C have been overlooked as
do Sul, namely SPS-241 and SPS-242 were most closely                            belonging to species of the genus Thermus which also
related to the M. ruber/M. taiwanensis/‘‘M. rosaceus’’                          grow at these temperatures. We generally chose red-pig-
clade, sharing 98.4–99.8% 16S rRNA gene sequence sim-                           mented colonies for further examination of Meiothermus
44                                A.L. Pires et al. / FEMS Microbiology Letters 245 (2005) 39–45

spp. after enrichments at these low temperatures and                SPS-243T, has been deposited in the Collection of the
discarded colonies with the normal yellow Thermus                   Institut Pasteur, Paris, France, as strain CIP 108604T
pigmentation.                                                       and in the BCCM/LMG Bacteria Collection, Ghent,
   The yellow-pigmentation of M. chliarophilus and                  Belgium as strain LMG 22897T.
strain SPS-243T corroborate the phylogenetic analysis
which indicates that these organisms are more closely re-
lated to each other than to the other species of the genus          Acknowledgements
Meiothermus. The 16S rRNA gene sequence analysis ar-
gues for the division of the genus Meiothermus into three             This research was funded in part by FCT/FEDER
genera namely; one that would include M. ruber, M. tai-             projects POCTI/35661/ESP/2000 and POCTI/35029/
wanensis M. cerbereus and ‘‘M. rosaceus’’, another genus            BSE/2000. We are indebted to Prof. J. Euzeby (Ecole´
that includes the species represented by strain SPS-243T,                      ´ ´
                                                                    National Veterinaire, Toulouse, France) for the etymol-
RQ-10 and RQ-12 and M. chliarophilus, and finally a                  ogy of the new organismÕs name.
novel genus for M. silvanus strains. However, there are
no phenotypic characteristics to distinguish these species
along these ranks that justify such a massive change in
the systematics of these organisms and we will, there-              References
fore, maintain the genus Meiothermus as defined by No-
                                                                     [1] Sako, Y., Nakagawa, S., Takai, K. and Horikoshi, K.
bre et al. [6].                                                          (2003) Marinithermus hydrothermalis gen. nov., sp. nov., a
   Differences in carbon source assimilations, the dis-                   strictly aerobic, thermophilic bacterium from a deep-sea
tinctive fatty acid composition with high proportions                    hydrothermal vent chimney. Int. J. Syst. Evol. Microbiol.
of iso C15:0 and iso C17:0, yellow pigmentation and                      53, 59–65.
                                                                     [2] Miroshnichenko, M.L., LÕHaridon, S., Nercessian, O., Antipov,
the 16S rRNA gene sequence analysis lead us to propose
                                                                         A.N., Kostrikina, N.A., Tindall, B.J., Schumann, P., Spring, S.,
the new species Meiothermus timidus for strain SPS-243T                  Stackebrandt, E., Bonch-Osmolovskaya, E.A. and Jeanthon, C.
(= LMG 22897T = CIP 108604T).                                            (2003) Vulcanithermus mediatlanticus gen. nov., sp. nov., a novel
                                                                         member of the family Thermaceae from a deep-sea hot vent. Int. J.
                                                                         Syst. Evol. Microbiol. 53, 1143–1148.
                                                                     [3] Miroshnichenko, M.L., LÕHaridon, S., Jeanthon, C., Antipov,
                                                                         A.N., Kostrikina, N.A., Tindall, B.J., Schumann, P., Spring, S.,
5. Description of Meiothermus timidus sp. nov.                           Stackebrandt, E. and Bonch-Osmolovskaya, E.A. (2003) Oceani-
                                                                         thermus profundus gen. nov., sp. nov., a thermophilic, microaer-
    Meiothermus timidus (tiÕmi. dus. L. adj. timidus, ti-                ophilic, facultatively chemolithoheterotrophic bacterium from a
mid, shy; because only one strain was recovered from                     deep-sea hydrothermal vent. Int. J. Syst. Evol. Microbiol. 53,
the hot spring at Sao Pedro do Sul after the isolation
                      ˜                                                  747–752.
                                                                     [4] Mori, K., Kakegawa, T., Higashi, Y., Nakamura, K., Maruyama,
of so many organisms, over several years, from this site).               A. and Hanada, S. (2004) Oceanithermus desulfurans sp. nov., a
M. timidus forms rod-shaped cells of variable length and                 novel thermophilic, sulfur-reducing bacterium isolated from a
are 0.5–0.8 lm wide. Long filaments are also present.                     sulfide chimney in Suiyo Seamount. Int. J. Syst. Evol. Microbiol.
Gram stain is negative. The cells are non-motile and                     54, 1561–1566.
spores are not formed. Colonies on Thermus medium                    [5] da Costa, M.S. and Rainey, F.A. (2001) Family Thermaceae,
                                                                         second ed (Boone, D.R. and Castenholtz, R.W., Eds.), BergeyÕs
are bright yellow-pigmented and 1–2 mm in diameter                       Manual of Systematic Bacteriology, vol. 1, pp. 403–420. Springer-
after 72 h of growth. The optimum growth temperature                     Verlag, New York.
for strain SPS-243T is about 55–60 °C. The optimum pH                [6] Nobre, M.F., Truper, H.G. and da Costa M.S. (1996) Transfer of
                                                                                           ¨
is about 7.5; growth does not occur at pH 5.0 or 10.5.                   Thermus ruber [7] , Thermus silvanus [8] and Thermus chliarophilus
The major respiratory quinone is menaquinone 8. Gly-                     [8] to Meiothermus gen. nov. as Meiothermus ruber comb. nov.,
                                                                         Meiothermus silvanus comb. nov., and Meiothermus chliarophilus
colipid variants GL-1a and GL-1b are present. The ma-                    comb. nov., respectively, and emendation of the genus Thermus.
jor fatty acids are 15:0 iso and 17:0 iso; 3-OH and 2-OH                 Int. J. Syst. Bacteriol. 46, 604–606.
fatty acids are present. Aerobic and heterotrophic. All              [7] Loginova, L.G., Egorova, L.A., Golovacheva, R.S. and Seregina,
strains are oxidase positive and catalase positive. Nitrate              L.M. (1984) Thermus ruber sp. nov., nom. rev. Int. J. Syst.
is reduced to nitrite. Degradation of elastin, starch and                Bacteriol. 34, 498–499.
                                                                     [8] Tenreiro, S., Nobre, M.F. and da Costa, M.S. (1995) Thermus
casein is positive. Strains SPS-243T, RQ-10 and RQ-12                    silvanus sp. nov. and Thermus chliarophilus sp. nov., two new
utilize D-glucose, D-fructose, D-melibiose, D-cellobiose,                species related to Thermus ruber but with lower growth temper-
sucrose, D-trehalose, D-raffinose, D-xylose, L- arabinose,                 atures. Int. J. Syst. Bacteriol. 45, 633–639.
D-sorbitol, D-mannitol, pyruvate, succinate, L-serine, L-            [9] Chung, A.P., Rainey, F., Nobre, M.F., Burghardt, J. and da
asparagine, L- arginine, L-glutamine and L-proline.                      Costa, M.S. (1997) Meiothermus cerbereus sp. nov., a new slightly
                                                                         thermophilic species with high levels of 3-hydroxy fatty acids. Int.
    The DNA of strain SPS-243T has a G+C content of                      J. Syst. Bacteriol. 47, 1225–1230.
65.1 mol%. This bacterium was isolated from hot spring              [10] Chen, M.Y., Lin, G.H., Lin, Y.T. and Tsay, S.S. (2002)
     ˜
at Sao Pedro do Sul in Central Portugal. The type strain,                Meiothermus taiwanensis sp. nov., a novel filamentous, thermo-
                                             A.L. Pires et al. / FEMS Microbiology Letters 245 (2005) 39–45                                           45

       philic species isolated in Taiwan. Int. J. Syst. Evol. Microbiol. 52,   [19] Nielsen, P., Fritze, D. and Priest, F.G. (1995) Phenetic diversity of
       1647–1654.                                                                   alkaliphilic Bacillus strains: proposal for nine new species.
[11]   Nobre, M.F. and da Costa, M.S. (2001) The genus Meiothermus,                 Microbiology 141, 1745–1761.
       second ed (Boone, D.R. and Castenholtz, R.W., Eds.), BergeyÕs           [20] Mesbah, M., Premachandran, U. and Whitman, W. (1989) Precise
       Manual of Systematic Bacteriology, vol. 1, pp. 414–420. Springer-            measurement of the G+C content of deoxyribonucleic acid by
       Verlag, New York.                                                            high performance liquid chromatography. Int. J. Syst. Bacteriol.
[12]   Chen, C., Lin, L., Peng, Q., Ben, K. and Zhou, Z. (2002)                     39, 159–167.
       Meiothermus rosaceus sp. nov. isolated from Tengchong hot               [21] Rainey, F.A, Ward-Rainey, N., Kroppenstedt, R.M. and Stacke-
       spring in Yunnan, China. FEMS Microbiol. Lett. 216, 263–268.                 brandt, E. (1996) The genus Nocardiopsis represents a phyloge-
[13]   Carreto, L., Wait, R., Nobre, M.F. and da Costa, M.S. (1996)                 netically coherent taxon and a distinct actinomycete lineage:
       Determination of the structure of a novel glycolipid from Thermus            proposal of Nocardiopsaceae fam. nov. Int. J. Syst. Bacteriol. 46,
       aquaticus 15004 and demonstration that hydroxy fatty acids are               1088–1092.
       amide linked to glycolipids in Thermus spp. J. Bacteriol. 178,          [22] Hall, T.A. (1999) BioEdit: a user-friendly biological sequence
       6479–6486.                                                                   alignment editor and analysis program for Windows 95/98/NT.
[14]   Ferreira, A.M., Wait, R., Nobre, M.F. and da Costa, M.S. (1999)              Nucleic. Acids. Symp. Ser. 41, 95–98.
       Characterization of glycolipids from Meiothermus spp.. Microbi-         [23] Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and
       ology 145, 1191–1199.                                                        Higgins, D.G. (1997) The ClustalX windows interface: flexible
[15]   Williams, R.A.D. and da Costa, M.S. (1992) The genus Thermus                 strategies for multiple sequence alignment aided by quality
       and related microorganisms In: The Prokaryotes (Balows, A.,                  analysis tools. Nucleic Acids Res. 24, 4876–4882.
       Truper, A.G., Dworkin, M., Harder, W. and Schleifer, K.-H.,
          ¨                                                                    [24] Jukes, T.H. and Cantor, C.R. (1969) Evolution of protein
       Eds.), second ed, pp. 3745–3753. Springer-Verlag, New York.                  molecules In: Mammalian Protein Metabolism (Munro, H.N.,
[16]   Edelstein, P.H. (1981) Improved semiselective medium for isola-              Ed.), pp. 21–132. Academic Press, New York.
       tion of Legionella pneumophila from contaminated clinical and           [25] Saitou, N. and Nei, M. (1987) The neighbor-joining method: a
       environmental specimens. J. Clin. Microbiol. 14, 298–303.                    new method for reconstructing phylogenetic trees. Mol. Biol.
[17]   Prado, A., da Costa, M.S. and Madeira, V.M.C. (1988) Effect of                Evol. 4, 406–425.
       growth temperature on the lipid composition of two strains of           [26] Felsenstein, J. (1985) Confidence limits on phylogenies: an
       Thermus sp. J. Gen. Microbiol. 134, 1653–1660.                               approach using the bootstrap. Evolution 39, 783–791.
[18]   Tindall, B.J. (1989) Fully saturated menaquinones in the archae-        [27] Kumar, S., Tamura, K., Jakobsen, I.B. and Nei, M. (2001)
       bacterium Pyrobaculum islandicum. FEMS Microbiol. Lett. 60,                  MEGA2: molecular evolutionary genetics analysis software.
       251–254.                                                                     Bioinformatics 12, 1244–1245.
                                               FEMS Microbiology Letters 245 (2005) 47–52
                                                                                                                    www.fems-microbiology.org




                       The Photorhabdus Pir toxins are similar
               to a developmentally regulated insect protein but show
                        no juvenile hormone esterase activity
                                Nicholas Waterfield a, Shizuo George Kamita b,
                               Bruce D. Hammock b, Richard ffrench-Constant a,*
                                a
                                    Department of Biology and Biochemistry, University of Bath, Bath, BA2 7AY, UK
                                     b
                                       Department of Entomology, University of California, Davis, CA 95616, USA

                         Received 6 October 2004; received in revised form 18 January 2005; accepted 14 February 2005

                                                        First published online 9 March 2005

                                                                Edited by M. Pallen




Abstract

    The genome of the insect pathogen Photorhabdus luminescens strain TT01 contains numerous genes predicting toxins and pro-
teases. Within the P. luminescens TT01 genome, the products of two loci, plu 4093-plu 4092 and plu 4437-plu 4436, show oral insec-
ticidal activity against both moth and mosquito larvae. The proteins encoded by these loci, here termed ÔPhotorhabdus insect relatedÕ
(Pir) proteins A and B, show similarity both to d-endotoxins from Bacillus thuringiensis (Bts) and a developmentally regulated pro-
tein from a beetle, Leptinotarsa decemlineata. The beetle protein has been inferred to possess juvenile hormone esterase (JHE) activ-
ity due to its developmentally regulated pattern of expression and the Photorhabdus proteins PirA and PirB have been proposed to
be mimics of insect JHEs that can disrupt insect metamorphosis by metabolizing the insect growth regulator juvenile hormone (JH)
[Nat. Biotechnol. 21 (2003) 1307–1313]. Here we confirm that, when injected together, PirA and PirB from two different Photorhab-
dus strains have insecticidal activity against caterpillars of the moth Galleria mellonella but show no oral activity against a second
moth species Manduca sexta. Direct measurement of JHE activity, however, shows that the Pir proteins are not able to metabolise
JH. These data show that the Pir proteins have no JHE activity, as suggested, but leave the mode of action of these interesting
proteins uncertain.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Juvenile hormone esterase; Insecticidal toxin; Photorhabdus luminescens




1. Introduction                                                              only two classes of genes have been investigated in de-
                                                                             tail. The first, the toxin complex (tc) genes, encode high
   The genome of the insect pathogen Photorhabdus                            molecular weight Tc toxins with oral activity against a
luminescens subsp. laumondii strain TT01 (termed                             range of caterpillar pests [2]. Although the functional
TT01 for brevity) contains numerous genes predicting                         activity of different Tc protein sub-domains has recently
toxins, hemolysins and proteases, which may be impor-                        been investigated via their expression in tissue culture
tant for insect pathogenicity [1]. Of the predicted toxins,                  cells [3], their precise mode of action remains obscure.
                                                                             The second class of toxins, encoded by homologs of
 *
     Corresponding author. Tel.: +44 1225 386261.                            the makes caterpillars floppy (mcf) gene, promote pro-
     E-mail address: bssrfc@bath.ac.uk (R. ffrench-Constant).                 grammed cell death (apoptosis) within the hemocytes

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.018
48                               N. Waterfield et al. / FEMS Microbiology Letters 245 (2005) 47–52

(insect phagocytes) and midgut epithelium of injected in-           and PirB together showed rapid morbidity and subse-
sects [4]. This destruction of the midgut reduces the cat-          quent darkening of the cuticle and death. This study
erpillarÕs body turgor and makes them ÔfloppyÕ.                      shows that Pir proteins are not associated with any
Interestingly, the Mcf protein carries a Bcl-2 homology             JHE activity and also casts doubt on the presumed func-
domain 3-like (BH3-like) domain and directly activates              tion of the developmentally regulated L. decemlineata
apoptosis in treated cells, suggesting that it may be mim-          protein. However, the mechanism whereby the Pir tox-
icking a pro-apoptotic BH3 domain only protein [5].                 ins induce melanization or insect death remains unclear.
    Hints that a third class of insecticidal toxin genes
were encoded in Photorhabdus genomes originally came
from sample sequencing of the P. luminescens subsp.                 2. Materials and methods
akhurstii strain W14 (termed W14) genome [6]. Two
clones from the W14 sample sequence predicted proteins              2.1. Cloning of the pir genes
with limited similarity to insecticidal d-endotoxins from
Bacillus thuringiensis [7]. These same clones also predict             The toxin encoding genes pirA and pirB were ampli-
similarity to a developmentally regulated protein from              fied from Photorhabdus genomic DNA using the rTth
the Colorado potato beetle Leptinotarsa decemlineata                DNA polymerase system (Perkin Elmer) in the polymer-
[8]. This beetle protein was presumed to have juvenile              ase chain reaction (PCR). PCR products were digested
hormone esterase (JHE) [9] activity based largely on                and cloned into the KpnI and HindIII restriction sites
its developmental profile in insects [8,10–13], but in the           of the arabinose-inducible expression plasmids pBAD30
absence of a direct demonstration of juvenile hormone               using T4-DNA ligase (New England Biolabs) and
(JH) hydrolysis via JHE enzyme activity. JHs and/or                 EC100 electrocompetent cells (Epicentre). The pirA
its metabolites are involved in a wide range of functions           and pirB genes were cloned with and without their
in larval and adult insects including roles in develop-             own promoters using the PCR primers shown in Table
ment, reproduction, diapause, and migration [6]. But                1 resulting in the clones detailed in the diagram in Fig. 1.
JH is perhaps most commonly known as the hormone
whose presence ensures a larval–larval moult rather                 2.2. Insect bioassays
than a larval–pupal moult [14]. As the absence of JH
at the time of moulting leads to a larval–pupal moult,                 Insects were bioassayed with recombinant PirA and
disruption of JH titre by JHE or a JH expoxide hydro-               PirB proteins either via injection directly into the cater-
lase has been proposed as a mechanism of insect control             pillar hemocoel or, for oral bioassay, via application of
[9]. In the paper describing the sequencing of the com-             bacterial preparations to artificial diet. For the insect
plete P. luminescens TT01 genome, the insecticidal activ-           bioassays, recombinant E. coli EC100 containing the
ity of the proteins produced by these d-endotoxin and               expression plasmids pPirABaymb, pPIRABproaym,
JHE-like genes was investigated [1]. These proteins are             pPirAaymb, pPirBaymb, pPirABtt01, pPIRABprott01
encoded at two distinct loci in the TT01 genome, plu                and the pBAD30 vector alone were grown at 30 °C with
4093-plu 4092 and plu 4437-plu 4436, each with a pair               aeration to an OD600 of 0.4, whereupon L-arabinose was
of proteins encoded at each locus [1]. Recombinant                  added to a final concentration of 0.2% (w/v) to induce
Escherichia coli clones carrying either of these two pairs          protein expression, and the cultures grown overnight.
of TT01 genes showed oral activity against both mos-                Harvested bacterial cells were then washed twice in an
quito larvae and the larvae of the moth Plutella xylo-              equal volume of sterile phosphate buffered saline
stella [1]. As plu 4092 and plu 4436 encode bacterial               (PBS) and re-suspended in an equal volume of PBS.
proteins with similarity to a developmentally regulated             For injection, last instar larvae of G. mellonella were
protein from the Colorado potato beetle [1], and since              cooled on ice for 20 min and then twenty animals per
this beetle protein is indirectly inferred to have esterase         sample were injected with 10 ll of re-suspended bacteria.
activity against JH [8,10–13], we directly tested the gene             For bioassays of oral activity caterpillars of a differ-
products plu4093 and plu4092 of TT01, and their homo-               ent moth, Manduca sexta, were used in a procedure de-
logs from P. asymbiotica strain ATCC43949, for insecti-             scribed previously [2]. Briefly, 100 ll of whole overnight
cidal and JHE activities.                                           cultures were applied to 1 cm3 disks of artificial wheat
    Here, we show that these insecticidal proteins are not          germ diet. Treated food blocks were allowed to dry for
associated with any JHE activity. We have therefore                 20 min and then three first instar M. sexta were placed
term these proteins ÔPhotorhabdus insect relatedÕ (Pir)             on each of six food blocks per treatment. Treated blocks
toxins, rather than JHE-like proteins, as they have no              were held at 25 °C for 7 days and larvae were then
detectable JHE activity. We also show, via expression               weighed and scored as alive or dead. Final larval weights
in E. coli, that injection of both proteins PirA and PirB           were expressed relative to the pBAD30 only control.
is necessary for activity against caterpillars of the wax           Injectable toxicity against M. sexta was also tested.
moth Galleria mellonella. Caterpillars injected with PirA           Here, 50 ll of these same induced cultures were injected
                                                                                                                                                                                       N. Waterfield et al. / FEMS Microbiology Letters 245 (2005) 47–52                            49

                                                                                                                                                                                                                          into a cohort of 10, fourth instar M. sexta, which were




                                                                                                                                                            JHEasyProF: CGTTTATTGGTaccGTAATGAAAGGCA

                                                                                                                                                            JHEasyF: GAATAggTAccTGTAAGTTGAGTAGGTT

                                                                                                                                                            JHEasyF: GAATAggTAccTGTAAGTTGAGTAGGTT




                                                                                                                                                            JHEtt01F: AGTGGTAccACTGTGTTTTGAAAATAT
                                                                                                                                                                                                                          monitored over 7 days for any deleterious affects.




                                                                                                                                                            JHEtt01ProF: TGAAAGGTAccTGAATTGTATTCA
                                                                                                                                                            JHEtt01R: TAAAAGCTtATAACATTCTACGTACA

                                                                                                                                                            JHEtt01R: TAAAAGCTtATAACATTCTACGTACA
                                                                                                                                                            JHEasyR: ATACAAAgcTTGCCGACATCAAAAGA

                                                                                                                                                            JHEasyR: ATACAAAgcTTGCCGACATCAAAAGA




                                                                                                                                                            JHEasyR: ATACAAAgcTTGCCGACATCAAAAGA
                                                                                                                                                            AJHEF:CGCGgTaCcACTAGAAATCTATTGGGT
                                                                                                                                                            AJHERR: CAGaAgCTTGAAGGATGAAGGGTAT
                                                                                                                                                                                                                          2.3. Juvenile hormone esterase assay

                                                                                                                                                                                                                              To assess the potential JHE activity of the recombi-
                                                                                                                         Lowercase bases mismatched to



                                                                                                                                                                                                                          nant Pir proteins of Photorhabdus, 0.2 ml of an over-
                                                                                                                                                                                                                          night culture of each clone was added to 10 ml of
                                                                                                                                                                                                                          Luria Broth (LB) medium supplemented with
                                                                                                                         Primer sequence 5 0 !3 0

                                                                                                                         create restriction sites




                                                                                                                                                                                                                          100 lg mlÀ1 ampicillin. These cultures were grown with
                                                                                                                                                                                                                          aeration to an OD600 of 0.3, at which point L-arabinose
                                                                                                                                                                                                                          was added to a final concentration of 0.2% (w/v). Sterile
                                                                                                                                                                                                                          filtered water was added in place of L-arabinose for the
                                                                                                                                                                                                                          un-induced negative control. At 8 h post-induction, bac-
                                                                                                                                                                                                                          teria were removed by centrifugation (2000g for 10 min,
                                                                                                                                                                                                                          at 5 °C) and supernatants were stored overnight at 5 °C.
                                                                                                                                                                                                                          These supernatants were concentrated fivefold using a
                                                                                                                          Promoters driving expression




                                                                                                                                                                                                                          Centricon30 (Millipore) protein concentration column.
                                                                                                                                                                                                                          The presence of toxin in these concentrated superna-
Sequences of the PCR primers used to amplify pirA and pirB genes from P. asymbiotica ATCC43949 and P. luminescens TT01




                                                                                                                                                                                                                          tants was confirmed by running 28 ll on a 12%
                                                                                                                                                                                                                          SDS–PAGE gel. JHE activity was tested according to
                                                                                                                                                                                                                          the protocol of Hammock and Sparks [15], using a
                                                                                                                                                                                                                          mixture of 3H-labeled (New England Nuclear) and unla-
                                                                                                                                                            Para +Ppir




                                                                                                                                                                                                 Para +Ppir




                                                                                                                                                                                                                          beled (Sigma) JH-III as a substrate (final concentration
                                                                                                                                                                                                                          of 5 · 10À6 M containing 700–800 counts minÀ1 of 3H-
                                                                                                                                                                         Para

                                                                                                                                                                                Para

                                                                                                                                                                                          Para




                                                                                                                                                                                                              Para




                                                                                                                                                                                                                          JH-III). Each assay which consisted of a 100 ll reaction
                                                                                                                                                                                                                          in 10 mM Tris, pH 8.0, or LB supplemented with ampi-
                                                                                                                                                                                                                          cillin was run for 15 min at 30 °C in duplicate. Purified
                                                                                                                                                            The [pirABpro] PCR product from strain




                                                                                                                                                            The [pirABpro] PCR product from strain




                                                                                                                                                                                                                          recombinant JHE (rJHE) from M. sexta, expressed
                                                                                                                                                            The [pirAB] PCR product from strain




                                                                                                                                                            The [pirAB] PCR product from strain
                                                                                                                                                            The [pirA] PCR product from strain

                                                                                                                                                            The [pirB] PCR product from strain




                                                                                                                                                                                                                          from recombinant baculovirus infected High 5 cells
                                                                                                                          Cloned PCR product (see Fig. 2)




                                                                                                                                                                                                                          [16], was assayed under the same conditions as a positive
                                                                                                                                                                                                                          control.


                                                                                                                                                                                                                          3. Results and Discussion
                                                                                                                                                            ATCC43949

                                                                                                                                                            ATCC43949

                                                                                                                                                            ATCC43949

                                                                                                                                                            ATCC43949




                                                                                                                                                                                                                          3.1. Pir sequence, expression and toxicity
                                                                                                                                                            TT01

                                                                                                                                                            TT01




                                                                                                                                                                                                                              The pir genes were first identified in a sample se-
                                                                                                                                                                                                                          quence of the genome of P. luminescens strain W14, as
                                                                                                                                                                                                                          clones (numbers 01891 and 01973) predicting proteins
                                                                                                                                                                                                                          with similarity to d-endotoxin genes from B. thuringien-
                                                                                                                                                            The pirAB operon excluding the promoter region




                                                                                                                                                                                                                          sis [6]. In current database searches, whilst the predicted
                                                                                                                                                            The pirAB operon including promoter region




                                                                                                                                                            The pirAB operon including promoter region




                                                                                                                                                                                                                          amino acid sequence of pirA shows little significant
                                                                                                                                                                                                                          homology with known sequences, the predicted amino
                                                                                                                                                                                                                          acid sequence of pirB shows significant BlastX matches
                                                                                                                                                                                                                          to both a developmentally regulated protein from the
                                                                                                                                                                                                                          beetle L. decemlineata and to a d-endotoxin from
                                                                                                                                                            The pirAB operon excluding




                                                                                                                                                                                                                          B. thuringiensis (plu 4092 and plu 4436, E = 9eÀ66 and
                                                                                                                                                                                                                          5eÀ58 to the beetle protein and 4eÀ4 and 1eÀ3 to the
                                                                                                                          pBAD30 derived clone




                                                                                                                                                              the promoter region
                                                                                                                                                            The pirA gene alone

                                                                                                                                                            The pirA gene alone




                                                                                                                                                                                                                          endotoxin respectively). Specifically, PirB shows 20.5%
                                                                                                                                                                                                                          identity and 41.5% similarity over 229 amino acids to
                                                                                                                                                                                                                          the N-terminal domain of the Cry2A insecticidal toxin
                                                                                                                                                            pPirABpro




                                                                                                                                                            pPirABpro




                                                                                                                                                                                                                          (Fig. 1(a)). We note that this region of the Cry2A pro-
Table 1




                                                                                                                                                            pPirAB




                                                                                                                                                            pPirAB
                                                                                                                                                            pPirA

                                                                                                                                                            pPirB




                                                                                                                                                                                                                          tein is the pore-forming domain, suggesting that the
                                                                                                                                                                                                                          Pir proteins may carry a similar motif. PirB also shows
50                                   N. Waterfield et al. / FEMS Microbiology Letters 245 (2005) 47–52




Fig. 1. Homology of predicted P. luminescens PirB to (a) Leptinotarsa decemlineata developmentally regulated protein (AF039135) and (b) the
parasporal crystal protein Cry2A of Bacillus thuringiensis (CAA10670 ).

more extensive similarity (35.2% identity and 58.4%                     revealed expression of proteins of the predicted sizes
similarity over 401 amino acids), partly over the same                  for both PirA (45 kDa) and PirB (14 kDa) via SDS–
region, [6] to a developmentally regulated protein from                 PAGE (Fig. 2). Injection of both PirA and PirB proteins
the beetle L. decemlineata [8] (Fig. 1(b)). This develop-               together into Galleria caused the larvae to become mor-
mentally regulated protein from L. decemlineata has                     ibund and die within 72 h. All the plasmid constructs
been purified and its expression profile monitored                        tested, that carried both pirA and pirB genes together,
throughout development in relation to the titre of JH                   from either species of Photorhabdus, showed 100% mor-
[8,10–13]. Although well characterized, to our knowl-                   tality within the injected larvae with 72 h (Table 2). We
edge no direct JHE activity has been measured from this                 note, however, that combinations of PirA and PirB had
beetle protein. We, therefore, questioned whether the                   neither injectable nor oral activity against a second cat-
similarity of the Photorhabdus Pir proteins to the beetle               erpillar M. sexta (data not shown). Injection of either
protein did indeed infer that Pir proteins are JHE-like or              PirA or PirB alone into caterpillars of Galleria was not
that they carry JHE activity.                                           associated with any mortality. However, subsequent
   To examine the insecticidal toxicity of Pir proteins                 mixture of individual PirA and PirB preparations recon-
and to test for JHE activity, we expressed recombinant                  stituted full activity against this insect (Table 2).
PirA and PirB proteins from two different species of                         Finally, it is interesting to note that uninduced
Photorhabdus. We tested the gene products of plu 4093                   pBAD30 plasmids still show 100% insecticidal activity
and plu 4092 from P. luminescens TT01, and their homo-                  (Table 2). We, therefore, suspect that the pBAD30 plas-
logs from P. asymbiotica strain ATCC43949, for insecti-                 mids are ÔleakyÕ and that sufficient Pir proteins are made
cidal and JHE activities. Induction of recombinant                      within uninduced cultures to cause full mortality
E. coli cultures carrying pPirAB plasmids from either                   amongst injected larvae, despite the fact that the amount
P. luminescens TT01 or P. asymbiotica ATCC43949                         of recombinant protein is not detectable by SDS–PAGE
                                       N. Waterfield et al. / FEMS Microbiology Letters 245 (2005) 47–52                                          51




Fig. 2. Genomic organization of loci encoding PirA and PirB in two different species of Photorhabdus. Note that the genomic organization is
conserved in P. luminescens strain TT01 and P. asymbiotica strain ATCC43949. PCR products used for cloning are shown (horizontal arrows). The
low GC-content of the region and the location of ERIC sequences (vertical arrows) suggest that this region has been horizontally acquired. The black
ORF has homology to fis-DNA invertase.

Table 2
Bioassay and JHE activity data
Clone (see Table 1)   Induction    Species        Galleria mortality by 24 h (%)    Galleria mortality by 48 h (%)   Galleria mortality by 72 h (%)
pPirAB                +            ATCC43949      100                               100                              100
pPirAB                À            ATCC43949       83                               100                              100
pPirABpro             +            ATCC43949       66                                83                              100
pPirABpro             À            ATCC43949       33                               100                              100
pPirA                 +            ATCC43949       10                                10                               10
pPirA                 À            ATCC43949        0                                 0                                0
pPirB                 +            ATCC43949        0                                 0                                0
pPirB                 À            ATCC43949        0                                 0                                0
pPirAB                +            TT01           100                               100                              100
pPirAB                À            TT01           100                               100                              100
pPirABpro             +            TT01           100                               100                              100
pPirABpro             À            TT01           100                               100                              100
pBAD30                +            na               0                                 0                                0



(Fig. 3). Further, when similar plasmids carry the likely
native promoters of pirA and pirB, this effect is reduced.
Thus, it seems likely that these genes are tightly down-
regulated by the DNA that surrounds them and in its
absence even a low level of protein expression is still suf-
ficient for insect toxicity.
   These experiments support the concept that the PirA
and PirB proteins are insecticidal when applied together.
However, these data do not clarify the likely mode of
secretion or release of the mature toxins from the host
bacteria. As the PirA and PirB proteins can be detected
in the cytosol of recombinant E. coli, it seems reasonable
to expect them to be released via lysis of the recombi-                      Fig. 3. SDS–PAGE analysis of E. coli cell lysate showing expression of
nant E. coli cells following an insect immune response                       the pirAB genes under control of the Para-promoter with (+) and
to their injection. Unfortunately, we cannot investigate                     without (À) 0.2% arabinose induction. Note the appearance of
the role of lysis directly using these recombinant bacte-                    proteins of the expected size upon arabinose induction. Note also
                                                                             that when the native promoter element was included in the PCR
ria, as lysis of the host E. coli cells alone leads to signif-               products (clones pPirABpro), protein expression was significantly
icant insect mortality, probably due to extensive release                    reduced, suggesting that the promoter is under strong repression, by
of E. coli LPS or peptidoglycan.                                             normal E. coli factors, even under arabinose induction.
52                                      N. Waterfield et al. / FEMS Microbiology Letters 245 (2005) 47–52

                                                                           References

                                                                            [1] Duchaud, E. et al. (2003) The genome sequence of the entomo-
                                                                                pathogenic bacterium Photorhabdus luminescens. Nat. Biotechnol.
                                                                                21, 1307–1313.
                                                                            [2] Bowen, D., Rocheleau, T.A., Blackburn, M., Andreev, O.,
                                                                                Golubeva, E., Bhartia, R. and ffrench-Constant, R.H. (1998)
                                                                                Insecticidal toxins from the bacterium Photorhabdus luminescens.
                                                                                Science 280, 2129–2132.
Fig. 4. The effect of PirAB on Galleria mellonella. 10 ll of an overnight    [3] Waterfield, N., Hares, M., Dowling, A., ffrench-Constant, R.,
induced culture was injected per insect. (A) E. coli [pBAD30] negative          (2005) Potentiation and cellular phenotypes of the insecticidal
control (B) E. coli [pPirABasymbiotica].                                        toxin complexes of Photorhabdus bacteria. Cell. Microbiol. (in
                                                                                press).
                                                                            [4] Daborn, P.J., Waterfield, N., Silva, C.P., Au, C.P.Y., Sharma, S.
                                                                                and ffrench-Constant, R.H. (2002) A single Photorhabdus gene
3.2. Pir proteins have no JHE activity                                          makes caterpillars floppy (mcf) allows Esherichia coli to persist
                                                                                within and kill insects. Proc. Natl. Acad. Sci. USA 99, 10742–
   No JHE activity could be detected from recombinant                           10747.
PirA and PirB when expressed E. coli. Under the same                        [5] Dowling, A., Daborn, P., Waterfield, N., Wang, P., Streuli, C.
                                                                                and ffrench-Constant, R. (2004) The insecticidal toxin makes
conditions tested (15 min incubation with 0.5 nmol of
                                                                                caterpillars floppy (Mcf) promotes apoptosis in mammalian cells.
JH-III substrate, at 30 °C), control experiments indicated                      Cell. Microbiol. 6, 345–353.
that approximately 18% of the substrate is hydrolyzed by                    [6] ffrench-Constant, R.H., Waterfield, N., Burland, V., Perna, N.T.,
80 ng of purified rJHE from M. sexta. This corresponds to                        Daborn, P.J., Bowen, D. and Blattner, F.R. (2000) A genomic
the ‘‘expression’’ of less than 1600 ng of ‘‘JHE’’ of Photo-                    sample sequence of the entomopathogenic bacterium Photorhab-
                                                                                dus luminescens W14: potential implications for virulence. Appl.
rhabdus in the 10 ml of culture of induced bacteria. This
                                                                                Environ. Microbiol. 66, 3310–3329.
data suggest that these recombinant Pir proteins do not                     [7] Gill, S.S., Cowles, E.A. and Pietrantonia, P.V. (1992) The mode
have JHE activity. This lack of any demonstrable JHE                            of action of Bacillus thuringiensis endotoxins. Annu. Rev.
activity in the Photorhabdus Pir proteins, but their clear                      Entomol. 37, 615–636.
similarity to a developmentally regulated insect protein,                   [8] Vermunt, A.M., Koopmanschap, A.B., Vlak, J.M. and de Kort,
                                                                                C.A. (1997) Cloning and sequence analysis of cDNA encoding a
has two major implications. First, the concept that they
                                                                                putative juvenile hormone esterase from the Colorado potato
might be JHE-like is based on the assumption that the                           beetle. Insect Biochem. Molec. 27, 919–928.
developmentally regulated protein in L. decemlineata is                     [9] Kamita, S.G. et al. (2003) Juvenile hormone (JH) esterase: why
indeed a JHE. Despite the extensive study of the hor-                           are you so JH specific. Insect Biochem. Molec. 33, 1261–1273.
monal regulation of this beetle protein, we still feel that                [10] Vermunt, A.M., Vermeesch, A.M. and de Kort, C.A. (1997)
                                                                                Purification and characterization of juvenile hormone esterase
JHE activity data is lacking for the beetle protein and that
                                                                                from hemolymph of the Colorado potato beetle. Arch. Insect
this protein itself cannot therefore be confirmed to have                        Biochem. Physiol. 35, 261–277.
such an activity. Second, Photorhabdus does indeed make                    [11] Kramer, S.J. and DeKort, C.A. (1975) Age-dependent changes in
Pir toxins both injectably Fig. 4, and orally [1], active                       juvenile hormone esterase and general carboxyesterase activity in
against different insects and these do show some similarity                      the hemolymph of the colorado potato beetle, Leptinotarsa
                                                                                decemlineata. Mol. Cell. Endocrinol. 4, 43–53.
to both a protein involved in beetle development and to Bt
                                                                           [12] Vermunt, A.M., Koopmanschap, A.B., Vlak, J.M. and de Kort,
d-endotoxins. Therefore, although they carry no JHE                             C.A. (1999) Expression of the juvenile hormone esterase gene in
activity, the Photorhabdus Pir toxins could still potentially                   the Colorado potato beetle, Leptinotarsa decemlineata: photope-
modulate insect development or be distant relatives of the                      riodic and juvenile hormone analog response. J. Insect Physiol.
Cry toxins of Bt. The mode of action of these interesting                       45, 135–142.
                                                                           [13] Vermunt, A.M., Koopmanschap, A.B., Vlak, J.M. and de Kort,
and novel bacterial toxins is therefore worthy of further
                                                                                C.A. (1998) Evidence for two juvenile hormone esterase-related
study.                                                                          genes in the Colorado potato beetle. Insect Mol. Biol. 7, 327–
                                                                                336.
                                                                           [14] Gilbert, L.I., Bollenbacher, W.E., Goodman, W., Smith, S.L.,
Acknowledgments                                                                 Agui, N., Granger, N. and Sedlak, B.J. (1980) Hormones
                                                                                controlling insect metamorphosis. Recent Prog. Horm. Res. 36,
   We thank Julian Parkhill and all in the Pathogen                             401–449.
                                                                           [15] Hammock, B.D. and Sparks, T.C. (1977) A rapid assay for insect
Sequencing group at the Sanger for sequencing P. asym-
                                                                                juvenile hormone esterase activity. Anal. Biochem. 82, 573–579.
biotica. Supported by grants from the BBSRC initiative                     [16] Hinton, A.C. and Hammock, B.D. (2003) In vitro expression and
Exploiting Genomics and by a Royal Society Merit                                biochemical characterization of juvenile hormone esterase from
Award to R. ff-C.                                                                Manduca sexta. Insect Biochem. Mol. 33, 317–329.
                                               FEMS Microbiology Letters 245 (2005) 53–59
                                                                                                                   www.fems-microbiology.org




             DNA methylation modulates Salmonella enterica serovar
               Typhimurium virulence in Caenorhabditis elegans
                                  Javin P. Oza, Jimmy B. Yeh, Norbert O. Reich                               *

                        Department of Chemistry and Biochemistry, University of California, Santa Barbara, CA 93106, USA

                         Received 20 August 2004; received in revised form 15 February 2005; accepted 16 February 2005

                                                       First published online 18 March 2005

                                                               Edited by R.Y.C. Lo




Abstract

    Salmonella enterica serovar Typhimurium was previously shown to be virulent in Caenorhabditis elegans. Here we demonstrate
that DNA adenine methyltransferase (DAM) modulates Salmonella virulence in the nematode, as it does in mice. After 5 days of
continual exposure to bacteria, twice as many worms died when exposed to the wild-type than the dam-mutant strain of Salmonella.
Similar trends in virulence were observed when worms were exposed to Salmonella strains for 5 h and transferred to the avirulent
Escherichia coli OP50. While a 10-fold attenuation was observed in the absence of DAM, the dam-strain was still able to infect and
persist in the host worm. Our results further support the use of C. elegans as an accessible and readily studied animal model of bac-
terial pathogenesis. However, our results suggest that crucial host responses differ between the murine and nematode models. Addi-
tionally, we carried out preliminary liquid culture based experiments with the long term goal of developing high throughput animal
based screens of DAM inhibitors.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: DNA methylation; Virulence; Caenorhabditis elegans; Salmonella typhimurium




1. Introduction                                                             serovar Typhimurium [5,6], and with the human fungal
                                                                            pathogen Cryptococcus neoformans [7]. These studies
   Studies of the free-living nematode Caenorhabditis                       demonstrated that mammals and C. elegans share simi-
elegans have provided important insights with relevance                     lar infection-like mechanisms. In addition, liquid media
to mammals [1–3]. However, C. elegans has only re-                          studies using Streptococcus pyogenes [8] and Bacillus
cently been studied as a model organism in mammalian                        thuringiensis [9] showed that the release of diffusible exo-
host–pathogen interactions. These studies have provided                     toxins provides a means to express virulence.
insights into the virulence mechanisms of the pathogenic                       Methylation of DNA at the N6-adenine position,
organisms and have established an accessible model for                      which is not found in mammals, is a primary example
studying host responses. Ausubel and coworkers [4] first                     of an epigenetic change wherein gene expression is al-
used the nematode worm in solid media based assays to                       tered without DNA sequence modification [10,11].
study host-pathogen interactions with human bacterial                       Methyltransferases involve an unusual mechanism in
pathogens Pseudomonas aeruginosa, Salmonella enterica                       which the target base is stabilized outside the B-form
                                                                            double helix during catalysis [12]. The product,
 *
     Corresponding author. Tel.: +1 805 893 8368; fax: +1 805 893 4120.     N6-methyladenosine, alters the DNA structure and af-
     E-mail address: reich@chem.ucsb.edu (N.O. Reich).                      fects DNA-protein interactions. Consequently, DNA

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.030
54                                 J.P. Oza et al. / FEMS Microbiology Letters 245 (2005) 53–59

Adenine Methyltransferases (DAMs) regulate DNA                      based on a prior method developed by Pomeroy et al.
replication, methyl-directed mismatch repair, transcrip-            [26] (Union Biometrica).
tion, viability, and virulence in various bacteria [13].
The majority of prokaryotic DNA methyltransferases
have a cognate restriction endonuclease, but a small                2. Materials and methods
set of MTases lack such a partner. DAM is one such en-
zyme, and is prevalent among enteric bacteria, including            2.1. Strains and media
Escherichia coli, Salmonella species, Yersinia species,
and Vibrio cholerae. In uropathogenic E. coli, DAM                     E. coli OP50, S. enterica serovar Typhimurium
controls the expression of Type I pili that are required            SL1344 (wild-type), and S. enterica serovar Typhimu-
for adherence to host cells [14]. Salmonella DAM mu-                rium SV4392 (dam-) [15] were grown at 37 °C overnight
tants displayed defects in protein secretion, cell invasion,        in Luria-Bertani broth. Bacterial lawns used for killing
and M cell cytotoxicity [15], such mutants were also un-            experiments were prepared using modified nematode
able to colonize deep tissue in a murine model and were             growth media (NGM) agar (0.35% peptone) seeded with
avirulent [16]. Although DAM is not essential for viabil-           10 ll of bacteria on large 100 mm plates. Plates were
ity in E. coli and Salmonella, it is required for the growth        incubated at 37 °C for 24 h and allowed to equilibrate
and viability of both V. cholerae and Yersinia pseudotu-            to room temperature before seeding worms onto the
berculosis [17]. Since mammals exploit DNA cytosine                 lawns. N2 and JK509 strains of C. elegans were main-
methylation and lack any detectable DNA adenine                     tained in a 15 °C incubator as hermaphrodites growing
methylation, the bacterial enzymes have become the tar-             on NGM while feeding on E. coli OP50. JK509 worms
get of antibiotic development [18].                                 were incubated at 25 °C during experiments for sterility
    Our objectives were to validate the use of C. elegans           [27].
to study mammalian pathogens by demonstrating that
S. enterica serovar Typhimurium DAM is important                    2.2. Plate-based worm killing assay
for pathogenesis in the nematode as demonstrated in
mice, and to use this information to determine which                   C. elegans N2 worms were synchronized to the L4
virulence genes are regulated by DAM. Further, a major              stage while feeding on E. coli OP50. NGM experimental
factor in drug discovery efforts is the transition from in           plates (10 mm) were prepared by spreading 10 ll of bac-
vitro, protein and cell-based screens to those involving            teria into a lawn and incubating at 37 °C for 24 h. Ten
animal studies. Recent advances in using isogenic cell              worms were picked onto each plate using a metal wire
lines [19], gene array-based expression analysis [20],              loop. Each experiment was carried out in triplicate.
and various multi-mode fluorescence-based detection                  Worms were transferred every 24 h to fresh lawns and
approaches are encouraging [21]. However, an animal                 were scored as dead when failing to respond to physical
model that provides an intermediate level of compound               stimulus [5]. Worms that died by adhering to the Petri-
screening prior to cost- and time-intensive studies using           plate walls were not included in the analysis. Three
mammals would be attractive. In particular, an animal               experiments were carried out at 25 °C, each one altering
model that provides information about lead compound                 the amount of virulent bacteria being fed to the nema-
efficacy and toxicity would be particularly useful. C. ele-           todes. Time required for 50% of worms to die (TD50)
gans provides many attractive features in this context.             and the associated standard error were determined by
The molecular architecture of vertebrate and inverte-               extrapolation.
brate systems, including drug metabolism and nervous
systems, is mostly shared [22]. It is estimated that                2.3. Worm shift killing assay
$0.6% of the 16,000 known C. elegans genes code for
cytochrome P450 enzymes, and the vast majority are                     Synchronized L4-stage N2 C. elegans worms (10)
closely associated to the three families of mammalian               were fed SL1344 wild-type Salmonella for 5 h on a
drug metabolizing enzymes [23]. While clearly not a sub-            100-mm NGM plate [5]. In the same manner, another
stitute for mammalian toxicity studies, recent efforts to            10 synchronized L4-stage worms were fed on a 100 mm
study both toxicity [24,25] and metabolism [22] in C. ele-          NGM plate with SV4392 dam-mutant lawn for 5 h.
gans provide support for its use as an initial, rapid and           Both experimental groups were then transferred onto
inexpensive screen.                                                 E. coli OP50 seeded 10 mm plates and transferred
    Our experiments were designed largely to determine              every 24 h to fresh OP50 lawns. Control groups were
whether DAM modulates Salmonella virulence in C. ele-               fed on OP50 10 mm plates. Each experiment was car-
gans. This would further validate C. elegans for patho-             ried out in triplicate. Worms were scored as dead when
genesis studies and provide a basis for screening DAM               physical stimuli failed to generate any response. Worms
inhibitors. We adapted the solid media killing assay used           that died by adhering to the Petri-plate walls were
by Ausubel [5], and a liquid assay detection procedure              discounted.
                                  J.P. Oza et al. / FEMS Microbiology Letters 245 (2005) 53–59                                      55

2.4. Bacterial dilution assay                                      Tubes, 15 ml). The liquid medium was changed daily
                                                                   to prevent dauer development.
   Overnight cultures of wild-type and dam-Salmonella                 The suspended worms (1 ml) from each culture were
in Luria-Bertani broth were diluted 1:1000 and 1:100               removed daily and treated with SYTOX Green nucleic
with E. coli OP50 cultures [5]. Ten ll of each of the              acid stain. All liquid assays were done in 96-well mi-
dilutions were seeded to 10 mm NGM plates and                      cro-titer cell-culture plates. Aliquots of 60 ll with 60
spread into lawns. Lawns were incubated at 37 °C                   worms were assayed in replicates of 8. Fluorescent mea-
for 24 h and were allowed to equilibrate to room tem-              surements were done using the Perkin–Elmer HTS-7000
perature before seeding with 10 N2 C. elegans. Worms               Bio Assay Reader with excitation filters set at 485 nm
were transferred daily to new Salmonella: OP50 lawns               and emission set at 595 nm [26].
and dead worms were scored when physical stimulus
generated no movement. The same experiment was
done with JK509 worms. Worms that died by adher-                   3. Results and discussion
ing to the Petri-plate walls were discounted.
                                                                   3.1. Salmonella dam-mutant shows attenuated virulence
2.5. Liquid killing fluorescence calibration assay                  in C. elegans

   One 10-mm stock plate of live synchronized L4                      A general killing assay, where the worms were ex-
stage JK509 worms was washed with M9 media with                    posed to 100% Salmonella lawns, evaluated the general
streptomycin (100 lg mlÀ1) and suspended into 4 ml                 killing ability of the dam-mutant strain (SV4392). Over
of complete S. basal medium. A 2-ml aliquot was                    the course of 7 days, 90% of the worms fed on wild-type
placed into a 15-ml falcon tube and heat-killed in a               Salmonella died with the time required for 50% of
50 °C water bath for 15 min. Both samples of worms                 worms to die (TD50) of 4.5 ± 0.3 days. The dam-mutant
were stained with SYTOX green nucleic acid stain                   strain exhibited an attenuated killing ability, as only
(Molecular Probes), a fluorescent green dye that pen-               60% of worms had died after 7 days (TD50 = 6.5 ± 0.3
etrates cells with compromised plasma membranes,                   days). Though this partial attenuation is statistically sig-
but will not cross the membrane of live cells. Dead                nificant, the mutant is not avirulent since less than 20%
and live stained worms were titrated into seven dead:l-            of worms fed E. coli OP50 had died after 7 days, as ex-
ive worm ratio groups (60 worms in each 60 ll ali-                 pected [5] (Fig. 1).
quot), added to 56 wells of a 96-well micro-titer                     An alternative assay developed by Ausubel and
plate (Costar, Corning, NY USA), giving eight repli-               coworkers was used to test the ability of Salmonella to
cates for each of the seven groups. The number of                  infect and proliferate in the C. elegans host after a brief
worms in each well was standardized to 60 worms                    exposure [5]. Worms were exposed to the wild-type and
by counting the number of worms in 10 ll aliquots                  dam-mutant Salmonella strains for 5 h and moved to
of a well-mixed worm suspension under a microscope
and diluting or concentrating the sample accordingly.
Fluorescence measurements were done using a Per-
kin–Elmer HTS-7000 Bio Assay Reader with an exci-
tation filter set at 485 nm and emission measured at
595 nm [26].

2.6. Liquid killing assay

   JK509 mutant C. elegans worms were prepared by
washing three 10 mm stock NGM plates of synchro-
nized L4 worms into M9 with streptomycin twice. A fi-
nal wash was done using 9 ml of Complete S. Basal
Medium. Worms were incubated in a 26 °C water bath
for 30 min to prevent the development of viable
progeny.
   Overnight bacterial cultures were centrifuged at
14,000 rpm for 10 min and the pellet was suspended                 Fig. 1. Death rate of C. elegans in N2 on NMM plates, feeding on E.
                                                                   coli OP50, WT Salmonella SL1344, and dam-Salmonella SV4392 over a
into 1 ml of complete S. basal medium. Each 1 ml
                                                                   1-week period. Worms fed on WT Salmonella (triangles) exhibited
of bacterial suspension was added to 3 ml of worms                 higher levels of killing than worms feeding on dam-Salmonella
to give a total experimental culture of 4 ml. Worm                 (squares). The control worms were fed E. coli OP50 (circles). Values
cultures were rocked overnight at 70 rpm (Falcon                   shown are means of ±standard error of triplicates.
56                                       J.P. Oza et al. / FEMS Microbiology Letters 245 (2005) 53–59

100% OP50 lawns. After 5 days, 45% of worms fed wild-                     on solid medium. Our results demonstrated that the glp-
type Salmonella and 25% of worms fed the dam-strain                       1 gene in C. elegans is not involved in Salmonella viru-
had died with TD50 values of 5.4 ± 0.4 and 7 ± 0.5 days,                  lence since the death rates of the N2 (data not shown)
respectively (Fig. 2). Thus, the ability of the Salmonella                and the JK509 worms were identical through the differ-
mutant to infect and persist in the host C. elegans is also               ent conditions. The TD50 for JK509 fed on Salmo-
attenuated with statistical significance under these                       nella:E. coli dilution of 1:100 was 6.6 ± 0.6 and
conditions.                                                               7.6 ± 0.6 for wild-type and dam-mutant Salmonella,
                                                                          respectively. For the Salmonella:E. coli dilution of
3.2. S. enterica serovar Typhimurium exhibits killing in                  1:1000, the TD50 was 7.6 ± 0.3 and 10.3 ± 0.3 for wild-
C. elegans mutant strain JK509                                            type and dam-Salmonella, respectively (Fig. 3). This
                                                                          analysis demonstrates that a 10-fold dilution in wild-
   The purpose of investigating liquid media condi-                       type Salmonella is required to obtain the degree of atten-
tions was to provide a basis for characterizing large                     uation conferred by the dam gene deletion. This analysis
numbers of DAM inhibitors in relatively small vol-                        also validates the glp-1 deletion mutant for liquid based
umes to minimize material cost and consumption.                           assays.
The transition from solid to liquid media posed signif-
icant challenges. One factor is worm fertility and the                    3.3. Dead C. elegans exhibit increased fluorescence
exponentially increasing population of worms. In solid                    when stained with SYTOX Green
media, this was solved by separating the experimental
nematodes from their progeny through the daily trans-                        Another challenge in the use of liquid cultures was
fer to fresh bacterial lawns. In liquid culture, however,                 distinguishing live and dead worms. On solid medium,
the production of progeny and the inability to remove                     worms not responding to a light tough were considered
them made it difficult to quantify the number of live                       dead. In order to address this problem in liquid culture,
experimental worms. Thus, we exploited the condition-                     we employed the SYTOX Green nucleic acid stain
ally sterile strain (JK509) with a deletion in the glp-1                  (Molecular Probes), which penetrates cells with compro-
gene [27]. The JK509 strain is fertile at 15 °C but not                   mised plasma membranes, but will not cross the mem-
at 25 °C.                                                                 brane of live cells. We demonstrated that this dye is
   We first tested the JK509 worms in a solid media as-                    selective for dead worms (Fig. 4(a)) and that fluores-
say with 1:100 and 1:1000 dilutions of Salmonella strains                 cence increases in a dose-dependant manner (Fig.
in parallel with the wild-type (N2) worms. The wild-type                  4(b)). This calibration curve allowed us to determine
and dam-strains of Salmonella were diluted 1:100 and                      the emission units corresponding to a known number
1:1000 in E. coli OP50 and fed to N2 and JK905 worms                      of dead worms.




Fig. 2. Death rate of N2 C. elegans exposed to WT Salmonella
SL1344, and dam-Salmonella SV4392 for 5 h, then fed on E. coli OP50       Fig. 3. Temperature sensitive C. elegans JK509 fed Salmonella:E. coli
for 1 week. Wild-type Salmonella (squares) shows an ability to            dilutions on solid medium. Both wild-type (1:100, circles; 1:1000,
proliferate and kill C. elegans with minimal exposure. The dam-           squares) and dam-mutant (1:100, triangles; 1:1000, diamonds) Salmo-
Salmonella (triangles) shows reduced virulence but still significantly     nella strains are virulent in C. elegans, though the dam-strain shows 10-
greater than E. coli OP50 (circles). Values shown are means of            fold attenuation. Values shown are means of ±standard error of
±standard error of triplicates.                                           triplicates.
                                          J.P. Oza et al. / FEMS Microbiology Letters 245 (2005) 53–59                                              57




Fig. 4. Validation of SYTOX Green and a standard calibration curve of dead C. elegans in liquid media. (a) Fluorescence of live JK509 worms alone,
live JK509 worms with SYTOX green dye, heat killed JK509 worms with SYTOX green day, and an empty well measured. (b) Dose-dependant
behavior is seen. The percentage of dead C. elegans is directly correlated with the emission signal; this correlation was used to convert emission data
into percent dead worms in the liquid assay (Fig. 5). Fluorescence was measured by excitation at 485 nm and emission at 595 nm.



3.4. S. enterica serovar Typhimurium shows attenuated
killing of C. elegans in liquid culture

   A smaller difference is seen between the TD50 of
JK509 worms fed wild-type Salmonella and dam-
mutant in liquid medium, 5.8 ± 0.7 and 6.5 ± 0.2 days,
respectively (Fig. 5). These results are comparable to
the percent of dead worms at 4 days on the standard
plate-based killing assay, after which time the killing
by the wild-type strain is accelerated (Fig. 1). How-
ever, the obstacles of maintaining a healthy culture
of both worms and bacteria in the same liquid media
which required shorter timepoints, and the incomplete
attenuation of virulence in the absence of DNA meth-
ylation indicated that further optimization is required.
Nevertheless, the general approach which makes use
                                                                               Fig. 5. Killing of C. elegans JK509 in liquid media. C. elegans feeding
of the JK509 strain and the counting of dead worms
                                                                               on dam-Salmonella (squares) showed reduced killing compared to the
in liquid medium via SYTOX Green, should be useful                             wild-type (triangles). This attenuation is partial and the mutant is
in developing a screen for DAM inhibitors using C.                             significantly more virulent that E. coli OP50 (circles). Values are means
elegans.                                                                       of ±standard errors of eight repeated experiments.
58                                       J.P. Oza et al. / FEMS Microbiology Letters 245 (2005) 53–59

4. Conclusions                                                             [2] Brooks, D.R., Hooper, N.M. and Isaac, R.E. (2003) The
                                                                               Caenorhabditis elegans orthologue of mammalian puromycin-
                                                                               sensitive aminopeptidase has roles in embryogenesis and repro-
   A solid media killing assay developed by Aballay                            duction. J. Biol. Chem. 278, 42795–42801.
et al. [5] provides the basis for studying bacterial viru-                 [3] Jones, A.K. and Sattelle, D.B. (2004) Functional genomics of the
lence mechanisms in C. elegans. We adapted this assay                          nicotinic acetylcholine receptor gene family of the nematode,
to evaluate the degree of attenuated virulence in a                            Caenorhabditis elegans. Bioessays 26, 39–49.
dam-mutant Salmonella [15,16], a highly specialized                        [4] Tan, M.W. and Ausubel, F.M. (2000) Caenorhabditis elegans: a
                                                                               model genetic host to study Pseudomonas aeruginosa pathogen-
vertebrate pathogen. The assay was dependent on                                esis. Curr. Opin. Microbiol. 3, 29–34.
the ingestion of either wild-type or dam-mutant Sal-                       [5] Aballay, A., Yorgey, P. and Ausubel, F.M. (2000) Salmonella
monella by C. elegans hosts and a measurable differ-                            typhimurium proliferates and establishes a persistent infection in
ence in bacterial virulence resulting in worm death.                           the intestine of Caenorhabditis elegans. Curr. Biol. 10, 1539–1542.
Although the dam-Salmonella strain was shown to be                         [6] Labrousse, A., Chauvet, S., Couillault, C., Kurz, C.L. and
                                                                               Ewbank, J.J. (2000) Caenorhabditis elegans is a model host for
completely avirulent in the mouse disease model, the                           Salmonella typhimurium. Curr. Biol. 10, 1543–1545.
results of the NGM solid media studies suggest that                        [7] Mylonakis, E., Ausubel, F.M., Perfect, J.R., Heitman, J. and
while removing DAM activity significantly reduces                               Calderwood, S.B. (2002) Killing of Caenorhabditis elegans by
Salmonella virulence, complete attenuation is not ob-                          Cryptococcus neoformans as a model of yeast pathogenesis. Proc.
served. The mutant strain continues to express viru-                           Natl. Acad. Sci. USA 99, 15675–15680.
                                                                           [8] Jansen, W.T., Bolm, M., Balling, R., Chhatwal, G.S. and
lence factors sufficient for disease in C. elegans but                           Schnabel, R. (2002) Hydrogen peroxide-mediated killing of
not the mammalian models. Thus, fundamental differ-                             Caenorhabditis elegans by Streptococcus pyogenes. Infect. Immun.
ences in host response between mice and worms are                              70, 5202–5207.
suggested by these results, perhaps due to differences                      [9] Marroquin, L.D., Elyassnia, D., Griffitts, J.S., Feitelson, J.S. and
in specific and non-specific defense systems [5].                                Aroian, R.V. (2000) Bacillus thuringiensis (Bt) toxin susceptibility
                                                                               and isolation of resistance mutants in the nematode Caenorhab-
   Infection in a liquid environment may be more dif-                          ditis elegans. Genetics 155, 1693–1699.
ficult due to the reduced ingestion of bacteria by C.                      [10] Reisenauer, A., Kahng, L.S., McCollum, S. and Shapiro, L.
elegans as a result of stress. Jones and Candido [28]                          (1999) Bacterial DNA methylation: a cell cycle regulator? J.
described a cessation in nematode pharyngeal pump-                             Bacteriol. 181, 5135–5139.
ing in a high stress environment, leading to the inhib-                   [11] Hernday, A., Krabbe, M., Braaten, B. and Low, D. (2002) Self-
                                                                               perpetuating epigenetic pili switches in bacteria. Proc. Natl. Acad.
ited ingestion of food. With the number of stress                              Sci. USA 99 (Suppl 4), 16470–16476.
factors increased in a liquid environment such as oxy-                    [12] Jeltsch, A. (2002) Beyond Watson and Crick: DNA methylation
gen tension and increased dauer pheromone concen-                              and molecular enzymology of DNA methyltransferases. Chem-
trations, nematodes may ingest fewer bacteria. While                           biochem. 3, 274–293.
the application of the liquid media killing assay to                      [13] Palmer, B.R. and Marinus, M.G. (1994) The dam and dcm strains
                                                                               of Escherichia coli – a review. Gene 143, 1–12.
screen for DAM inhibitors using C. elegans will re-                       [14] Hale, W.B., van der Woude, M.W., Braaten, B.A. and Low, D.A.
quire further optimization due to the incomplete                               (1998) Regulation of uropathogenic Escherichia coli adhesin
attenuation of the dam-mutant, our results support                             expression by DNA methylation. Mol. Genet. Metab. 65, 191–196.
the use of the nematode to study host–pathogen                            [15] Garcia-Del Portillo, F., Pucciarelli, M.G. and Casadesus, J.
interactions.                                                                  (1999) DNA adenine methylase mutants of Salmonella typhimu-
                                                                               rium show defects in protein secretion, cell invasion, and M cell
                                                                               cytotoxicity. Proc. Natl. Acad. Sci. USA 96, 11578–11583.
                                                                          [16] Heithoff, D.M., Sinsheimer, R.L., Low, D.A. and Mahan, M.J.
Acknowledgements                                                               (1999) An essential role for DNA adenine methylation in bacterial
                                                                               virulence. Science 284, 967–970.
                                                                          [17] Julio, S.M., Heithoff, D.M., Provenzano, D., Klose, K.E.,
   We thank C. Wood and members of the Rothman                                 Sinsheimer, R.L., Low, D.A. and Mahan, M.J. (2001) DNA
Lab for contributing the N2 strain and helpful discus-                         adenine methylase is essential for viability and plays a role in the
sions. We also thank the Caenorhabditis Genetics Cen-                          pathogenesis of Yersinia pseudotuberculosis and Vibrio cholerae.
ter for the JK509 strain and Professor P. Casadesus for                        Infect. Immun. 69, 7610–7615.
                                                                          [18] Wahnon, D.C., Shier, V.K. and Benkovic, S.J. (2001) Mecha-
providing us with S. enterica serovar Typhimurium
                                                                               nism-based inhibition of an essential bacterial adenine DNA
strains SL1344 (wild-type), and S. enterica serovar                            methyltransferase: rationally designed antibiotics. J. Am. Chem.
Typhimurium SV4392 (dam-). This work was supported                             Soc. 123, 976–977.
by NSF MCB-9983125 to NOR.                                                [19] McNeish, J. (2004) Embryonic stem cells in drug discovery. Nat.
                                                                               Rev. Drug Discov. 3, 70–80.
                                                                          [20] Sauter, G., Simon, R. and Hillan, K. (2003) Tissue microarrays in
                                                                               drug discovery. Nat. Rev. Drug Discov. 2, 962–972.
References                                                                [21] Eggeling, C., Brand, L., Ullmann, D. and Jager, S. (2003) Highly
                                                                               sensitive fluorescence detection technology currently available for
[1] Libina, N., Berman, J.R. and Kenyon, C. (2003) Tissue-specific              HTS. Drug Discov. Today 8, 632–641.
    activities of C. elegans DAF-16 in the regulation of lifespan. Cell   [22] Wolf, F.W. and Heberlein, U. (2003) Invertebrate models of drug
    115, 489–502.                                                              abuse. J. Neurobiol. 54, 161–178.
                                          J.P. Oza et al. / FEMS Microbiology Letters 245 (2005) 53–59                                          59

[23] Gotoh, O. (1998) Divergent structures of Caenorhabditis elegans       [26] Pomeroy, M., Ferrante, A., OÕConnor, G., and Hansen, W.P.
     cytochrome P450 genes suggest the frequent loss and gain of introns        (2000) C. elegans sorting: Live v. Dead. Union Biometrica
     during the evolution of nematodes. Mol. Biol. Evol. 15, 1447–1459.         COPAS Application Note B-02.
[24] Kayser, E.B., Hoppel, C.L., Morgan, P.G. and Sedensky, M.M.           [27] Austin, J. and Kimble, J. (1987) glp-1 is required in the germ line
     (2003) A mutation in mitochondrial complex I increases ethanol             for regulation of the decision between mitosis and meiosis in C.
     sensitivity in Caenorhabditis elegans. Alcohol. Clin. Exp. Res. 27,        elegans. Cell 51, 589–599.
     584–592.                                                              [28] Jones, D. and Candido, E.P. (1999) Feeding is inhibited by
[25] Smith, J.V. and Luo, Y. (2003) Elevation of oxidative free radicals        sublethal concentrations of toxicants and by heat stress in the
     in AlzheimerÕs disease models can be attenuated by Ginkgo biloba           nematode Caenorhabditis elegans: relationship to the cellular
     extract EGb 761. J. Alzheimers. Dis. 5, 287–300.                           stress response. J. Exp. Zool. 284, 147–157.
                                               FEMS Microbiology Letters 245 (2005) 61–65
                                                                                                                    www.fems-microbiology.org




     Allophanate hydrolase of Oleomonas sagaranensis involved in an
          ATP-dependent degradation pathway specific to urea
                            Takeshi Kanamori, Norihisa Kanou, Shingo Kusakabe,
                                    Haruyuki Atomi, Tadayuki Imanaka *
       Department of Synthetic Chemistry and Biological Chemistry, Graduate School of Engineering, Kyoto University, Katsura, Nishikyo-ku,
                                                            Kyoto 615-8510, Japan

                         Received 11 January 2005; received in revised form 17 February 2005; accepted 17 February 2005

                                                       First published online 12 March 2005

                                                                 Edited by S. Silver




Abstract

   The first prokaryotic urea carboxylase has previously been purified and characterized from Oleomonas sagaranensis. As the
results indicated the presence of an ATP-dependent urea degradation pathway in Bacteria, the characterization of the second com-
ponent of this pathway, allophanate hydrolase, was carried out. The gene encoding allophanate hydrolase was found adjacent to the
urea carboxylase gene. The purified, recombinant enzyme exhibited ammonia-generating activity towards allophanate, and, together
with urea carboxylase, efficiently produced ammonia from urea in an ATP-dependent manner. The substrate specificity of the
enzyme was strict, and analogs of allophanate were not hydrolyzed. Moreover, although the urea carboxylase exhibited carboxylase
activity towards urea, acetamide, and formamide, ammonia-releasing activity of the two enzymes combined was detected only
towards urea, indicating that the pathway was specific for urea degradation.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Allophanate hydrolase; Urea amidolyase; Urea carboxylase; Urea metabolism; Nitrogen assimilation




1. Introduction                                                               known to utilize urea as a nitrogen source through the
                                                                              function of urea amidolyase [8,9]. Urea amidolyase has
   The biological conversion of urea to ammonia and                           been found to consist of two distinct enzymatic activi-
carbon dioxide has been reported from various organ-                          ties, urea carboxylase activity and allophanate hydrolase
isms. Two distinct enzymes, urease and urea amidolyase,                       activity [10]. Urea carboxylase, a member of the biotin-
are known to degrade urea (Fig. 1) [1,2]. Urease, which                       dependent carboxylases, catalyzes the ATP-dependent
catalyzes the ATP-independent hydrolysis of urea, has                         carboxylation of urea to allophanate. Allophanate is
been characterized in plants, fungi, and bacteria, and a                      subsequently hydrolyzed to ammonia and carbon diox-
wealth of information on its characteristics, physiologi-                     ide by the function of allophanate hydrolase. Studies
cal functions, and three-dimensional structures have                          on urea amidolyase from yeast have revealed that the
been obtained [3–7]. On the other hand, some yeast                            yeast allophanate hydrolase is fused with urea carboxyl-
strains and green algae that lack urease have been                            ase on a single polypeptide [11–13]. Urea amidolyase
                                                                              activity in green microalgae is the result of two separate
 *
     Corresponding author. Tel.: +81 75 383 2777; fax: +81 75 383 2778.       enzymes, urea carboxylase and allophanate hydrolase
     E-mail address: imanaka@sbchem.kyoto-u.ac.jp (T. Imanaka).               [14]. Although allophanate hydrolase has been purified

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.023
62                                    T. Kanamori et al. / FEMS Microbiology Letters 245 (2005) 61–65




Fig. 1. Reactions catalyzed by urease and urea amidolyase. The two reactions catalyzed by urea carboxylase and allophanate hydrolase in the urea
amidolyase reaction are individually shown [1].



and enzymatically characterized from Chlamydomonas                            In this report, a detailed biochemical examination of
reinhardtii [15], urea carboxylase has not yet been puri-                  bacterial allophanate hydrolase from O. sagaranensis
fied from algae.                                                            was performed, clarifying the substrate specificity of
    In Bacteria, the orthologues of the urea carboxylase                   the novel urea carboxylase/allophanate hydrolase sys-
domain or the allophanate hydrolase domain of yeast                        tem in bacterial nitrogen assimilation.
enzymes have been found to be widely distributed
among several subdomains of Bacteria as separate genes
[1]. Martinez et al. [16] identified the first bacterial allo-               2. Materials and methods
phanate hydrolase gene, atzF, from Pseudomonas sp.
strain ADP as a metabolic gene for atrazine degrada-                       2.1. Bacterial strains, plasmids, and DNA analyses
tion. Although the protein product of the gene actually
exhibited allophanate hydrolase activity, its involvement                     Oleomonas sagaranensis strain HD-1 was isolated
in urea degradation remains unclear.                                       from an oil field in Sagara, Shizuoka, Japan [17]. Esch-
    The first prokaryotic urea carboxylase was previously                   erichia coli strain DH5a and pUC118 were used for
identified and biochemically characterized from a novel                     DNA manipulation, and E. coli strain BL21(DE3) and
a-Proteobacterium, Oleomonas sagaranensis [1]. O. sag-                     pET21a were used for gene expression. Methods for
aranensis urea carboxylase displayed carboxylase activi-                   DNA manipulation, gene isolation and sequencing anal-
ties towards urea, acetamide, and formamide. Although                      yses have been described previously [1].
comparison of the kcat/Km values indicated that urea was
the most preferred substrate among them, this substrate                    2.2. Gene expression and purification of recombinant
specificity raised the possibility that O. sagaranensis urea                proteins
carboxylase might participate in the assimilation of acet-
amide or formamide because these compounds served as                          Overproduction and purification of O. sagaranensis
a sole nitrogen source for O. sagaranensis. Furthermore,                   urea carboxylase have been described elsewhere [1].
though O. sagaranensis urea carboxylase was a mono-                        For allophanate hydrolase, an expression vector was
functional enzyme without an allophanate hydrolase do-                     constructed according to the methods for urea carboxyl-
main, a putative gene for allophanate hydrolase was                        ase [1] using a pair of primers as follows: 5 0 -AAAAA-
found adjacent to the O. sagaranensis urea carboxylase                     CATATGACGCTGCCCAAGATGTTGACCATCG-3 0
gene, initiating 15 bp downstream. The deduced primary                     and 5 0 -AAAAAGGATCCGATCCCCAGAGATTCA-
structure of the putative allophanate hydrolase exhibited                  CTTGGCAGCGCA-3 0 (underlining indicates the NdeI
40% of identity to that of the allophanate hydrolase do-                   and BamHI sites). The obtained vector, pET-ahy, was
main of Saccharomyces cerevisiae urea amidolyase (res-                     introduced into E. coli BL21(DE3) and the transform-
idues 1–622) and 50% identity to AtzF of Pseudomonas                       ant was grown until the turbidity reached OD660 = 0.4
sp. strain ADP.                                                            in Luria–Bertani (LB) medium containing 100 lg
                                 T. Kanamori et al. / FEMS Microbiology Letters 245 (2005) 61–65                            63

ampicillin mlÀ1 at 37 °C. Expression of the allophanate            along with 2.0 mM of allophanate did not lead to
hydrolase gene was induced by adding 0.1 mM isopro-                enhancement or inhibition of O. sagaranensis allophan-
pyl-b-D-thiogalactopyranoside, and the culture was                 ate hydrolase activity (data not shown), this amount of
incubated for another 24 h at 17 °C.                               urea is negligible under the conditions used in this study.
   Unless otherwise mentioned, all purification steps
were performed at 4 °C. The cells were harvested,                  2.4. Ammonia releasing assay
washed, and suspended in 50 mM Tris–HCl buffer (pH
8.0) (buffer A). The cells were sonicated on ice and centri-           The amide bond hydrolyzing activity of allophanate
fuged (20,000g, 30 min), followed by ultracentrifugation           hydrolase towards urea, acetamide, formamide, acetoac-
(100,000g, 30 min) to remove cell debris. The superna-             etamide, allophanate, biuret, diacetamide, or malona-
tant was brought to 30–40% saturation with saturated               mide, was determined spectrophotometrically in a
(NH4)2SO4 solution on ice. The precipitated proteins               coupled assay with glutamate dehydrogenase [20]. The
were recovered by centrifugation (20,000g, 15 min) and             reaction mixture was buffered with 100 mM HEPES
resuspended in a minimal volume of buffer A, and dia-               (pH 7.5). When allophanate was used as a substrate, it
lyzed against 2 l of buffer A twice. The desalted protein           was added into the reaction mixture at a concentration
solution was applied to a Resource Q column (Amer-                 of 2.0 mM. Other substrates were examined at concen-
sham Biosciences) equilibrated with buffer A. Proteins              trations of 20 mM. The oxidation of NADH linked with
were eluted with an increasing linear gradient of 0–               the ammonia generation was determined at 340 nm at
400 mM NaCl. Fractions with activity were concentrated             25 °C. One unit of activity was defined as hydrolysis of
5-fold and applied to a gel filtration column (Superdex             1 lmol of a substrate per min. Values in a control reac-
200 HR 10/30; Amersham Biosciences) equilibrated with              tion without O. sagaranensis allophanate hydrolase were
100 mM HEPES buffer (pH 7.5) containing 150 mM                      subtracted.
NaCl. The apparent homogeneity of the purified protein                 Ammonia-generating activity of the combination of
was confirmed by sodium dodecylsulfate–polyacryl-                   O. sagaranensis urea carboxylase and allophanate
amide gel electrophoresis [18,19] and Coomassie Brilliant          hydrolase from urea, acetamide, formamide was deter-
Blue staining [18]. The native molecular mass of allo-             mined using the spectrophotometric assay coupled with
phanate hydrolase was determined by gel filtration chro-            glutamate dehydrogenase [1]. Urea, acetamide, or form-
matography with a Superdex 200 HR 10/30 column as                  amide was added at a final concentration of 50, 250, or
described elsewhere [1].                                           100 mM, respectively. O. sagaranensis urea carboxylase
                                                                   and/or allophanate hydrolase were added at a final con-
2.3. Preparation of potassium allophanate                          centration of 5.5 and 131 mU mlÀ1, respectively. The
                                                                   oxidation of NADH was monitored as described above.
   Potassium allophanate was synthesized by saponifica-
tion of ethyl allophanate (TCI, Tokyo, Japan) with
potassium hydroxide [16]. The actual amount of allo-               3. Results
phanate produced was determined as follows. Synthe-
sized allophanate was added into reaction mixtures                 3.1. Primary structure of O. sagaranensis allophanate
(1 ml) at calculated concentrations of 0 (control reac-            hydrolase
tion), 1, 2, 3, or 4 mM, that included 100 mM HEPES
(pH 7.5) and 3.0 U of purified O. sagaranensis allophan-               The O. sagaranensis allophanate hydrolase gene was
ate hydrolase. The reaction mixtures were incubated at             composed of 1800 bp, corresponding to a protein of
37 °C until allophanate was completely converted                   600 amino acid residues and a molecular weight of
(15 min), and the amounts of ammonia produced were                 61,999. Allophanate hydrolase has been reported as a
determined using NH3 Kit (Wako, Osaka, Japan). The                 member of amidase signature protein family [16]. Se-
actual amount was estimated as 65.8% of the calculated             quence comparison with several members of the family
value, and all concentrations of allophanate mentioned             indicated that catalytic residues involved in the Ser–cis-
below represent the actual values.                                 Ser–Lys catalytic triad of amidase signature family [21],
   The amount of contaminant urea in the preparation               Ser177, Ser153, and Lys79, were conserved in O. saga-
of synthesized allophanate was also quantified by add-              ranensis allophanate hydrolase.
ing urease (0.2 U) from sword bean (Urea N B Kit,
Wako) into the reaction mixture described above. The               3.2. Gene expression and purification of recombinant
amount of additional ammonia produced with the addi-               O. sagaranensis allophanate hydrolase
tion of urease was measured, and as a result, the amount
of urea was determined to be 3.0% of the calculated con-              In order to carry out a detailed biochemical examina-
centration of allophanate. As addition of urea at a con-           tion of a bacterial allophanate hydrolase, overexpression
centration of 2.0 or 4.0 mM into the reaction mixture              of the O. sagaranensis allophanate hydrolase gene was
64                                T. Kanamori et al. / FEMS Microbiology Letters 245 (2005) 61–65

performed. Through three purification steps, the recom-              acetamide or formamide. Since acetamide and formam-
binant O. sagaranensis allophanate hydrolase was puri-              ide scarcely affect the allophanate hydrolyzing activity of
fied 2.8-fold with a yield of 32.8%. The specific activity            O. sagaranensis allophanate hydrolase at the concentra-
of the purified enzyme towards 2.0 mM of allophanate                 tions examined, the lack of the activity for acetamide
was 108U mgÀ1. The molecular mass of purified O. sag-                and formamide were not due to inhibition or inactiva-
aranensis allophanate hydrolase was estimated as                    tion of O. sagaranensis allophanate hydrolase by acet-
approximately 138 kDa, indicating that the recombinant              amide or formamide.
protein was a dimer.

3.3. Substrate specificity and kinetic examination of                4. Discussion
O. sagaranensis allophanate hydrolase
                                                                       Although the kinetic parameters of O. sagaranensis
   The substrate specificity of O. sagaranensis allophan-            allophanate hydrolase were determined, only a few
ate hydrolase was performed using compounds de-                     examples for comparison have been reported from other
scribed in Materials and methods as a substrate. No                 known allophanate hydrolase and urea amidolyase en-
activity was detected with urea, acetamide, formamide,              zymes. The Km value of O. sagaranensis allophanate
acetoacetamide, biuret, diacetamide, or malonamide.                 hydrolase towards allophanate was over 10 times lower
As allophanate was the only substrate to be catalyzed               than those of the purified allophanate hydrolase from
by the enzyme, the kinetic analysis of the allophanate              C. reinhardtii [15] and the partially purified urea amido-
hydrolase reaction with allophanate was carried out.                lyase from Pichia jadinii [22]. Although the Vmax value
The reaction followed Michaelis–Menten kinetics. The                towards allophanate of a purified enzyme has not been
Vmax value of O. sagaranensis allophanate hydrolase                 obtained from any other organism, comparison of the
for allophanate was calculated as 110 ± 1 U mgÀ1 pro-               purification tables suggested that the catalytic activity
tein and the Km value was 42.0 ± 1.9 lM.                            of O. sagaranensis allophanate hydrolase was much
                                                                    higher than those of other known enzymes.
3.4. Urea degrading activity of O. sagaranensis urea                   Further examination for the substrate specificity of
carboxylase/allophanate hydrolase system                            O. sagaranensis allophanate hydrolase revealed that O.
                                                                    sagaranensis allophanate hydrolase specifically hydro-
   As some yeast strains and green algae that lack urease           lyzed allophanate among substrates examined. Maitz
have been known to hydrolyze urea to ammonia and                    et al. [15] described that the structures of substrates in
carbon dioxide by the reaction catalyzed by urea amid-              which a keto and a carboxyl group were separated by
olyase, the ammonia-generating activity of the O. saga-             one atom were important in the recognition of sub-
ranensis urea carboxylase/allophanate hydrolase system              strates by allophanate hydrolase. Indeed, all of the sub-
from urea was examined. When O. sagaranensis urea                   strates examined, other than allophanate, did not
carboxylase or allophanate hydrolase was mixed with                 contain this structure supposed to be recognized by allo-
urea individually, no activity was observed. However,               phanate hydrolase. Allophanate contains three C–N
addition of O. sagaranensis allophanate hydrolase                   bonds, and the specific C–N bond that is hydrolyzed
along with urea carboxylase led to the production of a              by allophanate hydrolase is still unclear. Contrary to
significant amount of ammonia (10.2 U mgÀ1 of urea                   our expectations, the experiments for the substrate spec-
carboxylase). The apparent ammonia-generating rate                  ificity did not provide information on the cleavage site
of O. sagaranensis urea carboxylase/allophanate hydro-              because of the strict substrate specificity of O. sagaran-
lase system was almost equivalent to that of the carbox-            ensis allophanate hydrolase. On the other hand, the
ylation of urea, indicating that there is no significant loss        comparison of the primary structure of O. sagaranensis
of the intermediate, allophanate, between the reactions             allophanate hydrolase with other amidase enzymes indi-
of urea carboxylase and allophanate hydrolase.                      cated that O. sagaranensis allophanate hydrolase was a
   The previously determined substrate specificity of                member of the amidase signature family. As all known
O. sagaranensis urea carboxylase [1] suggested that                 members of this enzyme family catalyze the hydrolysis
acetamide and formamide might also be substrates of                 of the terminal amide bond [21,23], O. sagaranensis allo-
the O. sagaranensis urea carboxylase/allophanate hydro-             phanate hydrolase can also be supposed to hydrolyze
lase system. The predicted carboxylated products of                 the terminal C–N bond, followed by the spontaneous
acetamide and formamide, N-carboxyacetamide and                     hydrolysis of the product (N-carboxylcarbamate) in
N-carboxyformamide, have not been examined in the                   water.
experiments described above. Therefore, the ATP-                       Ammonia-generating activity of the urea carboxyl-
dependent ammonia-releasing activity of the system                  ase/allophanate hydrolase system towards urea sug-
with 250 mM acetamide or 100 mM formamide was                       gested that these two enzymes might form a complex
examined. However, no activities were observed with                 to directly transfer allophanate generated in the urea
                                      T. Kanamori et al. / FEMS Microbiology Letters 245 (2005) 61–65                                       65

carboxylase reaction to allophanate hydrolase. If so, one                [7] Collins, C.M. and DÕOrazio, S.E. (1993) Bacterial ureases:
would expect a difference in the elution profiles in gel fil-                   structure, regulation of expression and role in pathogenesis.
                                                                             Mol. Microbiol. 9, 907–913.
tration chromatography for either enzyme in the pres-                    [8] Roon, R.J. and Levenberg, B. (1972) Urea amidolyase. I. Properties
ence of the other. Complex formation can also be                             of the enzyme from Candida utilis. J. Biol. Chem. 247, 4107–4113.
expected to affect the reaction kinetics of the individual                [9] Leftley, J.W. and Syrett, P.J. (1973) Urease and ATP: Urea
enzymes. Further, mixing O. sagaranensis urea carboxyl-                      amidolyase activity in unicellular algae. J. Gen. Microbiol. 77,
ase, allophanate hydrolase and the avidin affinity resin                       109–115.
                                                                        [10] Whitney, P.A. and Cooper, T. (1973) Urea carboxylase from
that specifically binds biotinylated proteins might result                    Saccharomyces cerevisiae. Evidence for a minimal two-step
in co-precipitation of both enzymes. We carried out all                      reaction sequence. J. Biol. Chem. 248, 325–330.
of the above experiments, but none of the results sug-                  [11] Sumrada, R.A. and Cooper, T.G. (1982) Urea carboxylase and
gested complex formation (data not shown). This sug-                         allophanate hydrolase are components of a multifunctional
gested that O. sagaranensis urea carboxylase does not                        protein in yeast. J. Biol. Chem. 257, 9119–9127.
                                                                        [12] Nishiya, Y. and Imanaka, T. (1993) Cloning and nucleotide
interact with allophanate hydrolase, or the interaction                      sequence of the urea amidolyase gene from Candida utilis. J.
between them was too weak or unstable to detect. This                        Ferment. Bioeng. 75, 245–253.
is similar to the case of the algal enzymes [14].                       [13] Genbauffe, F.S. and Cooper, T.G. (1991) The urea amidolyase
    Our results on the substrate specificity of the urea                      (DUR1, 2) gene of Saccharomyces cerevisiae. DNA Seq. 2, 19–32.
carboxylase/allophanate hydrolase system of O. saga-                    [14] Thompson, J.F. and Muenster, A.M. (1971) Separation of the
                                                                             Chlorella ATP: Urea amido-lyase into two components. Biochem.
ranensis indicated that the system is specific for urea.                      Biophys. Res. Commun. 43, 1049–1055.
On the other hand, the O. sagaranensis cells displayed                  [15] Maitz, G.S., Haas, E.M. and Castric, P.A. (1982) Purification and
not only urea amidolyase activity but also an ATP-inde-                      properties of the allophanate hydrolase from Chlamydomonas
pendent ammonia-generating activity from urea that                           reinhardii. Biochim. Biophys. Acta 714, 486–491.
might correspond to the urease activity. The analyses                   [16] Martinez, B., Tomkins, J., Wackett, L.P., Wing, R. and Sadow-
                                                                             sky, M.J. (2001) Complete nucleotide sequence and organization
on the relationship between the culture conditions and                       of the atrazine catabolic plasmid pADP-1 from Pseudomonas sp.
the levels of activities of urea carboxylase, allophanate                    strain ADP. J. Bacteriol. 183, 5684–5697.
hydrolase and putative urease in the O. sagaranensis                    [17] Kanamori, T., Rashid, N., Morikawa, M., Atomi, H. and
cells may lead to new information on the roles of these                      Imanaka, T. (2002) Oleomonas sagaranensis gen. nov., sp. nov.,
enzymes in the urea decomposition in the prokaryotic                         represents a novel genus in the a-Proteobacteria. FEMS Micro-
                                                                             biol. Lett. 217, 255–261.
cells.                                                                  [18] Laemmli, U.K. (1970) Cleavage of structural proteins during the
                                                                             assembly of the head of bacteriophage T4. Nature 227, 680–685.
                                                                        [19] Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D.,
References                                                                   Seidman, J.G., Smith, J.A. and Struhl, K. (1995) Current
                                                                             Protocols in Molecular Biology. Wiley, New York.
[1] Kanamori, T., Kanou, N., Atomi, H. and Imanaka, T. (2004)           [20] Kaltwasser, H. and Schlegel, H.G. (1966) NADH-dependent
    Enzymatic characterization of a prokaryotic urea carboxylase. J.         coupled enzyme assay for urease and other ammonia-producing
    Bacteriol. 186, 2532–2539.                                               systems. Anal. Biochem. 16, 132–138.
[2] Hausinger, R.P. (2004) Metabolic versatility of prokaryotes for     [21] Shin, S., Lee, T.H., Ha, N.C., Koo, H.M., Kim, S.Y., Lee, H.S.,
    urea decomposition. J. Bacteriol. 186, 2520–2522.                        Kim, Y.S. and Oh, B.H. (2002) Structure of malonamidase E2
[3] Mobley, H.L. and Hausinger, R.P. (1989) Microbial ureases:               reveals a novel Ser–cisSer–Lys catalytic triad in a new serine
    significance, regulation, and molecular characterization. Micro-          hydrolase fold that is prevalent in nature. EMBO J. 21, 2509–2516.
    biol. Rev. 53, 85–108.                                              [22] Roon, R.J. and Levenberg, B. (1970) CO2 fixation and the
[4] Mobley, H.L., Island, M.D. and Hausinger, R.P. (1995) Molec-             involvement of allophanate in the biotin-enzyme-catalyzed cleav-
    ular biology of microbial ureases. Microbiol. Rev. 59, 451–480.          age of urea. J. Biol. Chem. 245, 4593–4595.
[5] Sirko, A. and Brodzik, R. (2000) Plant ureases: roles and           [23] Neumann, S. and Kula, M.R. (2002) Gene cloning, overexpres-
    regulation. Acta Biochim. Pol. 47, 1189–1195.                            sion and biochemical characterization of the peptide amidase
[6] Mackay, E.M. and Pateman, J.A. (1982) The regulation of urease           from Stenotrophomonas maltophilia. Appl. Microbiol. Biotechnol.
    activity in Aspergillus nidulans. Biochem. Genet. 20, 763–776.           58, 772–780.
                                                  FEMS Microbiology Letters 245 (2005) 67–72
                                                                                                                     www.fems-microbiology.org




                         A hyperactive, Ca2+-dependent antifreeze protein
                                    in an Antarctic bacterium
                        Jack A. Gilbert a, Peter L. Davies                     a,*
                                                                                     , Johanna Laybourn-Parry                b

a
    Department of Biochemistry and the Protein Engineering Network of Centres of Excellence, QueenÕs University, Kingston, Ont., Canada K7L 3N6
                                   b
                                     School of Bioscience, University of Nottingham, Nottingham NG7 2RD, UK

                           Received 16 December 2004; received in revised form 16 February 2005; accepted 17 February 2005

                                                          First published online 10 March 2005

                                                                  Edited by C. Edwards




Abstract

   In cold climates, some plants and bacteria that cannot avoid freezing use antifreeze proteins (AFPs) to lessen the destructive
effects of ice recrystallization. These AFPs have weak freezing point depression activity, perhaps to avoid sudden, uncontrolled
growth of ice. Here, we report on an uncharacteristically powerful bacterial AFP found in an Antarctic strain of the bacterium,
Marinomonas primoryensis. It is Ca2+-dependent, shows evidence of cooperativity, and can produce over 2 °C of freezing point
depression. Unlike most AFPs, it does not produce obvious crystal faceting during thermal hysteresis. This AFP might be capable
of imparting freezing avoidance to M. primoryensis in ice-covered Antarctic lakes. A hyperactive bacterial AFP has not previously
been reported.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Antifreeze protein; Thermal hysteresis; Calcium; Recrystallization inhibition; Ice; Antarctic bacterium




1. Introduction                                                                This is consistent with these species having a freeze-
                                                                               avoidance strategy, whereby they depress the freezing
   Antifreeze proteins (AFPs) are a diverse group of ice-                      point of their body fluids to prevent freezing of tissues
binding proteins that inhibit the growth of ice in two dif-                    [1,2,13,14]. However, AFP-producing plants and bacte-
ferent situations. Prior to freezing they possess thermal                      ria reported to date show substantially lower thermal
hysteresis (TH) activity, which is the non-colligative                         hysteresis activity than do animals. This is consistent
depression of the freezing point of a solution containing                      with a freeze-tolerance strategy whereby these organisms
ice below its melting point. In the frozen state they show                     readily freeze but use the RI activity of AFPs to control
ice recrystallization inhibition (RI), whereby the pro-                        the size of ice crystals [7,15]. The bacterial AFPs that
teins inhibit the growth of large crystals at the expense                      have been assessed for TH, have demonstrated low
of small crystals at high subzero temperatures. AFPs                           activity [8,10–12] compared to insect and fish AFPs,
have been found in animals [1,2], plants [3–7], fungi                          which have up to 5 and 2 °C of TH, respectively [1,16–
[8,9] and eubacterial species [8,10–12]. AFPs isolated                         18].
from animals typically have substantial TH activity.                              In a previous study, Gilbert et al. [19] isolated 11 bac-
                                                                               terial strains with RI activity from several Antarctic
    *
        Corresponding author. Tel.: +1 613 533 2983; fax: +1 613 533 2497.     lakes in the Vestfold Hills, Eastern Antarctica (68°S,
        E-mail address: daviesp@post.queensu.ca (P.L. Davies).                 78°E). A bacterium identified as M. protea in the

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.022
68                               J.A. Gilbert et al. / FEMS Microbiology Letters 245 (2005) 67–72

original study [20] is now thought to be a strain of Mari-          HCl (pH 8.0), from which metal ions (e.g., Ca2+) had
nomonas primoryensis [21] based on 16S rDNA compar-                 been chelated by passage through a Chelex-100 chelat-
ison (results not shown). It was one of the most                    ing resin column (iminodiacetic acid immobilised on 1%
abundant AFP-active bacterial strains isolated in that              cross-linked polystyrene 50–100 dry mesh), (Sigma) at
study. The lakes from which M. primoryensis was cul-                0.5 ml minÀ1. Approximately 10 ml of crude lysate
tured were isolated from the sea following the last gla-            was dialysed in 3500 MWCO (molecular weight cut-
cial maximum around 10,000 years ago when the land                  off) dialysis tubing (Fisher) at 4 °C against 1 l of
rose up as the ice cap retreated [22]. They are approxi-            Ca2+-free 25 mM Tris/HCl (pH 8.0) for $15 h, with
mately half as saline as seawater, and ice-covered, usu-            three changes of the dialysis buffer. Following dialysis,
ally with a short ice-free period of 3–6 weeks in late              metal salts (CaCl2, MnCl2, MgCl2, ZnCl2, CuSO4,
summer. Their brackish salinity helps maintain the                  NiSO4) were individually added to the solution to a fi-
water temperature in the water column between À1 °C                 nal concentration of 10 mM to determine the effect of
(at the ice–water interface) and +1 °C (at the base of              each upon the TH activity of the dialysed lysate
the oxygenated water) [19], thereby constituting an ice-            supernatant.
laden but thermally buffered environment. This study
describes the preliminary characterisation of a novel,              2.4. The effects of proteolysis and chelation
hyperactive AFP from M. primoryensis (MpAFP),
revealing several unusual properties, including Ca2+-                  The effects of proteases on TH activity were deter-
dependence.                                                         mined as follows. Pronase and trypsin (Sigma) were
                                                                    used at 37 °C at a 1:10 enzyme to substrate ratio. The
                                                                    protein concentration of the crude lysate supernatant
2. Materials and methods                                            was determined by Bradford assay (Bio-Rad) and a con-
                                                                    centration of $6.5 mg mlÀ1 was used for these experi-
2.1. Protein preparation                                            ments. Aliquots of the digests were measured for TH
                                                                    activity every 30 min. Proteinase K (MBI Fermentas)
   M. primoryensis was cultured in 1 l of 50% sea water             was added to the crude lysate supernatant to a final con-
broth (SWB) growth medium (per L: yeast extract (Sig-               centration of 2 mg mlÀ1 and incubated at 37 °C. TH
ma) 1 g, peptone (Sigma) 1 g, sea salt (Coral Life,                 activity again was recorded every 30 min. All protease
Aquatics Online) 19 g), with shaking at 4 °C for 4–5                experiments were performed in the presence and absence
days, or until the optical density at 600 nm reached                of Ca2+, where Ca2+ was removed from crude lysate
0.8–0.9. The cultures were centrifuged (4500·g at 4 °C              supernatant by dialysis as described above. The effects
for 15 min in a Beckman JA4.2 swinging bucket rotor).               of EDTA, EGTA and O-phenanthroline on MpAFP
The cell pellet was resuspended in 2.5 ml of ice-cold lysis         TH activity were recorded following incubation on ice
buffer (25 mM Tris/HCl (pH 8.0), 10 mM CaCl2). Fol-                  for 1 h.
lowing sonication on ice, the lysate was centrifuged
(27,000 · g (15,000 rpm) at 4 °C for 1 h in a Beckman
JA20 rotor) and the supernatant (cell-free extract) was             3. Results
removed and stored at À20 °C.
                                                                    3.1. Thermal hysteresis activity of crude lysate and growth
2.2. Thermal hysteresis measurement and image capture               medium

    TH measurements were made using a Clifton Nano-                    A typical preparation of crude lysate supernatant
litre Osmometer (Clifton Technical Physics) as previ-               contained 11 mg mlÀ1 of protein and had an activity
ously described [23]. To study the effect of [AFP] on                of 0.8 °C (±0.07 °C). There was little variation in con-
TH activity, serial dilutions of the lysate supernatant             centration or activity between preparations. No activity
were made in lysis buffer. Digital images of ice crystals            was found in the growth medium recovered after pellet-
formed during TH assay were taken using a Nikon                     ing the cells, even after 100-fold concentration.
COOLPIX 4500 digital camera mounted on a Leitz dia-
lux 22 microscope with a Leitz Wetzlar 160/- EF 10/0.25             3.2. Characterisation of MpAFP
objective.
                                                                       An initial attempt to purify the MpAFP by size-
2.3. Determining Ca2+-dependency                                    exclusion chromatography of lysate supernatant re-
                                                                    sulted in the complete loss of TH activity. From this,
   To determine the dependency of MpAFP activity on                 we reasoned a low molecular weight factor was required
divalent metal ions, samples containing MpAFP were                  for activity (not shown). This result was confirmed when
subjected to exhaustive dialysis against 25 mM Tris/                extensive dialysis of the lysate supernatant in 3500
                                                          J.A. Gilbert et al. / FEMS Microbiology Letters 245 (2005) 67–72                                                                     69

                            0.8                                                                                                   0.9
                            0.7
                                                                                                                                  0.8
  Thermal hysteresis (°C)




                                                                                               Thermal Hysteresis Activity (°C)
                            0.6
                            0.5                                                                                                   0.7
                            0.4
                                                                                                                                  0.6
                            0.3
                                                                                                                                  0.5
                            0.2
                                                                                                                                                              0.12
                            0.1                                                                                                   0.4                          0.1
                             0                                                                                                                                0.08
                                  a   b   c   d   e   f   g   h   i    j   k    l
                                                                                                                                  0.3
                                                                                                                                                              0.06

Fig. 1. Effect of various conditions on MpAFP activity in crude lysate                                                             0.2                         0.04

supernatant (error bars show standard deviation): (a) control:                                                                                                0.02

$6.5 mg mlÀ1 crude lysate supernatant; (b) exhaustive dialysis;                                                                   0.1                           0

(c) dialysate 10 mM Ca2+; (d) 10 mM EDTA; (e) 100 mM EDTA;                                                                                                           0       0.2   0.4   0.6
                                                                                                                                   0
(f) 10 mM EGTA; (g) 10 mM EDTA + 20 mM Ca2+; (h) 10 mM
o-phenanthroline; (i) proteinase K (+ or ÀCa2+); (j) pronase (ÀCa2+);                                                                   0   1   2         3              4         5           6
(k) trypsin (+ Ca2+); (l) trypsin (ÀCa2+).                                                                                                          [Protein] (mg/mL)

                                                                                             Fig. 2. Thermal hysteresis activity versus protein concentration curves
                                                                                             for pure fish type III AFP (n) and crude lysate supernatant of M.
MWCO membranes also caused the complete loss of                                              primoryensis (m). The insert shows the sigmoidal nature of the M.
activity (Fig. 1). The addition of 10 mM CaCl2 to the                                        protea curve at low protein concentrations.
dialysate restored full activity. The addition of other
divalent metals ions (Mn2+, Co2+, Ni2+, Zn2+, Cu2+,                                          lator O-phenanthroline to 10 mM had no effect on
Mg2+) to the Ca2+-free dialysate had no effect on                                             activity.
activity.                                                                                       The effect of proteolysis on MpAFP activity of the
   The effect of chelating agents on MpAFP activity in                                        crude lysate supernatant, was tested with and without
crude lysate supernatant was investigated (Fig. 1). Addi-                                    Ca2+ present (Fig. 1). Pronase, in the presence of
tion of 10 mM EDTA or EGTA on ice caused a 50%                                               Ca2+, caused a decrease in TH activity of 0.09 °C, for
reduction in TH activity. Addition of 100 mM EDTA                                            every 30 min of incubation at 37 °C (not shown). In
also caused a 50% reduction in activity. The saturation                                      the absence of Ca2+, activity was extinguished within
of 10 mM EDTA with 20 mM CaCl2 fully restored the                                            30 min. Proteinase K was more detrimental, eliminating
activity, confirming that loss of activity with EDTA is                                       activity within 30 min in the presence or absence of
due to chelation of Ca2+ ions. Addition of the iron che-                                     Ca2+. Trypsin had no effect on activity in the presence




Fig. 3. Ice crystal morphologies obtained with MpAFP. (a) and (b) two different ice crystals obtained in the presence of M. primoryensis crude lysate
supernatant at 0.3 °C of under-cooling. (c) a dendritic crystal growing extremely rapidly below the non-equilibrium freezing point. Size
marker = 50 lm and relates to (a) and (b) only.
70                                J.A. Gilbert et al. / FEMS Microbiology Letters 245 (2005) 67–72

of Ca2+. There was no loss of activity following incuba-                As this strain of M. primoryensis was isolated from a
tion at 37 °C with trypsin for 6 days; thereby indicating            saline (1.9%), permanently cold (À1 to +1 °C) Antarctic
the thermal stability of MpAFP at 37 °C when Ca2+ is                 lake with 1–2 m deep ice cover [19], we hypothesise that
present. However, in the absence of Ca2+, activity was               this bacterium has evolved a highly active AFP to resist
completely extinguished by 30 min.                                   freezing in the water column. An AFP with TH activity
                                                                     comparable to that found in marine fish should be suffi-
3.3. Effect of dilution on crude lysate supernatant TH                cient to inhibit the growth of ice crystals that might
activity                                                             otherwise be propagated into the bacterium, especially
                                                                     near the ice–water interface of the lake. The other
   Two-fold serial dilutions of this cell-free extract were          AFP-active bacterial species were isolated from harsher,
prepared and assayed for TH. The plot of activity                    frozen environments, i.e., high Arctic plant rhizosphere
against protein concentration (Fig. 2) showed a sigmoi-              (P. putida [10]), mid-gut of frozen beetle larvae (R. ery-
dal relationship at low protein concentrations. TH activ-            thropolis), frozen/chilled pork sausages (M. cryophilus
ity was undetectable below 0.18 mg mlÀ1 but began to                 [8]), and Antarctic soil (Moraxella sp [11] and P. fluores-
increase rapidly at 0.36 mg mlÀ1 and followed a more                 cens [12]). Bacteria in these environments would require
hyperbolic relationship with protein concentration from              an RI-active protein to prevent lethal recrystallization.
there on. The crude bacterial lysate supernatant was                 Even the most potent AFPs are unlikely to prevent a
quite active in comparison to pure type III AFP. Con-                bacterium from freezing in these harsh environments,
centrating the cell-free extract approximately 20-fold               and high TH activity will tend to cause rapid, uncontrol-
using a 30,000 MWCO Amicon ultra centrifugal con-                    lable ice crystal growth when freezing inevitably occurs.
centrator (Millipore) increased the activity to >2 °C,                  Most previously reported bacterial AFPs (see above)
higher than the maximal activity of most fish AFPs.                   were shown to be exported from the cell [8,10–12]. How-
                                                                     ever, in M. primoryensis AFP activity was only found in
                                                                     the cellular lysate supernatant. While we have not yet
3.4. Ice crystal morphology                                          determined the location of MpAFP within the cell, we
                                                                     suggest that it would be most effective if localised to the
   Ice crystals formed in the presence of MpAFP do not               periplasmic space, where it would be likely to encounter,
have distinct facets (Fig. 3(a) and (b)). They are typically         bind and inhibit embryonic ice crystals from the extracel-
rounded in shape and do not change their morphology                  lular environment before they damage the cell.
during the course of the TH measurement. The ice crys-                  Many AFPs impart a characteristic morphology to
tal ‘‘burst’’ occurring at the end-point of TH is dendritic          ice crystals as a result of their crystal plane-specific bind-
with hexagonal symmetry, suggesting growth from pri-                 ing. For example, fish AFP type I from winter flounder
mary or secondary prism faces or edges (Fig. 3(c)). This             binds to the {20–21} pyramidal planes of the ice crystal,
more closely resembles the ‘‘bursts’’ seen with insect               forming hexagonal bipyramids [28]. This morphology is
AFPs than ‘‘bursts’’ that occur along the c-axis from                assumed on initial cooling at the start of the TH-gap
crystals inhibited by fish AFPs [24].                                 (temperatures between non-equilibrium melting and
                                                                     freezing points). Below the non-equilibrium freezing
                                                                     point, fish AFPs tend to exhibit uncontrollable growth
4. Discussion                                                        along the c-axis [24]. In comparison, the insect AFP
                                                                     from Choristonerua fumiferana binds to both the pri-
    In this study, we have partially characterised a Ca2+-           mary prism planes and basal planes, to produce a
dependent, bacterial AFP that demonstrates hyperactive               hexagonal plate morphology that is stable throughout
thermal hysteresis. Previously, bacterial AFPs have                  the TH-gap. The structurally similar but unrelated
demonstrated RI activity but only low levels of                      AFP from Tenebrio molitor produces an even more com-
TH activity (<0.1 °C), e.g., Micrococcus cryophilus &                plex lemon-shaped crystal morphology [16] suggesting
Rhodococcus erythropolis [8], Pseudomonas putida [10],               possible binding to more than just the basal and primary
Moraxella sp. [11] and Pseudomonas fluorescens [12].                  prism planes. For both insect AFPs, uncontrollable ice
The presence of an AFP with low TH activity would                    growth below the non-equilibrium freezing point occurs
suggest that these bacterial strains employ a freeze-toler-          primarily along the a axes, producing a dendritic crystal
ant strategy similar to that of plants, e.g., rye grass [6],         pattern with hexagonal symmetry [29]. This ‘‘burst’’ pat-
carrot [4], winter rye [25] and bittersweet nightshade               tern is also seen with MpAFP. Other bacterial AFPs
[3]. The presence of a highly active bacterial antifreeze            have been shown to produce hexagonal crystal shaping
in M. primoryensis suggests that some bacteria, like in-             [10–12], but as yet their binding plane specificity has
sects [26,27] and fish [2] have also evolved a freeze-                not been reported.
avoidance strategy, which has not yet been reported in                  Unlike most AFPs, which show a hyperbolic relation-
microorganisms.                                                      ship between TH activity and AFP concentration [30],
                                        J.A. Gilbert et al. / FEMS Microbiology Letters 245 (2005) 67–72                                         71

the sigmoidal shape of the dilution curve at low protein                    [6] Sidebottom, C., Buckley, S., Pudney, P., Twigg, S., Jarman, C.,
concentrations of MpAFP is suggestive of cooperativity                          Holt, C., Telford, J., McArthur, A., Worrall, D., Hubbard, R.
                                                                                and Lillford, P. (2000) Heat-stable antifreeze protein from grass.
in binding to ice or inhibition of its growth. A similar re-                    Nature 406, 256.
sult has been reported for one of the smaller AFGPs                         [7] Griffith, M. and Yaish, M.W. (2004) Antifreeze proteins in
[17].                                                                           overwintering plants: a tale of two activities. Trends Plant Sci. 9,
   To date, Ca2+-dependent AFP activity has only been                           399–405.
shown in fish AFP type II from rainbow smelt (Osmerus                        [8] Duman, J. and Olsen, T.M. (1993) Thermal hysteresis protein
                                                                                activity in bacteria, fungi and phylogenetically diverse plants.
mordax) and Atlantic herring (Clupea harengus) [31].                            Cryobiology 30, 322–328.
The herring AFP, like MpAFP, demonstrates a confor-                         [9] Hoshino, T., Kiriaki, M. and Nakajima, T. (2003) Novel thermal
mational change from a protease-sensitive, inactive form                        hysteresis proteins from low temperature basidiomycete, Coprinus
to a protease-resistant, active form with the addition of                       psychromorbidus. Cryo Lett. 24, 135–142.
Ca2+ [31]. Type II AFPs are homologous to the carbo-                       [10] Sun, X., Griffith, M., Pasternak, J.J. and Glick, B.R. (1995) Low
                                                                                temperature growth, freezing survival, and production of anti-
hydrate-recognition domain of the Ca2+-dependent (C-                            freeze protein by the plant growth promoting rhizobacterium
type) animal lectins [32]. Although there are lectins in                        Pseudomonas putida GR12-2. Can. J. Microbiol. 41, 776–784.
bacteria that bind Ca2+ [33], there is no evidence at this                 [11] Yamashita, Y., Nakamura, N., Omiya, K., Nishikawa, J.,
time that MpAFP is a homolog. Stressman et al. [34]                             Kawahara, H. and Obata, H. (2002) Identification of an antifreeze
noted that during freeze/thaw cycling, the AFP from                             lipoprotein from Moraxella sp. of Antarctic origin. Biosci.
                                                                                Biotechnol. Biochem. 66, 239–247.
winter rye (Secale cereale) bound Ca2+ to the detriment                    [12] Kawahara, H., Nakano, Y., Omiya, K., Muryoi, N., Nishikawa,
of its activity. However, if the AFP was maintained at                          J. and Obata, H. (2004) Production of two types of ice-crystal-
4 °C, Ca2+ had no effect on its activity. We note that                           controlling proteins in Antarctic bacterium. J. Biosci. Bioeng. 98,
the bacterial AFP from P. putida, AfpA, contains a ser-                         220–223.
ies of putative Ca2+-binding repeats that could be in-                     [13] Cheng, C.C. and DeVries, A.L. (1991) The role of antifreeze
                                                                                glycopeptides and peptides in the freezing avoidance of cold-water
volved in a possible hemolysin-like, Ca2+-binding                               fish In: Life under Extreme Conditions (di Prisco, G., Ed.), pp. 1–
secretion domain [35]. However, there have been no re-                          14. Springer-Verlag, Berlin.
ports as yet of Ca2+-dependent bacterial AFPs. As such                     [14] Ewart, K.V., Lin, Q. and Hew, C.L. (1999) Structure, function
the Ca2+-dependency in MpAFP is novel for AFPs from                             and evolution of antifreeze proteins. Cell. Mol. Life. Sci. 55, 271–
this kingdom.                                                                   283.
                                                                           [15] Xu, H., Griffith, M., Patten, C.L. and Glick, B.R. (1998) Isolation
   In summary, we report the discovery of a Ca2+-                               and characterisation of an antifreeze protein with ice nucleation
dependent, hyperactive bacterial antifreeze protein from                        activity from the plant growth promoting rhizobacterium Pseu-
an Antarctic lake strain of the bacterium M.                                    domonas putida GR12-2. Can. J. Microbiol. 44, 64–73.
primoryensis.                                                              [16] Graham, L.A., Liou, Y.C., Walker, V.K. and Davies, P.L. (1997)
                                                                                Hyperactive antifreeze protein from beetles. Nature 388, 727–728.
                                                                           [17] Feeney, R.E., Burcham, T.S. and Yeh, Y. (1986) Antifreeze
                                                                                glycoproteins from polar fish blood. Annu. Rev. Biophys.
Acknowledgements                                                                Biophys. Chem. 15, 59–78.
                                                                           [18] Marshall, C.B., Fletcher, G.L. and Davies, P.L. (2004) Hyperac-
                                                                                tive antifreeze protein in a fish. Nature 429, 153.
   This work was funded by a grant from the Canadian
                                                                           [19] Gilbert, J.A., Hill, P.J., Dodd, C.E. and Laybourn-Parry, J.
Institutes of Health Research (CIHR). P.L.D holds a                             (2004) Demonstration of antifreeze protein activity in Antarctic
Canada Research Chair in Protein Engineering. We                                lake bacteria. Microbiology 150, 171–180.
are grateful to Chris Marshall and Dr. Andrew Scotter                      [20] Mills, S.V. (1999) Novel biochemical compounds from Antarctic
for comments and suggestions.                                                   microorganisms, Ph.D. Thesis, School of Bioscience, Nottingham
                                                                                University, Nottingham, UK.
                                                                           [21] Romanenko, L.A., Uchino, M., Mikhailov, V.V., Zhukova, N.V.
                                                                                and Uchimura, T. (2003) Marinomonas primoryensis sp. nov., a
References                                                                      novel psychrophile isolated from coastal sea-ice in the sea of
                                                                                Japan. Int. J. Syst. Evol. Microbiol. 53, 829–832.
[1] Duman, J.G. (2001) Antifreeze and ice nucleator proteins in            [22] Adamson, D.A. and Pickard, J. (1986) Cainozoic history of the
    terrestrial arthropods. Annu. Rev. Physiol. 63, 327–357.                    Vestfold Hills In: Antarctic Oases: Terrestrial Environments and
[2] Fletcher, G.L., Hew, C.L. and Davies, P.L. (2001) Antifreeze                History of the Vestfold Hills (Pickard, J., Ed.). Academic Press,
    proteins of teleost fishes. Annu. Rev. Physiol. 63, 359–390.                 Sydney.
[3] Urrutia, M.E., Duman, J.G. and Knight, C.A. (1992) Plant               [23] Chakrabartty, A. and Hew, C.L. (1991) The effect of enhanced
    thermal hysteresis proteins. Biochim. Biophys. Acta 1121, 199–              alpha-helicity on the activity of a winter flounder antifreeze
    206.                                                                        polypeptide. Eur. J. Biochem. 202, 1057–1063.
[4] Worrall, D., Elias, L., Ashford, D., Smallwood, M., Sidebottom,        [24] Graether, S.P., Kuiper, M.J., Gagne, S.M., Walker, V.K., Jia, Z.,
    C., Lillford, P., Telford, J., Holt, C. and Bowles, D. (1998) A             Sykes, B.D. and Davies, P.L. (2000) b-Helix structure and ice-
    carrot leucine-rich-repeat protein that inhibits ice recrystalliza-         binding properties of a hyperactive antifreeze protein from an
    tion. Science 282, 115–117.                                                 insect. Nature 406, 325–328.
[5] Meyer, K., Keil, M. and Naldrett, M.J. (1999) A leucine-rich           [25] Griffith, M., Ala, P., Yang, D.S., Hon, W.C. and Moffat, B.A.
    repeat protein of carrot that exhibits antifreeze activity. FEBS            (1992) Antifreeze protein produced endogenously in winter rye
    Lett. 447, 171–178.                                                         leaves. Plant Physiol. 100, 593–596.
72                                      J.A. Gilbert et al. / FEMS Microbiology Letters 245 (2005) 67–72

[26] Graether, S.P. and Sykes, B.D. (2004) Cold survival in freeze-        [32] Ewart, K.V., Li, Z., Yang, D.S., Fletcher, G.L. and Hew, C.L.
     intolerant insects: the structure and function of b-helical anti-          (1998) The ice-binding site of Atlantic herring antifreeze protein
     freeze proteins. Eur. J. Biochem. 271, 3285–3296.                          corresponds to the carbohydrate-binding site of C-type lectins.
[27] Duman, J.G., Bennett, V., Sformo, T., Hochstrasser, R. and                 Biochemistry 37, 4080–4085.
     Barnes, B.M. (2004) Antifreeze proteins in Alaskan insects and        [33] Cioci, G., Mitchell, E.P., Gautier, C., Wimmerova, M.,
     spiders. J. Insect Physiol. 50, 259–266.                                   Sudakevitz, D., Perez, S., Gilboa-Garber, N. and Imberty, A.
[28] Knight, C.A., Cheng, C.C. and DeVries, A.L. (1991) Adsorption              (2003) Structural basis of calcium and galactose recognition by
     of a-helical antifreeze peptides on specific ice crystal surface            the lectin PA-IL of Pseudomonas aeruginosa. FEBS Lett. 555,
     planes. Biophys. J. 59, 409–418.                                           297–301.
[29] Tyshenko, M.G., Doucet, D., Davies, P.L. and Walker, V.K.             [34] Stressmann, M., Kitao, S., Griffith, M., Moresoli, C., Bravo, L.A.
     (1997) The antifreeze potential of the spruce budworm thermal              and Marangoni, A.G. (2004) Calcium interacts with antifreeze
     hysteresis protein. Nat. Biotechnol. 15, 887–890.                          proteins and chitinase from cold-acclimated winter rye. Plant
[30] Davies, P.L. and Hew, C.L. (1990) Biochemistry of fish antifreeze           Physiol. 135, 364–376.
     proteins. Faseb J. 4, 2460–2468.                                      [35] Muryoi, N., Sato, M., Kaneko, S., Kawahara, H., Obata, H.,
[31] Ewart, K.V., Yang, D.S., Ananthanarayanan, V.S., Fletcher,                 Yaish, M.W., Griffith, M. and Glick, B.R. (2004) Cloning and
     G.L. and Hew, C.L. (1996) Ca2+-dependent antifreeze proteins.              expression of afpA, a gene encoding an antifreeze protein from
     Modulation of conformation and activity by divalent metal ions.            the arctic plant growth-promoting rhizobacterium Pseudomonas
     J. Biol. Chem. 271, 16627–16632.                                           putida GR12-2. J. Bacteriol. 186, 5661–5671.
                                             FEMS Microbiology Letters 245 (2005) 73–77
                                                                                                                    www.fems-microbiology.org




         Construction and use of an stx1 transcriptional fusion to gfp
                             Abram Aertsen *, Rob Van Houdt, Chris W. Michiels
             Laboratory of Food Microbiology, Katholieke Universiteit Leuven, Kasteelpark Arenberg 22, 3001 Hevelee, Leuven, Belgium

                       Received 24 December 2004; received in revised form 18 February 2005; accepted 20 February 2005

                                                      First published online 9 March 2005

                                                             Edited by M. Schembri




Abstract

   Shiga toxins (Stxs), also termed Vero toxins, are cytotoxic ribosome inactivating proteins that are produced by a number of gas-
trointestinal pathogens and that contribute to the severity of the associated diseases. In this work, we constructed and validated a
transcriptional fusion of the stx1AB promoter to the gfp reporter gene. The cloned promoter region encompasses both the proximal
and the distal promoter regions of stx1AB, mediating control by the hostÕs iron-responsive Fur repressor and the Stx prophageÕs Q
antiterminator protein, respectively. The probe was validated by demonstrating its responsiveness towards mitomycin C and EDTA,
and the contribution of host and phage encoded factors could be separated by studying stx1 expression in either wild-type or iso-
genic lysogenic cells. Moreover, stx1AB expressing populations could be visualized by flow cytometry. The potential use of such a
probe for non-destructive online detection of stx1AB expression and visualization of stx1AB expressing populations is further
discussed.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Escherichia coli; Shiga toxin; Flow cytometry; GFP promoter fusion




1. Introduction                                                            colitis and a severe complication called hemolytic uremic
                                                                           syndrome [2].
   Shiga toxins (Stxs) constitute a family of heteromulti-                    With regard to public health, both the dissemination
meric proteins belonging to the AB family of toxins and                    of stx genes and the regulation of their expression are of
form a branch of the potent class 2 ribosome inhibiting                    tremendous interest. While in S. dysenteriae type 1 the
proteins [1]. The cytotoxicity of Stxs was first demon-                     stxAB operon is embedded in remnants of a defective
strated on Vero cells, lending them the name of Vero                       bacteriophage genome, it often resides on still functional
toxins, and production of Stx was originally identified                     lambdoid prophages in the case of STEC strains [3]. As
in the enteropathogen Shigella dysenteriae type 1. Later,                  a result, the capacity to produce Stx can be easily trans-
several Stx producing Escherichia coli (STEC) strains                      mitted horizontally in a process termed lysogenic con-
have also been isolated. In pathogenic STEC strains                        version [4]. Moreover, induction of the SOS response,
Stx production can significantly contribute to virulence                    often as a result of DNA damaging treatments, is known
by increasing the severity of gastrointestinal illnesses                   to trigger the lytic cycle of lambdoid prophages [5] and
that vary from uncomplicated diarrhea to hemorrhagic                       results in a burst of Stx phage particles, in turn enhanc-
                                                                           ing the probability of infection and lysogenization of
                                                                           naive E. coli or other susceptible bacterial hosts [6,7].
 *
     Corresponding author. Tel.: +32 1632 1578; fax: +32 1632 1960.        Interestingly, owing to their localization in the late re-
     E-mail address: abram.aertsen@agr.kuleuven.ac.be (A. Aertsen).        gion of the phage genome, expression of stx genes was

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.024
74                                A. Aertsen et al. / FEMS Microbiology Letters 245 (2005) 73–77

found to be coregulated with transcription of late phage            of the fluorescence of induced versus control cultures.
genes associated with the lytic cycle [8,9]. Additional             Alternatively, GFP expressing populations were ana-
regulation in the case of stx1 allows for its expression            lyzed by flow cytometry, essentially as described before
under low iron conditions [10], a phenomenon also ob-               [15].
served for several other virulence genes and thought of
as a tactic to turn on virulence traits upon entering the
host organism where iron is scarce.                                 3. Results and discussion
   The techniques that are currently employed to moni-
tor Stx production or expression involve either immuno-             3.1. Construction of an stx1-gfp transcriptional fusion
logical methods for direct toxin detection [11], or specific
stx mRNA quantification and promoter fusions to re-                     stx1AB is carried by stx1 coding Stx phages, such as
porter proteins, such as alkaline phosphatase [10] and              H-19B, and is located in the late lytic region. The pro-
b-galactosidase [12]. Notwithstanding the importance                moter region directly upstream of stx1AB contains a
of revealing the patterns of stx expression under differ-            Fur box, making it responsive to the cellular iron status
ent conditions, none of these techniques allow rapid                through the action of the Fur regulatory protein en-
and online detection and quantification of stx expres-               coded by the host MG1655 [10]. Aside from this proxi-
sion. In this study, we therefore constructed and vali-             mal promoter element, however, stx1 transcription is
dated an stx1 gfp transcriptional fusion, allowing                  also driven by a more distal promoter element, PR0 ,
online and sensitive measurement of stx1AB expression,              whose transcription is allowed to pass the nearby termi-
and further discuss its use in a variety of applications.           nator TR0 in the presence of the phage encoded antiter-
                                                                    minator protein Q which interacts with the qut site
                                                                    (Fig. 1) [9]. The latter is produced at the end of a regu-
2. Materials and methods                                            latory cascade that is initiated when the prophage enters
                                                                    the lytic cycle, and extends transcription from PR0 to-
2.1. Strains and growth conditions                                  wards the late region. To study the regulation of both
                                                                    promoter elements in the stx1 gfp transcriptional fusion,
   E. coli strain MG1655 [13] was used in this study.               a 793 bp promoter fragment directly upstream of
MG1655 H-19B was constructed earlier [7] by lysogeniz-              stx1AB, Pstx1, was obtained by PCR from MG1655
ing MG1655 with Stx phage H-19B, encoding stx1AB.                   H-19B, using primers 5 0 -CAGTGGATCCTGGCACGG-
MG1655 Dfur::Kn was kindly provided by Touati                       AAACATGGGT-3 0 and 5 0 -TCAGTCTAGATTACGTC-
et al. [14]. MG1655 PsulA was constructed earlier [15]              TTTGCAGTCGAGAAGTC-3 0 . Pstx1 was subsequently
and contains a transcriptional fusion of the sulA pro-              digested by BamHI and XbaI and cloned upstream of
moter to gfp in pFPV25 [16]. Stationary phase cultures              gfp in BamHI and XbaI digested pFPV25 [16]. The
were obtained by growth in Luria Bertani broth (LB)                 resulting plasmid, pAA310, is depicted in Fig. 1.
[17] overnight at 37 °C under well-aerated conditions.
Exponential phase cultures were obtained by diluting
overnight cultures 1/100 in fresh prewarmed LB and
incubating further at 37 °C until late exponential phase
                                                                        Q                                                           stx1A
(OD600 = 0.6). Ampicillin (100 lg/ml, Ap100) and kana-                                    PR’          T R’                Pstx1A
mycin (50 lg/ml, Kn50) were added when necessary.
                                                                                      qut                            Fur box
2.2. Induction and measurement of gfp expression
                                                                                    Ba
                                                                                         mH
                                                                                                                       al
                                                                                                                     Xb




                                                                                              I
   Exponential phase cultures of strains carrying pro-
moter fusions were collected by centrifugation (5 min                                                                gfp
at 6000g), and resuspended in fresh LB. To measure                                        bla
GFP production after induction by mitomycin C (Appli-                                                 pAA310

chem, Darmstadt, Germany) or EDTA, 300 ll samples
were transferred to microplate wells and placed in a
                                                                                              colE1            mob
fluorescence reader (Fluoroscan Ascent FL, Thermolab-
systems, Brussels, Belgium). Fluorescence at 520 nm was             Fig. 1. Map of the pAA310 plasmid showing the Stx1 phage fragment
then measured at 30 min intervals with intermittent                 cloned upstream of gfp. Black boxes indicate regulatory sites: the qut
                                                                    site interacts with the Q antiterminator protein, while the Fur box
shaking (every 5 min) at 37 °C, using an excitation
                                                                    indicates the Fur binding region. Black arrows represent genes. BamHI
wavelength of 480 nm. At the same time OD600 was                    and XbaI cloning sites are shown. It should be noted that the 20 bp
measured and fluorescence was expressed per unit of                  between the XbaI site and the gfp start codon harbor a ribosome
OD600. Fold induction was then expressed as the ratio               binding site (5 0 -AAGAAG-3 0 ) (16).
                                                        A. Aertsen et al. / FEMS Microbiology Letters 245 (2005) 73–77                                 75

3.2. Validation of the stx1-gfp transcriptional fusion                                        was retained thus excluding Q mediated stx expression,
                                                                                              and allowing for immediate Fur mediated derepression
    Under certain stress conditions stx1 expression is                                        of stx1. It can be concluded that the Pstx1 fragment in
governed both by host as well as by prophage encoded                                          pAA310 integrates both host and phage attributed reg-
functions, and by comparing stress-induced expression                                         ulation, and that these effects can be separated in a
of Pstx1 in a wild-type and in an isogenic H-19B lysogen                                      wild-type or lysogenic background.
background, the contribution of host and prophage en-
coded factors can be separated. Indeed, in the presence                                       3.3. Use of the stx1-gfp transcription fusion to study stx1
of millimolar concentrations of EDTA, a chelating                                             expression in E. coli populations
agent sequestering soluble iron and derepressing the
Fur regulon, expression of Pstx1 rapidly increased >2-                                           Opposed to alkaline phosphatase or b-galactosidase
fold both in wild-type as well as in H-19B lysogenized                                        reporter proteins [10,12], the rapid and online non-
cells (Fig. 2(a), compare diamonds and triangles, respec-                                     destructive detection of GFP allows for the visualization
tively), indicating no involvement of prophage encoded                                        of stx1AB expression throughout a population by epi-
factors. On the other hand, when the same strains were                                        fluorescence microscopy or flow cytometry. Monitoring
exposed to mitomycin C, a DNA damaging agent and a                                            stx1AB expression using the latter technique also offers
potent SOS inducer, expression of Pstx1 was induced                                           high sensitivity, since changes in expression can in prin-
only in the lysogenic strain (Fig. 2(b), triangles). This                                     ciple be detected in populations of no more than a few
is in agreement with the fact that the SOS response trig-                                     hundred cells. We applied flow cytometry analysis and
gers the lytic cycle of the H-19B prophage and thus Q                                         observed that under our standard growth conditions in
mediated expression of the late region, including                                             LB medium Pstx1 is constitutively expressed, and this
stx1AB. In the absence of prophage, this cycle cannot                                         expression seems independent from prophage encoded
be initiated and no Q antiterminator protein can be pro-                                      factors, since the presence or absence of H-19B pro-
duced. When comparing the expression of stx1 (trian-                                          phage had little or no influence on Pstx1 expression
gles) and sulA (squares) in Fig. 2(b), a well-known                                           (compare MG1655 wild-type in Fig. 3(a) with its iso-
gene from the SOS regulon, the former shows a lag of                                          genic H-19B lysogen in Fig. 3(b)). This is in agreement
ca. 3 h, indicative of the supplementary time needed to                                       with a recent study by Livny and Friedman [18], who
(i) initiate the prophageÕs lytic cycle by the RecA medi-                                     by a RIVET based reporter approach calculated that
ated cleavage of its CI repressor [5], and (ii) initiate the                                  only ca. 0.005% of H-19B lysogens are spontaneously in-
late stage of the lytic cycle with concomitant Q mediated                                     duced per generation during growth in LB.
expression of stx1AB (measured by Pstx1) [9]. For com-                                           These results indicate, that in the absence of its lytic
parison, upon induction with EDTA, no SOS response                                            development, very little regulation is imposed by the
was triggered (Fig. 2(a), squares), and prophage latency                                      prophage, and stx1AB expression is predominantly


                                                3                                                         7
                                                        (a) EDTA                                                  (b) Mitomycin C

                                                                                                          6

                                                                                                          5
                                                2
                               Fold induction




                                                                                         Fold induction




                                                                                                          4

                                                                                                          3
                                                1
                                                                                                          2

                                                                                                          1

                                                0                                                         0
                                                    0      2       4      6      8                            0       2      4      6       8
                                                          Time after induction (h)                                   Time after induction (h)

Fig. 2. Induction of the Pstx1 promoter, measured as GFP production in MG1655 wild-type (r) and MG1655 H-19B (m) cells during exposure to
(a) 8 mM EDTA or (b) 2 lg/ml mitomycin C. Induction of PsulA (j) in MG1655 serves as a measure of induction of the SOS response. Fold induction
was calculated as the ratio of expression between induced and uninduced cultures of the same strain. Expression was determined as fluorescence
divided by the OD600 of the culture. Means ± standard deviations of four independent experiments are shown.
76                                     A. Aertsen et al. / FEMS Microbiology Letters 245 (2005) 73–77

                                                                         these cases, a population of interest can be transformed
                                                                         with pAA310 and its stx1AB expression as influenced by
                                                                         various environmental conditions can be highlighted
                                                                         from the total population. Moreover, in mixed popula-
                                                                         tions, non-lysogenic strains carrying the probe can be
                                                                         used to report infection by Stx phage, since upon infec-
                                                                         tion and initiation of the lytic cycle in these strains, the
                                                                         Q protein of the invading phage will induce expression
                                                                         from Pstx1.



                                                                         Acknowledgments

                                                                           We acknowledge financial support by research grants
                                                                         OT/01/35 from the K.U. Leuven Research Fund and
                                                                         G.0195.02 from F.W.O. Vlaanderen.



                                                                         References

                                                                          [1] Sandvig, K. (2001) Shiga toxins. Toxicon 39, 1629–1635.
                                                                          [2] Thorpe, C.M. (2004) Shiga toxin-producing Escherichia coli
Fig. 3. Flow cytometry analysis of Pstx1 expression, measured as GFP          infection. Clin. Infect. Dis. 38, 1298–1303.
production in late exponential cultures of (a) MG1655 wild-type,          [3] Unkmeir, A. and Schmidt, H. (2000) Structural analysis of phage-
(b) MG1655 H-19B, and (c) MG1655 Dfur:Kn. The curves each                     borne stx genes and their flanking sequences in shiga toxin-
represent populations of 105 cells. Representative results of four            producing Escherichia coli and Shigella dysenteriae type 1 strains.
independent experiments were shown. Cells containing pFPV25, and              Infect. Immun. 68, 4856–4864.
thus harboring a promoterless gfp gene (negative control) do not          [4] Acheson, D.W., Reidl, J., Zhang, X., Keusch, G.T., Mekalanos,
express GFP and have a mean fluorescence of ca. 2 (data not shown).            J.J. and Waldor, M.K. (1998) In vivo transduction with shiga
                                                                              toxin 1-encoding phage. Infect. Immun. 66, 4496–4498.
                                                                          [5] Kuzminov, A. (1999) Recombinational repair of DNA damage in
                                                                              Escherichia coli and bacteriophage lambda. Microbiol. Mol. Biol.
governed by the hostÕs Fur protein. To examine the im-                        Rev. 63, 751–813.
                                                                          [6] Zhang, X., McDaniel, A.D., Wolf, L.E., Keusch, G.T., Waldor,
pact of the Fur repressor, pAA310 was transformed to
                                                                              M.K. and Acheson, D.W. (2000) Quinolone antibiotics induce
MG1655 Dfur::Kn, and the resulting population was                             Shiga toxin-encoding bacteriophages, toxin production, and death
analyzed by flow cytometry (Fig. 3(c)). As expected, in                        in mice. J. Infect. Dis. 181, 664–670.
the absence of Fur, the Pstx1 expression levels of cells in-              [7] Aertsen, A., Faster, D., Michiels, C.W. Induction of Shiga toxin-
creased significantly (ca. 6-fold; compare Fig. 3(c) with                      converting prophage in Escherichia coli by high hydrostatic
                                                                              pressure. Appl. Environ. Microbiol. 71, 1155–1162.
(a)). Interestingly, during the preparation of this manu-
                                                                          [8] Wagner, P.L., Neely, M.N., Zhang, X., Acheson, D.W., Waldor,
script, it was shown that production of Stx2 from 933W                        M.K. and Friedman, D.I. (2001) Role for a phage promoter in
lysogens is not detectable when its lytic cycle was im-                       Shiga toxin 2 expression from a pathogenic Escherichia coli strain.
paired by replacing the CI repressor with an uncleavable                      J. Bacteriol. 183, 2081–2085.
variant [19]. This is in agreement with our observations                  [9] Wagner, P.L., Livny, J., Neely, M.N., Acheson, D.W., Friedman,
                                                                              D.I. and Waldor, M.K. (2002) Bacteriophage control of Shiga
with stx1AB expression, since the stx2AB regulon en-
                                                                              toxin 1 production and release by coli. Mol. Microbiol. 44, 957–
coded by phage 933W contains no Fur box and is there-                         970.
fore not regulated by the hostÕs iron homeostasis.                       [10] Calderwood, S.B. and Mekalanos, J.J. (1987) Iron regulation of
   Since Shiga toxins comprise an important virulence                         Shiga-like toxin expression in Escherichia coli is mediated by the
trait, understanding the regulation of their expression                       fur locus. J. Bacteriol. 169, 4759–4764.
                                                                         [11] Beutin, L., Zimmermann, S. and Gleier, K. (2002) Evaluation
is of increasing interest and the availability of versatile
                                                                              of the VTEC-Screen Seiken test for detection of different
monitoring methods is crucial. Besides for rapid online                       types of Shiga toxin (verotoxin)-producing Escherichia coli
monitoring of stx1AB expression in pure cultures as                           (STEC) in human stool samples. Diagn. Microbiol. Infect.
demonstrated in this work, the described stx1 gfp tran-                       Dis. 42, 1–8.
scriptional fusion can also be used in more complex set-                 [12] Kimmitt, P.T., Harwood, C.R. and Barer, M.R. (1999) Induction
                                                                              of type 2 Shiga toxin synthesis in Escherichia coli O157 by 4-
tings, in which the quantification of Stx toxin produced
                                                                              quinolones. Lancet 353, 1588–1589.
by a population by immunological or mRNA dependent                       [13] Blattner, F.R., Plunkett III, G., Bloch, C.A., Perna, N.T.,
methods may be biased either by difficult sampling or by                        Burland, V., Riley, M., Collado-Vides, J., Glasner, J.D., Rode,
the presence of other Stx producing populations. In                           C.K., Mayhew, G.F., Gregor, J., Davis, N.W., Kirkpatrick, H.A.,
                                          A. Aertsen et al. / FEMS Microbiology Letters 245 (2005) 73–77                                       77

     Goeden, D.I., Rose, D.J., Mau, B. and Shao, Y. (2004) The                   ible promoters by differential fluorescence induction. Mol.
     complete genome sequence of Escherichia coli K-12. Science 277,             Microbiol. 22, 367–378.
     1453–1474.                                                             [17] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular
[14] Touati, D., Jacques, M., Tardat, B.R., Bouchard, L. and Despied,            Cloning: A Laboratory Manual, second ed. Cold Spring Harbor
     S. (1995) Lethal oxidative damage and mutagenesis are generated             Laboratory Press, Cold Spring Harbor, NY.
     by iron in delta fur mutants of Escherichia coli: protective role of   [18] Livny, J. and Friedman, D.I. (2004) Characterizing spontaneous
     superoxide dismutase. J. Bacteriol 177, 2305–2314.                          induction of Stx encoding phages using a selectable reporter
[15] Aertsen, A., Van Houdt, R., Vanoirbeek, K. and Michiels, C.W.               system. Mol. Microbiol. 51, 1691–1704.
     (2004) An SOS response induced by high pressure in Escherichia         [19] Tyler, J.S., Mills, M.J. and Friedman, D.I. (2004) The operator
     coli. J. Bacteriol. 186, 6133–6141.                                         and early promoter region of the Shiga toxin type 2-encoding
[16] Valdivia, R.H. and Falkow, S. (1996) Bacterial genetics by flow              bacteriophage 933W and control of toxin expression. J. Bacteriol.
     cytometry: rapid isolation of Salmonella typhimurium acid-induc-            186, 7670–7679.
                                               FEMS Microbiology Letters 245 (2005) 79–84
                                                                                                                    www.fems-microbiology.org




Restriction site polymorphisms in the genes encoding new members
    of group 3 outer membrane protein family of Brucella spp.
                                  D. Garcıa-Yoldi a, C.M. Marın b, I. Lopez-Goni
                                         ´                   ´         ´      ˜                               a,*

                              a
                                                             ´               ´
                                Departamento de Microbiologıa y Parasitologıa, Universidad de Navarra, Pamplona, Spain
                 b
                                          ´            ´                         ´                            ´
                     Centro de Investigacion y Tecnologıa Agroalimentaria de Aragon (CITAA), Gobierno de Aragon, Zaragoza, Spain

                           Received 27 August 2004; received in revised form 13 December 2004; accepted 21 February 2005

                                                       First published online 10 March 2005

                                                              Edited by P.W. Andrew




Abstract

   Thirty-seven Brucella reference and field strains representing all the species and their biovars were analysed by PCR–RFLP to
determine the degree of variation in the genes encoding the new members of group 3 outer membrane protein (Omp) family. Anal-
ysis of the omp22 and omp25c/omp25d genes indicated that the restriction patterns were identical for all species and biovars with all
restriction enzymes tested, except for Brucella ovis that showed a short 30 bp deletion close to omp22 gene, and for B. abortus biovar
6 and B. ovis that lacked a DdeI site and a HinfI site, respectively, in the omp25c/omp25d genes. Analysis of PCR products of the
omp31b gene digested with 20 restriction enzymes revealed that this gene has a greater level of DNA polymorphism than the other
genes encoding the new members of group 3 Omp family. A deletion of 232 bp was detected in fourteen B melitensis strains from
different hosts and from different geographic origins, confirming that this feature is indeed a hallmark of B. melitensis. PCR–RFLP
analysis of omp31b with DdeI allowed us to identify species-specific markers for B. abortus, B. melitensis, and B. ovis. Finally, by
PCR analysis, Southern blot hybridization and DNA sequencing we showed that a large deletion of 15 kb, comprising the entire
omp25b gene and 21 more genes, is present in all B. ovis strains, thus confirming previous observations from other authors.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Brucella; DNA polymorphism; Outer membrane proteins




1. Introduction                                                             ceans, and B. pinnipediae, infecting pinnipeds [2]. By an
                                                                            analysis of approximately 25 phenotypic characteristics,
   The genus Brucella consists of six species, designated                   including serological typing for lipopolysaccharide,
on the basis of differences in pathogenicity and host pref-                  phage typing, sensitivity to dyes, requirement for CO2,
erence as Brucella melitensis (goats and sheep), B. abortus                 H2S production and metabolic properties, the genus Bru-
(cattle and bison), B. suis (infecting primarily swine, but                 cella can be classified in species and biovars [3]. However,
also hares, rodents and reindeer), B. ovis (sheep), B. canis                some problems are associated with these tests. Thus, it
(dogs) and B. neotomae (wood rats) [1]. The discovery of                    takes more than one week to culture the bacteria and com-
Brucella bacteria in marine mammals has led to the pro-                     plete the typing, the tests require skilled technicians, and
posal of two additional species: B. cetaceae, infecting ceta-               handling of the microorganism represents a high risk for
                                                                            laboratory personnel since most Brucella strains are
                                                                            highly pathogenic [4]. In an attempt to overcome these dif-
 *
     Corresponding author. Tel.: +34 948 425 600; fax: +34 948 425 649.     ficulties, several techniques have been employed in order
                                         ´
     E-mail address: ilgoni@unav.es (I. Lopez-Goni).
                                                  ˜                         to identify DNA polymorphisms that would enable

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.026
80                                           ´
                                      D. Garcıa-Yoldi et al. / FEMS Microbiology Letters 245 (2005) 79–84

                                                   ´
molecular typing of Brucella (reviewed by Vizcaıno et al.                 have classified these seven Omps in four subgroups based
[5]). In this regard, studies of the restriction fragment                 on their homology at the amino acid level: Omp25,
length polymorphisms (RFLP) of genes coding for the                       Omp22, the Omp25b-Omp25c-Omp25d cluster, and the
outer membrane proteins Omp2a and Omp2b (known                            Omp31-Omp31b subgroup. It has been shown that all
as group 2 Omps with 36–38 kDa), and Omp25 and                            these new members of group 3 Omps are expressed in B.
Omp31 (known as group 3 Omps with 25–31 kDa) have                         suis, B. abortus or B. melitensis [9–11]. In the present
allowed the differentiation between the Brucella species                   study, we have determined, by PCR–RFLP, the existence
and biovars [2,6–8]. Specifically, PCR–RFLP analysis of                    of DNA polymorphisms in the omp22, omp25b, omp25c,
omp25 revealed that B. melitensis strains lack a conserved                omp25d and omp31b genes of 37 Brucella reference and
Eco RV site and B. ovis strains have a 36 bp deletion at the              field strains, including representative strains of all the spe-
3 0 end of the gene [6]. In addition, a large DNA deletion                cies and its biovars.
leading to the loss of the entire omp31 gene has been
shown to be present in all B. abortus strains, and PCR–
RFLP of omp31 revealed specific markers for B. canis,                      2. Materials and methods
B. ovis and B. suis biovar 2 [8].
    Analysis of the completed B. melitensis and B. suis gen-              2.1. Bacterial strains and growth conditions
omes revealed the presence of five new genes homologous
to omp25 and omp31, and indicated the existence of new                      The Brucella strains used in this study are listed in
members of the group 3 Omp family [9]. Salhi et al. [10]                  Table 1. Cultures were grown on Trypticase Soy Agar


Table 1
Brucella strains used in this study
Species                                Biovar                        Straina                                        Host/origin
B. abortus                             1                             2308                                           Bovine/USA
                                       1                             RB51                                           –/USA
                                       1                             45/20                                          Bovine/USA
                                       2                             86/8/59 (ATCC 23449)                           Bovine/UK
                                       3                             Tulya (ATCC 23450)                             Human/Uganda
                                       4                             89.57                                          Bovine/France
                                       5                             B3196 (ATCC 23452)                             Bovine/UK
                                       6                             88.21                                          Bovine/France
                                       9                             C68 (ATCC 23455)                               Bovine/UK
B. melitensis                          1                             16M (ATCC 23456)                               Goat/USA
                                       1                             H38                                            Goat/Mexico
                                       1                             115                                            –
                                       1                             Rev1                                           Goat/USA
                                       1                             1507                                           Goat/Spain
                                       1                             1534                                           Human/Spain
                                       2                             63/9 (ATCC 23457)                              Goat/India
                                       2                             1449                                           Goat/Spain
                                       2                             1461                                           Goat/Spain
                                       2                             1455                                           Human/Spain
                                       3                             Ether (ATCC 23458)                             Human/Italy
                                       3                             1549                                           Human/Spain
                                       3                             1553                                           Bovine/Spain
                                       3                             1559                                           Goat/Spain
B. suis                                1                             78.145                                         Not known
                                       2                             Thomsen1 (ATCC 23445)                          Porcine/Denmark
                                       3                             686 (ATCC 23446)                               Human/USA
                                       4                             87.59                                          not known
                                       5                             ELT80                                          Human/USA
B. ovis                                                              63/290 Bow (ATCC 25840)                        Ovine/Australia
                                                                     Reo198                                         Ovine/USA
                                                                     PA                                             Ovine/France
                                                                     2306                                           Ovine/Spain
                                                                     2206                                           Ovine/France
B.   canis                                                           RM6/66 (ATCC 23365)                            Dog/USA
B.   neotomae                                                        5K33 (ATCC 23459)                              Desert wood rat/USA
B.   pinnipediae                                                     B2/94                                          Seal/Scotland
B.   cetaceae                                                        B14/94                                         Dolphin/Scotland
 a
     ATCC: American type culture collection.
                                           ´
                                    D. Garcıa-Yoldi et al. / FEMS Microbiology Letters 245 (2005) 79–84                                    81

Table 2
Sequences and location of primers used for PCR amplification
Primer                                 Sequence (5 0 –3 0 )                                                              Location codea
22F                                    CGCGCTGATATCGACATGAC                                                              BMEI0717    (omp22)
22R                                    CCCGGCTGTTACATATGCTG                                                              BMEI0717    (omp22)
25cdF                                  CCGCCTGCTGTGTCCTGTTT                                                              BMEI1829    (omp25c)
25cdR                                  GGCCGCGAAATAGACCAGAA                                                              BMEI1830    (omp25d)
25bF1                                  CGGGCCGCTTTTTTACTGTT                                                              BMEI1007    (omp25b)
25bR1                                  GTGCGCCGCCGTTCTAATTC                                                              BMEI1007    (omp25b)
25biF2b                                TCAACTGTCGTTCTCGTTGC                                                              BMEI1007    (omp25b)
25biR2b                                CCTTATGGCCGTAGTCGGTA                                                              BMEI1007    (omp25b)
25bF6c                                 GAGCGTTTATGATCCCGAACTGGTTTCC                                                      BMEI1014
25bR6c                                 GCCGCATACAGGATTGTGATAGATGGTTAC                                                    BMEI0992
31bF                                   CGTCGCCTTCCTGTCATC                                                                BMEI0402    (omp31b)
31bR                                   GCCGCAGTTCAATGATGT                                                                BMEI0402    (omp31b)
wboBF                                  ACCCTCCCTCGAAGTTTGTT                                                              BMEI0997    (wboB)
wboAR                                  CCCGCGCATTAAGAGTAGAC                                                              BMEI0998    (wboA)
 a
   Based on the B. melitensis genome sequence [12,15] (http://serine.urbm.fundp.ac.be/~seqbruce/GENOMES/).
 b
   Primers 25biF2 and 25biR2 were used to amplify a 592 bp internal fragment of B. melitensis 16M omp25b gene, used as probe for Southern blot
analysis.
 c
   Primers 25bF6 and 25bR6 were used to confirm the exact size of the DNA fragment absent in B. ovis. These primers amplify a fragment of about
17.7 kb using B. melitensis 16M DNA and a 2.6 kb fragment on B. ovis Reo 198, which was purified for sequencing.




(Biomerieux) supplemented with 0.5% yeast extract                         teins, and polysaccharides were removed by
(Merck) at 37 °C for 48 h. B. ovis strains were grown                     precipitation with 5 M NaCl and CTAB–NaCl solution
in 10% CO2 on Bacto Blood Agar Base (Difco Lab.,                          and incubated at 65 °C for 10 min. DNA was extracted
Becton Dickinson) supplemented with 5% of sterile                         by a standard protocol with phenol–chloroform–iso-
sheep blood defibrinated (Oxoid Ltd.). B. abortus bio-                     amyl alcohol, precipitated with isopropanol, washed
vars 2, 3 and 4, B. pinnipediae and B. cetaceae were also                 with 70% ethanol and dried. The pellet of DNA was
incubated in a CO2 atmosphere. The strains were typed                     re-dissolved in 50–100 ll of sterile distilled water. PCR
according to standard procedures [3].                                     was performed in a 25 ll volume reaction containing a
                                                                          final concentration of 1· Immolase buffer (Bioline),
2.2. Primer design and DNA sequence analysis                              200 lM of each dNTP, 1 lM of each primer, 1 mM
                                                                          MgCl2, 0.5 U of Immolase DNA polymerase (Bioline)
   Oligonucleotide primers were designed to amplify the                   and 100 ng of genomic DNA. The amplification was
entire omp31b, omp25b, omp25c/omp25d and omp22                            performed in a GeneAmp PCR System 2700 (Perkin–El-
ORFs as well as their adjacent DNA regions (Table 2).                     mer). Cycling conditions were as follows: an initial dena-
B. melitensis genomic DNA sequence information was                        turation step at 95 °C for 7 min, followed by 30 cycles of
obtained from the B. melitensis Genome Database [12]                      95 °C for 35 s, 55–60 °C (depending on the primers) for
developed by the Molecular Biology Research Unit at                       45 s, and 72 °C (60 s per each 1 kb of the amplicon). A
the University of Namur, Belgium (http://ser-                             final extension step was conducted at 72 °C for 6 min.
ine.urbm.fundp.ac.be/~seqbruce/GENOMES/). Primers                         For RFLP analysis, each PCR product (5 ll) was di-
were designed with the Primer3 program [13] (http://fro-                  gested by adding 1 U of the corresponding restriction
do.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi)      and                   enzyme (see Table 3) in a 25 ll reaction volume, follow-
were synthesised by Sigma-Genosys Ltd. Restriction                        ing the manufacturerÕs recommendations (New England
maps were obtained from http://tools.neb.com/NEBcut-                      Biolabs Inc.). Both PCR products and restriction digests
ter2/index.php. DNA sequencing was performed by Sist-                     were separated by electrophoresis (120 V for 1 h) on
           ´
emas Genomicos, Valencia, Spain.                                          agarose gels (0.8–2.5% agarose MS-8, Pronadisa) in
                                                                          TBE buffer (89 mM boric acid, 89 mM Tris–HCl,
2.3. PCR and RFLP analysis                                                2 mM EDTA, pH 8.0). Molecular mass marker 1 Kb
                                                                          plus DNA ladder (Invitrogen) was used as standard.
   Genomic DNA was extracted from pure cultures as                        The gels were stained with ethidium bromide and photo-
described previously [14]. Briefly, cells were resuspended                 graphed on a UV transilluminator Gelprinter Plus (TDI,
in 0.5 ml of TE buffer (10 mM Tris–HCl, 1 mM EDTA,                         Madrid, Spain).
pH 8.0), killed at 80 °C for 15 min, and incubated at                        For PCR amplification of long DNA fragments a
37 °C for 1 h with 0.5% sodium dodecyl sulfate and pro-                   JumpStart REDAccuTaq DNA polymerase (Sigma–
teinase K (200 mg/ml). Cell wall debris, denatured pro-                   Aldrich) was used. Previously, genomic DNA was
82                                          ´
                                     D. Garcıa-Yoldi et al. / FEMS Microbiology Letters 245 (2005) 79–84

Table 3
Restriction patterns of the PCR-amplified genes coding for the new members of group 3 outer membrane protien family of Brucella spp.
Brucella species     Biovar       Strain         Patterns with restriction enzymesa
                                                 omp22b        omp25bc        omp25cdd               omp31b
                                                 DdeI          Hpy188I        DdeI       HinfI       DdeI       BsmI       HinfI       EcoRVe
B. abortus           1            544            P1            P1             P1         P1          P1         P1         P1          P1
                     2            86/8/59        P1            P1             P1         P1          P1         P1         P1          P1
                     3            Tulya          P1            P1             P1         P1          P1         P1         P1          P1
                     4            89.57          P1            P1             P1         P1          P1         P1         P1          P1
                     5            B3196          P1            P1             P1         P1          P1         P1         P1          P1
                     6            88.21          P1            P1             P2         P1          P1         P1         P1          P1
                     9            C68            P1            P1             P1         P1          P1         P1         P1          P1
B. melitensis        1            16M            P1            P1             P1         P1          P2         P2         P2          P2
                     2            63/9           P1            P1             P1         P1          P2         P2         P2          P2
                     3            88.48          P1            P1             P1         P1          P2         P2         P2          P2
B. suis              1            78.145         P1            P1             P1         P1          P4         P1         P1          P1
                     2            Thomsen        P1            P1             P1         P1          P4         P1         P1          P1
                     3            686            P1            P1             P1         P1          P4         P1         P1          P1
                     4            87.59          P1            P1             P1         P1          P4         P1         P1          P1
                     5            ELT80          P1            P1             P1         P1          P4         P1         P1          P1
B.   ovis                         Reo198         P2            Deletedf       P1         P2          P3         P3         P3          P1
B.   canis                        RM6/66         P1            P1             P1         P1          P4         P1         P1          P1
B.   neotomae                     5K33           P1            P2             P1         P1          P4         P1         P1          P1
B.   pinnipediae                  B2/94          P1            P1             P1         P1          P4         P1         P1          P1
B.   cetaceae                     B14/94         P1            P1             P1         P1          P4         P1         P1          P1
 a
   For each restriction enzyme, pattern P1 was assigned to strains showing the same restriction pattern as B. abortus biovar 1.
 b
   A pattern identical to P2 was also obtained in B. ovis with the enzymes BccI, BstXI, BsaJI, EcoRV, Hpy188I, MboII, MmeI, NdeI, RsaI, Sau96I,
SspI and StuI.
 c
   With the exception of B. ovis, only one pattern was obtained with the enzymes BccI, BsmI, DdeI, MmeI, RsaI, and Sau96I.
 d
   Only one pattern was obtained with the enzymes AluI, BccI, BglI, BsaJI, ClaI, EcoRI, EcoRV, FokI, HindIII, Hpy188I, MboII, MmeI, RsaI, and
Sau96I.
 e
   Due to a short deletion in the omp31b gene in B. melitensis strains, two patterns P1 and P2 were also obtained with the enzymes AluI, BamHI,
BglI, BstXI, BsaJI, FokI, HindIII, Hpy 188I, KpnI, MboII, MmeI, NedI, RsaI, SalI, Sau 96I and XhoI.
 f
   The DNA deletion of about 15 kb was also detected in B. ovis 63/290 Bow, PA, 2306 and 2206.




digested with the rare-cutter restriction enzyme XhoI                     by exposure to UV light (70.000 lJ/cm2, Ultraviolet
(Promega). Primers (Table 2) were optimized to amplify                    crosslinker, Amersham Biosciences). Hybridisation and
long DNA sequences (28–30 bases long, 46–50% of GC                        detection reactions were performed using an omp25b
content, and Tm of 69–71 °C). PCR was performed in a                      fragment previously labelled with ECL Direct System
25 ll volume reaction with a final concentration of 1·                     kit (Amersham Biosciences), following the manufac-
REDAccuTaq buffer (Sigma–Aldrich), 500 lM of each                          turerÕs instructions.
dNTP, 1 lM of each primer, 1.25 U of JumpStart
REDAccuTaq DNA polymerase (Sigma–Aldrich) and
100 ng of genomic DNA. Cycling conditions were as fol-                    3. Results and discussion
lows: an initial denaturation step at 96 °C for 30 s, fol-
lowed by 30 cycles of 94 °C for 10 s, 68 °C for 30 s,                        The omp22 and omp25c/omp25d genes were amplified
and 68 °C for 4 min. A final extension step was carried                    with primers 22F–22R and 25cdF–25cdR, respectively
out at 68 °C for 4 min. Prior to DNA sequencing, the                      (Table 2), and then digested with several restriction en-
PCR product was purified using JETquick columns                            zymes (Table 3). On the basis of their restriction pat-
(Genomed GmbH).                                                           terns, a very low degree of DNA polymorphism was
                                                                          observed in the omp22 and omp25c/omp25d genes in all
2.4. Southern blot hybridisation                                          Brucella strains tested. Thus, only two patterns were ob-
                                                                          served in omp22 (Table 3). One pattern was specific of B.
   Southern blot hybridisation was performed according                    ovis and was consistently obtained with DdeI and twelve
to standard techniques. Brucella DNA (2 lg) was di-                       other restriction enzymes. Comparison of this restriction
gested with Eco RV and separated by electrophoresis                       pattern with that inferred from the genome sequence of
on a 1% agarose gel, transferred onto a nylon membrane                    B. melitensis [12,15], suggested that B. ovis has a short
(Hybond–N+, Amersham Biosciences), and immobilised                        deletion of about 30 bp in length. However, since the
                                       ´
                                D. Garcıa-Yoldi et al. / FEMS Microbiology Letters 245 (2005) 79–84                           83

deletion is outside the ORF of omp22 gene, it might not             omp31b in B. melitensis 16M. This short deletion is spe-
affect the synthesis of this protein.                                cific of B. melitensis species and was detected in the four-
   It was previously reported the existence of a high de-           teen B. melitensis strains tested, including six biovar 1,
gree of DNA variation in the two closely related genes              four biovar 2 and four biovar 3, from different hosts
omp2a and omp2b (separated by 900 bp) within the Bru-               and from different geographic origin (Table 2). These re-
cella genus [2,7]. Although genes omp25c and omp25d                 sults confirm that this feature is indeed a hallmark of B.
are also closely related and are separated by only                  melitensis [19]. In addition, our RFLP results show that
257 bp, PCR–RFLP analysis of the fragment that in-                  the omp31b gene displays the highest degree of DNA
cludes both genes, using fourteen different restriction en-          polymorphism of all the genes encoding the new mem-
zymes, revealed an identical restriction pattern in all             bers of group 3 Omp family. Table 3 shows that a single
Brucella strains, except for B. abortus biovar 6 which              PCR–RFLP analysis of the omp31b using DdeI can be
lacked a DdeI site, and B. ovis which lacked a HinfI site           used to distinguish Brucella species. Thus, Brucella spe-
(Table 3).                                                          cies could be classified into four different groups: pattern
   The omp25b gene was amplified by PCR with primers                 1 specific to B. abortus, pattern 2 specific to B. melitensis,
25bF1 and 25bR1. For this amplicon, and with the                    pattern 3 specific to B. ovis, and pattern 4 characteristic
exception of B. ovis, all Brucella strains displayed the            of B. suis, B. canis, B. neotomae, B. pinnipediae and B.
same RFLP pattern (with six restriction enzymes),                   cetaceae.
whereas only B. neotomae showed a different restriction                                                ´
                                                                       As mentioned above, Vizcaıno et al. [19] have re-
pattern with Hpy 188I (Table 3). No amplification was                cently described the DNA polymorphism in the genes
obtained for B. ovis Reo198, suggesting that the omp25b             omp25/omp31 family of Brucella spp. The authors have
gene is absent in this strain. This was verified by South-           determined the nucleotide sequence of genes omp31b,
ern blotting using an internal fragment of B. melitensis            omp25b, omp25c, omp25d and omp22 in the six classical
16M omp25b gene as probe (not shown). Very recently                 Brucella species and in representative strains of B. pinni-
Rajashekara et al. [16], using a whole-genome compari-              pediae and B. cetaceae. They found that these genes are
son of Brucella species by microarray technology, and               quite conserved in the genus Brucella and they reported
      ´
Vizcaıno et al. [19] by nucleotide sequencing, have re-             the existence of few nucleotide differences in each Bru-
ported a specific deletion of about 15 kb in B. ovis,                cella species in comparison with the consensus sequence.
which includes the omp25b gene. By PCR amplification                 However, only one strain of each species was analysed
with primers 25bF6 and 25bR6 and DNA sequencing,                    (with the exception of omp25b gene and B. cetaceae),
and by comparison with the published B. melitensis se-              and it cannot be excluded that these nucleotide differ-
quence [12], we confirmed that this deletion in B. ovis              ences (involving in some cases one or two nucleotides)
corresponds to the region from nucleotide 1035526 (at               were due to sequencing errors. Nevertheless, the obser-
the end of ORF BMEI0993) to nucleotide 1050580 (be-                 vations described in the present study are in agreement
tween BMEI1012 and BMEI1013) of the B. melitensis                   with some of their results.
genome, as has also been shown by Vizcaıno et al.´                     In summary, the most significant observations in the
[19]. In addition, subsequent PCR analysis confirmed                 present study were: (i) the confirmation that the 15 kb
that this deletion is present in four B. ovis strains from          DNA deletion that encompasses the omp25b and the
different geographic origin (strains 63/290, PA, 2306                wboA–wboB genes is a valuable species-specific marker
and 2206).                                                          for B. ovis; (ii) the detection of the short deletion
   According to the annotated B. melitensis genome se-              (232 bp) in omp31b in all B. melitensis tested, confirming
quence, this large deletion in B. ovis also includes the            that it can be used as a species-specific marker; (iii) the
wboA and wboB genes, which are known to be involved                 finding that the omp31b gene shows the highest degree
in the biosynthesis of the O-polysaccharide of the Bru-             of DNA polymorphism; (iv) the very low degree of
cella LPS [17–19]. In order to ascertain whether the                DNA polymorphism detected in omp22 and omp25c/
rough phenotype displayed by B. canis (a natural rough              omp25d; and (v) the finding that B. ovis is the most dis-
species) as well as B. melitensis 115 and B. abortus 45/20          tantly related species of the genus Brucella, confirming
(rough mutant strains derived from smooth-LPS Bru-                  previous conclusions from other authors [16,20]. Fur-
cella species) is caused by the absence of wboA and                 ther studies are necessary to identify new species-specific
wboB, a PCR assay was performed using primers                       DNA sequence variants that may facilitate the identifi-
wboBF and wboAR. A fragment of 2.5 kb was obtained                  cation of Brucella strains.
with the DNA of B. canis, B. melitensis 115 and B. abor-
tus 45/20.
   The omp31b gene was amplified by PCR with primers                 Acknowledgements
31bF and 31bR, and 20 restriction enzymes were used to
study the RFLP patterns of the amplified fragment (Ta-                                                ´
                                                                      We are grateful to G. Martınez de Tejada and J.
ble 3). A deletion of 232 bp was detected in the 5 0 end of         Novo for critical reading of the manuscript and to J.L.
84                                            ´
                                       D. Garcıa-Yoldi et al. / FEMS Microbiology Letters 245 (2005) 79–84

Vizmanos for technical assistance. This work was par-                       [11] Wagner, M.A., Eschenbrenner, M., Horn, T.A., Kraycer, J.A.,
                                  ´
tially supported by Redes Tematicas de Investigacio´n                            Mujer, C.V., Hagius, S., Elzer, P. and DelVecchio, V.G. (2002)
                                                                                 Global analysis of the Brucella melitensis proteome: identification
                                ´
Cooperativa del FIS – Promocion de las Regiones (obje-                           of proteins expressed in laboratory-grown culture. Proteomics 2,
                              ´                 ´
tivo 2, 2000–2006, Red Tematica de Investigacion en                              1047–1060.
Brucellosis, G03/204). Fellowship support to D. Gar-                        [12] De Bolle, X., Lambert, C., Depiereux, E. and Letesson, J.J. (2004)
 ´                      ´n
cıa-Yoldi from Asociacio de Amigos de la Universidad                             A Brucella melitensis genomic database. In: Brucella: Molecular
de Navarra is also gratefully acknowledged.                                                                  ´       ˜                 ´
                                                                                 and Cellular Biology (Lopez-Goni, I. and Moriyon, I., Eds.).
                                                                                 Horizon Bioscience, Norwich, UK, pp. 69–83.
                                                                            [13] Rozen, S. and Skaletsky, H.J. (2000) Primer3 on the WWW for
                                                                                 general users and for biologist programmers In: Bioinformatics
References                                                                       Methods and Protocols: Methods in Molecular Biology (Krawetz,
                                                                                 S. and Misener, S., Eds.), pp. 365–386. Humana Press, Totowa,
 [1] Corbel, M.J. (1997) Brucellosis: an overview. Emerg. Infect. Dis.           NJ.
     3, 213–221.                                                                                                                 ´       ˜
                                                                            [14] Romero, C., Gamazo, C., Pardo, M. and Lopez-Goni, I. (1995)
 [2] Cloeckaert, A., Verger, J.M., Grayon, M., Paquet, J.Y., Garin-              Specific detection of Brucella DNA by PCR. J. Clin. Microbiol.
     Bastuji, B., Foster, G. and Godfroid, J. (2001) Classification of            33, 615–617.
     Brucella spp. isolated from marine mammals by DNA polymor-             [15] DelVecchio, V.G., Kapatral, V., Redkar, R.J., Patra, G., Mujer,
     phism at the omp2 locus. Microbes Infect. 3, 729–738.                       C., Los, T., Ivanova, N., Anderson, I., Bhattacharyya, A.,
 [3] Alton, G.G., Jones, L.M., Angus, R.D. and Verger, J.M. (1988)               Lykidis, A., Reznik, G., Jablonski, L., Larsen, N., DÕSouza, M.,
     Techniques for the Brucellosis Laboratory. Institut National de la          Bernal, A., Mazur, M., Goltsman, E., Selkov, E., Elzer, P.H.,
     Recherche Agronomique, Paris.                                               Hagius, S., OÕCallaghan, D., Letesson, J.J., Haselkorn, R.,
 [4] Young, E.J. (1995) An overview of human brucellosis. Clin.                  Kyrpides, N. and Overbeek, R. (2002) The genome sequence of
     Infect. Dis. 21, 283–289.                                                   the facultative intracellular pathogen Brucella melitensis. Proc.
           ´
 [5] Vizcaıno, N., Cloeckaert, A., Verger, J., Grayon, M. and                    Natl. Acad. Sci. USA 99, 443–448.
          ´
     Fernandez-Lago, L. (2000) DNA polymorphism in the genus                [16] Rajashekara, G., Glasner, J.D., Glover, D.A. and Splitter, G.A.
     Brucella. Microbes Infect. 2, 1089–1100.                                    (2004) Comparative whole-genome hybridization reveals genomic
 [6] Cloeckaert, A., Verger, J.M., Grayon, M. and Grepinet, O. (1995)            islands in Brucella species. J. Bacteriol. 186, 5040–5051.
     Restriction site polymorphism of the genes encoding the major          [17] Mcquiston, J.R., Vemulapalli, R., Inzana, T.J., Schurig, G.G.,
     25 kDa and 36 kDa outer-membrane proteins of Brucella. Micro-               Sriranganathan, N., Fritzinger, D., Hadfield, T.L., Warren, R.A.,
     biology 141, 2111–2121.                                                     Lindler, L.E., Snellings, N., Hoover, D., Halling, S.M. and Boyle,
 [7] Ficht, T.A., Bearden, S.W., Sowa, B.A. and Marquis, H. (1990)               S.M. (1999) Genetic characterization of a Tn5-disrupted glyco-
     Genetic variation at the omp2 porin locus of the brucellae: species-        syltransferase gene homolog in Brucella abortus and its effect on
     specific markers. Mol. Microbiol. 4, 1135–1142.                              lipopolysaccharide composition and virulence. Infect. Immun. 67,
           ´
 [8] Vizcaıno, N., Verger, J.M., Grayon, M., Zygmunt, M.S. and                   3830–3835.
     Cloeckaert, A. (1997) DNA polymorphism at the omp-31 locus                          ´          ´                              ´         ´
                                                                            [18] Moriyon, I., Grillo, M.J., Monreal, D., Gonzalez, D., Marın, C.,
     of Brucella spp.: evidence for a large deletion in Brucella                   ´        ˜
                                                                                 Lopez-Goni, I., Mainar-Jaime, R.C., Moreno, E. and Blasco,
     abortus, and other species-specific markers. Microbiology 143,               J.M. (2004) Rough vaccines in animal brucellosis: structural and
     2913–2921.                                                                  genetic basis and present status. Vet. Res. 35, 1–38.
             ´
 [9] Guzman-Verri, C., Manterola, L., Sola-Landa, A., Parra, A.,                       ´                   ´                                 ´
                                                                            [19] Vizcaıno, N., Caro-Hernandez, P., Cloeckaert, A. and Fernandez-
                                                     ´
     Cloeckaert, A., Garin, J., Gorvel, J.P., Moriyon, I., Moreno, E.            Lago, L. (2004) DNA polymorphism in the omp25/omp31 family
              ´
     and Lopez-Goni, I. (2002) The two-component system BvrR/
                      ˜                                                          of Brucella spp.: identification of a 1.7 kb inversion in Brucella
     BvrS essential for Brucella abortus virulence regulates the                 cetaceae and of a 15.1 kb genomic island, absent from Brucella
     expression of outer membrane proteins with counterparts in                  ovis, related to the synthesis of smooth lipopolysaccharide.
     members of the Rhizobiaceae. Proc. Natl. Acad. Sci. USA 99,                 Microbes Infect. 6, 821–834.
     12375–12380.                                                                      ´                                               ´
                                                                            [20] Vizcaıno, N., Kittelberger, R., Cloeckaert, A., Marın, C.M. and
[10] Salhi, I., Boigegrain, R.A., Machold, J., Weise, C., Cloeckaert, A.              ´
                                                                                 Fernandez-Lago, L. (2001) Minor nucleotide substitutions in the
     and Rouot, B. (2003) Characterization of new members of the                 omp31 gene of Brucella ovis result in antigenic differences in the
     group 3 outer membrane protein family of Brucella spp. Infect.              major outer membrane protein that it encodes compared to those
     Immun. 71, 4326–4332.                                                       of the other Brucella species. Infect. Immun. 69, 7020–7028.
                                               FEMS Microbiology Letters 245 (2005) 85–92
                                                                                                                     www.fems-microbiology.org




      A phylogenetic study of commercial Chinese truffles and their
                     allies: Taxonomic implications
                                                            a,c                        a,*                    b
                                    Li-fang Zhang                 , Zhu L. Yang            ,   D.S. Song
                             a
                              Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650204, Yunnan, China
           b
               Kunming Edible Fungi Institute, ChinaÕs General National Supply and Marketing Cooperative, Kunming 650223, Yunnan, China
                                             c
                                               Graduate School, Chinese Academy of Sciences, Beijing, China

                          Received 19 November 2004; received in revised form 26 January 2005; accepted 22 February 2005

                                                        First published online 18 March 2005

                                                                   Edited by B. Paul




Abstract

   Phylogenetic relationships of commercial Chinese truffles and their allies were investigated mainly by morphological studies and
analyses of the sequences of ITS regions of nuclear ribosomal DNA. Two species, Tuber indicum and T. himalayense, closely related
to the European T. melanosporum (the Perigord Truffle), are recognized among commercial Chinese black truffles. Both T. pseudo-
himalayense and T. sinense should be regarded as synonyms of T. indicum. Tuber species producing excavated ascomata are not
monophyletic, suggesting that excavation of ascomata may have evolved more than once, or evolved once during the evolution
of truffle species and then was lost once during the evolution of Tuber species.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Tuber; Internal transcribed spacer; Systematics; Synonyms



1. Introduction                                                               ing to identify them based on subtle morphological char-
                                                                              acters alone. Previous molecular studies [6–10] have
   Truffles are very renowned and are of high economic                          repeatedly found two main monophyletic groups or hapl-
importance because of their cuisinary value. Although                         otypes (A and B) among the Chinese truffles identified as
the Chinese truffles, resembling Tuber melanosporum Vitt.                       T. indicum. It was unclear whether such a simple, two-part
(the European prized Perigord Truffle), are inferior in                         partitioning was related to differences in populations of
taste and odor, truffles exported from China to Europe                          diverse collecting sites as proposed by Paolocci et al. [7]
have increased dramatically since about 1993 [1]. For a                       or the partitioning reflected repeated misidentifications
long time, commercial Chinese truffles were lumped as                           of several taxa as T. indicum [8]. Another opinion is that
T. indicum Cooke and Massee [2], but in recent years, sev-                    most of the truffles exported from southwestern China
eral new species have been recognized: T. himalayense                         to Europe similar to T. melanosporum and regarded as
Zhang and Minter [3], T. pseudohimalayense Moreno                             T. indicum or T. himalayense were T. sinense, while T.
et al. [4], T. sinense Tao and Liu [5]. The taxa mentioned                    pseudohimalayense was considered to be very similar to
above are similar to each other and it seems to be challeng-                  T. sinense [1]. These controversial views made it worth-
                                                                              while to clarify the taxonomy of commercial Chinese truf-
 *
   Corresponding author. Fax: +86 871 5150227.
                                                                              fles similar to T. melanosporum.
   E-mail addresses: zlyang@public.km.yn.cn, fungi@mail.kib.ac.cn                 T. pseudoexcavatum Wang et al., another newly pub-
(Z.L. Yang).                                                                  lished commercial species from China, is macroscopically

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.028
86                                       L.F. Zhang et al. / FEMS Microbiology Letters 245 (2005) 85–92

similar to T. excavatum Vitt. and T. mesentericum Vitt.                     graphical origins in order to evaluate their relationships,
from Europe [1,11]. These three species are character-                      the interspecific and/or intraspecific divergence in the T.
ized by their deeply excavate ascomata (with an evident                     indicum ‘‘complex,’’ and to propose phylogenetic rela-
basal cavity), but their phylogenetic relationships have                    tionships between T. pseudoexcavatum and phenetically
never been considered.                                                      similar species.
   In this study a phylogenetic investigation of commer-
cial Chinese truffles (including T. indicum, T. hima-
layense, T. pseudohimalayense, T. sinense and T.                            2. Materials and methods
pseudoexcavatum) and their relative taxa was conducted
based both on morphological and molecular analyses.                         2.1. Morphological studies and sample source
Parsimony, likelihood and distance inferences were ap-
plied on a large number of internal transcribed spacer                        Standard techniques were employed [11,12] for
(ITS) sequences of Chinese truffles with different geo-                        macro-morphological and anatomical studies. Types of

Table 1
Taxa included in DNA analysis
Taxon                                             Voucher                Geographic origin                                   GenBank
                                                                                                                             b
Tuber indicum in Group A                          HKAS    39501          Kunming, Yunnan, China under Pinus armandii          AY514305
                                                                                                                             b
                                                  HKAS    39506          Chuxiong, Yunnan, China under Pinus yunnanensis      AY514306
                                                                                                                             b
                                                  HKAS    39515          Kunming, Yunnan, China                               AY514307
                                                                                                                             b
                                                  HKAS    39516          Kunming, Yunnan, China                               AY514308
                                                                                                                             b
                                                  HKAS    39507          Gongshan, Yunnan, China                              AY514309
                                                                                                                             b
                                                  HKAS    38933          Kunming, Yunnan, China under Pinus yunnanensis       AY773357
                                                  –                      Imported from China                                 Y09791
                                                  –                      Imported from China                                 Y09792
                                                  –                      Imported from China                                 AF106881
                                                  –                      Imported from China                                 AF300822
                                                  –                      Imported from China                                 AF300824
                                                  –                      Imported from China                                 U89362
T. indicum in Group B [T. himalayense]a           –                      Huili, Sichuan, China                               AF132502
                                                  –                      Imported from China                                 U89360
                                                  –                      Imported from China                                 AF106882
                                                  –                      Imported from China                                 AF106883
                                                  –                      Imported from China                                 AF300823
                                                  –                      Imported from China                                 AF106884
T.   himalayense [T. indicuma]                    –                      Huidong, Sichuan, China                             AF132503
                                                                                                                             b
T.   himalayense                                  HKAS    25689          Huize, Yunnan, China under Pinus yunnanensis         AY773356
T.   pseudohimalayense? [T. indicuma]             –                      Imported from China                                 U89361
T.   melanosporum                                 –                      Italy                                               AF106873
                                                  –                      Italy                                               AF106874
                                                  –                      Italy                                               AF106875
                                                  –                      Italy                                               AF106876
                                                  –                      Spain                                               AF106877
                                                  –                      France                                              AF106878
                                                  –                      France                                              AF106879
                                                  –                      France                                              AF132501
                                                  –                      Unknown                                             AF167096
                                                  –                      Unknown                                             AF167097
                                                  –                      France or Italy                                     AF300825
                                                  –                      France or Italy                                     AF300826
                                                  –                      France or Italy                                     AF300827
                                                  –                      Unknown                                             U89359
                                                                                                                             b
T.   pseudoexcavatum                              HKAS    39504          Chuxiong, Yunnan, China                              AY514310
T.   excavatum                                    –                      Hungary                                             AJ557545
T.   mesentericum                                 –                      Italy                                               AF106887
T.   brumale                                      –                      Unknown                                             AF106880
                                                  –                      Unknown                                             AF132504
T. brumale f. moschatum                           –                      Unknown                                             AF001010
T. borchii                                        –                      Unknown                                             AF132505
                                                  –                      Unknown                                             AJ557538
                                                  –                      Unknown                                             AJ557536
 a
     Recent epithets denoted within brackets are according to our conclusions.
 b
     Sequences obtained in this study. The others were from GenBank.
                                      L.F. Zhang et al. / FEMS Microbiology Letters 245 (2005) 85–92                          87

T. indicum [K (M) 39493], T. himalayense [K (M) 32236],                 35 cycles of 30 s at 94 °C, 1 min at 52 °C, 1 min at
and the isotype of T. sinense (HMAS 60222) were exam-                   72 °C, and a final extension of 5 min at 72 °C.
ined and morphologically compared with the collections                     Amplified PCR products were purified using the Wat-
sequenced in this study. Over 20 additional specimens                   sonÕs purification kit (Watson, China), followed by eth-
made for this study were examined and were deposited                    anol precipitations. Both DNA strands of amplicons
in the Cryptogamic Herbarium of Kunming Institute                       were sequenced using Dideoxy Chain Termination
of Botany, Chinese Academy of Sciences (HKAS).                          method with an ABI PRISMä Bigdye Terminator cycle
   The samples used for molecular analysis, their geo-                  sequencing kit on an ABI 310 automatic sequencer. The
graphic origin, depository and the GenBank accession                    same primers as described above for PCR were used for
numbers are listed in Table 1. All sequences labeled T.                 the sequencing reactions.
indicum and its allies in GenBank were included in our
study. Sampling localities of T. indicum and T. himalay-                2.3. Alignment and phylogenetic analyses
ense are shown in Fig. 1. The outgroup was T. borchii
Vitt., a white truffle in the genus Tuber. The type of T.                    DNA sequences were edited and aligned with Seq-
indicum and T. himalayense, and the isotype of T. sinense               Man and Megalign (DNASTAR Package), and manu-
were not sequenced in consideration of their poor condi-                ally modified where necessary. Ambiguous regions
tion or in order to minimize sampling from them.                        (characters 24, 41, 51–54, 86–87, 102, 121–123, 146–
                                                                        147, 149, 354, 370–371, 419, 433–434, 474, 491, 493–
2.2. DNA extraction, PCR amplification and sequencing                    494) were excluded from the analyses. Gaps were treated
                                                                        as missing data. All unambiguous characters and char-
   Total DNA was obtained directly from fresh or dried                  acter-transformations were weighted equally. Analyses
specimens using a modified CTAB procedure of Doyle                       of maximum-parsimony (MP), maximum-likelihood
and Doyle [13]. The primers ITS 4 and ITS 5 [14] were                   (ML) and neighbor-joining (NJ) were performed with
used for amplification of the ITS region. Reaction vol-                  PAUP version 4.0b10 [15]. ML model parameters
umes were 20 ll and contained 1.5 U of AmpliTaq                         (Base = equal, Nst = 2, TRatio = 1.8972, Rates = gam-
DNA polymerase (Perkin–Elmer), Replitherm TM buf-                       ma, Shape = 3.3712, Pinvar = 0.3349) were selected by
fer, 1.5 mmol LÀ1 MgCl2, 0.4 mmol LÀ1 dNTP,                             hLRT in Modeltest Version 3.06 [16]. To construct the
0.1 lmol LÀ1 primer, 25–60 ng sample DNA. PCR was                       distance tree with neighbor-joining method we used
performed in a GeneAmp 9600 thermal cycler (Perkin–                     Kimura two-parameter model [17]. Heuristic searches
Elmer, Applied Biosystems). Cycling conditions were                     were performed with these settings: MAXTREES set
set as follows: initial denaturation at 97 °C for 4 min,                to 1000, TBR, zero length branch collapsed, gaps trea-
                                                                        ted as missing. A heuristic search option of 1000 random
                                                                        addition sequence replicates was used for MP, of asis
                                                                        addition sequence for ML. To assess the relative support
                                                                        for each clade, bootstrap values were calculated from
                                                                        1000 (100 for ML tree) replicates analyses.


                                                                        3. Results

                                                                          ITS sequence data of 44 samples were analyzed. The
                                                                        final alignment contained 522 characters of which 25
                                                                        ambiguous characters were excluded.

                                                                        3.1. MP analysis

                                                                           Of the remaining 497 included characters, 194 charac-
                                                                        ters were constant, 67 were variable, and 236 were par-
                                                                        simony-informative. A single MP tree of 670 steps,
                                                                        CI = 0.7657, RI = 0.8910, was found (Fig. 2).
                                                                           The ITS phylogenetic tree indicated that sampled
                                                                        specimens labeled T. indicum were not monophyletic.
                                                                        Two main groups, A and B, can be recognized. Boot-
                                                                        strap support for each group was strong. The ITS region
Fig. 1. Sampling localities of Tuber indicum (black squares) and T.     of group B differed in length from group A by insertion
himalayense (black triangles).                                          of a few base pairs in the ITS 2 (not shown), whereas
88                                       L.F. Zhang et al. / FEMS Microbiology Letters 245 (2005) 85–92


                                                                   100                   T. brumale_AF106880
                                                                                         T. brumale_AF132504
                                                                                         T. brumale f. moschatum_AF001010

                                                                                  T. indicum_*AY514305
                                                                                   T. indicum_*AY514309
                                                                                   T. indicum_*AY514308
                                                                                  T. indicum_*AY514306
                                                                                  T. indicum_*AY773357
                                                                                  T. himalayense_AF132503
                                                                                   T. indicum_AF300824
                                                          Group A                  T. indicum_AF106881
                                            55
                                                                                   T. indicum_U89362
                                                      Tuber indicum                  T. indicum_*AY514307
                                                                            94    T. indicum_Y09791
                                                                                  T. indicum_Y09792
                                                                             85 T. pseudohimalayense?_U89361
                                                                                 T. indicum_AF300822
                                                                                     T. melanosporum_AF106875
                                                                                      T. melanosporum_AF106879
                                                                                     T. melanosporum_U89359
                                                             100                 100 T. melanosporum_AF106873
                                                                                      T. melanosporum_AF106874
                                                                                     T. melanosporum_AF106877
                                                                                      T. melanosporum_AF167096
                             83
                                                                                     T. melanosporum_AF300825
                             1A
                                                                                     T. melanosporum_AF106876
                                                                                      T. melanosporum_AF300826
                                                                            64
                                                                                      T. melanosporum_AF300827
                                                                                      T. melanosporum_AF106878
                                                                                      T. melanosporum_AF132501
                                                                                      T. melanosporum_AF167097
                     100                                                             T. indicum_AF132502
                                                                                     T. himalayense_*AY773356

                                                                Group B          100 T. indicum_U89360
                                                                                     T. indicum_AF106882
                                                          T. himalayense              T. indicum_AF106884
                                                                                     T. indicum_AF300823
                                                                                    T. indicum_AF106883
                                                                T. pseudoexcavatum_*AY514310

                                          98                                     T. excavatum_AJ557545
                             T. borchii_AJ557538                                               T. mesentericum_AF106887
                             T. borchii_AJ557536
                        61      T. borchii_AF132505
                              10 changes

Fig. 2. The single most parsimonious tree generated for the commercial Chinese truffles and their allies based on ITS sequence data. Numbers above
each internode are the percentage of 1000 bootstrap replicates supporting that binary partition (value >50%). GenBank accession number preceded
by an asterisk was obtained in this study.


within a single group sequences were quite homoge-                         vate ascomata, is nested in clade 1A, supported with a
neous (more than 98% nucleotide identity). In group                        bootstrap value of 83%.
A, T. pseudohimalayense together with AF300822
showed a slight difference from the other samples. Tuber                    3.2. ML analysis
brumale Vitt. formed a sister group to the clade compris-
ing groups A, B and T. melanosporum with weak sup-                            The tree (Fig. 3) produced by ML analysis exhibited
port (55%). Relationships among the three highly                           a topology that was somewhat congruent with those
supported groups, A, B and T. melanosporum were not                        from the MP analysis: each of groups A and B was well
resolved. T. excavatum and T. mesentericum constituted                     supported as a monophyletic group. Subtle differences
a highly supported monophyletic group (boot-                               between the ML and MP topologies were not
strap = 98%), while T. pseudoexcavatum, also with exca-                    supported.
                                          L.F. Zhang et al. / FEMS Microbiology Letters 245 (2005) 85–92                                    89

                                                           T. brumale_AF106880
                                              100
                                                           T. brumale_AF132504
                                                           T. brumale f. moschatum_AF001010
                                                     T. pseudoexcavatum_*AY514310
                                                         T. indicum_*AY514305
                                                         T. indicum_*AY514309
                                                          T. indicum_*AY514308
                                                         T. indicum_*AY514306
                                                         T. himalayense_AF132503
                                                         T. indicum_*AY773357
                                                         T. indicum_AF300824
                                                                                         Group A
                                                         T. indicum_AF106881             Tuber indicum
                                                          T. indicum_U89362
                                                          T. indicum_*AY514307

                                                 89 T. indicum_Y09791
                                                         T. indicum_Y09792
                                                         T. pseudohimalayense?_U89361
                                                         T. indicum_AF300822
                                                         T. himalayense_*AY773356
                                                         T. indicum_AF132502
                                                         T. indicum_U89360
                                                    91 T. indicum_AF106882          Group B
                                                         T. indicum_AF106884        T. himalayense
                                         53
                                                         T. indicum_AF300823
                                                          T. indicum_AF106883
                                                         T. melanosporum_AF106875
                        100                              T. melanosporum_AF106879

                                                    97
                                                         T. melanosporum_U89359
                                                         T. melanosporum_AF106873
                                                         T. melanosporum_AF106874
                                                         T. melanosporum_AF106877
                                                         T. melanosporum_AF167096
                                                         T. melanosporum_AF300825
                                                         T. melanosporum_AF106876
                                                         T. melanosporum_AF300826
                                                         T. melanosporum_AF300827
                                                         T. melanosporum_AF106878
                                                         T. melanosporum_AF132501
                                                         T. melanosporum_AF167097
                                                            T. excavatum_AJ557545
                                                                                                   T. mesentericum_AF106887
                                         T. borchii_AJ557538
                                         T. borchii_AJ557536
                                          T. borchii_AF132505
                              0.05 substitutions/site

Fig. 3. The most likelihood tree generated for the commercial Chinese truffles and their allies based on ITS sequence data. Numbers above each
internode are the percentage of 100 bootstrap replicates supporting that binary partition (value >50%). GenBank accession number preceded by an
asterisk was obtained in this study.




3.3. NJ analysis                                                                   unclear. In this study, over 20 collections of the T. indi-
                                                                                   cum complex including the types of T. indicum and T.
   NJ analysis yielded a topology (not shown) that was                             himalayense, and the isotype of T. sinense were exam-
similar to those from the ML and MP analyses.                                      ined. In the light of the molecular phylogenetic analyses
                                                                                   and given the hypothesis that the distinctly separated
3.4. Taxonomic implications                                                        clades in the trees produced from these analyses repre-
                                                                                   sent a single species each, one is driven to the conclusion
   The original descriptions of T. indicum, T. himalay-                            that morphologies of all species mentioned above are
ense, T. pseudohimalayense and T. sinense were usually                             variable. Past attempts at distinguishing the taxa have
based on a single collection, i.e., the type, or few collec-                       not been successful because the complexity of the situa-
tions. Thus morphological variation within a species was                           tion was not taken into account. The size and form of
90                                     L.F. Zhang et al. / FEMS Microbiology Letters 245 (2005) 85–92

Table 2
Morphological characters of commercial Chinese species of Tuber recognized in this study
Taxon                   Peridium surface                                        Ascospore ornamentations
Tuber indicum           With pyramidal warts, sometimes warts less              Mostly partially reticulate, sometimes spiny, rarely alveolate but no
                        regular, thin, acuate, rarely wide and very coarse      crater-like structure at sporal poles
T. himalayense          With polygonal shallow splits and flattened warts        Alveolate, often forming a crater-like structure at one or both
                                                                                sporal poles
T. pseudoexcavatum      With small verrucous warts, ascomata deeply             Spinoreticulatae (spines usually with broad basal connections)
                        excavate




the ascomata, the asci and even the ascospores are rela-                     Thus, the morphological and molecular differences
tively variable from collection to collection and cannot                     between the two groups do not appear to relate to
be used alone as morphological characters with which                         geographical distributions.
to separate species. Within a given species, variations                          Is the diversity due to ectomycorrhizal host-specific-
in the ornamentation of the surfaces of peridia and                          ity? Although the voucher collections for sequences
ascospores are also present. Examination of the mor-                         AY514305, AY514306 and AY773357 in group A were
phology of the taxa of concerned strongly supported                          collected in forests dominated by different species of
the hypothesis based on the molecular data analysis.                         Pinus, they showed no differences in ITS sequences.
Morphological character states of the isotype of T. sin-                     Conversely, the vouchers for sequences AY514306,
ense are within the ranges of variation of the same states                   AY773357 and AY773356 were all collected in forests
in T. indicum, and that the ranges of states of morpho-                      dominated by P. yunnanensis; and they did not cluster
logical characters in T. indicum and T. pseudohimalay-                       in the same group. It seems there is no strict host-
ense overlap.                                                                specificity between the truffles and the trees.
   On the other hand, morphological characters of the                            Our data suggest that the two groups, A and B, are
surface of the peridium in combination with the forms                        closely related but separate species, if T. melanosporum
of the ornamentations of the ascospores appear to be                         is recognized. Then the question is: what is the correct
useful tools for determining the taxonomy of the T. indi-                    scientific name corresponding to each group? Roux et
cum complex. Unique morphological characters for                             al. [8] suggested sequences in group A could belong to
commercial Chinese truffles recognized in this study                           species like T. himalayense and T. pseudohimalayense
are summarized in Table 2.                                                   while those in group B should be T. indicum. Our mor-
                                                                             phological comparative studies of the types of T. indi-
                                                                             cum [K (M) 39493] and T. himalayense [K (M) 32236],
4. Discussion                                                                and the specimens sequenced in this study and other col-
                                                                             lections kept in HKAS lead to a different conclusion,
4.1. Phylogeny and taxonomy of the complex of                                i.e., that the isolates in group A are T. indicum and those
T. indicum                                                                   in group B are T. himalayense. This conclusion was
                                                                             based on the following considerations. First, the sample
   Two main groups can be consistently identified with-                       of AY773356 in group B is identical with the type of T.
in the commercial Chinese truffles that closely resemble                       himalayense in the key characters separating T. himalay-
T. melanosporum in all analyses, which conforms to the                       ense from T. indicum: the surface of the peridium only
observations of other studies [6–10].                                        with polygonal shallow splits and flattened warts (that
   Paolocci et al. [7] proposed different geographical ori-                   of T. indicum usually has distinct pyramidal warts), like
gins for groups A and B. However, as showed in Table 1                       a parched riverbed (see Figs. 9–10 in Zhang and Minter
and Fig. 1, our samples in group A were collected from                       [3]), and the ornamentations of the ascospores include a
diverse locations and exhibit minimal variation of their                     crater-like structure at one or both sporal poles, a un-
ITS sequences. For example, samples yielding sequences                       ique form of ornamentation in the taxa studied (see
AY514305, AY514308 and AY773357 were from Kun-                               Fig. 14 in Zhang and Minter [3], Fig. 3 in Moreno et
ming, while AY514306 and AY514309 were extracted                             al. [4]). Second, our samples in group A resemble the
from material from Chuxiong and Gongshan, respec-                            type of T. indicum in macro- and micromorphology
tively, but their ITS sequences are identical. On the con-                   and none of them possess both characters unique to
trary, some samples collected in closer proximity                            T. himalayense.
showed consistent genetic differences. For instance, the                          It is worth emphasizing again that there are varia-
samples made from Huili (AY132502) and Huize                                 tions in the ornamentations of the peridium and ascosp-
(AY773356) differ from the sample AY132503 collected                          ores among collections of a single species. Some of
from Huidong, a locality between the first two places.                        our samples of T. indicum (such as the vouchers for
                                  L.F. Zhang et al. / FEMS Microbiology Letters 245 (2005) 85–92                             91

sequences AY514305 and AY514308), have less regular,                4.2. Phylogenetic relationships among the species with
thin, acuate pyramidal warts while some (such as the                excavate ascomata
voucher for sequence AY514307 and HKAS 44318),
possess wide, coarsely pyramidal warts, but none of                    The three species, T. excavatum, T. mesentericum and
them are as flat as those in T. himalayense. The spines              T. pseudoexcavatum, which have excavated ascomata,
of the ascospores of the holotype of T. indicum are al-             did not group together in any of the analyses. The ITS
most free or sometimes connected by low ridges at-                  lineages within Tuber were not well supported by asco-
tached to the very base of the spines, while the                    ma excavation. Thus, the ‘‘ascoma with orifice or cav-
ascospores of most of our samples of T. indicum show                ity’’ may have evolved more than once; or if it evolved
partial reticulation (pseudoreticulum) by anastomosis               only once, then it was lost once during the evolution
of the broad bases of a few spines (also see Yamanaka               of Tuber species. The homoplasy of ‘‘ascoma with orifice
et al. [18]). An extreme case is the ornamentations of              or cavity’’ indicates that this character lacks phyloge-
the ascospores in the sample of AY773357, which are                 netic information at higher taxonomic levels, such as
alveolate; but the crater-like structures of T. himalayense         at the rank of section. It should not be used alone in sep-
spores are absent; and the surface of the voucherÕs perid-          arating taxa. However, this does not decrease the value
ium is coarsely pyramidally warted.                                 of this character in distinguishing T. pseudoexcavatum
    Although the ascospore ornamentation of our vou-                among commercial Chinese truffles.
cher for sequence AY773357 comprises spines with
broad basal connections that form a distinct reticulum,             4.3. Concluding remarks
which is very similar to that described in the protologue
for T. pseudohimalayense [4], the voucher strongly                      A molecular phylogenetic investigation of commer-
resembles T. indicum in ITS sequence and other mor-                 cial Chinese truffles and their relatives was conducted
phological characters. Because the morphological differ-             in combination with morphological studies. It illus-
ences between T. indicum and T. pseudohimalayense are               trates that two groups of commercial Chinese truffles
overlapping, we suppose T. pseudohimalayense, whose                 macroscopically similar to T. melanosporum corre-
type is unfortunately unavailable for our analysis, is              spond to two closely related but separate species,
probably conspecific with T. indicum. Thus, sequence                 i.e., T. indicum and T. himalayense. It is also shown
U89361 , which has been supposed to be T. pseudohima-               that Tuber species producing excavated ascomata are
layense, is very likely to be T. indicum.                           not monophyletic.
    The ITS sequence AF132503 from GenBank ex-
tracted from material determined as T. himalayense [8]
is nested in the clade of T. indicum, which suggests that           Acknowledgments
the voucher for AF132503 has been misidentified and is
in fact T. indicum.                                                    We would like to thank the curators of HMAS and
    Wang and Hall [1] suggested that most of the truf-              K for loaning the types or isotype of Tuber species;
fles similar to T. melanosporum and exported from                    the staff at the Laboratory of Plant Biodiversity and
southwestern China to Europe were T. sinense. We                    Biogeography of Kunming Institute of Botany for
have restudied the isotype of T. sinense (HMAS                      assisting us with technical issues; Dr. A. Rubini, Isti-
60222), which was mentioned by Zhang [12]. Only half                tuto di Ricerche sul Miglioramento Genetico delle
an immature ascoma is preserved. Its peridium pos-                  Piante Foraggere, for presenting his Ph.D. dissertation
sesses pyramidal warts, and spines of its ascospores                and some valuable literature to us; Dr. Yun Wang,
are somewhat connected by broken lines but without                  New Zealand Institute for Crop and Food Research,
the unique ornamentation of T. himalayense. Since                   Ltd. for his discussing truffle systematics with us;
the macro-morphological and anatomical characters                   Dr. P.B. Matheny, Clark University, Dr. R.E. Tulloss,
of the isotype can be covered within the variation                  the New York Botanical Garden, Ms. Juan Chen and
range of T. indicum (Table 2.), T. sinense is probably              Ms. Xiang-Hua Wang, Kunming Institute of Botany,
a synonym of T. indicum.                                            and Dr. L.A. Glacy, Sonoma State University, for giv-
    T. indicum and T. himalayense, which only occur in              ing us salutary comments on earlier versions of the
Asia, have a close relationship with T. melanosporum,               manuscript; and Dr. K. Hansen, Harvard University
which only occurs in Europe. They probably share a                  Herbaria for critically reviewing the paper. We
common origin, as suggested in a recent study based                 acknowledge the support provided by a Special Fund
on southern and dot-blot hybridization [19]. Because                of Life Science of CAS supported by the Ministry of
the lengths of the branches that link them are so short,            Finance (No. STZ-01-14), a key project of the Knowl-
it is conceivable that the diversification and differentia-           edge Innovation Program of the Chinese Academy of
tion among T. indicum, T. himalayense and T. melano-                Sciences (No. KSCX2-SW-101C) and the National
sporum occurred within a relatively short time.                     Natural Science Foundation of China (No. 30470010).
92                                       L.F. Zhang et al. / FEMS Microbiology Letters 245 (2005) 85–92

References                                                                        black truffle (Tuber indicum) in commercialized products: fruiting
                                                                                  bodies and mycorrhizal seedlings. Mycorrhiza 11, 89–94.
 [1] Wang, Y., and Hall, L.R., (1999) Tuber sinense and other Tuber        [11]                                                    ´
                                                                                  Wang, Y., Moreno, G., Riousset, L.J., Manjon, J.L., Riousset,
     species from south-west China. In: Abstracts of Vth International                       ´
                                                                                  G., Fourre, G., Massimo, G., Di, Garcı     ´a-Montero, L.G. and
     Congress Science and Cultivation of Truffle, 4–6 March 1999                      ´
                                                                                  Dıez, J. (1998) Tuber pseudoexcavatum sp. nov. a new species
        ´ ´
     (Federation Francaise des Trufficultures, (Ed.), pp. 115–116. Aix-             from China commercialized in Spain, France and Italy with
     en-Provence, France.                                                         additional comments on Chinese truffles. Cryptogamie. Mycol.
 [2] Cooke, M.C. and Massee, G. (1892) Himalayan truffles. Grevillea                19, 113–120.
     20, 67.                                                               [12]   Zhang, B.C. (1990) Systematics of hypogeous Pezizales and
 [3] Zhang, B.C. and Minter, D.W. (1988) Tuber himalayense sp nov                 taxonomy of the Chinese genera and species, 130pp. PhD
     with notes on Himalayan truffles. Tran. Br. Mycol. Soc. 91, 593–               Dissertation. Institute of Microbiology, the Chinese Academy of
     597.                                                                         Sciences, China.
                         ´          ´
 [4] Moreno, G., Manjon, J.L., Dıez, J., Garcı  ´a-Montero, L.G. and       [13]   Doyle, J.J. and Doyle, J.L. (1987) A rapid DNA isolation
     Massimo, G.Di. (1997) Tuber pseudohimalayense sp. nov. an                    procedure for small quantities of fresh leaf material. Phytochem.
     Asiatic species commercialized in Spain similar to the ‘‘Perigord’’          Bull. 19, 11–15.
     truffle. Mycotaxon 63, 217–224.                                         [14]   White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification
 [5] Tao, K. and Liu, B. (1989) A new species of the genus Tuber from             and direct sequencing of fungal ribosomal RNA genes for
     China. J. Shanxi Univ. (Nat. Sci. Ed.) 12, 215–218.                          phylogenetics In: PCR Protocols: a Guide to Methods and
                             ´
 [6] Gandeboeuf, D., Dupre, C., Roeckel-Drevet, P., Nicolas, P. and               Applications (Innis, M.A., Gelfand, D.H., Sninsky, J. and White,
     Chevalier, G. (1997) Grouping and identification of Tuber species             T.J., Eds.), pp. 315–322. Academic Press, USA.
     using RAPD markers. Can. J. Bot. 75, 36–45.                           [15]   Swofford, D.L. (2003) PAUP*: Phylogenetic Analysis Using
 [7] Paolocci, F., Rubini, A., Granetti, B. and Arcioni, S. (1997)                Parsimony (and Other Methods), Version 4.0b 10. Sinauer
     Typing Tuber melanosporum and Chinese black truffle species by                 Associates, Sunderland, Massachusetts.
     molecular markers. FEMS Microbiol. Lett. 153, 255–260.                [16]   Posada, D. and Crandall, K.A. (1998) Modeltest: testing the
                  ´
 [8] Roux, C., Sejalon-Delmas, N., Martins, M., Parguey-Leduc, A.,                model of DNA substitution. Bioinformatics 14, 817–818.
                           ´
     Dargent, R. and Becard, G. (1999) Phylogenetic relationships          [17]   Kimura, M. (1980) A simple method for estimating evolutionary
     between European and Chinese truffles based on parsimony and                   rates of base substitutions through comparative studies of
     distance analysis of ITS sequences. FEMS Microbiol. Lett. 180,               nucleotide sequences. J. Mol. Evol. 16, 111–120.
     147–155.                                                              [18]   Yamanaka, K., Namba, K. and Nakanishi, J. (2000) Morpho-
 [9] Longato, S. and Bonfante, P. (1997) Molecular identification of               logical characteristics of Chinese black truffle in Yunnan Prov-
     mycorrihizal fungi by direct amplification of microsatellite                  ince. Nihon Kin Gakkai Kaiho 41, 79–84.
     regions. Mycol. Res. 101, 425–432.                                    [19]   Paolocci, F., Rubini, A., Riccioni, C., Granetti, B. and Arcioni, S.
                       ´
[10] Mabru, D., Dupre, C., Douet, J.P., Leroy, P., Ravel, C., Ricard,             (2000) Cloning and characterization of two repeated sequences in
              ´
     J.M., Medina, B., Castroviejo, M. and Chevalier, G. (2001) Rapid             the symbiotic fungus Tuber melanosporum Vitt. FEMS Microbiol.
     molecular typing method for the reliable detection of Asiatic                Ecol. 34, 139–146.
                                             FEMS Microbiology Letters 245 (2005) 93–98
                                                                                                                   www.fems-microbiology.org




            CTX-M and SHV-12 b-lactamases are the most common
        extended-spectrum enzymes in clinical isolates of Escherichia coli
         and Klebsiella pneumoniae collected from 3 university hospitals
                                 within Korea
         Jungmin Kim a,*,1, Yu-Mi Lim a, Insoo Rheem b, Yeonhee Lee c, Je-Chul Lee d,
                    Sung-Yong Seol d, Yu-Chul Lee d, Dong-Taek Cho d
a
    Department of Microbiology, Dankook University College of Medicine, San-29, Anseo-dong, Chonan City, Choongnam 330-715, Republic of Korea
                 b
                   Department of Laboratory Medicine, Dankook University College of Medicine, San-29, Anseo-dong, Chonan City,
                                                       Choongnam 330-715, Republic of Korea
       c
         Department of Biology and Culture Collection of Antimicrobial Resistant Microbes, Seoul WomenÕs University, Seoul, Republic of Korea
                    d
                      Department of Microbiology School of Medicine, Kyungpook National University, Daegu, Republic of Korea

                          Received 2 October 2004; received in revised form 5 January 2005; accepted 22 February 2005

                                                     First published online 12 March 2005

                                                            Edited by R.A. Bonomo




Abstract

   Among the 443 clinical isolates of Escherichia coli and Klebsiella spp. collected between June and November 2003 from 3
university hospitals in Korea, 62 isolates were confirmed as extended-spectrum b-lactamase (ESBL)- or plasmid-mediated AmpC b-
lactamase-producers by double disk synergy test, PCR and sequencing for b-lactamase genes. The most frequently identified ESBL
gene among E. coli and K. pneumoniae isolates was blaSHV-12 and blaCTX-M (blaCTX-M-9, blaCTX-M-14, blaCTX-M-3, and blaCTX-M-15).
Four kinds of plasmid-mediated AmpC b-lactamases, ACT-1, CMY-1, CMY-2, and DHA-1, were detected. ESBL production was
associated with high levels of resistance to tetracycline, sulfisoxazole, streptomycin, kanamycin, gentamicin and tobramycin when
compared to non-ESBL producing isolates. Conclusively, this study suggests that the CTX-M b-lactamases are prevalent and var-
ious kinds of plasmid-mediated AmpC enzymes are distributed in clinical isolates of E. coli and Klebsiella spp. in Korea.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: CTX-M ESBL; SHV-12; Escherichia coli; Klebsiella pneumoniae; Korea



1. Introduction                                                            and caused the crisis of antimicrobial drug resistance.
                                                                           ESBLs are usually described as acquired b-lactamases
   The evolution and dissemination of extended-spec-                       that are encoded mostly by plasmid-located genes, lead-
trum b-lactamases (ESBL) have compromised the clini-                       ing to the complex and dynamic evolution and epidemi-
cal use of third-generation cephalosporins worldwide                       ology of ESBLs. The number of ESBL variants
                                                                           identified has been constantly growing and more than
    *
                                                                           100 different ESBL variants are known at present
   Corresponding author. Tel.: +82 53 420 4845; fax: +82 53 427 5664.
   E-mail address: minkim@dankook.ac.kr (J. Kim).
                                                                           (http://www.lahey.org/studies/webt.htm). Most ESBLs
 1
   Present address: Department of Microbiology, Kyungpook                  are derivatives of TEM-1, TEM-2, or SHV-1 enzymes;
National University School of Medicine, Daegu, Republic of Korea.          however, reports describing the emergence of b-lactamases

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.029
94                                         J. Kim et al. / FEMS Microbiology Letters 245 (2005) 93–98

belong to other families, such as PER, VEB, CTX-M                          ing isolates, strains for which the cefotaxime MIC
and/or OXA derivatives, are increasing worldwide [1–5].                    was P2 mg lÀ1 were subjected to the double-disk syn-
   Among gram-negative pathogens in Korea, the inci-                       ergy test with cefotaxime, ceftazidime, aztreonam, cefe-
dence of resistance to extended-spectrum b-lactam anti-                    pime, and amoxicillin-clavulanic acid disks (Oxoid,
biotics is becoming an ever-increasing problem and                         Basingstoke, United Kingdom) as described previously
rapid increase in ESBL-producing Escherichia coli and                      [8]. The disks were placed 20 mm apart (from center to
Klebsiella pneumoniae has been reported [6–9].                             center); for selected isolates the test was repeated with
Although, the most commonly identified ESBLs in                             the distance reduced to 15 mm.
Korea are TEM-52, SHV-2a and SHV-12 [6–9], recent
report suggests dissemination of CTX-M-14 in Korea
                                                                           2.2. Antimicrobial susceptibility tests
[10]. Indeed, we here report the dissemination of CTX-
M enzymes, such as CTX-M-3, CTX-M-9, CTX-M-15,
                                                                              Minimal inhibitory concentrations (MICs) were
and CTX-M-14, among the isolates of E. coli and Kleb-
                                                                           measured using a standard agar dilution method
siella spp. collected in 2003 from 3 university hospitals
                                                                           according to the approved method of the National
located in different cities of Korea. We also report on
                                                                           Committee for Clinical Laboratory Standards [12]. E.
the first identification of ACT-1 and CMY-2, plasmid-
                                                                           coli ATCC 25922 was used as a quality reference
mediated AmpC b-lactamases, from the isolates of
                                                                           strain. The antimicrobial agents included were ampicil-
E. coli in Korea.
                                                                           lin, cefoxitin, cefotaxime, kanamycin, tobramycin, gen-
                                                                           tamicin, amikacin, sulfisoxazole, chloramphenicol,
                                                                           streptomycin, tetracycline, and trimethoprim (all from
2. Materials and methods
                                                                           Sigma).
2.1. Clinical isolates
                                                                           2.3. PCR amplification and nucleotide sequencing
   Consecutive non-duplicate nosocomial isolates of
E. coli, K. oxytoca, and K. pneumoniae were collected                         PCR was performed to detect b-lactamase genes with
between June and November 2003 from 3 university                           primers shown in Table 1. PCRs were performed with 30
hospitals located in 3 different cities in Korea. Species                   cycles of denaturation for 1 min at 95 °C, annealing for
identification was carried out with VITEK-GNI                               1 min at 50 °C for TEM, CTX-M-9 and DHA-1, and
                ´
CARDS (bioMerieux Vitek Inc., Hazelwood, Mo.) by                           55 °C for SHV, CTX-M-3 and OXA, respectively, and
standard methods [11]. For selection of ESBL-produc-                       1 min at 72 °C for polymerization. Final products were


Table 1
Oligonucleotide primers used for detection of b-lactamase genes
Primers            Tma (°C)      Nucleotide sequences                              References (GenBank No.)   Expected amplicon size (bp)
                                  0                                         0
CTX-M-9-S          50            5 -TAT TGG GAG TTT GAG ATG GT-3                   AF4546633.2; 742–761        932
CTX-M-9-AS                       5 0 -TCC TTC AAC TCA GCA AAA GT-3 0               AF4546633.2; 1655–1674
CTX-M-3-S          55            5 0 -CGT CAC GCT GTT GTT AGG AA-3 0               AJ632119.1; 180–209         780
CTX-M-3-AS                       5 0 -ACG GCT TTC TGC CTT AGG TT-3 0               AJ632119.1; 941–960
TEM-S              50            5 0 -ATA AAA TTC TTG AAG ACG AAA-3 0              AB103506; 166–186          1080
TEM-AS                           5 0 -GAC AGT TAC CAA TGC TTA ATC-3 0              AB103506; 1225–1245
SHV-S              55            5 0 -TGG TTA TGC GTT ATA TTC GCC-3 0              AY223863; 166–186           865
SHV-AS                           5 0 -GGT TAG CGT TGC CAG TGC T-3 0                AY223863; 1015–1031
OXA-1-S            55            5 0 -AGC CGT TAA AAT TAA GCC C-3 0                AV162283.2; 1052–1070       908
OXA-1-AS                         5 0 -CTT GAT TGA AGG GTT GGG CG-3 0               AV162283.2; 1941–1960
CMY-1-S            60            5 0 -GAG CAG ACC CTG TTC GAG AT-3 0               X92508; 570–589             846
CMY-1-AS                         5 0 -GAT TGG CCA GCA TGA CGA TG-3 0               X92508; 1397–1416
CMY-2-S            60            5 0 -TGGCCAGAACTGACAGGCAAA-3 0                    X78117; 478–498             462
CMY-2-AS                         5 0 -TTTCTCCTGAACGTGGCTGGC-3 0                    X78117; 919–939
ACT-1-S            50            5 0 -AAACCTGTCACTCCACAAAC-3 0                     U58495; 244–264             887
ACT-1-AS                         5 0 -GGGTTCGGATAGCTTTTATT-3 0                     U58495; 1111–1130
DHA-1-S            50            5 0 -GTT ACT CAC ACA CGG AAG GT-3 0               AY205600; 75–94             869
DHA-1-AS                         5 0 -TTT TAT AGT AGC GGG TCT GG-3 0               AY205600; 925–944
 a
     Annealing temperature used for PCR.
                                   J. Kim et al. / FEMS Microbiology Letters 245 (2005) 93–98                                                                                                                                                                                                                                                                  95

extended by incubation for 10 min at 72 °C. Amplified




                                                                                                                                                                                                                                                                                                         TEM-1/SHV-12/CTX-M-3/DHA-1/OXA-30 (1)
PCR products were sequenced on both strands.
Sequencing was carried out with the Taq DyeDeoxyTer-




                                                                                                                                                                                                                                                                                                         SHV-12/CTX-M-3/DHA-1/OXA-30 (1)
minal cycle-sequencing kit using primers used for PCR
and the sequence was analyzed in an automatic DNA se-




                                                                                                                                                                                                                                                        CTX-M-3/OXA-30/CMY-1(1)




                                                                                                                                                                                                                                                                                                         TEM-52/SHV-12/OXA-30 (1)
                                                                                                                                                                                                                                                                                                         TEM-54/SHV-12/DHA-1(2)
quencer (377 ABI Prism, Perkin Elmer). DNA sequence
analysis was performed with DNASIS for Windows




                                                                                                                                                                                                                                                                                                         SHV-12/CTX-M-14 (4)
                                                                                                                                                                                                                                                        SHV-12/CTX-M-9 (1)




                                                                                                                                                                                                                                                                                                         TEM-52/SHV-12 (1)


                                                                                                                                                                                                                                                                                                         TEM-52/SHV-12 (1)
(Hitachi Software Engineering America Ltd., San Bru-




                                                                                                                                                                                                                                                                                                         SHV-12/DHA-1(2)
no, CA). Database similarity searches for both the




                                                                                                                                                                                                                                          Mixed ESBLs
nucleotide sequences and deduced protein sequences




                                                                                                                                                                                                                                                                                                                                                 15 (24.2)
were performed with BLAST at the National Center
for Biotechnology Information website.




                                                                                                                                                                                                                                                                                                         TEM-1/SHV-1/OXA-30/CMY-1(1)
3. Results

   Between June and November 2003, 443 isolates




                                                                                                                                                                                                                                                        TEM-1/ CMY-2 (6)
including 272 of E. coli, 13 of K. oxytoca, and 158 of




                                                                                                                                                                                                                                                                                                         TEM-1/DHA-1(1)
K. pneumoniae were collected from 3 university hospitals
in Korea. Among them, 87 isolates revealed P2 mg lÀ1




                                                                                                                                                                                                                                                        ACT-1 (1)




                                                                                                                                                                                                                                                                                                                                                 9 (14.5)
of MIC against cefotaxime and they were subjected to


                                                                                                                                                                                                                                          AmpC
the double disk synergy test (DDST), PCR of b-lacta-
mase genes, and subsequent sequencing of amplified b-




                                                                                                                                                                                                                                                        TEM-54/CTX-M-15/OXA-30 (3)
lactamase genes. Of 87 isolates revealed P2 mg lÀ1 of


                                                                                                                                                                                                                                                        TEM-1/CTX-M-14/OXA-30 (1)




                                                                                                                                                                                                                                                        TEM-1/CTX-M-15/OXA-30 (5)
                                                                                                                                                                                                                                                        TEM-1/CTX-M-3/OXA-30 (1)
                                                                    Distribution of ESBLs among the clinical isolates of E. coli and Klebsiella spp. collected from 3 university hospitals in Korea




MIC against cefotaxime, 45 isolates (35 of E. coli and
10 of K. pneumoniae) showed resistance to cefoxitin.
                                                                                                                                                                                                                                                        TEM-1/CTX-M-14 (2)




                                                                                                                                                                                                                                                                                                         SHV-11/CTX-M-14(1)
                                                                                                                                                                                                                                                                                                         SHV-11/CTX-M-3 (2)
                                                                                                                                                                                                                                                        TEM-1/CTX-M-3 (1)
They were screened for plasmid-mediated AmpC b-
lactamases with the primers shown in Table 1 and
                                                                                                                                                                                                                                                        CTX-M-14 (1)
                                                                                                                                                                                                                                                        CTX-M-9 (1)




amplified PCR products were analyzed by nucleotide




                                                                                                                                                                                                                                                                                                                                                 18 (29.0)
                                                                                                                                                                                                                                          CTX-M




sequencing.
   From the results, 62 strains were identified as ESBL-
or plasmid-mediated AmpCs-producers, including 32
                                                                                                                                                                                                                                                                                                         TEM-1/SHV-12/OXA-30 (1)
                                                                                                                                                                                                                                                        TEM-1/SHV-12/OXA-30 (2)




isolates of E. coli, 2 isolates of K. oxytoca, and 28 iso-
lates of K. pneumoniae (Table 2). The most frequently
                                                                                                                                                                                                                                                                                     TEM-54/SHV-12 (1)



                                                                                                                                                                                                                                                                                                         TEM-54/SHV-12 (2)
identified ESBL gene among E. coli and K. pneumoniae
                                                                                                                                                                                                      Type of ESBL (number of isolates)


                                                                                                                                                                                                                                                        TEM-1/SHV-12 (3)




                                                                                                                                                                                                                                                                                     TEM-1/SHV-12 (1)




                                                                                                                                                                                                                                                                                                         TEM-1/SHV-12 (4)
isolates was blaSHV-12 and blaCTX-M which identified
from 18 (29%) and 18 (29%) isolates, respectively.
                                                                                                                                                                                                                                                        SHV-12 (1)




                                                                                                                                                                                                                                                                                                         SHV-12 (3)




                                                                                                                                                                                                                                                                                                                                                 18 (29.0)
Among 32 isolates of E. coli, 8 isolates carried blaTEM-
                                                                                                                                                                                                                                          SHV




and SHV-derived genes (blaTEM-52 in 2 isolates and
blaSHV-12 6 isolates); 15 isolates carried blaCTX-M
(blaCTX-M-9 in 1 isolate, blaCTX-M-14 in 4, blaCTX-M-3 in
                                                                                                                                                                                                                                                        TEM-52 (2)




2, and blaCTX-M-15 in 8); blaCMY-2 and blaACT-1,
                                                                                                                                                                                                                                                                                                                                                 2 (3.3)
                                                                                                                                                                                                                                          TEM




PABL-coding genes, were identified in one and six iso-
lates, respectively; and remaining 2 isolates carried sev-
eral blaESBL genes (blaSHV-12 and blaCTX-M-9 in 1
                                                                                                                                                                                                      Number of isolates




isolate and blaCTX-M-3, blaOXA-30, and blaCMY-1 in 1 iso-
late). Among 28 isolates of K. pneumoniae, 10 isolates
carried blaSHV-12 and 3 isolates carried blaCTX-M
(blaCTX-M-14 in one and blaCTX-M-3 in two); blaCMY-1
                                                                                                                                                                                                                                                        32




                                                                                                                                                                                                                                                                                                         28




                                                                                                                                                                                                                                                                                                                                                 62
                                                                                                                                                                                                                                                                                     2




and blaDHA-1 were identified in one and one isolate,
                                                                                                                                                                                                                                                                                                                                                 Number of strains (%)




respectively; and remaining 13 isolates carried several
blaESBL genes. Seven of eight isolates carrying blaDHA-1
                                                                                                                                                                                                                                                                                                         K. pneumoniae




also carried blaSHV-12, blaTEM, blaCTX-M-3, and/or
                                                                                                                                                                                                                                                                                     K. oxytoca




blaOXA-30. One K. pneumoniae isolate carried five differ-
                                                                    Table 2


                                                                                                                                                                                                      Species


                                                                                                                                                                                                                                                        E. coli




ent kinds of bla genes, such as blaTEM-52, blaSHV-12,
blaCTX-M-3, blaDHA-1, and blaOXA-30.
96                                          J. Kim et al. / FEMS Microbiology Letters 245 (2005) 93–98

Table 3
Antimicrobial susceptibilities (%) of ESBL-producing isolates of E. coli and Klebsiella spp.
Antimicrobials            Total (87)a                                E. coli (51)                          Klebsiella spp. (36)
                          ESBL (62)           Non-ESBL (25)          ESBL (32)           Non-ESBL (19)     ESBL (30)              Non-ESBL (6)
                          R         S         R          S           R         S         R        S        R         S            R        S
Ampicillin                89        11        96          4          84        16        95        5       85        15           100        0
Chloramphenicol           32        68        32         68          41        59        37       63       21        79            17       83
Tetracycline              40        60        28         72          69        31        37       63        9        91             0      100
Sulfisoxazole              73        27        56         44          81        19        58       42       58        42            50       50
Trimethoprim              47        53        52         48          59        41        53       47       30        70            50       50
Streptomycin              63        37        40         60          69        31        47       53       52        48            17       83
Kanamycin                 81        19        52         48          75        25        53       47       79        21            50       50
Gentamicin                60        40        48         52          66        34        47       53       48        52            50       50
Amikacin                  29        71        28         72          25        75        26       74       30        70            33       67
Tobtramycin               92         8        48         52          91         9        47       53       85        15            50       50
 a
     Parenthesis indicates the number of isolates.



   Resistance rates of the ESBL- or plasmid-mediated                          been identified from only 4 isolates in Korea [10], identi-
AmpCs-producing E. coli and Klebsiella spp. against                           fication of this enzyme in three different genera, i.e., Shi-
non-b-lactam antibiotics are given in Table 3. Produc-                        gella sonnei, E. coli, and K. pneumoniae, and from
tion of ESBL or plasmid-mediated AmpCs among E.                               different parts of Korea suggests dissemination of this
coli and Klebsiella spp. was associated with high levels                      enzyme in Korea. Indeed, CTX-M ESBL, with SHV-
of resistance to tetracycline, sulfisoxazole, streptomycin,                    12, was the most frequently found ESBL among E. coli
kanamycin, gentamicin and tobramycin when compared                            and K. pneumoniae isolates in this study. Moreover, four
to non-ESBL producing isolates. Especially, resistance                        kinds of CTX-M ESBLs, CTX-M-3, CTX-M-9, CTX-
rates of ESBL-producers to aminoglycosides except ami-                        M-15, and CTX-M-14, were found, suggesting that
kacin were very high as 63% to streptomycin, 81% to                           CTX-M enzymes have been persisted for longer periods
kanamycin, 60% to gentamicin, and 92% to tobramycin.                          and evolved in Korean hospital environments. There-
But the resistance rates to ampicillin, chloramphenicol,                      fore, more attention and evaluation for CTX-M enzymes
trimethoprim, and amikacin were the same or lower in                          are needed to catch the precise situation of ESBLs in
ESBL-producing isolates than in non-ESBL producing                            Korea.
isolates.                                                                        Since first CTX-M-b-lactamase, FEC-1 was discov-
                                                                              ered in a cefotaxime-resistant E. coli strain in 1986
                                                                              [14], CTX-M b-lactamases become the most widespread
4. Discussion                                                                 non-TEM, non-SHV plasmid-mediated class A ESBLs.
                                                                              In Far East, there have been reports of CTX-M-2,
   In this study, the overall prevalence rates of ESBL-                       CTX-M-3, CTX-M-15, and CTX-M-14 in Japan [15–
producers in E. coli and K. pneumoniae isolates were                          17] and of CTX-M-3, CTX-M-9, CTX-M-13, and
11.8% (32 of 272 isolates) and 17.7% (28 of 158 isolates),                    CTX-M-14 from isolates of E. coli, K. pneumoniae and
respectively. The result was very similar to the ESBL                         S. marcescens in China and Taiwan [18–21]. CTX-M-
survey in 1999 in 28 hospitals in Korea which revealed                        14 and CTX-M-17 have commonly been observed in
a frequency of 8.3% and 18.1% ESBL producers among                            E. coli and K. pneumoniae strains in Vietnam [22,23]
E. coli and K. pneumoniae, respectively [13]. Data from                       and CTX-M-15 was reported in India [24]. Therefore,
the SENTRY Antimicrobial Surveillance Program, per-                           it seems that CTX-M-3 and CTX-M-14 types are the
formed on K. pneumoniae, E. coli, P. mirabilis and Sal-                       most prevalent type of CTX-M enzymes in Far East.
monella spp. isolates collected in 1997–1999 from all                            Since 1989, over 20 plasmid-mediated AmpC b-lacta-
over the world, showed that ESBL frequency in K. pneu-                        mases have been reported worldwide [25,26]. Whereas
moniae may account for about 45% in Latin America,                            ESBLs confer resistance to the oxyimino-cephalosporins
25% in the Western Pacific, 23% in Europe and 8% in                            such as ceftazidime, cefotaxime, and aztreonam, plas-
the USA [14]. Therefore, it seems that the frequency of                       mid-mediated AmpCs confer resistance to cephamycins
ESBL among K. pneumoniae in Korea may be higher                               such as cefoxitin and cefotetan. From this study, 8 of
than in USA but lower than in Latin America and                               272 (2.9%) E. coli isolates and 8 of 158 (5.1%) K. pneumo-
Europe.                                                                       niae isolates demonstrated plasmid-mediated AmpCs-
   So far, TEM-52 and SHV-12 are the most common                              producers. Similarly, a survey performed in 2002 in
types of ESBL in Korea and CTX-M enzyme has been                              12 university hospitals in Korea showed that the preva-
rarely found in Korea [6–10]. Although CTX-M-14 has                           lence rate of plasmid-mediated AmpCs-producers was
                                    J. Kim et al. / FEMS Microbiology Letters 245 (2005) 93–98                                            97

1.5% (8 of 544 isolates) in E. coli and 5.4% (20 of 367 iso-        Acknowledgments
lates) in K. pneumoniae [27].
   To date in Korea, CMY-1, CMY-11, and DHA-1                          This study was supported by a grant from the Korea
plasmid-mediated AmpCs has been identified from                      Health 21 R&D Project, Ministry of Health and Wel-
cefoxitin-resistant E. coli and K. pneumoniae isolates              fare, Republic of Korea (03-PJ1-PG1-CH03-0002).
[8,27–29]. However, from this study, CMY-2 and
ACT-1, in addition to CMY-1 and DHA-1, were firstly
identified in six E. coli isolates and one E. coli isolate,          References
respectively. Although this may be a first report on the
blaCMY-2-carrying E. coli isolates in Korea, the spread              [1] Bauernfeind, A., Stemplinger, I., Jungwirth, R., Mangold, P.,
of blaCMY-2 among E. coli and Salmonella isolates from                   Amann, S., Akalin, E., Ang, O., Bal, C. and Casellas, J.M. (1996)
food animals has recently been reported in North Amer-                   Characterization of beta-lactamase gene bla PER-2, which
                                                                         encodes an extended-spectrum class A beta-lactamase. Antimic-
ica and has raised a public health concern [15,30–34].
                                                                         rob. Agents Chemother. 40, 616–620.
Moreover, a connection between CMY-2-producing                       [2] Bonnet, R. (2004) Growing group of extended-spectrum b-
E. coli and Salmonella isolates from humans and those                    lactamases: The CTX-M-enzymes. Antimicrob. Agents Chemo-
from food animals has been established in the United                     ther. 48, 1–14.
States [32–35] and blaCMY-2-carrying Salmonella and                  [3] Bou, G., Oliver, A. and Martinez-Beltran, J. (2000) OXA-24, a
                                                                         novel class D b-lactamases with carbapenemase activity in an
E. coli isolates associated with community-acquired
                                                                         Acinetobacter baumannii clinical strains. Antimicrob. Agents
infections in Taiwan [36]. To prevent further spread of                  Chemother. 44, 1556–1561.
blaCMY-2-carrying isolates in Korea, constant and con-               [4] Danel, F., Hall, L.M., Gur, D., Akalin, H.E. and Livermore,
sistent surveillance is needed.                                          D.M. (1995) Transferable production of PER-1 b-lactamase in
   Since ESBL producers express their b-lactamase                        Pseudomonas aeruginosa. J. Antimicrob. Chemother. 35, 281–294.
                                                                     [5] Naas, T. and Nordmann, P. (1999) OXA-type b-lactamases. Curr.
genes from plasmids, these organisms may also have
                                                                         Pharm. Design 5, 865–879.
genes coding for resistance to additional classes of anti-           [6] Jeong, S.H., Bae, I.K., Lee, J.H., Sohn, S.G., Kang, G.H., Jeon,
biotics. This study showed association of ESBL produc-                   G.J., Kim, Y.H., Jeong, B.C. and Lee, S.H. (2004) Molecular
tion with high levels of resistance to tetracycline,                     characterization of extended-spectrum beta-lactamases produced
sulfisoxazole, and aminoglycosides such as streptomy-                     by clinical isolates of Klebsiella pneumoniae and Escherichia coli
                                                                         from a Korean nationwide survey. J. Clin. Microbiol. 42, 1902–
cin, kanamycin, gentamicin and tobramycin when com-
                                                                         1906.
pared to non-ESBL producing isolates. This finding                    [7] Jeong, S.H., Bae, I.K., Kwon, S.B., Lee, J.H., Jung, H.I., Song,
suggests that genes coding for ESBLs and genes coding                    J.S., Jeong, B.C., Kim, S.J. and Lee, S.H. (2004) Investigation of
for resistance to these antibiotics may reside within the                extended-spectrum beta-lactamases produced by clinical isolates
same plasmids and therefore be spread together. This                     of Klebsiella pneumoniae and Escherichia coli in Korea. Lett.
                                                                         Appl. Microbiol. 39, 41–47.
means that resistance to two different kinds of drugs
                                                                     [8] Kim, J., Kwon, Y., Pai, H., Kim, J.W. and Cho, D.T. (1998)
may be co-selected by the use of either one.                             Survey of Klebsiella pneumoniae strains producing extended-
   It should be also emphasized that most of ESBL-                       spectrum beta-lactamases: Prevalence of SHV-12 and SHV-12a in
producers from this study carried more than two kinds                    Korea. J. Clin. Microbiol. 36, 1446–1449.
of bla genes. Of 62 ESBL-producers, 30 isolates (48.4%)              [9] Pai, H., Lyu, S., Lee, J.H., Kim, J.M., Kim, J.W. and Choe, K.W.
                                                                         (1999) Survey of extended-spectrum b-lactamases in clinical
and 18 isolates (29.0%) carried blaTEM-1 or blaOxa-30,
                                                                         isolates of Escherichia coli and Klebsiella pneumoniae: Prevalence
respectively, besides to blaESBL. Even more, 15 (24.2%)                  of TEM-52 in Korea. J. Clin. Microbiol. 37, 1758–1763.
of 62 ESBL-producers carried more than two kinds of                 [10] Pai, H., Choi, E.H., Lee, H.J., Hong, J.Y. and Jacoby, G.A.
blaESBL. Surprisingly, one isolate of K. pneumoniae car-                 (2001) Identification of CTX-M-14 extended-spectrum b-lacta-
ried three kinds of blaESBL, such as blaSHV-12, blaCTX-M,                mase in clinical isolates of Shigella sonnei, Escherichia coli, and
                                                                         Klebsiella pneumoniae in Korea. J. Clin. Microbiol. 39, 3747–3749.
and blaDHA-1, in addition to blaTEM-1 and blaOXA-30.
                                                                    [11] Farmer III, J.J. (1995) Enterobacteriaceae: Introduction and
These findings indicate that very complex and dynamic                     identification In: Manual of Clinical Microbiology (Murray, P.R.,
evolution and dissemination of bla genes have been pro-                  Baron, E.J., Pfaller, M.A., Tenover, F.C. and Yolken, R.H.,
gressed in hospital environments for long periods.                       Eds.), 3rd edn, pp. 438–449. American Society for Microbiology,
   In conclusion, the overall prevalence rates of ESBL-                  Washington, DC.
                                                                    [12] National Committee for Clinical Laboratory Standards. (2000)
producers were relatively high as 11.8% and 17.7% in
                                                                         Methods for dilution antimicrobial susceptibility tests for bacteria
E. coli and K. pneumoniae, respectively, and the most                    that grow aerobically. Approved Standard, 5th edn. NCCLS 20,
common types of ESBLs were CTX-M and SHV-12.                             pp. 7–10.
To our knowledge, CTX-M-3, CTX-M-9, CTX-M-15,                       [13] Lee, K., Chang, C., Kim, E.C., Song, W.K., Kim, J.S., Kim, M.N.,
ACT-1, and CMY-2 were firstly identified in E. coli                        Park, Y.J., Yong, D. and Chong, Y. (2000) Nationwide spread of
                                                                         extended-spectrum b-lactamase (ESBL)-producing Escherichia
and K. pneumoniae isolates from Korea. The relatively
                                                                         coli and Klebsiella pneumoniae in Korea [Abstract C-1994], 121
high prevalence of CTX-M enzyme and the presence                         p. In Program and abstracts of the 40th Interscience Conference on
of diverse plasmid-mediated AmpCs underline the need                     Antimicrobial Agents and Chemotherapy, Toronto, Canada.
for routine surveillance for these b-lactamases.                         American Society for Microbiology, Washington, DC.
98                                           J. Kim et al. / FEMS Microbiology Letters 245 (2005) 93–98

[14] Matsumoto, Y., Ikeda, F., Kamimura, T., Yokota, Y. and Mine,            [26] Philippin, A., Arlet, G. and Jacoby, G.A. (2002) Plasmid-
     Y. (1988) Novel plasmid-mediated beta-lactamase from Esche-                  mediated AmpC-type b-lactamases. Antimicrob. Agents Chemo-
     richia coli that inactivates oxyimino-cephalosporins. Antimicrob.            ther. 46, 1–11.
     Agents Chemother. 32, 1243–1246.                                        [27] Song, W.K., Kim, J.S., Kim, M.N., Kim, E.C., Park, Y.J., Yong,
[15] Ma, L., Ishii, Y., Ishiguro, M., Matsuzawa, H. and Yamaguchi,                D. and Lee, K. (2002) Occurrence and genotypic distributions of
     K. (1998) Cloning and sequencing of the gene encoding Toho-2, a              plasmid-mediated AmpC b-lactamase-producing Escherichia coli
     class A b-lactamase preferentially inhibited by tazobactam.                  and Klebsiella pneumoniae in Korea. Kor. J. Lab. Med. 22, 410–
     Antimicrob. Agents Chemother. 42, 1181–1186.                                 416.
[16] Ohkawa, T., Yoshinaga, M., Ikarimoto, N., Miyanohara, H.,               [28] Lee, S.H., Kim, J.Y., Lee, G.S., Cheon, S.H., An, Y.J., Jeong,
     Miyata, K., Doi, Y., Shibata, N. and Arakawa, Y. (2002)                      S.H. and Lee, K.J. (2002) Characterization of blaCMY-11 an
     Characterization of Klebsiella pneumoniae and Escherichia coli               AmpC type plasmid-mediated beta-lactamase gene in a Korean
     strains that produce CTX-M-2-type broad spectrum beta-lacta-                 clinical isolates of Escherichia coli. J. Antimicrob. Chemother. 49,
     mase isolated from a child with leukemia. Pediatr. Infect. Dis. J.           269–273.
     21, 260–262.                                                            [29] Kim, J. and Kwon, Y. (1999) AmpC-type b-lactamase in clinical
[17] Yamasaki, K., Komatsu, M., Yamashita, T., Shimakawa, K.,                     isolates of cefoxitin-resistant Escherichia coli and Klebsiella
     Ura, T., Nishio, H., Satoh, K., Washidu, R., Kinoshita, S. and               pneumoniae. J. Kor. Soc. Microbiol. 34, 327–336.
     Aihara, M. (2003) Production of CTX-M-3 extended-spectrum               [30] Allen, K.J. and Poppe, C. (2002) Occurrence and characterization
     beta-lactamase and IMP-1 metallo beta-lactamase by five gram-                 of resistance to extended-spectrum cephalosporins mediated by b-
     negative bacilli: Survey of clinical isolates from seven laboratories        lactamase CMY-2 in Salmonella isolated from food-producing
     collected in 1998 and 2000, in the Kinki region of Japan. J.                 animals in Canada. Can. J. Vet. Res. 66, 137–144.
     Antimicrob. Chemother. 51, 631–638.                                     [31] Carattoli, A., Tosini, F., Giles, W.P., Rupp, M.E., Hinrichs, S.H.,
[18] Chanawong, A., MÕZail, F.H., Heritage, J., Xiong, J.H. and                   Angulo, F.J., Barrett, T.J. and Fey, P.D. (2002) Characterization
     Hawkey, P.M. (2002) Three cefotaximases, CTX-M-9, CTX-M-                     of plasmids carrying CMY-2 from expanded-spectrum cephalo-
     13, and CTX-M-14, among Enterobacteriaceae in the PeopleÕs                   sporin-resistant Salmonella strains isolated in the United States
     Republic of China. Antimicrob. Agents Chemother. 46, 630–637.                between 1996 and 1998. Antimicrob. Agents Chemother. 46,
[19] Ma, L., Ishii, Y., Chang, F.Y., Yamaguchi, K., Ho, M. and Siu,               1269–1272.
     L.K. (2002) CTX-M-14, a plasmid-mediated CTX-M type                     [32] Winokur, P.L., Brueggemann, A., Desalvo, D.L., Hoffmann, L.,
     extended-spectrum beta-lactamase isolated from Escherichia coli.             Apley, M.D., Uhlenhopp, E.K., Pfaller, M.A. and Doern, G.V.
     Antimicrob. Agents Chemother. 46, 1985–1988.                                 (2000) Animal and human multidrug-resistant, cephalosporin-
[20] Wang, H., Wang, S., Kelkar, W., Wu, W., Chen, M. and Quinn,                  resistant Salmonella isolates expressing a plasmid-mediated
     J.P. (2003) Clinical isolates of Enterobacteriaceae producing                CMY-2 AmpC b-lactamase. Antimicrob. Agents Chemother.
     extended-spectrum beta-lactamases: Prevalence of CTX-M-3 at                  44, 2777–2783.
     a hospital in China. Antimicrob. Agents Chemother. 47, 790–793.         [33] Winokur, P.L., Vonstein, D.L., Hoffman, L.J., Uhlenhopp, E.K.
[21] Yan, J.J., Ko, W.C., Tsai, S.H., Wu, H.M., Jin, Y.T. and Wu, J.J.            and Doern, G.V. (2001) Evidence for transfer of CMY-2 AmpC
     (2000) Dissemination of CTX-M-3 and CMY-2 b-lactamases                       b-lactamase plasmids between Escherichia coli and Salmonella
     among clinical isolates of Escherichia coli in southern Taiwan. J.           isolates from food animals and humans. Antimicrob. Agents
     Clin. Microbiol. 38, 4320–4325.                                              Chemother. 45, 2716–2722.
[22] Cao, V., Lambert, T. and Courvalin, P. (2002) ColE1-like plasmid        [34] Zhao, S., White, D.G., McDermott, P.F., Friedman, S., English,
     pIP843 of Klebsiella pneumoniae encoding extended-spectrum                   L., Ayers, S., Meng, J., Maurer, J.J., Holland, R. and Walker,
     beta-lactamase CTX-M-17. Antimicrob. Agents Chemother. 46,                   R.D. (2001) Identification and expression of cephamycinase
     1212–1217.                                                                   blaCMY genes in Escherichia coli and Salmonella isolates from
[23] Yu, W.L., Wu, L.T., Pfaller, M.A., Winokur, P.A. and Jones,                  food animals and ground meat. Antimicrob. Agents Chemother.
     R.N. (2003) Confirmation of extended-spectrum beta-lactamase-                 45, 3647–3650.
     producing Serratia marcescens: Preliminary report from Taiwan.          [35] Fey, P.D., Safranek, T.J., Rupp, M.E., Dunne, E.F., Ribot, E.,
     Diagn. Microbiol. Infect. Dis. 45, 221–224.                                  Iwen, P.C., Bradford, P.A., Angulo, F.J. and Hinrichs, S.H.
[24] Karim, A., Poirel, L., Nagarajan, S. and Nordmann, P. (2001)                 (2000) Ceftriaxone-resistant Salmonella infection acquired by a
     Plasmid-mediated extended-spectrum b-lactamase (CTX-M-3-                     child from cattle. N. Engl. J. Med. 342, 1242–1249.
     like) from India and gene association with insertion sequence           [36] Yan, J.J., Hong, C.Y., Ko, W.C., Chen, Y.J., Tsai, S.H., Chuang,
     ISEcp1. FEMS Microbiol. Lett. 201, 237–241.                                  C.L. and Wu, J.J. (2004) Dissemination of blaCMY-2 among
[25] Bauernfeind, A., Chong, Y. and Schweighart, S. (1989) Extended               Escherichia coli isolates from food animals, retail ground meats,
     broad spectrum b-lactamase in Klebsiella pneumoniae including                and humans in southern Taiwan. Antimicrob. Agents Chemother.
     resistance to cephamycins. Infection 17, 316–321.                            48, 1353–1356.
                                              FEMS Microbiology Letters 245 (2005) 99–105
                                                                                                                      www.fems-microbiology.org




                          Orbilia querci sp. nov. and its knob-forming
                                   nematophagous anamorph
                                           a,b,c                              a,*                                 a
                              Bin Liu              , Xing-Zhong Liu                 , Wen-Ying Zhuang
               a
                   Key Laboratory of Systematic Mycology and Lichenology, Institute of Microbiology, Chinese Academy of Sciences,
                                                        P.O. Box 2714, Beijing 100080, China
                       b
                         Institute of Applied Microbiology, Agricultural College of Guangxi University, Nanning 530005, China
                                     c
                                       Graduate School of the Chinese Academy of Sciences, Beijing 100039, China

                         Received 10 November 2004; received in revised form 22 January 2005; accepted 22 February 2005

                                                      First published online 12 March 2005

                                                                Edited by B. Paul




Abstract

    Orbilia querci, a new nematode-trapping fungus, was found on rotten wood of Quercus sp. in Huai-rou County, Beijing, China. It
is characterized by having a tear-shaped spore body in the cylindrical ascospore. Pure culture was obtained from the ascospores.
Conidiophores were simple or occasionally branched, bearing a single conidium on the tip. Conidia were spindle-shaped, mostly
with 3-septa. Nematodes were captured by means of adhesive stalked knobs. The adhesive knobs were produced frequently on nutri-
tional agar plates even in the absence of challenging nematodes. Its anamorph is placed in Dactylellina and named as D. querci. The
sequence divergence of the ITS1 region between the fungus and the other knob-forming species tested was 23.8–33.4%, supporting
O. querci as a distinct species. This is the first report of the connection between a knob-forming nematophagous hyphomycete and
an Orbilia teleomorph.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Orbiliaceous fungi; Nematophagous fungi; Teleomorph-anamorph connection; Orbilia querci; Dactylellina querci




1. Introduction                                                             genera currently accepted in the family [2]. More than
                                                                            200 species of the Orbiliaceae have been reported in
   Orbiliaceous fungi include those which produce                           the world, but most of them have not been re-evaluated,
small, waxy, light-colored and semitranslucent apothe-                      and very few of them were studied in culture. Recently,
cia with tiny asci and ascospores and a swollen paraph-                     more attention has been paid to the orbiliaceous fungi
ysis apex. Orbiliaceae, a family traditionally placed in                    because of their nematophagous anamorphs [3–6].
the Helotiales, was excluded from this order according                         Nematode-trapping hyphomycetes have been classi-
to molecular evidence. Recently, a new order Orbiliales                     fied by the morphology of conidiophores and conidia
and a new class Orbiliomycetes were proposed [1]. Orbi-                     [7–11]. Rubner [12] revised the generic concepts of the
lia Fr. and Hyalorbilia Baral and Marson are the only                       predatory hyphomycetes based on trapping organs in
                                                                            her monographic treatment of the Dactylella-Monacros-
                                                                            porium complex. Later, Hagedorn and Scholler [13] and
 *
   Corresponding author. Tel.: +86 10 62658587; fax: +86 10
                                                                            Scholler et al. [14] emended the predatory orbiliaceous
62656920.                                                                   fungi according to rDNA sequence data and the mor-
   E-mail address: liuxz@sun.im.ac.cn (X.-Z. Liu).                          phology of trapping organs assigned the adhesive knob

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.027
100                                       B. Liu et al. / FEMS Microbiology Letters 245 (2005) 99–105

forming species into Dactylellina M. Morelet and Gam-                      margins of the colony where the agar was removed
sylella Scholler, Hagedorn and Rubner, respectively.                       and observed directly under a compound microscope
   Net-work and constricting ring forming fungi have                       after 1–3 days [15]. All microscopic characteristics were
been demonstrated to link with Orbilia [3–5]. However,                     measured from 50 individuals in water mounts. Obser-
there were no connections established between adhesive                     vations, measurements, and photographs were taken
knob-forming fungi and Orbilia teleomorphs [13]. Dur-                      with an Olympus B51 microscope with differential inter-
ing our recent study on the orbiliaceous fungi and their                   ference contrast (DIC).
anamorphs, an interesting Orbilia specimen was col-                           DNA was extracted from the pure cultures using a
lected from Huai-rou County, Beijing, China, and adhe-                     modified method of Doyle and Doyle [16]. Primers for
sive knob-forming anamorph produced from the                               PCR amplification of the internal transcribed spacer re-
ascospores. A new species of Orbilia and of Dactylellina                   gion of nr DNA were ITS5 and ITS4 described by White
are proposed and described.                                                et al. [17]. PCR products were purified using the Go3S
                                                                           PCR Product Purification Kit and sequenced on an
                                                                           automated ABI 377 sequencer (PE). Related sequences
2. Materials and methods                                                   were obtained from GenBank. All sequences were
                                                                           aligned with the Clustal X program [18] and adjusted
   The fresh specimen of Orbilia was collected from                        visually where necessary in the program BioEdit
Labagoumen Forest Park of Huai-rou County, Beijing,                        sequence alignment editor [19]. Cladistic analyses using
China in July, 2002. A dried voucher specimen was                          the neighbor-joining method [20] and maximum-
deposited in the Mycological Herbarium, Institute of                       parsimony method were performed with MEGA version
Microbiology, Chinese Academy of Sciences (HMAS                            2.1 [21]. The neighbor-joining tree was constructed with
88781). The specimen was rehydrated and sectioned lon-                     Kimura 2-parameter model, including transitions and
gitudinally at the thickness of 10–15 lm by freezing                       transversions and with pairwise deletion of gaps. The
microtome; the living ascospores were observed directly                    maximum-parsimony trees were searched using the
from the tap water mount of living specimen.                               Min-mini heuristic algorithm with a search factor of 3.
   An apothecium was stuck on the lid of a Petri dish                      The robustness of branches was assessed by bootstrap
with its hymenium upside down to shoot ascospores                          analysis with 1000 replicates. Details of strains used
on the surface of water agar (15 g Bacto-Agar (Difco),                     and GenBank accession numbers are given in Table 1.
50 mg streptomycin, 30 mg chlortetracycline, 1000 ml
distilled water). After germination, the ascospores were
transferred onto PDA plates (Oxoid, UK). The morpho-                       3. Results
logical characteristics of the anamorph were observed
and measured from cultures on PDA and CMA (Oxoid,                          3.1. Morphological descriptions
UK) after incubation for 7–10 days at 25 °C. Trapping
organs were induced by adding Panagrellus redivivus                           Etymology: species epithet refers to the host genus
(L.) Goodey into a 10 · 10 mm square slot at the                           (see Fig. 1).


Table 1
Species and sequence database accession numbers
Species                                           Strain no.                          Geographic origin                          Accession no.
Dactylellina drechsleri                           AS 3.6773                           Mainland China                             AY773448
Dactylellina ellipsospora                         CBS224.54                           UK                                         U51971
Dactylellina ellipsospora                         AS 3.6758                           Mainland China                             AY804214
Dactylellina haptotyla                            CBS325.94                           Canary Islands                             AF106523
Dactylellina haptotyla                            AS 3.6779                           Mainland China                             AY773470
Dactylellina leptospora                           CBS560.92                           USA                                        AF106529
Dactylellina leptospora                           AS 3.6775                           Mainland China                             AY773466
Gamsylella arcuata                                CBS174.89                           UK                                         AF106527
Gamsylella gephyropaga                            CBS178.37                           UK                                         U51974
Gamsylella lobata                                 CBS329.94                           Germany                                    AF106524
Gamsylella parvicollis                            516                                 Mainland China                             AY804215
Gamsylella phymatopaga                            CCRC32875                           Taiwan                                     U51970
Orbilia epipora                                   DHP107                              USA                                        U72601a
Orbilia querci                                    AS 3.6762                           Mainland China                             AY804213
Patinella tenebricosa                             DHP133                              USA                                        U72606
Hyalorbilia brevistipitata                        CBS 113946                          Mainland China                             AY514636
 a
     U72601 under a tentative name O. alnea in GenBank and [5], Baral (unpublished) identified the specimen as O. epipora (Nyl.) Karsten.
                                         B. Liu et al. / FEMS Microbiology Letters 245 (2005) 99–105                                         101




Fig. 1. Orbilia querci. (A) Dried apothecia. (B) Vertical section of an apothecium. (C)–(D) Asci and ascospores, arrow indicates the SB in living
ascospore. E. Asci. F. Paraphyses. Bars A = 100 lm; B = 10 lm; (C)–(F) = 5 lm.




   Apothecia 0.2–0.5 mm in diam., solitaria vel gregaria,                  refringens lacrimiformis vel ovata, 1.1–1.8 · 0.7–
superficialia, translucentia, sessilia, concavo. Excipulum                  1.0 lm. Paraphyses filiformes, 1.5–2.0 lm diam., apice
ectale texturae angulare, cellulae isodiametrae, 6–                        usque 2.0–2.5 diam., hyalinae.
10(À14) lm diam. Asci 18–30 · 2.5–3.0 lm, 8-spori, cyl-                       Mycelium sparsum, hyphis hyalinis septatis laevibus
indraceo-clavati, basi angustati plerumque furcati, apice                  compositum. Conidiophora hyalina, recta, simplicia,
truncati vel rotundati. Ascosporae hyalinae, cylindri-                     solitaria, septata, 130–180 lm alta, basi 5–6.5 lm crassa,
coclavatae,     non-septatae,      imbricate    biseriatae,                ad apicem angustata 1.5–2.5 lm crassa. Conidia singu-
5.0–6.0 · 0.8–1.2 lm. Cellula apicalis cum vacuola                         laria, apicalia, hyalina, laevia, fusiformia, apicea obtuse,
102                                   B. Liu et al. / FEMS Microbiology Letters 245 (2005) 99–105

25–32.5–40(À50) lm longa, 8–9.5–12 lm mm lata, 3- ad                  lm thick. Subhymenium poor-developed. Asci cylindri-
5-septata, saepe 3-septata. Chlamydosporae desunt (see                cal-clavate, narrower and tapered towards the base,
Fig. 2).                                                              sometime forked at the base, apex truncate to rounded,
   Apothecia superficial on rotten wood, gregarious,                   18–30 · 2.5–3.0 lm. Ascospores hyaline, subcylindrical
sessile, 0.2–0.5 mm in diam. Disc concave, smooth,                    to cylindrical-clavate, straight or sometimes slightly
translucent, whitish to pale yellow when fresh, brownish              curved, non-septate, usually overlapping tightly and
yellow when dried. Ectal excipulum of textura angularis,              biseriate within ascus, 5.0–6.0 · 0.8–1.2 lm in water,
78–96-lm thick, cells isodiametric, 6–10(À14) lm in                   spore body (SB) tear-shaped to short rod-shaped, 1.1–
diam. Medullary excipulum of textura intricate, 27–35-                1.8 · 0.7–1.0 lm. Paraphyses filiform with a clavate to




Fig. 2. Dactylellina querci (A) Colony on PDA. (B)–(F). Conidiophores and conidia, note the single conidium produced on each tip of the
conidiophores. (G)–(H) Stalked knobs. Bars A = 2 cm; B = 20 lm; (C)–(H) = 10 lm.
                                            B. Liu et al. / FEMS Microbiology Letters 245 (2005) 99–105                                              103

capitate apex, hyaline, 18–22-lm long, 2.0–2.5-lm wide                          phae hyaline, septate, branched, 2.5–3.5-lm wide. Con-
at apex and 1.5–2.0-lm wide below.                                              idiophores mostly 130–180 lm high, 5–6.5-lm wide at
   Colonies colorless on PDA or CMA, reached to 60–                             the base, 1.5–2.5 lm at the tip, sometime branched near
65 mm in diam. on PDA and 45 mm on CMA after 20                                 the apex, bearing a single conidium. Conidia were com-
days culture at 23–25 °C. Aerial mycelium sparse, hy-                           monly spindle-shaped, slightly rounded at the distal end,




Fig. 3. Phylogenetic trees of O. querci and the related species based on ITS region sequence data, with trees rooted with Hyalorbilia brevistipitata. (A)
A neighbor-joining tree obtained using Kimura 2-parameter distances. (B) The strict consensus of two maximum parsimony trees. Percentages at
nodes represent levels of bootstrap support from 1000 replicates. Bootstrap values less than 50% are not shown.
104                                       B. Liu et al. / FEMS Microbiology Letters 245 (2005) 99–105

narrowly truncate at the base, 25–32.5–40(À50) · 8–9.5–                     other knob-forming species tested although the relation-
12 lm, with 3–5 and mainly 3-septa, but the middle cell                     ships between Dactylellina and Gamsylella are poorly re-
is not much larger than the others. Chlamydospores not                      solved. O. querci is also distinguishable from O. epipora
observed. Trapping nematodes by means of stalked                            and P. tenebricosa. Similar results were obtained with
knobs (0–5.5 lm), knobs spherical to subspherical,                          Maximum parsimony methods (Fig. 3(B)).
8.0–12.0 · 7.5–10.0 lm. Knobs produced frequently on
the nutritional agar plates even without challenging with
nematode.                                                                   4. Discussion
   Holotype: PR China, Beijing, Huai-rou County,
Labagoumen Forest Park, alt. 850 m, 10 July 2002, B.                           Morphologically, the present species appears to be
Liu 6175 (HMAS 88781), permanent slide culture                              similar to O. epipora and Orbilia rectispora (Boud.)
(HMAS 88783).                                                               Baral in asci and paraphyses, but differs mainly in the
   Habitat: on rotten wood of Quercus sp.                                   shape of the spore body and in the size of the ascospores
                                                                            (Table 2). According to BaralÕs unpublished world
3.2. DNA sequencing and phylogenetic analysis                               monograph of the Orbiliomycetes, spore body (SB) is
                                                                            the key characteristic to separate species. The SB of
    The sequences of O. querci and the related species                      our fungus is tear- to rod-shaped, 1.1–1.8 · 0.7–1.0 lm
were compared. The total lengths of ITS1–5.8S–ITS2                          in size, while those of O. epipora and O. rectispora are
rDNA regions of these species are 505–536 bases. The                        globose (Baral, pers. comm.). The ascospores of O. quer-
sequences obtained were compared with the ITS1 se-                          ci are longer than those in O. epipora and shorter than
quences of related species of Dactylellina. There was                       that in O. rectispora, and its asci are slightly smaller than
77.2% similarity between O. querci and D. leptospora                        that in the two species. The spore arrangement in ascus
(Drechsler) Scholler et al., 73.5% with Dactylellina ellip-                 of O. querci is usually tightly overlapping and biseriate,
sospora (Preuss) Scholler et al., 71.7% with Dactylellina                   which is also different from the other two species. Fur-
drechsleri (Tarjan) Scholler et al., 67.6% with Dactylel-                   thermore, the anamorphs of both O. epipora and O. rec-
lina haptotyla (Drechsler) Scholler et al., 55.4% with Or-                  tispora are Dactylella and not nematode-trapping
bilia epipora (Nyl.) Karsten, and 52.4% with Patinella                      (Baral, pers. comm.). O. querci also differs from O. epi-
                ˇ
tenebricosa Svrcek.                                                         pora according to the sequence data; the similarity of the
    A neighbor-joining tree (Fig. 3(A)) was constructed                     two species in the sequence of ITS1 region was only
based on sequences of the ITS region of O. querci and                       54.4%. Regrettably, no sequence of O. rectispora is
the related species, with Hyalorbilia brevistipitata Liu                    available to compare with O. querci.
et al. [22] as the outgroup. The tree showed that the                          The new species is also similar to P. tenebricosa in the
nematode-trapping species formed a clade with 96%                           size of ascospores, but the latter differs in dull gray-
bootstrap support, while O. epipora showed little homol-                    brown apothecia with a 46–60-lm long and 4–5-lm
ogy with them. In the nematode-trapping clade, P. ten-                      wide glass processes at margin [23]. The anamorph of
ebricosa and its constricting ring forming anamorph                         P. tenebricosa is Monacrosporium polybrochum [5] which
Drechslerella polybrocha (Drechsler) Scholler et al.                        was later transferred to Drechslerella by Scholler et al.
formed a subclade, while Dactylellina and Gamsylella                        [14]. In addition to the different anamorph, the SBs of
species trapping nematodes with adhesive knobs or                           P. tenebricosa are filiform (1.5–2 · 0.3–0.6 lm) (Baral,
branches formed the other one with 97% bootstrap sup-                       pers. comm.) instead of tear-shaped and their ITS se-
port. Two groups were recognized in the second subc-                        quences are divergent.
lades, one comprised 3 Gamsylella species and the                              The anamorph of O. querci resembles D. drechsleri,
other was of 5 Dactylellina species and 2 Gamsylella                        D. ellipsospora and D. haptotyla in the shape of conidia
species, with which O. querci was grouped. O. querci                        and adhesive knobs, but differs from them in that it
was related to D. leptospora with a 62% bootstrap value.                    lacks the largest cell in conidia and in having shorter
The tree indicated that O. querci is distinguishable from                   stalks of adhesive knobs. The sequence divergence of


Table 2
Comparison of the morphological characteristics of Orbilia querci with other similar species
Species                                     Asci (lm)                              Ascospores (lm)                           Spore body (lm)
Orbilia epipora                             25–42 · 3–4                            2.7–4.5(À5) · 0.8–1.3                     –
Orbilia rectispora                          36–41 · 3–4                            5.2–10(À13) · 1–1.7                       1.2–2.0
Patinella tenebricosa                       25–35 · 3–3.5                          5–5.6 · 0.8–1                             1.5–2.0 · 0.3–0.6
Orbilia querci                              18–30 · 2.5–3.0                        5.0–6.0 · 0.8–1.2                         1.1–1.8 · 0.7–1.0
Data of O. epipora, O. rectispora and P. tenebricosa cited from BaralÕs unpublished world monograph of the Orbiliomycetes.
                                           B. Liu et al. / FEMS Microbiology Letters 245 (2005) 99–105                                      105

the ITS1 region between O. querci and the other knob-                       [7] Drechsler, C. (1937) Some hyphomycetes that prey on free-living
forming species tested is 23.8–33.4%, which supports                            terricolous nematodes. Mycologia 29, 447–552.
                                                                            [8] Subramanian, C.V. (1963) Dactylella, Monacrosporium and Dac-
the separation of O. querci from its related species.                           tylaria. J. Indian Bot. Soc. 42, 291–300.
   The connection between orbiliacous fungi and nema-                       [9] Cooke, R.C. and Godfrey, B.E.S. (1964) A key to the
tode-trapping hyphomycetes has been well-established.                           nematode-destroying fungi. Trans. Brit. Mycol. Soc. 47, 61–
Many nematode-trapping hyphomycetes derived from                                74.
Orbilia have been described [1,5]. Among them, only                        [10] De Hoog, G.S. and Van Ooschort, C.A.N. (1985) Taxonomy of
                                                                                the Dactylaria comples. Stud. Mycol. 26, 1–122.
adhesive network-forming Arthrobotrys and constricting                     [11] Liu, X.Z. and Zhang, K.Q. (1994) Nematode-trapping species of
ring-forming Drechslerella were known. This is the first                         Monacrosporium with the special reference to two new species.
evidence that a knob-forming nematode-trapping hyph-                            Mycol. Res. 98, 862–867.
omycete is connected with an Orbilia teleomorph.                           [12] Rubner, A. (1996) Revision of predacious hyphomycetes in
                                                                                the Dactylella-Monacrosporium complex. Stud. Mycol. 39, 1–
                                                                                134.
                                                                           [13] Hagedorn, G. and Scholler, M. (1999) Revaluation of predatory
Acknowledgments                                                                 orbiliaceous fungi. I. Phylogenetic analysis using rDNA sequence
                                                                                data. Sydowia 51, 27–48.
                                                                           [14] Scholler, M., Hagedorn, G. and Rubner, A. (1999) A revaluation
   We are grateful to Mr. H.O. Baral for generously
                                                                                of predatory orbiliaceous fungi. II. A new generic concept.
providing his unpublished ‘‘World Monographic of the                            Sydowia 51, 89–113.
Orbiliomycetes (Ascomycota)’’ and invaluable discus-                       [15] Gao, R.H., Lei, L.P. and Liu, X.Z. (1996) A simple method for
sion on identification of the teleomorph; to Dr. J.Y.                            inducing and observing predacious device of nematode-trapping
Zhuang for correction of the Latin diagnoses. This pro-                         fungi. Acta Mycol. Sin. 15, 304–305.
                                                                           [16] Doyle, J.J. and Doyle, J.L. (1987) A rapid DNA isolation
ject is supported by the National Natural Science Foun-
                                                                                procedure for small quantities of fresh leaf tissue. Phytochem.
dations of China (Nos. 30460002, 30230020 and                                   Bull. 19, 11–15.
30270007).                                                                 [17] White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990)
                                                                                Amplification and direct sequencing of fungal ribosomal
                                                                                RNA genes for phylogenetics In: PCR Protocols: A Guide
                                                                                to Methods and Applications (Innis, M.A., Gelfand, D.H.,
References                                                                      Sninsky, J.J. and White, T.J., Eds.), pp. 315–322. Academic
                                                                                press.
[1] Baral, H.O., Eriksson, O.E., Marson, G. and Weber, E. (2003)           [18] Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and
    Nos 3591. In: Notes on ascomycete systematics (Eriksson, O.E.,              Higgins, D.G. (1997) The Clustal-X windows interface: flexible
    Baral, H.O., Currah, R.S., Hansen, K. Kurtzman, C.P., Laessoe,              strategies for multiple sequence alignment aided by quality
    T., Rambold, G., Eds.), Nos. 3580–3623; Myconet 9, 91–103.                  analysis tools. Nucl. Acids Res. 25, 4876–4882.
[2] Baral, H.O. and Marson, G. (2001) Monographic revision of              [19] Saitou, N. and Nei, M. (1987) The neighbour-joining method: a
    Gelatinopsis and Calloriopsis (Calloriopsideae, Leotiales). In:             new method for reconstructing phylogenetic trees. Mol. Biol.
    Micologia 2000, pp. 23–46. Associazione Micologica Bresadola,               Evol. 4, 406–425.
    Trento.                                                                [20] Hall, T.A. (1999) BioEdit: a user-friendly biological sequence
[3] Pfister, D.H. (1994) Orbilia fimicola, a nematophagous discomyc-              alignment editor and analysis program for Windows 95/98/NT.
    ete and its Arthrobotrys anamorph. Mycologia 86, 451–453.                   Nucl. Acids Symp. Ser. 41, 95–98.
[4] Pfister, D.H. and Liftik, M.E. (1995) Two Arthrobotrys ana-             [21] Kumar, S., Tamura, K., Jakobsen, I. and Nei, M. (2001)
    moprhs from Orbilia auricolor. Mycologia 87, 684–688.                       MEGA2: molecular evolutionary genetics analysis software.
[5] Pfister, D.H. (1997) Castor, pollux, and the life histories of fungi.        Bioinformatics 17, 1244–1245.
    Mycologia 89, 1–23.                                                    [22] Liu, B., Liu, X.Z. and Zhuang, W.Y. (2005) A new species of
[6] Webster, J., Henrici, A. and Spooner, B.M. (1998) Orbilia                   Hyalorbilia and its anamorph from China. Nova Hedwigia.
    fimicoloides sp. nov, the teleomorph of Dactylella cf. oxyspora.                 ˇ
                                                                           [23] Svrcek, M. (1977) New or less known discomycetes V. Ceska
    Mycol. Res. 102, 99–102.                                                    Mykologie 31, 132–138.
                                                FEMS Microbiology Letters 245 (2005) 107–116
                                                                                                                      www.fems-microbiology.org




             Disruption of a gene encoding glycerol 3-phosphatase from
                   Candida albicans impairs intracellular glycerol
                        accumulation-mediated salt-tolerance
                                                a,b                                   c,d                             a,e,*
                           Jinjiang Fan               , Malcolm Whiteway                    , Shi-Hsiang Shen
a
    Mammalian Cell Genetics, Health Sector, Biotechnology Research Institute, National Research Council of Canada, Montreal, Que., Canada H4P 2R2
                       b
                         Guy-Bernier Research Center, Maisonneuve-Rosemont Hospital, Montreal, Que., Canada H1T 2M4
              c
                Genetics, Biotechnology Research Institute, National Research Council of Canada, Montreal, Que., Canada H4P 2R2
                                        d
                                          Department of Biology, McGill University, Montreal, Que., Canada
                                  e
                                    Department of Medicine, McGill University, Montreal, Que., Canada H3G 1A4

                             Received 6 January 2005; received in revised form 23 February 2005; accepted 24 February 2005

                                                          First published online 17 March 2005

                                                                  Edited by L.F. Bisson




Abstract

   Intracellular glycerol accumulation is critical for Candida albicans to maintain osmolarity, and therefore defects in glycerol
homeostasis can have severe effects on the morphogenetic plasticity and pathogenicity of this fungus. The final step of glycerol syn-
thesis involves the dephosphorylation of glycerol 3-phosphate by glycerol 3-phosphatase (GPP1). We have identified a single copy of
the GPP orthologous gene (GPP1) in the C. albicans haploid genome, as well as the paralogous gene 2-deoxyglucose-6-phosphate
phosphatase (DOG1); both belong to a family of low molecular weight phosphatases. A knockout of the GPP1 gene in C. albicans
caused increased susceptibility to high salt concentrations, indicating a deficiency in osmoregulation. Reintroduction of the GPP1
gene complemented the impairment of salt-tolerance in the gpp1/gpp1 mutant. Northern blot analysis showed that the GPP1 gene
was strongly responsive to osmotic stress, and its transcriptional expression was positively correlated with intracellular glycerol
accumulation. These results demonstrate that the GPP1 gene plays an important role in the osmoregulation in C. albicans.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords:      DL-Glycerol-3-phosphatase   (GPP1); Gene disruption; Glycerol; Candida albicans




1. Introduction                                                                represents a promising means of identifying new drug
                                                                               targets. Searching among the low homology genes and/
   Candida albicans is a common human commensal                                or Candida-specific genes as potential drug targets is an
fungal pathogen [1]. The transition from the yeast to                          issue of current pharmacological interest, mainly based
the filamentous form has been considered a putative vir-                        on the concern of recent studies on drug-resistance
ulence factor for this pathogen [2,3]. Detection of Can-                       occurring in native and experimental populations of
dida genes that are not homologous to human genes,                             C. albicans [4,5].
and are responsible for the virulence of the pathogen,                            Although osmoregulation involves a very conserved
                                                                               mitogen-activated protein kinase (MAPK) controlled
    *
        Corresponding author. Tel.: +1 514 496 6318; fax: +1 514 496 6319.     pathway from yeast to humans, the upstream and
        E-mail address: shi.shen@nrc.ca (S.-H. Shen).                          downstream branches of the pathway appear to have

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.031
108                                      J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116

some species-specific characteristics [6–8]. The central                   2. Materials and methods
component of the osmoregulation pathway in yeast
is the MAP kinase, Hog1p [9]. Its homologue from                          2.1. Strains, growth conditions and plasmid preparation
C. albicans has been isolated through yeast comple-
mentation [10]. The main effects of the disruption of                         The C. albicans strains used for this study are listed in
the C. albicans Hog1 were not only on osmoregula-                         Table 1. C. albicans strains were grown routinely at
tion, but also on morphogenesis and pathogenesis                          30 °C in YPD medium (1% yeast extract, 2% peptone,
[11]. These phenomena were proposed to be due to                          and 2% glucose), synthetic complete medium [0.67%
the accumulation of intracellular glycerol. However,                      (wt/vol) Difco yeast nitrogen base without amino acids
the regulatory control mechanism of intracellular                         and 2% (wt/vol) glucose] and synthetic complete med-
glycerol synthesis has not yet been clarified in                           ium lacking specific nutrients. Escherichia coli strain
C. albicans.                                                              DH5a and LB medium were used for transformation
   In the synthesis of glycerol in the budding yeast                      and plasmid DNA preparation. Plasmid pFLAG-Met3
Saccharomyces cerevisiae, two paralogous genes, the                       was used for cloning of GPP1 in C. albicans. Vector
dl-glycerol 3-phosphate phosphohydrolases GPP1 and                        CIp10-MAL2p was used for cloning and introducing
GPP2/HOR2, encode proteins that control the dephos-                       DOG1 gene into C. albicans. Sequencing of both strands
phorylation of glycerol 3-phosphatate into glycerol                       of DNA was performed by the dideoxy-chain termina-
and phosphate [12]. Interestingly, two other genes,                       tion method [17], using the ABI PRISM dye terminator
encoding the 2-deoxyglucose 6-phosphate phospha-                          cycle sequencing reaction kit (Perkin–Elmer), and reac-
tases Dog1p and Dog2p, are highly homologous to                           tions were analyzed with an automated sequencer
GPP1 and GPP2, but have different defined functions.                        (ABI, Model 377).
These proteins are reported to be involved in
the detoxification of a non-metabolizable analogue of                      2.2. DNA and RNA manipulations
glucose, 2-deoxyglucose through conversion of 2-
deoxy-D-glucose 6-phosphate to 2-deoxy D-glucose                             Recombinant DNA, genomic DNA and RNA han-
and orthophosphate [13]. However, only GPP2 and                           dling were carried out by standard techniques [18].
DOG1 in S. cerevisiae are responsive to osmoregula-                       Yeast genomic DNA for PCR was prepared according
tion [14]. In humans, glycerol is mainly derived from                     to manufacturerÕs manual (Qiagen Inc, Germany).
triacylglycerol (fat) through lipolysis, and not directly                 Southern blot hybridizations were carried out with
from the glycerol-3-phosphate that normally forms fat                     a-32p-dCTP labeled hybrid probe as shown in Fig. 2.
through sequential addition of three fatty acids                          The 512 bp PCR amplicon with primers (GPP1-locus-
[15,16]. In fact, the biochemical synthesis of glycerol                   R, 5 0 -TCCAATGATTTCCACA TTCG-3 0 , and GPP1-
seems to be absent in mammals.                                            URA3-F, 5 0 -TTATACCATCCAAATCCCGC-3 0 ) was
   Thus, we reasoned that the synthesis of glycerol in                    radioactively labeled by random priming with Ready-
C. albicans could be a potential target for the drug devel-               To-Go DNA labeling Beads (Amersham, USA) and
opment, given that the accumulation of intracellular                      was used as a hybridization probe following standard
glycerol affects cellular growth characteristics. Here,                    procedures [18]. Total RNA from C. albicans was iso-
we report the identification of the GPP homologous                         lated from 50 mg (wet weight) samples by the method
genes from the human fungal pathogen C. albicans                          described in Qiagen Inc., and fractionated by electro-
and characterize the salt sensitivity that resulted from                  phoresis in a 1.5% formaldehyde agarose gel. Nucleic
the knockout of the GPP1 gene.                                            acids were transferred to hybond-N nylon membranes


Table 1
C. albicans strains used in this study
Strain                                              Genotype                                                                Reference
SC5314                                              Wide type                                                               [36]
RM1000                                              ura3::imm434/ura3::imm434, his1::hisG/his1::hisG                        [37]
RM1000+                                             RM1000; URA3/HIS1                                                       This   study
JF1                                                 RM1000 gpp1::HIS1/GPP1                                                  This   study
JF1U                                                JF1 Met3-GPP1::URA3                                                     This   study
JF1+                                                JF1 GPP1::URA3                                                          This   study
JF34                                                RM1000 gpp1::HIS1/gpp1::URA3-dp1200                                     This   study
JF34lp1                                             RM1000 gpp1::HIS1/gpp1::dpl200                                          This   study
JF34lp+                                             JF34lp1 GPP1::URA3                                                      This   study
JF11                                                RM1000 dog1:HIS1/DOG1                                                   This   study
JF11/MAL2-DOG1                                      JF11 MAL2-DOG1::URA3                                                    This   study
                                        J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116                                       109

as recommended by the manufacturer and Northern                           lated using PROTDIST. These distances were estimated
hybridization was performed under stringent conditions                    by using the Dayhoff PAM matrix setting, and the gene-
using standard protocols. The 1.5-kb ClaI–SalI frag-                      alogy was estimated by using the Neighbor-Joining
ment from the C. albicans actin gene [19] was used as                     algorithm (NEIGHBOR) in PHYLIP. Bootstrap values
a probe in control hybridization.                                         were calculated using the method of Felsenstein in PHY-
                                                                          LIP [21] with 100 replications. Protein sequence motifs
2.3. Sequence analyses                                                    were identified via an iterative MEME/MAST approach
                                                                          (http://meme.sdsc.edu) [22].
   The predicted amino acid sequences of GPPs and
DOGs in S. cerevisiae were used to search the C. albicans                 2.4. Gene knockout procedure
genome database assembly (Version 19) at the Stanford
DNA Sequencing and Technology Center (www-                                   Single and double allelic knockouts of the GPP1 gene
sequence.stanford.edu/group/candida). Sequencing of                       (orf19.5437/orf19.12892) were achieved by the proce-
C. albicans was accomplished with the support of the                      dure described previously [23]. In brief, URA3-dpl200
NIDR and the Burroughs Wellcome Fund. The data-                           and/or His1 cassettes were PCR-amplified with the
base searches were performed using the TBLASN algo-                       introduction of flanking 60 bp of target genes at 5 0 -
rithm with default settings [20]. The predicted amino                     end and 3 0 -end of each open reading frame (ORF).
acid sequences of each selected genes were aligned using                  The PCR products were directly used to sequentially
the PILEUP program of the GCG Wisconsin sequence                          transform a suitable host strain through electroporation
analysis package (Wisconsin Package Version 10.0-                         [24]. Primers were designed based on the predicted geno-
UNIX, Genetics Computer Group (GCG), Madison,                             mic sequence of each target gene (Fig. 2), and are listed
Wisc., 1999). Phylogenetic analyses were performed                        in Table 2. Correct insertion and deletion of the Ura3
using programs in the Phylogeny Inference Package                         and/or His1 marker were checked by PCR using specific
(PHYLIP), version 3.57c [21]. For distance-based meth-                    primers (Fig. 2(a)). The colonies producing a correct
ods, pairwise distances between each protein were calcu-                  PCR pattern were further checked by Southern blot

Table 2
Oligonucleotides used in this study
Primer                Sequencea                                                                               Purpose
GPP1DISURA3-R         TCTGAATTCTGGAGAGATTTCGGAAAAACTAGACCTCATGTTGATCC                                         GPP1 gene disruption
                      AGAAGAAATTATCGTTTTCCCAGTCACGACGTT
GPP1DISURA3-F         TTGAATTCGTCAGTTTCCTTGTTGTATGAGTCGATTCTAAAGC TGGAT                                       GPP1 gene disruption
                      AAATCTTTGACAACTGTGGAATTGTGAGCGGATA
GPP1DISHIS1-R         TCTGAATTCTGGAGAGATTTCGGAAAAACTAGACCTCATGTTG ATCCA                                       GPP1 gene disruption
                      GAAGAAATTATCGGTACCTGGAGGATGAGGAG
GPP1DISHIS1-F         TTGAATTCGTCAGTTTCCTTGTTGTATGAGTCGATTCTAAAGCT GGATA                                      GPP1 gene disruption
                      AATCTTTGACAACAATATTTATGAGAAACTATCACTTC
DOG1DISURA3-R         GATTCCACTGCTGCTGTTGAAAAGACTTGGGAAAACCAAGTG AATCAA                                       DOG1 gene disruption
                      CACAATCAAGAGGTTTTCCCAGTCACGACGTT
DOG1DISURA3-F         AAACTAGTTTAACTGCTTCCCCTGATTGCTCGATTTTAACTTT GGTAAAAT                                    DOG1 gene disruption
                      CTTCAACAACTGTGGAATTGTGAGCGGATA
DOG1DISHIS1-R         GATTCCACTGCTGCTGTTGAAAAGACTTGGGAAAACCAAGTG AATCAACA                                     DOG1 gene disruption
                      CAATCAAGAGGGTACCTGGAGGATGAGGAG
DOG1DISHIS1-F         AAACTAGTTTAACTGCTTCCCCTGATTGCTCGATTTTAACTTTGG TAAAATC                                   DOG1 gene disruption
                      TTCAACAACAATATTTATGAGAAACTATCACTTC
GPP1-locus-R          TCCAATGATTTCCACATTCG                                                                    Confirmation of GPP1 disruption
GPP1-URA3-F           TTATACCATCCAAATCCCGC                                                                    Confirmation of GPP1 disruption
GPP1-HIS-F            TCTGCCCTTTTTAGGAACAGC                                                                   Confirmation of GPP1 disruption
GPP1-out-F            TTGAGCAAATACCGACAACC                                                                    Confirmation of GPP1 disruption
DOG1-locus-R          TTTTCCAGAATATAAAAGGTTGGC                                                                Confirmation of DOG1 disruption
DOG1-URA3-F           CGAATCAATGGCACTACAGC                                                                    Confirmation of DOG1 disruption
DOG1-HIS-F            CTGCCCTTTTTAGGAACAGC                                                                    Confirmation of DOG1 disruption
DOG1-out-F            ATGCCCACAACTGTGAAACC                                                                    Confirmation of DOG1 disruption
DOG1Mal2-R            GCACGCGTCAAATGACAGAAATCGTCAC                                                            Cloning of partial DOG1
DOG1Mal2-F            GCTCTAGAGGATTATTTTTTTCATTCAATG                                                          Cloning of partial DOG1
CIp10-R               ACGCCAAGCGCGCAATTAACC                                                                   Detection of insert orientation
Flag-GPP1R            GCCTGCAG ATGACAAAGACTCAACAACC                                                           GPP1 revertant
Flag-GPP1F            GCGCATGC AGCAGATTCTTGTAAAAATTGC                                                         GPP1 revertant
 a
   Italics indicate sequences with homology to Ura3 or His1 markers. Underlined characters indicate restriction enzyme sites introduced for the
convenient cloning of each gene.
110                               J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116

analysis using a hybrid probe originating from the Ura3/           prototrophic transformants were selected on SD agar
His1 marker and target gene to rule out possible off-               plates without uridine and/or histidine.
target insertion (Fig. 2(c)). Loop-outs of the Ura3-marker
from the chromosome were selected by growing the cells
                                                                   2.8. Quantitative dilution assays and plate assay
overnight in SD medium without adding histidine and
uridine, and then plating the cells on minimal medium
                                                                      Saturated cultures of C. albicans strains were diluted
supplemented with uridine (50 lg/ml) and 5-fluoroorotic
                                                                   into SD liquid medium. A serial dilutions of cell suspen-
acid (5-FOA) (200 lg/ml). A conditional knockout of
                                                                   sions from an initial OD600 = 0.5 were spotted onto SD
the DOG1 gene (orf19.10895/Orf19.3392) was made by
                                                                   solid medium with or without uridine and/or histidine
introducing a Mal2-DOG1 linearized plasmid derived
                                                                   and incubated at 30 or 37 °C for 3 days.
from vector CIp10-MAL2p [25]. The plasmid, named
as CIp10-Mal2-DOG1, contains a fragment of the 5 0
end of the DOG1 ORF at the cut-sites of MuI/XbaI that              2.9. Measurement of intracellular glycerol
was then linearized by NcoI before transformation.
                                                                      Determination of intracellular glycerol was done
2.5. PCR amplifications                                             spectrophotometrically with a commercial glycerol
                                                                   determination kit (Boehringer-Mannheim Biochemicals)
   Pfu polymerase (New England Biolabs, USA) was                   as described in the instructions from the manufacturer.
used for PCR to generate DNA fragments used in gene                In brief, cells were grown overnight in selection medium
knockout, cloning steps and/or as probes. PCR buffers               (SD) with supplements of uridine or histidine. A 10 ml
and conditions were those suggested by the manufac-                culture of YPD was re-inoculated with 1:50 of the over-
turer. PCR was carried out in a thermal cycler 480 (Per-           night culture, and was grown to OD600 = 0.5 (about
kin–Elmer) with a first cycle at 94 °C for 2 min, followed          4 h). Then the cells were treated with 0.5 M NaCl for
by 30 cycles of annealing at 55 °C for 1 min. Elongation           45 min by adding 10 ml of 1 M NaCl in YPD, or treated
was performed at 72 °C for 2 min. The different primers             with YPD only as control. To collect the cells, the 20 ml
used for PCR are described in Table 2. C. albicans DNA             cultures were spun down and the pellets were washed
templates for PCR were prepared from overnight cul-                and resuspended in 2 ml of 0.5 M Tris–HCl, pH 7.5,
tures by mechanical breakage with glass beads, and then            by vortexing. One ml was heated at 95 °C for 10 min
used DNeasy Plant Mini Kit following the procedure in              and then centrifuged at low-speed (about 5000 rpm for
the manufacturerÕs manual (Qiagen Inc, Germany).                   30 s). The supernatant was used for glycerol determina-
                                                                   tion according to the manufacturerÕs specifications.
2.6. Re-introduction of the wild-type GPP1 gene                    Glycerol concentrations were normalized to the weight
                                                                   of each pellet. Data represent the average of three inde-
     For re-integration of a single copy of the GPP1 gene          pendent experiments.
into the gpp1/gpp1 deletion mutant JF34, the C. albicans
wild-type GPP1 gene on a 765-bp fragment was ampli-
fied from genomic DNA of strain SC5314 by standard                  3. Results and discussion
PCR with primers Flag-GPP1R (5 0 -GCCTGCAGAT-
GACAAAGACTCAACAACC-3 0 ) and Flag-GPP1F                            3.1. Identification of S. cerevisiae GPP orthologues in
(5 0 -GCGCATGCAGCAGATTCTTGTAAAAATTGC-                              C. albicans
3 0 ). The resulting PCR product was digested with PstI
and SphI, and ligated into plasmid pFlag-Met3 at the                  In S. cerevisiae, two GPPs are closely related to each
PstI and SphI sites [26], resulting in plasmid pFlag-              other with 95% amino acid identity. These form a new
Met3-GPP1. Plasmid pFlag-Met3-GPP1 was digested                    family of low molecular weight phosphatases together
with StuI and transformed into the gpp1/gpp1 strain                with two DOGs, which encode highly homologous
JF34lp1 to generate the gpp1/gpp1 + GPP1 comple-                   enzymes capable of dephosphorylating 2-deoxyglucose-
mented strain JF34lp+. Integration was confirmed by                 6-phosphate [14]. To identify the GPP homologous se-
PCR with primers Flag-GPP1R/Flag-GPP1F.                            quences from C. albicans, we used BLAST programs
                                                                   to search the C. albicans genome database for S. cerevi-
2.7. C. albicans transformation                                    siae GPP1 homologues and adopted an established phy-
                                                                   logenetic method to predict the functions of each
   C. albicans strains were transformed by electropora-            homologous sequence from C. albicans. Two genes were
tion [24]. PCR products were directly used for the                 found that possessed, respectively, 46% and 38% identi-
GPP1 gene deletion, and the plasmids were linearized               ties in amino acid sequence to that of the GPPs and
with StuI and then transformed for reintroduction of               DOGs from S. cerevisiae. We used MEME as a motif
the GPP1 gene into C. albicans. Uridine and/or histidine           discovery tool and obtained five motifs, which occur in
                                  J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116                               111

most of the selected sequences (Fig. 1(a)). Interestingly,         cells. The revertants were confirmed by direct PCR of
motif 1 with a consensus sequence DXDG(T/V/L), con-                the GPP1 encoding gene (data not shown).
tains a hydrolase signature DXDXT/V [28]. This motif
at the N-terminus of GPP1 and/or DOG1 and most of                  3.3. GPP1 can account for the high osmo-resistance of
the other sequences selected may indicate a functional             C. albicans
importance within the class of low molecular weight
phosphatases (Fig. 1(a)). Four sequences in the align-                 The ability to obtain the homozygous gpp1/gpp1 mu-
ment, including GS1 that encodes a human protein of                tant in C. albicans suggests that GPP1 is not essential for
unknown function [27], have a threonine replaced by a              cell viability. However, a gpp1/gpp2 double mutant in
leucine at the position +5 in the motif DXDXT/V                    S. cerevisiae is hypersensitive to stress growth conditions
(Fig. 1(a)); this may affect their conserved functions.             [12]. To determine whether the gpp1/gpp1 mutant of
The first aspartate in the motif was previously reported            C. albicans is sensitive to NaCl, the homozygous mutant
to be phosphorylated and strictly conserved in a large             was tested against a serial salt dilution (Fig. 3). The result
family of hydrolases comprising phosphatases and halo-             showed that the growth of the gpp1/gpp1 mutant, when
acid dehalogenases [28,29].                                        compared to the heterozygote and wild-type parental
   Phylogenetic analysis demonstrated that the two                 strains, was strongly inhibited by increased salinity.
genes from C. albicans were GPP1 and DOG1 ortho-                       Using similar disruption strategies, we disrupted a
logues, suggesting that the two genes in C. albicans have          single allele of DOG1 gene, but were not able to obtain
diverged from each other before species separation from            the dog1/dog1 homozygous mutant, which indicates
S. cerevisiae. GPP1 (orf19.5437/orf19.12892) from                  either that DOG1 gene is essential for C. albicans sur-
C. albicans contains an open reading frame (ORF)                   vival, or that deletion may damage other essential genes
encoding a putative protein of 254 amino acids with a              adjacent to its locus. In support of the later assumption
calculated molecular mass of 28.1 kDa, while DOG1                  there are only 241 bp between the terminus of the DOG1
(orf19.10895/Orf19.3392) from C. albicans contains an              gene and the presumed promoter region of its neighbor-
ORF with 240 amino acids and a molecular mass of a                 ing gene encoding a dead box helicase (orf19.3393/
26.1-kDa. The predicted amino acid sequences encoded               orf19.10896). Nevertheless, we constructed a conditional
by GPP1 and DOG1 exhibit high similarities with the                mutant using the MAL2 promoter (data not shown) and
sequences of other members of the haloacid dehalogen-              compared this strainÕs growth under the same saline
ase hydrolase/phosphatase superfamily from other                   conditions. It appears that DOG1 has a different role
organisms including humans, but the GPP1 and DOG1                  from that of GPP1 (Fig. 3), which is consistent with
genes belong to one of the two main distinct phyloge-              their distinct physiological functions in S. cerevisiae [13].
netic clades with 99% bootstrap support, suggesting that               To examine whether the reduced resistance to salt ob-
they are distantly related to the homologous gene GS1              served above was directly caused by the deletion of the
from humans (Fig. 1(b)).                                           GPP1 gene, we reintroduced GPP1 under control of
                                                                   the MET3 promoter on an integrating plasmid
3.2. Chromosomal deletion of GPP1                                  into the gpp1/gpp1 homozygous mutant. In the reinte-
                                                                   grant the reduced resistance to salt was reversed back
   To illuminate the functions of GPP1, we deleted both            to that of the wild type and parental strains (Fig.
chromosomal copies of the gene in C. albicans (Fig. 2).            3(c)). The gene products of GPP1 and GPP2 in S. cere-
The central part of the GPP1 coding regions was re-                visiae have been shown to be similar in enzymatic activ-
placed sequentially by PCR products of His1 and                    ities, but only GPP2 is regulated by osmotic stress
URA3-dpl200 with using two flanking sequences of the                [12,14]. In C. albicans, it seems that the unique GPP1
target gene for gene deletion through homologous                   gene is essential for salt resistance.
recombination (Fig. 2(a)). Out of 60 transformants from
the first round of transformation, 50% had the PCR                  3.4. GPP1 null mutant cells exhibit reduced
amplicon insertion at the GPP1 locus based on a PCR                accumulation of intracellular glycerol
screening strategy (Fig. 2(b)). The colonies with a right
sized PCR product were picked for further Southern                    Glycerol is of great importance as an osmolyte in the
blot analysis. The pattern of Southern hybridization               cellular response to stresses. To synthesize large
with the 512 bp target gene/Ura3 hybrid probe was con-             amounts of glycerol in response to stress, the pathway-
sistent with integration of the Ura3 and His1 cassettes at         related enzymes have to be activated. To examine
the GPP1 loci uniquely (Fig. 2(c)). To re-introduce the            whether the transcription of the GPP1 gene in the
deleted genes, the mutants were grown on FOA-contain-              wild-type strain is related to stress conditions, Northern
ing SD agar plates to obtain UraÀ strains through elim-            hybridization with a GPP1 probe was analyzed and
inating the URA3 marker, and then a plasmid construct              compared with that using an Act1 probe as a control.
containing a functional gene was transformed into the              GPP1 transcription was weakly detected in the
112   J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116
                                          J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116                                           113




Fig. 2. Disruption of the C. albicans GPP1 gene. (a) Restriction maps of the C. albicans GPP1 gene and disruption strategy for the GPP1. (b) PCR
analysis of transformants with GPP1 gene disruption. M. 1 Kb ladder. Lane 1, JF1 (gpp1/GPP1); Lane 2, Rm1000; Lane 3, JF34 (gpp1/gpp1), and
Lane 4, JF1 (gpp1/GPP1), Lane 5, JF34 (gpp1/gpp1); Lane 6, Sc5314. His1, PCR using His1-specific primers; Ura3, PCR using Ura3-specific primers;
GPP1, using GPP1-specific primers. (c) Southern blot analysis of tranformants with PCR-based gene disruption. Lane 1, Sc5314; Lane 2, JF1 (gpp1/
GPP1); Lane 3, JF34 (gpp1/gpp1). The probe used was the 512 bp PCR amplicon using primer GPP1-locus-R/GPP1-out-F (see Table 2) and is
indicated in panel A as black solid bar. Genomic DNAs were digested with ClaI and HindIII. The relevant genotypes of the strains used for DNA
analysis are indicated under the lanes. The exact sizes of expected hybridizing DNA fragments are indicated on the right.


untreated cells, whereas cells treated with higher salt                      GPP1 in the white/opaque transition has not been well
concentrations exhibited a higher lever of GPP1 mRNA                         established, these motifs, together with two putative
(Fig. 4(a)). The results demonstrated that GPP1 was                          TATAA boxes and two CAATA boxes in the same
highly up-regulated by the stress response, consistent                       region, suggest that the expression of the GPP1 gene
with a function in the osmoregulation.                                       has the potential to be highly regulated. In fact, gen-
   In the 5 0 -nontranslated regions of the GPP1 gene                        ome-wide transcriptional profiling has showed that the
from C. albicans there were two canonical nuclear factor                     GPP1 gene is up-regulated in white cells [35], and a com-
1-like proteins (NF1) binding sites (TGGCA), and two                         prehensive microarray analysis has reported the GPP1
hexameric repeats (HR), TTGCTA, which are found                              gene to be significantly repressed upon induction of hy-
in WHI1 gene from C. albicans [30,31] (data not shown).                      phal growth [32].
It seems that GPP1 gene may also plays a role in white/                         Because the ultimately controlled product of GPP1
opaque transition. Even though the potential role of                         is the accumulation of glycerol, we measured the


b
Fig. 1. Comparison of the C. albicans homologues of Saccharomyces cerevisiae GPP1/GPP2 and DOG1/DOG2 to other sequences of GPP- and DOG-
related proteins. (a) Deduced amino acid alignments for GPP- and DOG-sequences from C. albicans and 13 members of the haloacid dehalogenase
hydrolase/phosphatase superfamily from other species. The GenBank Accession Nos. of the sequences used here are as follows: Aspergillus nidulans
(GPP_an), AF043232; Sinorhizobium meliloti (GPP_sm), CAB01954; Escherichia coli (GPP_ec), AAG57422; Drosophila melanogaster (GPP_dm),
AE003586; D. melanogaster (GS1L_dm), Q94529; Human (GS1), XP_010289; Schizosaccharomyces pombe (Hydro_sp), T40833; Streptomyces
coelicolor (GPP_sco), CAB76079; Mycobacterium tuberculosis (Hydro_mt), (AAK47845); S. cerevisiae (ScDOG1), NP_011910; S. cerevisiae
(ScDOG2), NP_011909; S. cerevisiae (ScGPP1/rh2), NP_012211; S. cerevisiae (ScGPP2/hor2), NP_010984. Alignments were made using the PILEUP
program of the GCG Wisconsin sequence analysis package. Residues conserved in complete or 100% conserved, 80% or greater conserved, and 60%
or greater conserved, are highlighted in black, dark grey, and light grey, respectively. The top two levels are also distinguished by either upper or
lower case characters on the consensus line. Similar amino acids are defined by Higgins et al. [34]. Dashes indicate gaps introduced to facilitate
alignment. Solid bars indicate the conserved region in motif, DXDXT/V of the hydrolases/phosphatases, and other motifs obtained from the MEME/
MAST searches. (b) Unrooted protein phylogeny for GPP- and DOG-like sequences from C. albicans and other organisms. This tree was produced
using the neighbor-Joining algorithm with the PHYLIP 3.5 package [21] on the core 246 aa of sequence conserved between all selected hydrolases/
phosphatases. The numbers at the nodes represent the bootstrap percentages (100 bootstrap resamplings), showing only those larger than 50%. The
bold value on the node and thicker branch represent the two main phylogenetic clades. The scale bar indicates the estimated number of amino acid
substitutions per site.
114                                       J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116




                                                                           Fig. 4. The expression of the GPP1 is responsive to different
                                                                           concentrations of NaCl. (a) Northern blot analysis of GPP1
                                                                           expression in response to different concentrations of NaCl. Total
                                                                           RNA was isolated from exponential phase Sc5314 cell grown in YPD
                                                                           containing 0, 0.75, 1.0, and 1.5 M of NaCl. The blot was probed
                                                                           using GPP1 full ORF. A PCR-amplified DNA fragment of the C.
                                                                           albicans actin gene (ACT1) was used as control. (b) Comparison of
                                                                           intracellular glycerol accumulation among wild type (1), parental (2),
                                                                           single chromosomal copy mutant (3), and double chromosomal
                                                                           copies mutant (4), and revertant (5) strains, subjected to NaCl in
Fig. 3. Sensitivity of GPP1 knockout strains to NaCl compared to           YPD medium. The intracellular glycerol content was measured from
wild types. C. albicans cells were grown to exponential phase in           3 independent experiments after the addition of 0.5 M NaCl (solid
selection medium and then diluted to OD600 = 0.5. A serial dilution of     bars) to exponentially growing cultures. As a non-omostressed
cells from 10À3 to 10À7 were made as show above each panel, and then       control, one-half of the culture received just YPD medium (open
spotted onto SD plates (10 ll each). The plates were incubated at 30 °C    bars).
for 3 days (a), and incubated at 37 °C for 3 days (b) before
microphotographs were taken. (c) Reintroduction of the GPP1 gene
restored its salt resistance. The revertant strain was constructed from
the null mutant for GPP1 with a functional GPP1 gene driven by the         The revertant possesses a single copy of the GPP1
MET3 promoter. The GPP1 ORF was cloned into a plasmid pFLAG-               gene inserted into the RP10 locus; the glycerol values
Met3 [26], and then the plasmid was used to transform the null mutant      in the revertant were similar to that of heterozygous
strains for GPP1 gene to make a revertant (JF34lp+). Wild type,
                                                                           mutant, consistent with our expectations. The C. albi-
parental, revertant, and mutant strains were grown in SD medium,
diluted, and spotted on SD plates. The plates were incubated at 30 °C      cans GPP1 has a function similar to that of GPP2 in
for 3 days.                                                                S. cerevisiae, the gene is responsible for osmoregula-
                                                                           tion in yeast, whereas GPP1 in S. cerevisiae appears
intracellular concentrations of glycerol in the gpp1/                      to play a different role in the physiology of the organ-
gpp1 mutant and in its parental strains in the presence                    ism [12]. Nevertheless, the level of glycerol accumula-
of 0.5 M NaCl (Fig. 4(b)). The results showed that                         tion is a mechanism essentially responsible for the
glycerol accumulation in the gpp1/gpp1 mutant upon                         salt-tolerance in C. albicans. Since intracellular accu-
exposure to salt was significantly lower than that of                       mulation of glycerol also plays a role in germination
its parental strain, the heterozygous mutant or the                        of some fungi and in penetration of the cuticles of rice
revertant (Fig. 4(b)), indicating that GPP1 signifi-                        blastÕs host plants [33], a further study on the function
cantly contributes to glycerol synthesis in C. albicans.                   of glycerol in hyphal formation and in other stress
                                          J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116                                          115

conditions should help provide us with new insights                        [11] Alonso-Monge, R., Navarro-Garcia, F., Molero, G., Diez-Orejas,
into the virulence factors of C. albicans.                                      R., Gustin, M., Pla, J., Sanchez, M. and Nombela, C. (1999) Role
                                                                                of the mitogen-activated protein kinase Hog1p in morphogenesis
                                                                                and virulence of Candida albicans. J. Bacteriol. 181, 3058–3068.
                                                                           [12] Pahlman, A.K., Granath, K., Ansell, R., Hohmann, S. and Adler,
4. Conclusions                                                                  L. (2001) The yeast glycerol 3-phosphatases Gpp1p and Gpp2p
                                                                                are required for glycerol biosynthesis and differentially involved in
   We have identified two GPP homologues (GPP1 and                               the cellular responses to osmotic, anaerobic, and oxidative stress.
                                                                                J. Biol. Chem. 276, 3555–3563.
DOG1) from C. albicans by phylogenetic sequence anal-                      [13] Randez-Gil, F., Blasco, A., Prieto, J.A. and Sanz, P. (1995)
ysis. The gene disruption of the GPP1 orthologue from                           DOGR1 and DOGR2: two genes from Saccharomyces cerevisiae
C. albicans showed that it plays an important role in the                       that confer 2-deoxyglucose resistance when overexpressed. Yeast
intracellular glycerol-mediated osmoregulation. Conse-                          11, 1233–1240.
quently, the GPP orthologue of C. albicans may contrib-                    [14] Norbeck, J., Pahlman, A.K., Akhtar, N., Blomberg, A. and
                                                                                Adler, L. (1996) Purification and characterization of two isoen-
ute to pathogenesis in humans. Since the expression of                          zymes of DL-glycerol-3- phosphatase from Saccharomyces cere-
the GPP1 gene is significantly up-regulated by high salin-                       visiae. Identification of the corresponding GPP1 and GPP2 genes
ity, but down-regulated during the yeast/hyphae- and                            and evidence for osmotic regulation of Gpp2p expression by the
white/opaque-transitions in C. albicans [32,35], further                        osmosensing mitogen-activated protein kinase signal transduction
study on the mutant GPP1 gene should clarify the biolog-                        pathway. J. Biol. Chem. 271, 13875–13881.
                                                                           [15] Bartley, J.A. and Ward, R. (1985) Glycerol kinase deficiency
ical function of glycerol in this human pathogenic yeast.                       inhibits glycerol utilization in phosphoglyceride and triacylglyc-
                                                                                erol biosynthesis. Pediatr. Res. 19, 313–314.
                                                                           [16] Lee, D.P., Deonarine, A.S., Kienetz, M., Zhu, Q., Skrzypczak,
Acknowledgements                                                                M., Chan, M. and Choy, P.C. (2001) A novel pathway for lipid
                                                                                biosynthesis: the direct acylation of glycerol. J. Lipid Res. 42,
                                                                                1979–1986.
   This work was supported by Visiting Fellowships in                      [17] Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequenc-
Canadian Government Laboratories from the Natural                               ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA
Sciences and Engineering Research Council of Canada                             74, 5463–5467.
to J.F. through the NRC GHI program. We acknowl-                           [18] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular
                                                                                Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor
edge help and advice received from Denis Banville and
                                                                                Laboratory Press, New York, USA.
Zhenbao Yu (BRI, NRC, Canada). We wish to thank                            [19] Losberger, C. and Ernst, J.F. (1989) Sequence of the Candida
             ´
Denis LÕAbee for technical support.                                             albicans gene encoding actin. Nucleic Acids Res. 17, 9488.
                                                                           [20] Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,
                                                                                Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-
                                                                                BLAST: a new generation of protein database search programs.
References                                                                      Nucleic Acids Res. 25, 3389–3402.
                                                                           [21] Felsenstein, J. (1995) PHYLIP (Phylogeny Inference Package)
 [1] Odds, F.C. (1988) Candida and Candidosis: A Review and                     Version 3.572. Distributed over the World Wide Web, Seattle.
     Bibliography, 2nd edn. Bailliere Tindall, London, UK.                 [22] Bailey, T.L. and Elkan, C. (1994) Fitting a mixture model by
 [2] Cutler, J.E. (1991) Putative virulence factors of Candida albicans.        expectation maximization to discover motifs in biopolymers.
     Annu. Rev. Microbiol. 45, 187–218.                                         Proc. Int. Conf. Intell. Syst. Mol. Biol. 2, 28–36.
 [3] Kobayashi, S.D. and Cutler, J.E. (1998) Candida albicans hyphal       [23] Wilson, R.B., Davis, D. and Mitchell, A.P. (1999) Rapid
     formation and virulence: is there a clearly defined role? Trends            hypothesis testing with Candida albicans through gene disruption
     Microbiol. 6, 92–94.                                                       with short homology regions. J. Bacteriol. 181, 1868–1874.
 [4] Cowen, L.E., Nantel, A., Whiteway, M.S., Thomas, D.Y.,                [24] De Backer, M.D., Maes, D., Vandoninck, S., Logghe, M.,
     Tessier, D.C., Kohn, L.M. and Anderson, J.B. (2002) Population             Contreras, R. and Luyten, W.H. (1999) Transformation of
     genomics of drug resistance in Candida albicans. Proc. Natl. Acad.         Candida albicans by electroporation. Yeast 15, 1609–1618.
     Sci. USA 99, 9284–9289.                                               [25] Backen, A.C., Broadbent, I.D., Fetherston, R.W., Rosamond,
 [5] Rogers, T.R. (2002) Antifungal drug resistance: does it matter?.           J.D., Schnell, N.F. and Stark, M.J. (2000) Evaluation of the
     Int. J. Infect. Dis. 6 (Suppl. 1), S47–S53.                                CaMAL2 promoter for regulated expression of genes in Candida
 [6] Sleator, R.D. and Hill, C. (2002) Bacterial osmoadaptation: the            albicans. Yeast 16, 1121–1129.
     role of osmolytes in bacterial stress and virulence. FEMS             [26] Umeyama, T., Nagai, Y., Niimi, M. and Uehara, Y. (2002)
     Microbiol. Rev. 26, 49–71.                                                 Construction of FLAG tagging vectors for Candida albicans.
 [7] Xu, J.R. (2000) Map kinases in fungal pathogens. Fungal Genet.             Yeast 19, 611–618.
     Biol. 31, 137–152.                                                    [27] Yen, P.H., Ellison, J., Salido, E.C., Mohandas, T. and Shapiro, L.
 [8] Hohmann, S. (2002) Osmotic stress signaling and osmoadaptation             (1992) Isolation of a new gene from the distal short arm of the
     in yeasts. Microbiol. Mol. Biol. Rev. 66, 300–372.                         human X chromosome that escapes X-inactivation. Hum. Mol.
 [9] Brewster, J.L., de Valoir, T., Dwyer, N.D., Winter, E. and Gustin,         Genet. 1, 47–52.
     M.C. (1993) An osmosensing signal transduction pathway in             [28] Collet, J.F., Stroobant, V., Pirard, M., Delpierre, G. and Van
     yeast. Science 259, 1760–1763.                                             Schaftingen, E. (1998) A new class of phosphotransferases
[10] San Jose, C., Monge, R.A., Perez-Diaz, R., Pla, J. and Nombela,            phosphorylated on an aspartate residue in an amino-terminal
     C. (1996) The mitogen-activated protein kinase homolog HOG1                DXDX(T/V) motif. J. Biol. Chem. 273, 14107–14112.
     gene controls glycerol accumulation in the pathogenic fungus          [29] Kobor, M.S., Archambault, J., Lester, W., Holstege, F.C.,
     Candida albicans. J. Bacteriol. 178, 5850–5852.                            Gileadi, O., Jansma, D.B., Jennings, E.G., Kouyoumdjian, F.,
116                                        J. Fan et al. / FEMS Microbiology Letters 245 (2005) 107–116

     Davidson, D.R., Young, R.A. and Greenblatt, J. () An unusual           [33] De Jong, J.C., McCormack, B.J., Smirnoff, N. and Talbot, N.J.
     eukaryotic protein phosphatase required for transcription by                (1997) Glycerol generates turgor in rice blast. Nature 389, 244–245.
     RNA polymerase II and CTD dephosphorylation in S. cerevisiae.          [34] Higgins, D.G., Bleasby, A.J. and Fuchs, R. (1992) CLUSTAL V:
     Mol. Cell 4, 55–62.                                                         improved software for multiple sequence alignment. Comput.
[30] Paonessa, G., Gounari, F., Frank, R. and Cortese, R. (1988)                 Appl. Biosci. 8, 189–191.
     Purification of a NF1-like DNA-binding protein from rat liver           [35] Lan, C.Y., Newport, G., Murillo, L.A., Jones, T., Scherer, S.,
     and cloning of the corresponding cDNA. EMBO J. 7, 3115–3123.                Davis, R.W. and Agabian, N. (2002) Metabolic specialization
[31] Srikantha, T., Chandrasekhar, A. and Soll, D.R. (1995) Func-                associated with phenotypic switching in Candida albicans. Proc.
     tional analysis of the promoter of the phase-specific WHI1 gene of           Natl. Acad. Sci. USA 99, 14907–14912.
     Candida albicans. Mol. Cell Biol. 15, 1797–1805.                       [36] Gillum, A.M., Tsay, E.Y. and Kirsch, D.R. (1984) Isolation of the
[32] Nantel, A., Dignard, D., Bachewich, C., Harcus, D., Marcil, A.,             Candida albicans gene for orotidine-5 0 -phosphate decarboxylase
     Bouin, A.P., Sensen, C.W., Hogues, H., van het, H.M., Gordon,               by complementation of S. cerevisiae ura3 and E. coli pyrF
     P., Rigby, T., Benoit, F., Tessier, D.C., Thomas, D.Y. and                  mutations. Mol. Gen. Genet. 198, 179–182.
     Whiteway, M. (2002) Transcription profiling of Candida albicans         [37] Negredo, A., Monteoliva, L., Gil, C., Pla, J. and Nombela, C.
     cells undergoing the yeast-to-hyphal transition. Mol. Biol. Cell 13,        (1997) Cloning, analysis and one-step disruption of the ARG5,6
     3452–3465.                                                                  gene of Candida albicans. Microbiology 143 (Pt 2), 297–302.
                                          FEMS Microbiology Letters 245 (2005) 117–121
                                                                                                                  www.fems-microbiology.org




                  Direct transformation of a clinical isolate of
             Candida parapsilosis using a dominant selection marker
                                     ´
                             Attila Gacser, Siegfried Salomon, Wilhelm Schafer
                                                                          ¨                                   *

                 Center of Applied Molecular Biology, University of Hamburg, Ohnhorststrasse 18, D-22609 Hamburg, Germany

                        Received 20 August 2004; received in revised form 28 January 2005; accepted 25 February 2005

                                                    First published online 9 March 2005

                                                       Edited by N. Gunde-Cimerman




Abstract

   Candida parapsilosis is a human pathogenic fungus with increasing importance, particularly in nosocomial infections. For
detailed molecular genetic explorations of prototrophic clinical isolates of C. parapsilosis, we developed an efficient transformation
system based on a dominant selectable marker. The gene encoding resistance to mycophenolic acid (MPA) was used for selection in
yeast transformation. C. parapsilosis cells were transformed with a plasmid vector containing the Candida albicans inosine mono-
phosphate dehydrogenase gene (IMH3) responsible for mycophenolic acid resistance. Transformation was carried out both by elec-
troporation and by the lithium acetate (LiAc) method. The LiAc method resulted in very poor transformation efficiency, while the
modified electroporation method yielded a high number of mitotically stable transformants exhibiting unambiguous MPA resis-
tance. Two hundred transformants were analysed for the presence of the C. albicans IMH3r gene by polymerase chain reaction. Inte-
gration of single or multiple plasmid copies into the genomic DNA of C. parapsilosis was determined by Southern hybridization. To
our knowledge, the present study is the first report about a method based on a dominant selectable marker for the transformation of
a prototrophic, clinical isolate of C. parapsilosis. The described technique may prove to be an efficient tool for the examination of the
biology and virulence of this pathogenic yeast.
Ó 2005 Published by Elsevier B.V. on behalf of the Federation of European Microbiological Societies.

Keywords: Candida parapsilosis; Transformation system; Human pathogen; Mycophenolic acid resistance; Pathogenic yeast




1. Introduction                                                          ical surveys have illustrated the increasing impact of
                                                                         non-C. albicans infections [1–4]. Although C. parapsilo-
   Several yeast species are among the agents causing                    sis is described as a harmless commensal of the normal
opportunistic infections in humans and mammals. Can-                     human microflora residing on skin surfaces [5,6], it is
didiases are of the greatest clinical importance among                   also an important pathogen commonly isolated from
them. Candida albicans is clearly the predominant spe-                   pathological lesions of the nails and skin [7]. Further-
cies of Candida mycoses, however, a series of recent clin-               more, this species has recently emerged as an important
                                                                         nosocomial pathogen [8–10]. Clinical manifestations in-
                                                                         clude fungemia, endocarditis, endophtalmitis, septic
 *
   Corresponding author. Tel.: +49 40 42816 266; fax: +49 40 42816       arthritis, and peritonitis. The shift from a non-patho-
513.
   E-mail address: schaefer@botanik.uni-hamburg.de (W. Schafer).
                                                            ¨
                                                                         genic inhabitant into a pathogen is triggered by predis-
   URL:     http://www.biologie.uni-hamburg.de/bzf/mppg/mppg.htm         posing host factors or by iatrogenic factors such as
(W. Schafer).
       ¨                                                                 antibiotic treatment, vascular catheters, parenteral

0378-1097/$22.00 Ó 2005 Published by Elsevier B.V. on behalf of the Federation of European Microbiological Societies.
doi:10.1016/j.femsle.2005.02.035
118                                   ´
                                  A. Gacser et al. / FEMS Microbiology Letters 245 (2005) 117–121

nutrition as well as immunosuppressants used for cancer             phosphate dehydrogenase) from C. albicans responsible
therapy and organ transplantation [4,11–13]. Several                for MPA resistance. The plasmid was digested with
interesting biological features potentially related to              XbaI and the 2704 bp fragment containing IMH3r was
pathogenicity (e.g., proliferation in high concentrations           cloned into XbaI digested pBluescript vector resulting
of glucose or lipids, adherence to prosthetic materials,            in the plasmid pMPA (Fig. 1). Isolation of this plasmid
colonization of human hands, and possibly resistance                                ´
                                                                    from E. coli DH5a was carried out with the alkaline lysis
to new antifungal agents [2]) may provide C. parapsilosis           procedure according to Sambrook et al. [17].
with a selective advantage in the modern medical envi-
ronment. The molecular genetic studies of C. parapsilo-             2.3. Methods for the transformation of C. parapsilosis
sis are difficult, as it has cells that are diploid and/or
aneuploid, and a sexual cycle is unknown. However,                     The LiAc method for transformation of C. parapsilo-
the possibility to transfer exogenous, in vitro modified             sis was performed according to the protocol of Gietz
DNA into cells of different yeast species significantly               and Schiestl [18]. The cells were centrifuged after heat
contributed to the understanding of various biological              shock, resuspended in 5 ml of YPG medium and incu-
phenomena at the molecular level. A transformation                  bated with gently shaking at 30 °C for 3 h. Aliquots of
system based on complementation of a galactokinase-                 the cell suspension were spread on YPG plates contain-
deficient mutant of C. parapsilosis by the homologous                ing 200 lg MPA/ml.
galactokinase gene (Gal1) was described previously by                  Electroporation was carried out as described by
Nosek et al. [14].                                                  Becker and Guarente [19], with certain modifications.
   The aim of this study was to develop a transforma-               Cells of C. parapsilosis GA-1 were grown in 500 ml of
tion system for clinical isolates of C. parapsilosis, which         YPG at 30 °C to a density of approximately 108 cells/
is based on the gene responsible for MPA resistance                 ml. The cells were pelleted at 5000g and suspended in
(IMH3r: inosine monophosphate dehydrogenase) as a                   100 ml TE buffer (10 mM Tris–HCl, pH 7.5, 1 mM
dominant selectable marker [15]. Dominant selection                 EDTA, pH 7.5) containing 0.1 M LiAc. The suspension
systems have advantages over selection based on com-                was incubated in a rotary shaker at 150 rpm for 45 min
plementation, as they require neither the isolation of              at 30 °C. After addition of 2.5 ml 1 M dithiothreitol, the
mutants, nor complementation assays. Such an ap-                    suspension was kept in the shaker for additional 15 min.
proach would greatly facilitate the study of molecular              Cells were diluted to 500 ml with water, washed with ice-
characteristics in the case of clinical C. parapsilosis iso-        cold water and subsequently with ice-cold 1 M sorbitol,
lates, resulting in a better understanding of their patho-          and resuspended in 1 ml 1 M sorbitol.
genicity mechanisms.                                                   Cells in a total volume of 40 ll were used with or
                                                                    without plasmid DNA for electroporation experiments.
                                                                    The transformation mixture was transferred to an ice-
2. Materials and methods                                            cold electroporation cuvette (0.2-cm gap) (Bio Rad)
                                                                    and pulsed at 1.5 kV, 25 lF, 200 X for 5 ms in a Electro-
2.1. Microorganisms and culture conditions                          porator 2510 (Eppendorf). Cells were immediately resus-
                                                                    pended in YPG containing 1 M sorbitol and incubated
   The wild-type strain GA-1, a clinical C. parapsilosis            at 30 °C for 4 h before being plated on YPG/1 M sorbi-
isolate was obtained by Dr. Neuber of the University                tol plates supplemented with 200 lg MPA/ml.
Clinic Hamburg–Eppendorf. It was grown in YPG med-
ium containing 1% (w/v) yeast extract, 1% (w/v) bacto
peptone and 2% (w/v) glucose. Transformed isolates
were maintained in YPG containing 250 lg MPA/ml.
Cultures were grown at 30 °C in an orbital shaker at
                                          ´
180 rpm. The Escherichia coli strain DH5a (Invitrogen)
used for the propagation of plasmids was cultured in
Luria–Bertani medium containing 1% (w/v) tryptone,
0.5% (w/v) yeast extract, 1% (w/v) NaCl with 100 lg
ampicillin/ml. For solid media, 2% agar was added prior
to autoclaving.

2.2. Transformation vector

  Plasmid pSFL1 [16] was kindly provided by Dr. J.                  Fig. 1. Structure of the vector pMPA used in the transformation
Morschhauser, Wu
        ¨       ¨rzburg, Germany. It contains the                   experiments. The direction of transcription of the IMH3r gene is
IMH3r gene, a mutated form of IMH3 (inosine mono-                   indicated by arrows.
                                     ´
                                 A. Gacser et al. / FEMS Microbiology Letters 245 (2005) 117–121                             119

2.4. Isolation of chromosomal DNA and Southern                     sis of guanosine monophosphate [22]. The IMH3r gene –
hybridization                                                      which is a mutated form of the IMH3 allele À is able to
                                                                   confer MPA-resistance [15] and can be used as a domi-
   Isolation of genomic DNA was performed as de-                   nant selectable marker for transformation. In the case of
scribed elsewhere (http://www.fhcrc.org/labs/breeden/              C. parapsilosis GA-1, concentrations of 150 lg/ml and
Methods/genomic_DNAprep.html). A 5-ml overnight                    200 lg/ml MPA yielded complete inhibition of cell
culture was pelleted and washed, followed by vortexing             growth in liquid synthetic minimal medium (YCB) and
of the cells with glass beads in a lysis buffer (10 mM              liquid complete medium (YPG), respectively. Growth
Tris–HCl, pH 8.0, 1mM EDTA, 100 mM NaCl, 1%                        inhibition on solid media was also tested. No colonies
SDS, 2% Triton X-100) for 2 min. The supernatant                   appeared when 108 cells were spread onto a YPG-agar
was recovered and 275 ll 7 M ammonium acetate (pH                  plate containing 200 lg/ml MPA. The results of these
7.0) was added. After 5 min of incubation at 65 °C,                experiments suggested that IMH3r can be used as a
the sample was left on ice for additional 5 min. Then              dominant selection marker also for the transformation
500 ll chloroform was added and the sample was centri-             of C. parapsilosis.
fuged for 2 min at 21,000g. The aqueous phase contain-
ing the DNA was precipitated with 1 ml isopropanol.                3.2. Transformation of C. parapsilosis
The pellet was washed with 70% (v/v) ethanol, air-dried,
and resuspended in 50 ll H2O containing 10 lg RNase                   The transformations were carried out either by the
A/ml. The quality and quantity of the isolated DNA                 LiAc method or by electroporation, the transformation
were determined by 0.8% agarose gel electrophoresis in             vector pMPA (Fig. 1) was used in a circular or an XbaI
1% TBE. Southern blots were performed according to                 digested form. Using the LiAc procedure with a digested
Sambrook et al. [17]. Probe labelling and detection were           vector, we observed an extremely low transformation effi-
carried out using a non-radioactive digoxigenin (DIG)              ciency (0.1 transformants/lg plasmid DNA). No trans-
labelling kit (Roche).                                             formants were obtained with the circular plasmid. Due
                                                                   to this low transformation rate, a different method was
2.5. PCR analysis of transformants                                 developed. Transformation via electroporation was per-
                                                                   formed as described by Becker and Guarente [19] with
   Genomic DNA of each colony that grew on the selec-              some modifications. The cells treated with electric pulse
tion plates after transformation with pMPA was ana-                were incubated at 30 °C in YPG liquid medium contain-
lysed for the presence of the IMH3r gene. The 5 0 and 3 0          ing 1 M sorbitol prior to spreading on MPA-containing
primers specific for the resistance gene were M1 (AAAT-             plates, as it was shown that preincubation is essential to
GGTAAAGTTGGCGGTAAA) and M2 (TGTCA-                                 obtain antibiotic-resistant transformants [23]. No
CGTGCGTCTAAAAATCATA), respectively. PCR                            MPA-resistant colonies were obtained when cells were
amplification included 30 cycles of 3 min at 94 °C, 30 s            spread on the selection plate immediately after the pulse
at 57 °C, and 45 s at 72 °C with a final elongation step            treatment. The monitoring experiments indicated that 3 h
of 10 min.                                                         of incubation after the electroporation are sufficient for
                                                                   expression of the IMH3r resistance gene. When the elec-
                                                                   troporation method was employed with 20 lg of the di-
3. Results and discussion                                          gested form of pMPA, an average of approximately 150
                                                                   colonies appeared (Fig. 2). No transformants grew after
3.1. Determination of antifungal susceptibility                    electroporation with the undigested plasmid and there
                                                                   were no colonies in the negative control. Consequently,
   Candida parapsilosis strain GA-1 proved to be natu-             the electroporation method was almost 100-fold more
rally resistant to many drugs and chemical substances.             efficient than the LiAc procedure for the transformation
Frequencies of spontaneous resistant mutants at 200                of C. parapsilosis. In addition, the results indicate that the
lg/ml zeocin and at 350 lg/ml hygromycin B were more               frequency of C. parapsilosis transformation can be in-
than 30% and 10% of the plated cells, respectively (data           creased with the linearization of the vector.
not shown). The emerging of resistance at such high fre-
quencies preclude the use of these compounds for the               3.3. Stable integration of the resistance gene into
selection of transformants.                                        the C. parapsilosis genome
   The gene IMH3r which confers resistance to the anti-
biotic mycophenolic acid (MPA) has been successfully                  To determine the presence of the IMH3r gene, total
used as a selectable marker to transform C. albicans               DNAs of 19 transformants and the wild-type strain were
and C. dubliniensis [15,20,21]. MPA represses the growth           analysed by PCR with specific primers. An amplicon
of yeast cells by inhibiting inosine monophosphate                 with the expected length (1250 bp) was detected in the
(IMP) dehydrogenase activity in the de novo biosynthe-             case of all examined transformants, while the fragment
120                                       ´
                                      A. Gacser et al. / FEMS Microbiology Letters 245 (2005) 117–121




Fig. 2. Selection for MPA resistance nine days after transformation. (A) Control YPG-MPA plate with untransformed cells. (B) Resistant colonies
on YPG medium with 250 lg mlÀ1 mycophenolic acid.


could not be amplified from the wild-type DNA (Fig. 3).                    ing single copy integration of the IMH3r gene, which
These results demonstrate that the MPA resistance gene                    seems to be sufficient to confer MPA resistance to
was transformed into the cells of C. parapsilosis. The                    C. parapsilosis.
IMH3r gene originates from the yeast C. albicans. To
test the potential similarity between the sequences of
the IMH3 genes of C. parapsilosis and C. albicans which
could result in homologous recombination, we per-
formed Southern blot analysis using C. albicans IMH3r
as a probe. The negative results of this experiment sug-
gest that there is no significant homology between the
IMH3 genes of C. parapsilosis and C. albicans (data
not shown).
   Southern blot analysis using genomic DNA digested
with HindIII – a restriction enzyme which does not cleave
pMPA À was used to show that the IMH3r gene was
incorporated into the genome and to determine the copy
numbers of integration (Fig. 4). No hybridization signal
was observed in the untransformed control strain. Multi-
ple integrations were observed in the case of 15 trans-
                                                                          Fig. 4. Southern blot analysis of DNA from the wild type strain (wt)
formants (lanes: 2, 4, 5, 6, 8, 9, 10, 11, 15, 16, 17, 18, 19,            and 23 transformants (lanes 1–23). Genomic DNAs were digested with
20, 21). A single band was detected in the case of eight                  HindIII, hybridization was carried out with the IMH3r gene as a probe.
transformants (lanes 1, 3, 7, 12, 13, 14, 22, 23), suggest-               Arrows indicate single copy integrations.




Fig. 3. PCR amplification of a part of the IMH3r gene integrated into the genome of C. parapsilosis transformants. Control: wild type; marker:
GeneRuler DNA Ladder Mix (Fermentas).
                                             ´
                                         A. Gacser et al. / FEMS Microbiology Letters 245 (2005) 117–121                                        121

    The results show that the vector integrates randomly                    [7] Weems, J.J. (1992) Candida parapsilosis: epidemiology, pathoge-
in approx. 80% of all cases. On the other hand, in ap-                          nicity, clinical manifestations, and antimicrobial susceptibility.
                                                                                Clin. Infect. Dis. 14, 756–766.
prox. 20% of all transformants the integration seems                        [8] Abi-Said, D., Anaissie, E., Uzun, O., Raad, I., Pinzowski, H. and
to occur at a putative hotspot of the genome: the upper                         Vartivarian, S. (1997) The epidemiology of hematogenous candi-
band in lanes 1, 2, 3 and 17, 18, 19 may be the result of                       diasis caused by different Candida species. Clin. Infect. Dis. 24,
vector integration at the same genomic locus. As there is                       1122–1228.
no significant homology between the IMH3 genes of                            [9] Huang, Y.C., Lin, T.Y., Lien, R.I., Chou, Y.H., Kuo, C.Y.,
                                                                                Yang, P.H. and Hsieh, W.S. (2000) Candidemia in special care
C. parapsilosis and C. albicans, the integration hotspot                        nurseries: comparison of albicans and parapsilosis infection. J.
may be the result of microhomologies within the                                 Infect. 40, 171–175.
IMH3 gene or elsewhere in the genome of C. parapsilo-                                                                   ´
                                                                           [10] Alonso-Valle, H., Acha, O., Garsıa-Palomo, D.J., Farinas-
sis. It is also possible that the resolution of the gel is not                  ´                  ´
                                                                                alvarez, C., Fernandez-Mazarrasa, C. and Ferina, M.C. (2003)
sufficient for the differentiation between fragments lar-                          Candidemia in a tertiary care hospital: epidemiology and factors
                                                                                influencing mortality. Eur. J. Clin. Microbiol. Infect. Dis. 22, 254–
ger then 10 Kb.                                                                 257.
    In summary, the dominant transformation system                         [11] Kojic, E.M. and Darouiche, R.O. (2003) Comparison of adher-
developed in this study can be applied to transform clin-                       ence of Candida albicans and Candida parapsilosis to silicone
ical isolates of C. parapsilosis. The electroporation based                     catheters in vitro and in vivo. Clin. Microbiol. Infect. 9, 684–690.
on MPA-resistance and a linearized vector is a highly                      [12] Lewis, R.E., Kontoyiannis, D.P., Darouiche, R.O., Raad, I.I. and
                                                                                Prince, R.A. (2002) Antifungal activity of amphotericin B,
efficient system for transforming C. parapsilosis. Fur-                           fluconazole, and voriconazole in an in vitro model of Candida
thermore, we showed that the transforming DNA inte-                             catheter-related bloodstream infection. Antimicrob. Agents Che-
grated into the genome of C. parapsilosis and that a                            mother. 46, 3499–3505.
single copy of the IMH3 allele is sufficient to confer                       [13] Weems, J.J., Chamberland, M.E., Ward, J., Willy, M., Padhye,
resistance to mycophenolic acid.                                                A.A. and Solomon, S.L. (1987) Candida parapsilosis fungemia
                                                                                associated with parenteral nutrition and contaminated blood
    These results provide a good basis for a detailed ge-                       pressure transducers. J. Clin. Microbiol. 25, 1029–1032.
netic analysis in the case of this human pathogenic yeast.                                       ´     ´               ´         ´ˇ
                                                                           [14] Nosek, J., Adamıkova, L., Zemanova, J., Tomaska, L., Zufferey,
The presented promising method may help us to eluci-                            R. and Mamoun, C.B. (2002) Genetic manipulation of the
date whether homologous recombination occurs in                                 pathogenetic yeast Candida parapsilosis.. Curr. Genet. 42, 27–35.
C. parapsilosis and whether transformation mediated                        [15] Beckerman, J., Chibana, H., Turner, J. and Magee, P.T. (2001)
                                                                                Single-copy IMH3 allele is sufficient to confer resistance to
gene disruption is possible.                                                    mycophenolic acid in Candida albicans and to mediate transfor-
                                                                                mation of clinical Candida species. Infect. Immun. 69, 108–114.
                                                                           [16] Wirsching, S., Michel, S. and Morschauser, J. (2000) Targeted
                                                                                                                          ¨
                                                                                gene disruption in Candida albicans wild-type strains: the role of
References                                                                      the MDR1 gene in fluconazole resistance of clinical Candida
                                                                                albicans isolates. Mol. Microbiol. 36, 856–865.
 [1] Cassone, A., Bernardis, F., Pontieri, E., Carruba, G., Girmenia,      [17] Sambrook, J., Fritsch, E.R. and Maniatis, T. (1998) Molecular
     C., Martino, P., Fernandez-Rodriguez, M., Quindos, G. and                  Cloning: a Laboratory Manual, second ed. Cold Spring Harbor
     Ponton, J. (1995) Biotype diversity of Candida parapsilosis and its        Laboratory Press, Cold Spring Harbor, NY.
     relationship to the clinical source and experimental pathogenicity.   [18] Gietz, R.D. and Schiestl, R.H. (1995) Transforming yeast with
     J. Infect. Dis. 171, 967–975.                                              DNA. Methods Mol. Cell. Biol. 5, 255–269.
 [2] Lupetti, A., Tavanti, A., Davini, P., Ghelardi, E., Corsini, V.,      [19] Becker, D.M. and Guarente, L. (1991) High-efficiency transfor-
     Merusi, I., Boldrini, A., Campa, M. and Senesi, S. (2002)                  mation of yeast by electroporation. Meth. Enzymol. 194, 182–187.
     Horizontal transmission of Candida parapsilosis candidemia in         [20] Kohler, G.A., White, T.C. and Agabian, N. (1997) Overexpres-
     a neonatal Intensive Care Unit. J. Clin. Microbiol. 40, 2363–              sion of a cloned IMP dehydrogenase gene of Candida albicans
     2369.                                                                      confers resistance to the specific inhibitor mycophenolic acid. J.
 [3] Bendel, C.M. (2003) Colonization and epithelial adhesion in the            Bacteriol. 179, 2331–2338.
     pathogenesis of neonatal candidiasis. Semin. Perinatol. 27, 357–      [21] Wirsching, S., Moran, G.P., Sullivan, D.J., Coleman, D.C. and
     364.                                                                       Morschhauser, J. (2001) MDR1-mediated drug resistance in
                                                                                          ¨
 [4] Mullen, C.A., El-Baki, H.A., Samir, H., Tarrand, J.J. and                  Candida dublinensis. Antimicrob. Agents Chemother. 45, 3416–
     Rolston, K.V. (2003) Non-albicans Candida is the most common               3421.
     cause of candidemia in pediatric cancer patients. Support Care        [22] Jackson, R.C., Weber, G. and Weber, H.G. (1975) Inosine
     Cancer 11, 321–325.                                                        monophosphate dehydrogenase: an enzyme linked with prolifer-
 [5] Njoku-Obi, A.N.U., Okafor, J.I. and Gugnani, H.C. (1976)                   ation and malignancy. Nature 256, 331–333.
     Yeast-like fungi recovered from normal human skin in Nsukka           [23] Webster, T.D. and Dickson, R.C. (1983) Direct selection of
     (Nigeria). Antonie van Leeuwenhoek 42, 101–105.                            Saccharomyces cerevisiae resistant to the antibiotic G418 follow-
 [6] Mok, W.Y. and Barreto da Silva, M.S. (1984) Mycoflora of the                ing transformation with a DNA vector carrying the kanamycin-
     human dermal surfaces. Can. J. Microbiol. 30, 1205–1209.                   resistance gene of Tn903. Gene 26, 243–252.
                                               FEMS Microbiology Letters 245 (2005) 123–129
                                                                                                                   www.fems-microbiology.org




           Chemiluminescence of enterococci isolates from freshwater
                                       a,*,1
               Philippe Andre                  , Catherine Metzger a, Sophie Petey a, Daniel Muller b,
                                                    Dominique J.-M. Vidon a
                       a
                         U.F.R. des Sciences Pharmaceutiques, UE-3429, 74 route du Rhin, B.P. 24, 67401 Illkirch Cedex, France
           b                              ´                           ´
               Laboratoire de Dynamique, Evolution et Expression des genomes de micro-organismes, FRE 2326 ULP/CNRS 28, rue Goethe,
                                                          67083 Strasbourg Cedex, France

                          Received 14 December 2004; received in revised form 2 February 2005; accepted 28 February 2005

                                                       First published online 19 March 2005

                                                                Edited by A. Oren




Abstract

   All Enterococcus spp., isolated from environmental water samples (n = 81), emitted a high chemiluminescence signal in the pres-
ence of luminol (10À2 M). Kinetic studies of chemiluminescence show a close correlation between chemiluminescence and growth
curves during the exponential phase, with a maximum chemiluminescence reached just before bacterial growth entered in the
stationary phase. On the other hand, genera closely related to Enterococcus such as Streptococcus or Lactococcus produced a very
weak chemiluminescent signal. Chemiluminescence of enterococci could therefore offer a rapid test, in aiding the identification of the
genus Enterococcus and in the survey of the microbiological quality of water supplies.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Chemiluminescence; Enterococcus; Water




1. Introduction                                                                Enterococcus spp. are natural members of the human
                                                                            and warmblood animal intestinal flora. Enterococcus fae-
   At present, the genus Enterococcus contains 30 spe-                      calis is the dominant species found in human feces [5],
cies. They are Gram-positive catalase negative cocci that                   but Enterococcus faecium, Enterococcus hirae, Enterococ-
grow in nutrient medium containing 6.5% NaCl, 40%                           cus avium, and Enterococcus durans have also been co-
bile salts, and at pH 9.6. Most of them can also grow                       isolated [6]. In the dairy cow, E. faecium is the predomi-
at 10 and 45 °C and can survive exposure at 60 °C for                       nant species isolated [7] but E. faecalis, E. hirae and
30 min [1]. Enterococci have recently acquired particular                   Enterococcus casseliflavus are also found [8]. Further-
medical relevance because of their increased disease                        more, enterococci are frequently isolated in soil, plants,
causing incidence [2,3], emerging as major nosocomial                       vegetables [9], in a variety of small-scale cheeses pro-
pathogens [4].                                                              duced from cow, goat and buffalo milk [10] and in vari-
                                                                            ous foods [11]. Because of their high concentration in
 *
                                                                            feces and their long survival in the environment, entero-
   Corresponding author. Tel.: +33 03 90 24 41 43; fax: +33 00 90 24        cocci have been proposed as water fecal contamination
42 86.
   E-mail address: andre@pharma.u-strasbg.fr (P. Andre).
                                                                            indicators [12,13]. Epidemiological studies have indeed
 1
   New address: U.F.R. des Sciences Pharmaceutiques, UMR CNRS               demonstrated a strong correlation between the presence
7034, 74 route du Rhin, B.P. 24, 67401 Illkirch Cedex, France.              of enterococci in water and disease risk [14]. Isolation

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.036
124                              P. Andre et al. / FEMS Microbiology Letters 245 (2005) 123–129

and enumeration of enterococci are usually obtained by             a river (Siegelwasser n = 10) (Strasbourg, France).
a membrane filter technique followed by growth on Sla-              Water samples were analyzed by the standard mem-
netz and Bartley agar (SBA) medium [15]. However, it               brane filter method, with a final incubation on BEA agar
has been shown by Figueras et al. [16] that enumeration            (BioRad, France) at 37 °C. Presumed enterococci were
and detection of water enterococci with this medium                defined as the black isolates that grew on BEA medium.
show a very low specificity. In order to produce more               Samples of the Strasbourg river were analyzed using
reliable results, these authors suggested transferring the         SBA (Institut Pasteur Production, France) for filter cul-
entire membrane onto bile-esculin agar. Presently, the             tures, without transfer on BEA agar. Suspect colonies,
European standard for water quality – detection and                pink to brown, with a diameter around 1 mm, were di-
enumeration of intestinal enterococci – membrane                   rectly assayed for CL and species characterization.
filtration method (ISO 7899-2:2000) recommends the                     Bacteria were kept at À80 °C in BHI broth (BioRad,
membrane filtration technique on SBA medium followed                France) supplemented with 20% glycerol. Before each
by a transfer to bile-esculin-azide (BEA) agar. Only               experiment, one loopful of bacteria was scratched from
black colonies growing on BEA agar can be considered               the frozen surface of the stock culture, seeded on a slant
as intestinal enterococci.                                         of tryptic soy agar (TSA) (BioRad, France), and grown
   It has been reported that different bacterial species            aerobically at 37 °C overnight.
such as Listeria monocytogenes [17], Listeria innocua                 All type strains used in this study are listed in Table 2.
[18] and lactic acid bacteria [19] produce a weak chemi-           Two laboratory strains have been used: Staphylococcus
luminescence (CL). This phenomenon is correlated with              epidermidis and Staphylococcus xylosus.
the production of superoxide anion, H2O2 and other
reactive oxygen species (ROS) [20]. Luminol is the most            2.2. Phenotypic species characterization
commonly used CL probe for measuring OÀ concentra-
                                             2
tion in biological systems [21] and hence has been used               Identification of the different strains was achieved
to detect the ROS production by different bacteria such             using the biochemical keys of Schlegel and Bouvet [26]
as Staphylococcus aureus [22] or Listeria spp. [23]. We            and Manero and Blanch [27]. Isolates were tested for
have previously shown that the addition of luminol in-             the production of yellow pigment, arginine di-hydrolase
creases 10-fold the CL produced by L. monocytogenes                (ADH) (BioRad, France) production, tellurite 0.04%
[24] and used this property to develop a simple CL-                reduction, mobility and the production of acid from
based method for rapid enumeration of Listeria spp.                L-arabinose, lactose, mannitol, D-raffinose, and ribose
microcolonies in raw milk [18]. Huycke et al. [25] re-             (Sigma, France). For all E. durans and E. hirae strains,
cently reported that under inhibition of bacterial                 production of acid from methyl a-D glucopyranoside
respiration E. faecalis produced large amounts of extra-           (Sigma, France) was negative. One strain (F9H) has
cellular superoxide, which is generated in the presence of                                                          ´
                                                                   been identified by the Vitek JR System (bioMerieux,
fermentable sugar (glucose, gentobiose, cellobiose or              France).
D-mannose) by the cell membrane through univalent
reduction of oxygen by reduced demethylmenaquinone.                2.3. Sequencing of the 16S-rRNA-encoding DNA and
They show that if E. faecalis respiratory chain is                 phylogenetic analysis
impaired by lack of access to haematin, a cofactor for
cytochrome bd, or to fumarate, a terminal electron                    Chromosomal DNA was isolated from a 10 ml over-
acceptor, extracellular superoxide is generated by par-            night culture in Luria–Bertani broth (Difco, France).
tially reduced demethylmenaquinone.                                Cells pellets of the culture were resuspended in 400 ll
   In the present study, we show that all enterococci iso-         TE (10 mM Tris–HCl, 1 mM EDTA) (Euromedex,
lated from water on BEA agar or SBA medium by mem-                 France), 400 ll saturated Phenol, and 1.2g glass beads
brane filter technique can also emit, in brain-heart                (0.25–0.5 mm). The tubes were shaken at maximum
infusion (BHI) broth, a CL signal. We used this prop-              speed in a beadbeater (Retsh MM2) for 6 min and were
erty to develop a chemiluminescence based method for               kept cool on ice for 30 min. Following centrifugation at
a faster characterization of the genus Enterococcus.               12000g for 15 min, the clear supernatants were trans-
                                                                   ferred into new 2 ml microfuge tubes. DNA was precip-
                                                                   itated using 1 volume isopropanol, then pooled onto a
2. Materials and methods                                           glass rod, washed by dipping the end of rod into 1 ml
                                                                   of 70% ethanol and finally was resuspended in 100 ll
2.1. Bacteria isolation and growth conditions                      TE. The nearly full length 16S-rDNA was amplified
                                                                   using bacterial primers 5 0 -AGAGTTTGATCCTGGCT-
   Enterococci isolates (n = 81) were obtained from var-           CAG-3 0 (fD1) and 5 0 -AAGCTTAAGGAGGTGATC-
ious freshwater sources provided by the Institut de                CAGCC-3 0 (rD1) [28]. Identification of the strains was
Recherche Hydrologique de Colmar (n = 71) and from                 performed using the BLAST program [29] and The
                                         P. Andre et al. / FEMS Microbiology Letters 245 (2005) 123–129                                      125

Ribosomal Database Project (RDP) http://rdp.cme.                              sponding to 1.0–3.0 · 108 CFU was added to 9 ml of
msu.edu/html/ [30].                                                           BHI broth. For the CL determination, 0.1 ml of BHI
                                                                              broth was mixed with 0.1 ml of 1.0 M sodium carbonate
2.4. Chemiluminescence and bacterial growth                                   and 0.1 ml of 10À4 M luminol (Sigma France). CL was
measurements                                                                  then measured for 10 s at room temperature with a
                                                                              Lumac M-2500 Biocounter (Perstorp Analytical) and
   All isolated Enterococcus strains from BEA or SBA                          expressed in relative light unit (RLU). Background CL
medium and the type strains were tested for CL produc-                        signal was very low (around 1000 RLU) and was re-
tion. Overnight cultures on TSA at 37 °C suspended in                         moved from all measurements. Bacterial growth was
distilled water to an absorbance (A620) of 0.156 were                         monitored by measuring A620 of vortexed cultures at
used as the inoculum. One ml of this inoculum corre-                          37 °C with a digital photometer (Dr Lange, Germany).



Table 1
Phenotypical identification of enterococci isolates from freshwater
Species                Tellurite   Pigment   Mobility   ADH    Biochemical test resultsa                       Strains
                                                               L-Ara   Lact    Mann    D-Raff   Ribo    Sorbi
E.   avium             À           À         À          À      +       +       +       À       +       À       F3I
E.   casseliflavus      +           +         À          +      +       +       +       À       +       À       F9J
E.   casseliflavus      À           À         À          À      À       À       +       À       À       À       F10J*
E.   casseliflavus      +           À         +          À      À       À       +       +       +       +       F9C*
E.   casseliflavus      +           +         +          +      +       +       +       +       nd      +       C3M2, C1M1, C1M3
E.   columbae          À           À         À          À      +       +       +       +       +       À       Z11
E.   columbae          À           À         +          À      +       +       +       +       +       À       Z12
E.   durans            +           À         À          +      À       +       À       À       +       À       F3H, F4H
E.   durans            +           À         À          +      À       À       À       À       +       À       F6D*, Z10
E.   faecalis          +           +         À          +      À       +       +       À       +       +       D1M1
E.   faecalis          +           À         À          +      À       +       +       À       +       +       D1M2, C3V2, F10F, F3G F4G,
                                                                                                               F6G,
                                                                                                               F2I, F5I, F9I, FIJ, F3J, F4J, F5J,
                                                                                                               F7B, T1, T2, T4
E. faecalis            À           À         À          +      À       +       +       À       +       +       F2J, F6B
E. faecalis            À           À         À          +      À       +       +       À       +       À       F8G
E. faecalis            +           À         À          À      À       À       À       À       +       À       F7I*, F10C*
E. faecalis            +           À         À          +      À       À       +       À       +       +       Z2, Z4, Z5
E. faecium             À           À         À          +      +       +       À       À       +       À       F1F*, F2F, E2F
E. faecium             +           nd        À          +      +       +       +       À       +       À       F7F, F9F
E. faecium             À           +         À          +      +       +       À       À       +       À       F1H, F2H
E. faecium             +           À         À          +      +       +       +       À       +       À       F1I, E3F
E. faecium             À           nd        À          +      +       +       +       À       +       À       F3F*
E. faecium             À           À         À          +      +       +       +       +       +       À       E4F, C8V2
E. faecium             +           +         À          +      +       +       +       +       nd      À       C8V3
E. gallinarum          +           À         +          +      +       À       +       +       +       +       F8B
E. gallinarum          +           À         +          +      À       +       +       +       +       +       F6C
E. gallinarum          À           +         +          +      +       +       +       +       +       +       F5D*
E. gallinarum          +           +         +          +      +       +       +       +       nd      +       D1M3, A2
E. gallinarum          +           À         +          +      +       +       +       +       nd      +       C1M2, D3A2
E. gallinarum          +           À         +          À      +       +       +       +       +       À       T3
E. hirae               +           +         À          +      À       +       À       À       +       À       F6H
E. hirae               +           À         À          +      À       +       À       À       +       +       F4I
E. mundtii             À           +         À          +      +       +       +       +       +       À       F5F, T5
E. mundtii             +           +         À          À      +       +       +       +       +       À       F8F, F5H, F5C*
E. mundtii             À           +         À          À      +       +       À       À       +       À       F5G*
E. mundtii             +           +         À          +      +       +       +       +       nd      +       B1M2, B1M3
E. pseudoavium         +           À         À          À      À       +       +       À       +       +       F5B, C8V1
E. raffinosus            +           À         À          À      +       +       +       +       nd      +       C3V1
E. sulfureus           +           +         À          À      À       +       À       À       +       À       F4F, F6F, F10H, F6J, F9B
E. sulfureus           +           +         À          À      +       +       +       À       nd      À       B1M1, D3A1
Enterococcus spp.      +           À         À          À      À       À       À       À       À       À       F9H*
Staphylococcus spp.    +           +         À          À      À       À       À       À       +       À       F10I*
 a
     L-Ara, Lact, Mann, D-Raff, Ribo, Sorbi: acid production from L-arabinose, lactose, mannitol, D-raffinose, ribose, and sorbitol.
 *
     Strains identified by sequencing of the 16S-rRNA-encoding DNA. nd: not done.
126                                      P. Andre et al. / FEMS Microbiology Letters 245 (2005) 123–129

3. Results                                                                 identified, respectively, as Staphylococcus spp by
                                                                           16S-rRNA sequencing (99.65% identity) and as Strepto-
3.1. Identification of bacterial isolates from water                        coccus uberis by VITEK JR system.

    As shown in Table 1, the large majority (98.7%) of                     3.2. Chemiluminescence
water isolates on BEA agar or SBA were enterococci.
Eighty one Enterococcus strains were identifiedas E. fae-                      As shown in Fig. 1, there was a good correlation be-
calis (26 strains), E. faecium (13 strains), Enterococcus                  tween CL emitted and the growth curve during growth
mundtii (8 strains), Enterococcus gallinarum (8 strains),                  phase. Both curves were similar and the maximum CL
Enterococcus sulfureus (7 strains), E. casseliflavus (6                     was obtained at the end of the exponential growth phase
strains), E. durans (4 strains), Enterococcus colombae                     and followed by a rapid decrease of CL at the beginning
(2 strains), E. hirae (2 strains), Enterococcus pseudoa-                   of the stationary phase. For all strains (n = 81), the max-
vium (2 strains), E. avium, Enterococcus raffinosus, and                     imum growth level was reached between 4 and 6 h. The
Enterococcus spp. (1 strain each). E. faecalis was the                     maximum CL was obtained just before bacterial growth
most frequently (32.1%) isolated species, followed by                      entered into the stationary phase. This maximum was
E. faecium (14.8%), E. mundtii and E. gallinarum                           dependent on bacterial growth level (data not shown),
(9.8%). Biochemical tests performed revealed a further                     and was followed by a rapid and very sharp drop of
diversity among strains within each species. The reliabil-                 luminescence.
ity of the phenotypic identification keys was question-                        CL patterns were compared for the six most represen-
able for 11 strains which were identified by 16S-rRNA                       tative species (E. faecalis, E. faecium, E. mundtii, E. gal-
sequencing (respectively: F10J E. casseliflavus: 99.3%;                     linarum, and E. sulfureus). The distribution of isolates
F9C E. casseliflavus: 99.44%; F6D E. durans: 99.38%;                        according to CL levels is shown in Fig. 2. For the species
F7I E. faecalis: 99.86%; F10C E. faecalis: 100%; F1F                       E. faecalis (with the exception of three strains), E. fae-
E.faecium: 99.72%; F3F E.faecium: 99.72%; F5D E. gal-                      cium, E. casseliflavus and E. sulfureus, there was a rela-
linarum: 99.93%; F5G E. mundtii: 99.86%; F5C E. mund-                      tive homogenous distribution, while E. mundtii, E.
tii: 99.99%; and F9H E. spp., 99.65% identity). The                        gallinarum showed a larger distribution of CL. As
strains F10I and F9H, obtained on BEA agar, were                           shown in Table 2, all enterococci isolates tested dis-
                                                                           played a CL signal between 76,250 and 309,500 RLU.
                                                                           In the same manner, all enterococci collection strains
                1.4   (A)                                                  emitted a CL signal comprised between 41,500 and
                1.2                                                        396,200 RLU, while the CL emitted by non enterococci
                1.0
       A620nm




                0.8                                                                             9                             9
                                                                                                8                             8
                0.6                                                                             7          E. faecalis        7        E. gallinarum
                                                                                                6                             6
                0.4                                                                             5                             5
                                                                                                4                             4
                0.2                                                                             3                             3
                                                                                                2                             2
                                                                                                1                             1
          5x105                                                                                     1 2 3 4 5 6 7 8 9             1 2 3 4 5 6 7 8 9
                      (B)                                                                       9                             9
                                                                            Number of strains




                                                                                                8                             8
                                                                                                7          E. faecium         7        E. sulfureus
          4x105                                                                                 6                             6
                                                                                                5                             5
                                                                                                4                             4
 RLU




          3x105                                                                                 3                             3
                                                                                                2                             2
                                                                                                1                             1
          2x105
                                                                                                    1 2 3 4 5 6 7 8 9             1 2 3 4 5 6 7 8 9
                                                                                                9                             9
          1x105                                                                                 8                             8
                                                                                                7          E. casseliflavus   7        E. mundtii
                                                                                                6                             6
                                                                                                5                             5
                       1    2    3          4       5        6                                  4                             4
                                                                                                3                             3
                                     Time (h)                                                   2                             2
                                                                                                1                             1
Fig. 1. (A) Growth of E. faecalis CIP 103214 (d), E. casseliflavus CIP                               1 2 3 4 5 6 7 8 9             1 2 3 4 5 6 7 8 9
102598 (n), E. coli CIP 7624 (h), S. agalactiae CIP 104971 (n) and L.
lactis ATCC 11454 (m) in BHI; (B) Chemiluminescence of E. faecalis         Fig. 2. Histogram distribution of the maximal CL signal emitted by
CIP 103214 (d), E. casseliflavus CIP 102598 (h), E. coli CIP 7624 (n),      different enterococci strains. (1) 5 · 104 RLU, (2) 5 · 104–105 RLU, (3)
S. agalactiae CIP 104971(n) and L. lactis ATCC 11454 (m) in BHI.           105–1.5 · 105 RLU, (4) 1.5 · 105–2 · 105 RLU, (5) 2 · 105–2.5 · 105
The results are means of triplicate experiments and bars indicate          RLU, (6) 2.5 · 105–3 · 105 RLU, (7) 3 · 105–3.5 · 105 RLU, (8)
standard deviation.                                                        3.5 · 105–4 · 105 RLU, (9) 4 · 105–4.5 · 105 RLU.
                                         P. Andre et al. / FEMS Microbiology Letters 245 (2005) 123–129                           127

Table 2                                                                    different CL patterns of E. mundtii and E. gallinarum
Maximal CL emitted by different enterococci species isolated from           isolates were poorly discriminated.
freshwater samples, enterococci type strains and non-enterococci
strains
Organism                            Number of       Maximal CLa
                                    isolates        (RLU ± SDb)
                                                                           4. Discussion
E. faecalis                         26              309,500 ± 113,300
E. faecium                          13               81,000 ± 38,700
                                                                              The CL method is based on the detection of photon
E. mundtii                           8              277,500 ± 84,700       emission produced by different probes, such as luminol
E. gallinarum                        8              282,600 ± 98,700       and lucigenine, in response to oxygen metabolites gener-
E. sufureus                          7              178,000 ± 58,200       ated by different cells [21–31]. In the presence of oxygen
E. casseliflavus                      6              303,100 ± 63,500       species, light production emitted by luminol depends on
E. durans                            4               76,200 ± 49,400
E. hirae                             2              212,500 ± 19,400
                                                                           the formation of an unstable endoperoxide or dioxetane,
E. pseudoavium                       2              268,000 ± 66,400       which decomposes to an electronically excited product,
E. columbae                          2              285,000 ± 95,000       which releases a photon as it falls to the basal state. It
E. avium                             1              150,000                has been shown by Yamashoji et al. [32] that after addi-
E. raffinosus                          1              238,000                tion of quinone solution containing metallic salts,
Enterococcus spp.                    1              190,000
Staphylococcus spp.                  1                 9000
                                                                           EDTA, menadione or coenzyme Q1, and luminol, men-
                                                                           adione-catalyzed luminol CL can be used for bacterial
E.   faecalis ATCC 29212                            279,400 ± 43,600
                                                                           detection. In this case, quinone:NAD(P)H reductase
E.   casseliflavus CIP 102598                        396,200 ± 32,400
E.   cecorum CIP 103676                             209,900 ± 6900         localized in the cytosol of the bacteria [33] reduced, in
E.   dispar CIP 103646                               41,500 ± 6600         the presence of oxygen, quinone to quinol and semiqui-
E.   durans CIP 55125                                56,600 ± 7600         nones. This chain of redox reactions enhanced the pro-
E.   flavescens CIP 103525                           282,800 ± 6900         duction of active oxygen species such as OÀ and H2O2.
                                                                                                                        2
E.   malodoratus CIP 103012                          80,900 ± 22,700
                                                                           They used this property to develop a CL assay for detec-
E.   saccharolyticus CIP 103246                     327,300 ± 31,000
                                                                           tion of viable microorganisms.
A. baumanii CIP 7034                                   1200 ± 312             In the case of the Enterococcus genus, we show that in
B. subtilis CIP 7718                                   7100 ± 320
E. coli CIP 7624                                     12,600 ± 5400
                                                                           BHI broth, all enterococci tested produced naturally in
C. freundii CIP 5362                                   2500 ± 812          the presence of luminol a high CL signal. Futhermore,
L. lactis ATCC 11454                                 18,200 ± 5200         as shown by Huycke et al. [25] this effect was dependent
P. aeruginosa CIP 76110                              10,500 ± 4800         on the presence of fermentable sugar (glucose) in the
P. fluorescens CIP 6913                               12,300 ± 5300         medium, since this effect was not observed in tryptic
S. agalactiae CIP 104971                             11,100 ± 7600
                                                                           soy broth, a medium without fermentable sugar (data
S. mitis ATCC 903                                      9300 ± 3200
S. aureus CIP 7625                                   12,300 ± 6300         not shown).
S. epidermidis laboratory strain                       2000 ± 460             We used this property to rapidly detect enterococci
S. xylosus laboratory strain                           7500 ± 1300         from freshwater samples. For all enterococci strains
  a
    Enterococci type strains and non-enterococci strains: means are        tested, the CL signal intensity increased during the expo-
average of triplicate experiments excepted for E. faecalis ATCC 29212,     nential growth phase to reach a maximal value before
n = 15.                                                                    the entrance in the stationary phase, followed by a rapid
  b
    SD: standard deviation.
                                                                           CL decrease. This effect was also described by Yam-
                                                                           ashoji et al. [33] who showed that in the presence of
                                                                           menadione, CL intensity emitted by E. coli increased
strains such as Acinetobacter baumannii, Bacillus subtilis,                during the exponential phase of growth. All main species
Citrobacter freundii, Escherichia coli, Lactococcus lactis,                of enterococci (n = 18) [26] emitted a high signal of CL
Pseudomonas aeruginosa, Pseudomonas fluorescens,                            using luminol as a probe (Table 2), while closely related
Streptococcus agalactiae, Streptococcus mitis, S. aureus,                  Enterococcus genus such as Streptococcus or Lactococ-
S. epidermidis and S. xylosus was very low. A high CL                      cus produced a very weak signal. Furthermore, bacteria
level was produced by E. faecalis (n = 26), E. casselifla-                  such as A. baumannii, C. freundii, E. coli, P. aeruginosa,
vus (n = 6), E. gallinarum (n = 8) and E. mundtii                          and P. fluorescens which are frequently associated with
(n = 8), while E. faecium (n = 13) and E. durans (n = 4)                   freshwater, or an ubiquitous bacteria such as B. subtilis
displayed a lower CL. It is noteworthy that 89% of E.                      do not produce any significant CL. We also tested differ-
faecalis strains produced a CL level higher than                           ent strains of Staphylococcus such as S. aureus, S. xylo-
150,000 RLU, while 92% of E. faecium strains emitted                       sus and S. epidermidis, and one strain of Staphylococcus
a CL signal under this threshold. Similarly, 100% of E.                    spp. isolated from fresh water on BEA medium. None of
sulfureus strains displayed a CL signal lower than                         these strains exhibited a significant CL level. These re-
300,000 RLU, while 85% of E. casseliflavus strains pro-                     sults show that high CL emission using luminol as a
duced a signal above this value. On the other hand, the                    probe is quite specific to the genus Enterococcus.
128                                   P. Andre et al. / FEMS Microbiology Letters 245 (2005) 123–129

   For several species such as E. faecalis, E. faecium, and                    Prokariotes, Vol. 2, pp. 1465–1481. Springer-Verlag, New
E. casseliflavus, we found a good correlation between                           York, NY.
                                                                         [3]   Jett, B.D., Huycke, M.M. and Gilmore, M.S. (1994) Virulence of
bacterial species and CL intensity. By contrast, for E.                        Enterococci. Clin. Microbiol. Rev. 7, 462–478.
mundtii or E. gallinarum, the pattern of the signal was                  [4]   McDonald, L.C., Kuehnert, M.J., Tenover, F.C. and Jarvis, W.R.
very scattered and there was no clear correlation be-                          (1997) Vancomycin-resistant enterococci outside the health-care
tween bacterial species and CL signal.                                         setting: prevalence, sources and public health implications.
   Previous works have shown that extracellular super-                         Emerg. Infect. Dis. 3, 311–317.
                                                                         [5]   Murray, B.E. (1990) The life and times of the Enterococcus. Clin.
oxide production is frequently encountered in several                          Microbiol. Rev. 3, 46–65.
enterococcal species such as E. faecalis, E. faecium, E.                 [6]   Facklam, R.R. and Sahm, D.F. (1995) Enterococcus In: Manual
casseliflavus, and E. gallinarum [34]. This superoxide                          of Clinical Microbiology (Murray, P.R., Baron, E.J., Pfaller,
production accounts for the CL emitted by all entero-                          F.C., Tenover, F.C. and Yolken, R.H., Eds.), 6th Edn, pp. 308–
cocci strains from water in the presence of luminol. It                        314. A.S.M. Press, Washington, DC.
                                                                         [7]   Devriese, L.A., Laurier, L., De Herdt, P. and Haesebrouck, F.
is noteworthy that the strain F10I misidentified as Ente-                       (1992) Enterocococcal and streptococcal species isolated from
cococcu s spp. by biochemical key and which displays a                         faeces of calves. J. Appl. Bact. 72, 29–31.
very low CL level (9000 RLU) has been identified as                       [8]   Devriese, L.A., Van de Kerchove, A., Kilpper-Balz, R. and
                                                                                                                                      ¨
Staphylococcus spp. by 16S-rRNA sequencing. On the                             Schleife, K.H. (1987) Characterization and identification of
other hand, the strain F9H producing a high CL signal                          Enterococcus species isolated from the intestines of animals. Int.
                                                                               J. Syst. Bact. 37, 257–259.
(190,000 RLU) was identified as Streptococcus uberis by                   [9]   Facklam, R.R. and Teixeira, L.M. (1997) Enterococcus In: Topley
VITEK JR system (BioMerieux, France), while 16S-                               and WilsonÕs Microbiology and Microbial Infections (Balows, A.
rRNA sequencing shows its belonging to the genus                               and Duerden, B.I., Eds.), 9th Edn, pp. 669–682. Edward Arnold,
Enterococcus.                                                                  London, UK.
   Samples provided from the Strasbourg areas (n = 10)                  [10]   Andrighetto, C., Knijff, E., Lombardi, A., Torriani, S., Vancan-
                                                                               neyt, M., Kersters, K., Swings, J. and Dellaglio, F.J. (2001)
were obtained by direct water filtration on SBA. CL was                         Phenotypic and genetic diversity of enterococci isolated from
analyzed by directly transferring the characteristic colo-                     Italian cheeses. Dairy Res. 68, 303–316.
nies to BHI broth, while the isolates were identified                    [11]   Franz, C.M.A.P., Holzapfel, W.H. and Stiles, M.E. (1999)
later. In this case, all tested strains (n = 10) produced a                    Enterococci at the crossroads of food safety. Int. J. Food
high CL signal within ±4 h depending on the bacterial                          Microbiol. 47, 1–24.
                                                                        [12]   US EPA (1986) Bacteriological Ambient Water Quality Criteria
species and all of them were identified as enterococci.                         for Marine and Freshwater Recreational Waters. PB86-158-045.
These results showed that using a two-steps technique,                         United States Environmental Protection Agency, Springfield, VA.
CL measuring enables a strong identification of entero-                  [13]   Chenoweth, C. and Schaberg, D. (1990) The epidemiology of
cocci strains from water isolates. Therefore, we propose                       enterococci. Eur. J. Clin. Microbiol. Infect. Dis. 9, 80–89.
a new test based on CL measurement to detect entero-                    [14]   Kay, D., Fleisher, J.M., Salmon, R.L., Jones, F., Wyer, M.D.,
                                                                               Godfree, A.F., Zelenauch-Jacquotte, Z. and Shore, R. (1994)
cocci grown on BEA or SBA medium more rapidly than                             Predicting likelihood of gastroenteritis from sea bathing: results
biochemical test. A strain can be identified as entero-                         from randomised exposure. Lancet 344, 905–909.
cocci by transferring the characteristic colonies directly              [15]   Slanetz, L.W. and Bartley, C.H. (1957) Numbers of enterococci in
to BHI and measuring the CL emitted during 4 or 6 h.                           water, sewage, and feces detremined by the membrane filter
   This work shows that all enterococci strains isolated                       technique with an improved medium. J. Bacteriol. 74, 591–595.
                                                                        [16]   Figueras, M.J., Inza, I., Polo, F.L., Feliu, M.T. and Guarro, J.
from freshwater samples emitted CL amplified by lumi-                           (1996) A fast method for confirmation of fecal streptococci from
nol. This signal is a discriminant help to the identifica-                      M-Enterococcus medium. Appl. Environ. Microbiol. 62, 2177–
tion of the genus Enterococcus.                                                2178.
                                                                        [17]   Roth, J.A. and Kaeberle, M.L. (1980) Chemiluminescence by
                                                                               Listeria monocytogenes. J. Bacteriol. 144, 752–757.
                                                                        [18]   Vidon, D., Donze, S., Muller, C., Entzman, A. and Andre, P.    ´
Acknowledgments                                                                (2001) A simple chemiluminescence-based method for rapid
                                                                               enumeration of Listeria spp. microcolonies. J. Appl. Microbiol.
   We thank Dr. Niamh Gilmartin for the English                                90, 988–993.
correction.                                                             [19]   Vogel, R. and Sussmuth, R. (1999) Weak light emission patterns
                                                                                                ¨
                                                                               from lactic acid bacteria. Luminescence 14, 99–105.
                                                                        [20]   Allen, R.C. (1979) Chemiluminescence from eukaryotic and
                                                                               prokaryotic cells: reducing potential and oxygen requirements.
References                                                                     Photochem. Photobiol. 30, 157–163.
                                                                        [21]   Hodgson, E.K. and Fridovich, I. (1973) The role of OÀ in the
                                                                                                                                         2
[1] Schleifer, K.H. and Kilpper-Balz, R. (1987) Molecular and
                                     ¨                                         chemiluminescence of luminol. Photochem. Photobiol. 18, 451–
    chemotaxonomic approches to the classification of streptococci,             455.
    enterococci and lactococci: a review. Syst. Appl. Microbiol. 10,    [22]   Becerra, M.C. and Albesa, I. (2002) Oxidative stress induced by
    1–19.                                                                      ciprofloxacin in Staphylococcus aureus. Biochem. Biophys. Res.
[2] Devriese, L.A., Collins, M.D. and Wirth, R. (1991) The genus               Commun. 297, 1003–1007.
    Enterococcus In: (Ballows, A., Truper, H.G., Dworkin, M.,
                                         ¨                              [23]         ´
                                                                               Andre, P., Bilger, S., Remy, P., Bettinger, S. and Vidon, D. (2003)
    Harder, W. and Schleifer, K.H., Eds.), 2nd Edn. The                        Effects of iron and oxygen species scavengers on Listeria spp.
                                           P. Andre et al. / FEMS Microbiology Letters 245 (2005) 123–129                                        129

       chemiluminescence. Biochem. Biophys. Res. Commun. 304, 807–                  BLAST: a new generation of protein database search programs.
       811.                                                                         Nucleic Acids Res. 25, 3389–3402.
[24]                    ´
       Vidon, D., Andre, P., Baaj, D., Gryczka, C. and Philipp, P. (1994)    [30]   Cole, J.R., Chai, B., Marsh, T.L., Farris, R.J., Wang, Q., Kulam,
       Luminol enhanced chemiluminescence by Listeria monocytogenes:                S.A., Chandra, S., McGarrell, D.M., Schmidt, T.M., Garrity,
       a test for rapid assessment of antimicrobials agents. FEMS                   G.M. and Tiedje, J.M. (2003) The Ribosomal Database Project
       Microbiol. Lett. 120, 225–230.                                               (RDP-II): previewing a new autoaligner that allows regular
[25]   Huycke, M.M., Moore, D., Joyce, W., Wise, P., Shepard, L.,                   updates and the new prokaryotic taxonomy. Nucleic Acids Res.
       Kotake, Y. and Gilmore, M.S. (2001) Extracellular superoxide                 31, 442–443.
       production by Enterococcus faecalis requires dimethylmenaqui-         [31]   Peters, T.R., Tosk, J.M. and Goulbourne Jr., E.A. (1990)
       none and is attenuated by functional terminal quinol oxidases.               Lucigenin chemiluminescence as a probe for measuring reactive
       Mol. Microbiol. 42, 729–740.                                                 oxygen species production in E. coli. Anal. Biochem. 186, 316–
[26]   Schlegel, L. and Bouvet, A. (1998) Streptocoques et genres                   319.
                ´                   ´
       apparentes: abiotropes et enterocoques. Bull. Soc. Fr. Microbiol.     [32]   Yamashoji, S., Asakawa, A., Kawasaki, S. and Kawamoto, S.
       13HS, 7–17.                                                                  (2004) Chemiluminescence assay for detection of viable microor-
[27]   Manero, A. and Blanch, A.R. (1999) Identification of Enterococ-               ganisms. Anal. Biochem. 333, 303–308.
       cus spp. with a biochemical key. Appl. Environ. Microbiol. 65,        [33]   Yamashoji, S., Manome, I. and Ikedo, M. (2001) Menadione-
       4425–4430.                                                                   catalyzed OÀ production by Escherichia coli cells: application of
                                                                                                2
[28]   Weisburg, W.G., Barns, S.M., Pelletier, D.A. and Lane, D.J.                  rapid chemiluminescence assay to antimicrobial susceptibility
       (1991) 16S ribosomal DNA amplification for phylogenetic study.                testing. Microbiol. Immunol. 45, 333–340.
       J. Bacteriol. 173, 697–703.                                           [34]   Huycke, M.M., Joyce, W. and Wack, M.F. (1996) Augmented
[29]   Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,               production of extracellular superoxide by blood isolates of
       Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-                 Enterococcus faecalis. J. Infect. Dis. 173, 743–746.
                                           FEMS Microbiology Letters 245 (2005) 131–137
                                                                                                                   www.fems-microbiology.org




           Identification of mature appressorium-enriched transcripts
               in Magnaporthe grisea, the rice blast fungus, using
                      suppression subtractive hybridization
                                  Jian-Ping Lu, Tong-Bao Liu, Fu-Cheng Lin                                *

                         College of Life Sciences, Zhejiang University, Kaixuan Road 268, Hangzhou 310029, PR China

                       Received 9 November 2004; received in revised form 7 January 2005; accepted 28 February 2005

                                                    First published online 17 March 2005

                                                         Edited by A. von Tiedemann




Abstract

   We have constructed a fungal subtractive suppressive library enriched in genes expressed during appressorium maturation in
Magnaporthe grisea. Sequencing of 250 clones from the subtracted appressorium cDNA library revealed 142 unique genes, repre-
sented by 155 non-redundant ESTs (expressed sequence tags). Of these ESTs, 72 have not been previously isolated in M. grisea. RT-
PCR analysis of 105 of the genes discovered found transcripts corresponding to 71 of the ESTs only in mature appressoria while
transcripts corresponding to a further 34 of the isolated ESTs were expressed both in appressoria and conidia/mycelia. Genes spe-
cifically expressed in appressorium identified by SSH included a number that have been previously implicated in appressorium for-
mation or function including GAS1, GAS3, and PTH11.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Appressorium; cDNA; Suppression subtractive hybridization; Gene expression profile; Rice blast fungus




1. Introduction                                                              Once attached to the rice surface, conidia of the fun-
                                                                          gus quickly germinate forming short germ tubes in 0.5–
   Rice blast disease, caused by Magnaporthe grisea, is                   1.5 h. The germ tube then stops growing at the tip and a
one of the most severe diseases of rice throughout the                    terminal ‘‘hooking’’ of hypha appears within 4 h. At
world [1]. This fungal pathogen, as one of the best-stud-                 approximately 4–8 h, melanization of the appressorium
ied species among phytopathogenic fungi, has been used                    begins, followed by appearances of abundant glycogen
as a primary model for elucidating various aspects of the                 rosettes and an appressorium pore ring within 16–24 h.
host–pathogen interaction with its host [2–4]. This fun-                  At 24–31 h, glycogen rosettes are nearly absent, appres-
gus as well a number of fungal plant pathogens can pen-                   sorial turgor pressure is at a peak, and penetration pegs
etrate plant tissues by using the appressorium, a                         emerge, infection hyphae form in 31 h and spread to
specialized cellular structure [5]. Appressorium forma-                   adjacent epidermal cells in 48 h [6]. In view of the timing
tion appears to be a complex process from initiation                      of the appressorium formation process, as outlined
to maturation [4–6].                                                      above, 24 h may be a key time point for production of
                                                                          turgor pressure and synthesis of the materials essential
 *
   Corresponding author. Tel.: +86 571 86971185; fax: +86 571
                                                                          for the function of the M. grisea appressorium. Genes
86971128.                                                                 expressed during this stage may be required for appres-
   E-mail address: fuchenglin@zju.edu.cn (F.-C. Lin).                     sorium maturation and/or penetration of the plant via

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.02.032
132                               J.-P. Lu et al. / FEMS Microbiology Letters 245 (2005) 131–137

the appressorium. For this reason we set out to identify            the appressoria harvested from duplicate films was iso-
genes expressed specifically in the late appressorium                lated separately by a Trizol method following the man-
stage, but not expressed, or expressed at a low level,              ufacturerÕs procedure (Molecular Research Center, Inc.,
within conidia/mycelia.                                             USA). Three microlitres of total RNA ($15 lg total
    Many approaches, such as expressed sequence tags                RNA for conidia/mycelia mixture and $5 lg total
(EST) sequencing [7–9], serial analysis of gene expres-             RNA for appressoria) was used for the synthesis of dou-
sion (SAGE) [10], microarray [11] and the isolation of              ble-stranded cDNA with a SMART cDNA library con-
appressorium defective or deficient mutants [12–14],                 struction kit (Clontech, USA). The protocol for
have been used to identify appressorium specific genes.              SMART cDNA synthesis by LD PCR supplied with
To date, several genes involved in fungal infection, spe-           the kit was followed, until the proteinase K digestion
cifically in appressorium formation and subsequent                   step.
plant penetration, have been identified and character-
ized [4,15,16]. Despite these advances, the genetic basis           2.3. cDNA subtraction and cloning
of turgor generation within the appressoria of M. grisea
is still poorly understood [17].                                       For a cDNA library of genes specially expressed dur-
    Suppression subtractive hybridization (SSH) technol-            ing appressorium stage, cDNA subtractive hybridiza-
ogy is a powerful approach for identifying genes differen-           tion was carried out by following the protocol of the
tially expressed by cells or organisms in specific                   PCR-select cDNA subtraction kit (Clontech, USA) ex-
development stages or environmental conditions. For                 cept for the use of AluI digestion of cDNA instead of
example, 35 transcripts showing a significant increase               RsaI digestion. The subtracted cDNAs were cloned into
in expression during early stages of germination in                 the pBlueScript II SK (+) Vector (Stratagene, USA).
Pyrenophora teres [18] and 12 genes whose transcripts
are significantly enriched in Aspergillus nidulans conidia           2.4. DNA sequencing and analysis
[19] were identified by SSH. A late appressorium cDNA
library of rice blast fungus had been constructed in our               The recombinant cDNA clones were directly se-
lab [20]. Here, we report the construction of a subtractive         quenced on an ABI 377 DNA sequencer (Applied Bio-
suppressive cDNA library and discovery of transcripts               systems, USA) with T7 primer. The sequence data
uniquely expressed during appressorium maturation.                  were analyzed using VecScreen program (NCBI) for
                                                                    vector masking, and then the adaptor sequences (adap-
                                                                    tor 1 and adaptor 2R) were removed from these cDNA
2. Materials and methods                                            sequences. These EST sequences were processed using
                                                                    software BioEdit [22] for contig assembly. Processed se-
2.1. Fungal cultures                                                quences were subjected to similarity searches against M.
                                                                    grisea database (genome ver. 2) (http://www.broad.mi-
   M. grisea GUY-11 was used in this study. Conidia                 t.edu/cgi-bin/annotation/magnaporthe/) using Blast ver-
were obtained by harvesting plate cultures of the fungus            sion 2.2.1 [23]. Once the genomic regions corresponding
grown on complete medium [21] in a 14-h-light and 10-               to EST sequences were identified, a representative EST
h-dark cycle at 25 °C for 12–14 days. Conidia were har-             sequence was selected for each gene identified by one
vested by scraping sporulating cultures with a glass rod            or more detached EST sequence(s). All representative
in sterile distilled water, followed by centrifugation at           EST sequences were subjected to blastn and blastx
1000g for 10 min and resuspension in distilled water to             search against GenBank database using Blast 2.2.8 [23]
a concentration of 1–1.5 · 106 spores/ml. Drops (20 ll)             and against phytopathogenic fungi and Oomycete EST
of this standard inoculum were applied onto the hydro-              database (version 1.4) in COGEME (http://cogeme.ex.
phobic surface of projection transparency film (terylene             ac.uk/index.html) using Blast 2.2.5.
resin; Gaoke, China) and incubated at 25 °C for 24 h.
M. grisea aerial mycelia were obtained using the method             2.5. RT-PCR analysis
of Talbot et al. [21]. Substrate mycelia of M. grisea were
harvested by collecting cultures of the fungus grown in                For detection of differential expression by RT-PCR,
liquid complete medium at 25 °C with shaking at                     3 ll of total RNA ($15 lg RNA for conidia/mycelia
180 rpm for 3 days.                                                 mixture and $5 lg RNA for appressoria) was reverse-
                                                                    transcribed into first-strand cDNA by the protocol for
2.2. RNA isolation and cDNA synthesis                               SMART cDNA synthesis using SMART cDNA library
                                                                    construction kit (Clontech, USA). The primer sequences
  Equal weights of conidia, aerial mycelia and substrate            of RT-PCR used to detect mRNAs for the 105 clones
mycelia were mixed and quickly frozen in liquid N2 for              were designed according to the EST sequences or pre-
RNA extraction. Total RNA of the above mixture and                  dicted protein-coding sequences in M. grisea database
                                 J.-P. Lu et al. / FEMS Microbiology Letters 245 (2005) 131–137                                        133

(genome ver. 2) (http://www.broad.mit.edu/cgi-bin/                 Table 1
annotation/magnaporthe/). After the initial denatur-               Blast similarity alignments of 155 cDNA EST sequences against the
                                                                   Magnaporthe grisea database (Broad Institute)
ation (2 min at 94 °C), PCR was run for 35 cycles of
60 s at 94 °C, 30 s at 55 °C and 60 s at 72 °C. PCR prod-          Similarity                  Expect-value                   Blastn
ucts were separated on a 1.2% agarose/EtBr gel.                    High                        6e-28                          152a (139b)
                                                                   Null                                                       3
                                                                   Total                                                      155
3. Results                                                          a
                                                                       119 Contigs matching 152 ESTs were identified.
                                                                     b
                                                                       The values in parenthese indicate the number of genes that could be
3.1. Construction of subtractive cDNA library                      identified by comparing the EST sequences with the predicted gene
                                                                   sequences from 119 contigs.

   Using microscopic assessment it was found that after
                                                                   Table 2
$24 h of incubation, melanized appressoria had devel-              Sequence similarities between ESTs and the best match in the
oped in most of cells. The ratio of appressorium forma-            GenBank database using blastn and blastx at the time of submission
tion (appressoria numbers/conidia numbers) on the                  Similarity           Expect-value             Blastn             Blastx
hydrophobic surface of duplicate film was 96%.
                                                                   High                 6e-30                     67                 89
   Total RNA of the conidia/mycelia mixture and the                Moderate             E-3 to e-29               15                 37
mature appressoria, incubated for 23.5–24.5 h on dupli-            Low                  Pe-2                      59                 14
cate films, was isolated separately by a Trizol method.             Null                                            1                  2
RNA quality was assessed using electrophoretic analysis            Total                                         142                142
which indicated that the total RNA was intact and suit-
able for use. From this RNA, a subtractive appressoria
cDNA library, subtracted by conidia, aerial mycelia,               ESTs, 70 ESTs have been correspond to known genes or
and substrate mycelia mixture, was constructed. A total            have been previously sequenced in M. grisea while a fur-
of 338 recombinant cDNA clones, from the subtracted                ther 72 ESTs have been isolated for the first time in the
cDNA mixture ligated to vector, were stored in À20 °C.             current study. Eight-nine per cent (when compared with
                                                                   protein databases) of the 142 ESTs had significant
3.2. Sequence analysis                                             matches (p < 0.001) to known (or predicted) genes pres-
                                                                   ent in GenBank at the time of submission.
   Among 338 subtractive cDNA clones, 250 clones                      Among the 142 genes identified in 250 cDNA clones,
were partially sequenced using T7 primer, and 155                  the ESTs of 40 genes (28%) were detected at least twice.
non-redundant ESTs were generated from these cDNA                  The most abundant 10 ESTs are listed in Table 3.
sequences using BioEdit software [22]. Theses 155 se-              Among these, the most frequently detected EST (16
quences were compared to the draft sequences of the                times, 6.4%) and a further four ESTs show significant
M. grisea genome ver. 2 (http://www.broad.mit.edu/                 similarity to previously characterized genes or genes
cgi-bin/annotation/magnaporthe/), using the Blast algo-            whose predicted product can be functionally categorized
rithm [23]. 119 contigs, matching 152 ESTs were identi-            based on homology to known proteins. An EST match-
fied within the M. grisea database (Broad Institute),               ing probable keto acyl reductase encoding gene, in-
while no matching contigs could be found for the                   volved in fatty acid metabolism, was detected nine
remaining three ESTs (Table 1). Some non-redundant                 times while ESTs matching the GAS1 (MAS3) gene,
ESTs, which were classed as unique by alignment among              encoding a suspected virulence factor, were also detected
the ESTs, were found to match the same predicted M.                seven times.
grisea gene. This analysis revealed a match to a total
of 139 different predicted genes from the M. grisea draft           3.3. RT-PCR analysis
genome annotation. Assuming that the three ESTs
which did not match any sequence present in the M. gri-               To confirm differential gene expression in appressoria
sea database represent a further three separate genes ab-          and conidia/aerial mycelia/substrate mycelia as indicted
sent form the draft genome sequence, a total of 142                by SSH subtraction strategy, the transcript abundance
genes in total have been shown to be expressed within              of 105 of the genes identified was assessed using
maturing appressorium here.                                        RT-PCR. Among 105 genes examined, 71 were expressed
   A summary of homology search against GenBank                    only in appressoria while 34 genes were expressed both in
using the Blast algorithm [23] and analysis of 142 cDNA            appressoria and conidia/mycelia (Table 4).
sequences, representing 142 unique genes, is shown in                 Fig. 1 shows the gene expression analysis for nine
Table 2. The source organism of every matching record              genes in appressoria or in conidia/mycelia mixture of
of all homology searches in GenBank using blastn were              M. grisea. These genes, which include a predicted glyox-
checked and counted, and it was found that, among 142              alase I-encoding gene (clone s126: GenBank Accession
134                                      J.-P. Lu et al. / FEMS Microbiology Letters 245 (2005) 131–137

Table 3
List of the 10 most abundant ESTs
ESTsa                                            Putative gene products                                                          Number of clones
                                                                               b
ESTs119 (CK828201)                               Predicted protein (MG02778.4)                                                   16   (6.4%)c
ESTs155 (CK828227)                               Probable keto acyl reductase (MG10351.4)                                         9   (3.6%)
ESTs98 (CK828185)                                Membrane-associated or secreted protein (MG02884.4)                              7   (2.8%)
ESTs105 (CK828190)                               Predicted protein (MG08526.4)                                                    7   (2.8%)
ESTs56 (CK828275)                                MAS3 protein (MG07044.4)                                                         7   (2.8%)
ESTs9 (CK828294)                                 Cytochrome P-450-alk1 (MG06973.4)                                                6   (2.4%)
ESTs28 (CK828256)                                Predicted protein (MG02287.4)                                                    6   (2.4%)
ESTs134 (CK828214)                               Predicted protein (MG10355.4)                                                    6   (2.4%)
ESTs19 (CK828247)                                Predicted protein (MG10345.4)                                                    5   (2.0%)
ESTs127 (CK828209)                               Neuronal calcium sensor (MG01550.4)                                              4   (1.6%)
 a
   Sequences were assembled from 250 ESTs randomly sequenced from a cDNA library constructed from appressorium cDNA (incubating for 23.5–
24.5 h on an inductive surface) subtracted by cDNA of conidia/mycelia in PCR-select cDNA subtractive hybridization method. GenBank Accession
Nos. are in parentheses.
 b
   Gene names in Magnaporthe grisea database (Broad Institute) that correspond to ESTs are in parentheses.
 c
   Percentage in parentheses was calculated based on 250 cDNA clones analyzed.



Table 4                                                                      code for a predicted potassium channel beta chain (clone
Results of RT-PCR analysis of gene expression in mature appressoria          s20: GenBank Accession No. CK828252), an alcohol
or in conidia/mycelia mixture
                                                                             oxidase (clone s48: GenBank Accession No.
Expression stages       Appressoria       Appressoria,           Total       CK828270) and a membrane-associated or secreted pro-
                                          conidia/mycelia
                                                                             tein (clone s98: GenBank Accession No. CK828185)
Gene numbers            71                34                     105         were highly expressed both in appressoria and conidia/
Percentage              67.6              32.4                   100
                                                                             mycelia. These results indicated that our SSH approach
                                                                             was successful in revealing differential gene expression
No. CK828208) and two ESTs predicted to encode a pro-                        during the maturation of M. grisea appressoria.
tein of unknown function (clone s134 and clone s119:
GenBank Accession Nos. CK828214 and CK828201),
seem to be expressed specifically in appressorium while                       4. Discussion
the transcript is absent from conidia/mycelia. The EST
matching the gene coding for the GAS1 (MAS3) protein                            Because the RNA obtained from appressoria was
(clone s56: GenBank Accession No. CK828275) was                              limited, the protocol for cDNA synthesis of mycelia/
found expressed strongly in appressorium and very                            conidia and appressoria by LD PCR used in the con-
weakly in conidia/mycelia mixture. Two other genes, pre-                     struction of SSH subtracted cDNA library was different
dicted to encode a product with no similarity to any                         from the protocol provided by clontech PCR-select
known protein (clone s7: GenBank Accession No.                               cDNA subtraction kit (Clontech, USA) but identical,
CK828283) and a gene whose hypothetical product is re-                       with that used earlier in the construction of appressoria
lated to acetyl coenzyme A synthetase (clone s117: Gen-                      cDNA library [20]. According to the restriction enzyme
Bank Accession No. CK828240) seems to be expressed at                        cut site analysis of 8821 unique EST sequences of M. gri-
a higher level within appressoria. The genes predicted to                    sea obtained from COGEME 1.5 (http://cogeme.ex.




Fig. 1. RT-PCR analysis of gene expression of nine genes in mature appressoria or in conidia/mycelia mixture of M. grisea. The same capital or small
letter indicated RT-PCR product from total RNA of product from mature appressoria or conidia/mycelia mixture. M indicated GenRulerTM 100 bp
DNA ladder (0.5 lg/lane) (MBI, Lithuania). These nine genes were predicted to code for (the gene names in Magnaporthe grisea database (Broad
Institute) that correspond to the following ESTs are in parentheses): A or a, s134 sequence coding for a protein of unknown function (MG10355.4); B
or b, s117 sequence coding for a protein related to acetyl coenzyme A synthetase (MG00689.4); C or c, s119 sequence coding for a protein of
unknown function (MG02778.4); D or d, s7 sequence coding for a predicted protein of unknown function (MG10345.4); E or e, s98 sequence coding
for a membrane-associated or secreted protein (MG02884.4); F or f, s56 sequence coding for MAS3 protein (MG07044.4); G or g, s48 sequence
coding for alcohol oxidase (MG09072.4); H or h, s20 sequence coding for potassium channel beta chain (MG06182.4); I or i, s126 sequence coding
for glyoxalase I S-D-lactoylglutathione lyase (MG10350.4).
                                           J.-P. Lu et al. / FEMS Microbiology Letters 245 (2005) 131–137                              135

ac.uk/), the number of AluI cut sites in the cDNAs syn-                      s283, s177: GenBank Accession Nos. CN121362,
thesized with SMART cDNA library construction kit is                         CK828241), four distinct P450 monooxygenases (clones
nearly many as the number of RsaI cut sites in the                           s103, s116, s261, s9: GenBank Accession Nos.
cDNAs synthesized with clontech PCR-select cDNA                              CK828188, CK828198, CN193452, CK828294), a D-2-
subtraction kit (Table 5). If RsaI had been used to digest                   hydroxy-acid dehydrogenase (clone s130: GenBank
cDNA as suggested by cDNA subtraction kit (Clontech,                         Accession No. CK828211), a further putative monooxy-
USA), the subtracted cDNA library would lose its diver-                      genase (clone s67: GenBank Accession No. CK828282)
sity greatly, because the cDNAs synthesized in this study                    and a cyclohexanone monooxygenase (clone s159: Gen-
only have 61% RsaI sites of the cDNAs synthesized by                         Bank Accession No. CK828229). The purified cyclohex-
the protocol provided by clontech PCR-select cDNA                            anone monooxygenase is a remarkably versatile
subtraction kit (Clontech, USA). So, AluI was selected                       oxygenation catalyst that uses the bound flavin adenine
to digest cDNA. The analysis of subtracted cDNA li-                          dinucleotide (FAD)-4a-OOH oxygenating intermediate
brary showed that good results were obtained using AluI                      to initiate oxygen transfer to both electrophilic substrate
digestion instead of RsaI. 155 independent clones were                       sites, such as the carbonyl of ketones and aldehydes, and
found among 250 recombinant cDNA clones and 71                               nucleophilic substrate sites [24]. It is likely that the
gene transcripts were found to be unique to appressoria                      expression of these genes plays a role in the function
among the 105 genes examined with RT-PCR.                                    of the appressorium. At 24-h post germination the
   In the last decade, many scientific efforts have been                       appressorium generates enormous turgor pressure (up
focused on the molecular genetic basis of M. grisea                          to 8 MPa), which is used to rupture the plant cuticle
pathogenesis. Analyses of subtracted cDNA libraries,                         [6]. The turgor inside the appressorium is generated by
SAGE and microarray have revealed a number of genes                          a rapid increase in intracellular glycerol levels, which is
specially expressed during the early phase of appresso-                      maintained by a specialized cell-wall layer containing
rium formation in M. grisea or during the plant–fungus                       melanin [25,26]. Peroxisomes are single-membrane-
interaction stage [8–10]. However, the gene expression                       bound organelles possessing multiple metabolic func-
profile in the later stages of appressorium development                       tions, including b-oxidation of fatty acids, glyoxylate
has received very little attention until now. The fact that                  metabolism, and metabolism of reactive-oxygen species.
72 ESTs (51%) of total 142 non-redundant ESTs identi-                        Clapex6-deleted mutants of Colletotrichum lagenarium
fied from 250 recombinant cDNA clones in this study                           have a defect in fatty acid b-oxidation in peroxisomes
have not previously been isolated, suggests that many                        and form small appressoria with severely reduced mel-
genes specific to the maturing appressorium remained                          anization that failed to produce infectious hyphae [27].
to be discovered in M. grisea. The identification and                         The gene ICL1 encoding isocitrate lyase, involved in
characterization of these genes might provide important                      the glyoxylate cycle, is required for full virulence by
clues as to the probable metabolic pathways and/or                           M. grisea and shows elevated expression during develop-
structural features unique to the maturation of the                          ment of infection structures and cuticle penetration [28].
appressorium.                                                                It has also been demonstrated that the mobilization and
   In this study, we found ESTs matching many genes                          dissolution of glycogen and lipid is under the control of
whose product is probably involved in lipid metabolism                       the PMK1 MAPK pathway and the CPKA/SUM1-
within peroxisomes. The predicted products of these                          encoded PKA [29]. Both of these signaling pathways
genes include an acyl-CoA dehydrogenase (clone s104:                         are required for appressorium differentiation (give fur-
GenBank Accession No. CK828189), a probable keto                             ther references to the relevant papers here). An EST
acyl reductase (clone s155), an alcohol oxidase (clone                       (clone s197: GenBank Accession No. CK828251) whose
s48), a glyoxalase I in pyruvate metabolism (clone                           predicted product shows homology to a serine–threo-
s126), and two different kinds of acetyl-CoA synthetase                       nine kinase Pdd7p, required for pexophagy in Pichia an-
involving in pyruvate dehydrogenase bypass (clones                           gusta and Hansenula polymorpha [30,31], was also

Table 5
Numbers of AluI/RsaI cutting sites in 8821 unique EST sequences of M. grisea obtained from COGEME 1.5 (http://cogeme.ex.ac.uk/)
Restriction enzymes      Total number          Number of sites      Number of sites        Total number of          Total number of
                         of sites in EST       added by cDNA        added by CDS           sites in cDNAs           sites in cDNAs
                         sequences             synthesis primera    III/3 0 PCR primerb    synthesized by           synthesized by
                                                                                           cDNA synthesis primerc   CDS III/3 0 PCR primerd
Alu1                     21,956                0                    0                      21,956                   21,956
Rsa 1                    13,745                8821                 0                      22,566                   13,745
 a
     Number of sites in cDNAs added by cDNA synthesis primer with clontech PCR-select cDNAsubtraction kit.
 b
     Number of sites in cDNAs added by CDS III/3 0 PCR primer with SMART cDNA library construction kit.
 c
     Total number of sites in cDNAs synthesized by cDNA synthesis primer with clontech PCR-select cDNA subtraction kit.
 d
     Total number of sites in cDNAs synthesized by CDS III/3 0 PCR primer with SMART cDNA library construction kit.
136                              J.-P. Lu et al. / FEMS Microbiology Letters 245 (2005) 131–137

identified in the current work. Taken together these re-            constitutively up-regulated during appressorium forma-
sults support the view that lipid metabolism plays an              tion compared to vegetative mycelia [11]. These data are
important role in infection biology, and suggest that a            consistent with a role for sterol biosynthesis or sterol
major metabolic activity during appressorium matura-               modification within pathogenesis by fungal phytopatho-
tion is the conversion of fat reserves into glycerol.              gens [11,35].
P450 monooxygenase genes, glyoxalase I and other                       Comparison of our data with results from previous
genes could also be involved in secondary metabolism,              analyses of subtracted cDNA libraries, SAGE and micro-
especially in detoxification of antagonistic substances se-         array in M. grisea [7,8,10] is of interest. Although some of
creted by plants. Among these, the transcripts of a pre-           the genes identified by previous analyses, such as GAS1,
dicted glyoxalase I encoding gene (represented by EST              GAS2 and THNR, were also found in our study, most
clone s126), a probable keto acyl reductase (clone                 of the genes revealed by our experiments matched to pre-
s155), three distinct P450 monooxygenase encoding                  dicted open/reading frames within the M. grisea genome
genes (clones, s103, s116, S261), a D-2-hydroxy-acid               sequence database for which no corresponding EST has
dehydrogenase encoding gene homolog (clone s130)                   been sequenced to date. The recovery of so many ESTs
and a putative monooxygenase encoding gene (clone                  which have not been previously isolated in this species
s67) were confirmed to be abundant within appressoria               is likely due to the time point chosen. The gene expression
but were not detected within conidia/mycelia using                 pattern within mature appressoria after a 24 h incuba-
RT-PCR.                                                            tion, is different from the pattern during the early phase
   Among the genes expressed in appressorium identified             of appressorium formation (after a 3–6 h incubation), a
by SSH, some genes, including GAS1 (MAS3) (clone s56)              phase which has been much more extensively exploited
and GAS2 (MAS1) (clone s266: GenBank Accession No.                 in EST generation in M. grisea in previous studies (give
CN121353), THNR (tetrahydroxynaphthalene reduc-                    some more references here). It is not surprising that we
tase, clone s142: GenBank Accession No. CK828220),                 found many peroxisome-related genes, as that is the time
and PTH11 (clone s247: GenBank Accession No.                       when turgor pressure is generated from glycerol. Func-
CN121346), have previously been reported to be in-                 tional analyses of the novel genes identified during this
volved in appressorium formation and pathogenicity                 work are underway in our laboratory.
[32–34]. GAS1 and GAS2 are preferentially expressed
within appressoria in M. grisea compared with mycelial
growth stage and although GAS1 and GAS2 deleted mu-                Acknowledgments
tants have no defect in vegetative growth, conidiation, or
appressoria formation, they are reduced in appressorial               The project was sponsored by the Scientific Research
penetration and lesion development [34]. During the bio-           Foundation for the Returned Overseas Chinese Schol-
synthesis of fungal melanin, tetrahydroxynaphthalene               ars, State Education Ministry, partly supported by Na-
reductase catalyzes the NADPH-dependent reduction                  tional Natural Science Foundation of China (Grant No.
of 1,3,6,8- tetrahydroxynaphthalene (T4HN) into (+)-               30270049) and by Ministry of Science and Technology
scytalone and 1,3,8- trihydroxynaphthalene into (À)-               of China (863 Program No. 2002AA245041). We are in-
vermelone [33]. Another pathogenicity gene, PTH11,                 debted to the following for help and advice generously
encodes a transmembrane protein that is an upstream                given to us during the planning and writing of this arti-
effector of appressorium differentiation in response to              cle: Dr. Muriel Viaud, Dr. Wei-Liang Chen and Profes-
surface cues; strains lacking this gene are very reduced           sor De-Bao Li.
in pathogenicity due to a defect in appressorium differen-
tiation [32]. Our RT-PCR analysis showed that tran-
scripts matching GAS1 (clone s56), GAS2 (clone s266)               References
and PTH11 (clone s247) were abundant with appressoria
but scare within conidia and mycelia.                               [1] Baker, B., Zambryski, P., Staskawicz, B. and Dinesh-Kumar, S.P.
   The predicted product of clones s248, s80 and s243                   (1997) Signaling in plant–microbe interactions. Science 276, 726–
(GenBank Accession Nos. CN121347, CK828291,                             733.
CN121345), have similarity to human oxysterol-binding               [2] Soanes, D.M., Skinner, W., Keon, J., Hargreaves, J. and Talbot,
                                                                        N.J. (2002) Genomics of phytopathogenic fungi and the develop-
protein, C14 sterol reductase and 6-phosphogluconate                    ment of bioinformatic resources. Mol. Plant Microbe Interact. 15,
reductase, respectively. In C. gloeosporioides, a sterol                421–427.
glycosyl transferase gene (chip6) is induced by hard-sur-           [3] Valent, B. (1990) Rice blast as a model system for plant
face treatment at an early stage of appressorium forma-                 pathology. Phytopathology 80, 33–36.
                                                                    [4] Dean, R.A. (1997) Signal pathways and appressorium morpho-
tion, and is required for fungal pathogenicity [35]. In M.
                                                                        genesis. Annu. Rev. Phytopathol. 35, 211–234.
grisea, clones AP2E02 and AP1I02, similar to phospho-               [5] Tucker, S.L. and Talbot, N.J. (2001) Surface attachment and pre-
glucose isomerase and delta-(24)-sterol c-methyl trans-                 penetration stage development by plant pathogenic fungi. Annu.
ferase gene involved in sterol biosynthesis, were found                 Rev. Phytopathol. 39, 385–417.
                                         J.-P. Lu et al. / FEMS Microbiology Letters 245 (2005) 131–137                                        137

 [6] Talbot, N.J. (1995) Having a blast: exploring the pathogenicity of    [21] Talbot, N.J., Ebbole, D.J. and Hamer, J.E. (1993) Identification
     Magnaporthe grisea. Trends Microbiol. 3, 9–16.                             and characterization of MPG1, a gene involved in pathogenicity
 [7] Kamakura, T., Xiao, J.Z., Choi, W.B., Kochi, T., Yamaguchi, S.,            from the rice blast fungus Magnaporthe grisea. Plant Cell 5, 1575–
     Teraoka, T. and Yamaguchi, I. (1999) cDNA subtractive cloning              1590.
     of genes expressed during early stage of appressorium formation       [22] Hall, T.A. (1999) BioEdit: a user-friendly biological sequence
     by Magnaporthe grisea. Biosci. Biotechnol. Biochem. 63, 1407–              alignment editor and analysis program for Windows 95/98/NT.
     1413.                                                                      Nucl. Acids Symp. Ser. 41, 95–98.
 [8] Kim, S., Ahn, K.P. and Lee, Y.H. (2001) Analysis of genes             [23] Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang,
                                                                                                                    ¨
     expressed during rice Magnaporthe grisea interactions. Mol. Plant          Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-
     Microbe Interact. 14, 1340–1346.                                           BLAST: a new generation of protein database search programs.
 [9] Rauyaree, R., Choi, W., Fang, E., Blackmon, B. and Dean, R.A.              Nucleic. Acids Res. 25, 3389–3402.
     (2001) Genes expressed during early stages of rice infection with     [24] Chen, Y.C., Peoples, O.P and Walsh, C.T. (1988) Acinetobacter
     the rice blast fungus Magnaporthe grisea. Mol. Plant Pathol. 2,            cyclohexanone monooxygenase: gene cloning and sequence deter-
     347–354.                                                                   mination. J. Bacteriol. 170, 781–789.
[10] Irie, T., Matsumura, H., Terauchi, R. and Saitoh, H. (2003) Serial    [25] Howard, R.J., Ferrari, M.A., Roach, D.H. and Money, N.P.
     analysis of gene expression (SAGE) of Magnaporthe grisea: genes            (1991) Penetration of hard substrates by a fungus employing
     involved in appressorium formation. Mol. Genet. Genomics 270,              enormous turgor pressures. Proc. Natl. Acad. Sci. USA 88,
     181–189.                                                                   11281–11284.
[11] Takano, Y., Choi, W., Mitchell, T.K., Okuno, T. and Dean, R.A.        [26] de Jong, J.C., McCormack, B.J., Smirnoff, N. and Talbot, N.J.
     (2003) Large scale parallel analysis of gene expression during             (1997) Glycerol generates turgor in rice blast. Nature 389, 244–
     infection-related morphogenesis of Magnaporthe grisea. Mol.                245.
     Plant Pathol. 4, 337–347.                                             [27] Kimura, A., Takano, Y., Furusawa, I. and Okuno, T. (2001)
              `
[12] Balhadere, P.V., Foster, A.J. and Talbot, N.J. (1999) Identifica-           Peroxisomal metabolic function is required for appressorium-
     tion of pathogenicity mutants of the rice blast fungus Magnapor-           mediated plant infection by Colletotrichum lagenarium. Plant Cell
     the grisea using insertional mutagenesis. Mol. Plant–Microbe               13, 1945–1958.
     Interact. 12, 129–142.                                                [28] Wang, Z.Y., Thornton, C.R., Kershaw, M.J., Li, D.B. and
[13] Shi, Z., Christian, D. and Leung, H. (1995) Enhanced                       Talbot, N.J. (2003) The glyoxylate cycle is required for temporal
     transformation in Magnaporthe grisea by restriction enzyme                 regulation of virulence by the plant pathogenic fungus Magna-
     mediated integration of plasmid DNA. Phytopathology 85,                    porthe grisea. Mol. Microbiol. 47, 1601–1612.
     329–333.                                                              [29] Thines, E., Weber, R.W.S. and Talbot, N.J. (2000) MAP kinase
[14] Sweigard, J.A., Carroll, A.M., Farrall, L., Chumley, F.G. and              and protein kinase a – dependent mobilization of triacylglycerol
     Valent, B. (1998) Magnaporthe grisea pathogenicity genes                   and glycogen during appressorium turgor generation by Magna-
     obtained through insertional mutagenesis. Mol. Plant–Microbe               porthe grisea. Plant Cell 12, 1703–1718.
     Interact. 11, 404–412.                                                [30] Reggiori, F. and Klionsky, D.J. (2002) Autophagy in the
[15] Hamer, J.E. and Talbot, N.J. (1998) Infection-related develop-             eukaryotic cell. Eukaryotic Cell 1, 11–21.
     ment in the rice blast fungus Magnaporthe grisea. Curr. Opin.         [31] Komduur, J.A., Veenhuis, M. and Kiel, J.A. (2003) The Hansen-
     Microbiol. 1, 693–697.                                                     ula polymorpha PDD7 gene is essential for macropexophagy and
[16] Idnurm, A. and Howlett, B.J. (2001) Pathogenicity genes of                 microautophagy. FEMS Yeast Res. 3, 27–34.
     phytopathogenic fungi. Mol. Plant Pathol. 2, 241–255.                 [32] DeZwaan, T.M., Carroll, A.M., Valent, B. and Sweigard, J.A.
[17] Talbot, N.J. (2003) On the trail of a cereal killer: exploring the         (1999) Magnaporthe grisea pth11p is a novel plasma membrane
     biology of Magnaporthe grisea. Annu. Rev. Microbiol. 57, 177–              protein that mediates appressorium differentiation in response to
     202.                                                                       inductive substrate cues. Plant Cell 11, 2013–2030.
[18] Dilger, M., Felsenstein, F.G. and Schwarz, G. (2003) Identifica-       [33] Vidal-Cros, A., Viviani, F., Labesse, G., Boccara, M. and
     tion and quantitative expression analysis of genes that are                Gaudry, M. (1994) Polyhydroxynaphthalene reductase involved
     differentially expressed during conidial germination in Pyreno-             in melanin biosynthesis in Magnaporthe grisea. Purification,
     phora teres. Mol. Genet. Genomics 270, 147–155.                            cDNA cloning and sequencing. Eur. J. Biochem. 219, 985–992.
[19] Osherov, N., Mathew, J., Romans, A. and May, G.S. (2002)              [34] Xue, C., Park, G., Choi, W., Zheng, L., Dean, R.A. and Xu, J.R.
     Identification of conidial-enriched transcripts in Aspergillus nidu-        (2002) Two novel fungal virulence genes specifically expressed in
     lans using suppression subtractive hybridization. Fungal Genet.            appressoria of the rice blast fungus. Plant Cell 14, 2107–2119.
     Biol. 37, 197–204.                                                    [35] Kim, Y.K., Wang, Y., Liu, Z.M. and Kolattukudy, P.E. (2002)
[20] Lu, J.P., Liu, T.B., Yu, X.Y. and Lin, F.C. (2005) Representative          Identification of a hard surface contact-induced gene in Collet-
     appressorium stage cDNA library of Magnaporthe grisea. J.                  otrichum gloeosporioids conidia as a sterol glycosyl transferase, a
     Zhejiang Univ. Sci. 6B (2), 132–136.                                       novel fungal virulence factor. Plant J. 30, 177–187.
                                            FEMS Microbiology Letters 245 (2005) 139–144
                                                                                                                   www.fems-microbiology.org




         Competition among symbiotic cyanobacterial Nostoc strains
           forming artificial associations with rice (Oryza sativa)
                               Malin Nilsson *, Ulla Rasmussen, Birgitta Bergman
                         Department of Botany, Stockholm University, Lilla Frescati vagen 5, S-10691 Stockholm, Sweden
                                                                                     ¨
                          Received 10 January 2005; received in revised form 22 February 2005; accepted 2 March 2005

                                                     First published online 14 March 2005

                                                          Edited by K. Forchhammer




Abstract

   Competition among four symbiotically competent Nostoc strains, colonizing rice roots, was examined using hetR-DGGE (dena-
turing gradient gel electrophoresis) as strain identification. Although mixed in various combinations, only one strain at a time asso-
ciated with the rice roots. Nostoc strain 8964:3 was the most competitive and our data suggest that its competitive fitness was
dependent on rapid hormogonial spreading as displayed on agar plates. Furthermore, rice roots induced hormogonia in all tested
Nostoc strains, but only Nostoc strain 9104 showed positive chemotaxis towards the root. Inhibition of growth of competing cyano-
bacterial strains was not apparent.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Competition; Rice; Nostoc; Chemotaxis; Hormogonia induction




1. Introduction                                                           and cell/callus cultures of for example Panax, Medicago,
                                                                          and Nicotiana [4–6]. In addition, associations between in-
    Creation of artificial associations between nitrogen-                  tact plants such as, wheat, corn, bean, and sugar beat and
fixing micro-organisms and plants of great agricultural                    soil cyanobacteria of the genus Nostoc, Anabaena and
importance could potentially reduce the demand for                        Cylindrospermum have been established with varying
chemically produced nitrogen-fertilizers. Cyanobacteria                   success [7–14].
might have great potential in such artificial associations                    Through screening of Nostoc strains collected from
as they (in particular the genus Nostoc) naturally have a                 natural plant symbioses, such as with Gunnera,
broad host range and can infect all major plant organs                    Anthoceros and cycads, a selection of rice root associ-
[1]. In addition, Nostoc possesses specialized cells, the                 ating strains were identified [15]. The association was
heterocysts, preventing destruction of nitrogenase by                     tight and the cyanobacteria could not be removed
oxygen [2], and the genus is one of the most common                       by washing or by sonication. When associated with
soil cyanobacteria [3].                                                   rice roots, the Nostoc strains increased their nitrogen
    Attempts have been made to form artificial associa-                    fixation and their presence appeared to improve the
tions between free-living, nitrogen-fixing cyanobacteria                   growth of the rice plants [15]. Only individual cyano-
(such as, Chlorogloeopsis, Anabaena and Synechococcus),                   bacterial strains were tested for association in the pre-
                                                                          vious study. However, under natural conditions,
 *
     Corresponding author. Tel.: +46 8 163407; fax: +46 8 162555.         cyanobacteria are likely to exist in mixed populations
     E-mail address: malin.nilsson@botan.su.se (M. Nilsson).              and may compete for suitable substrates or hosts to

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.03.010
140                             M. Nilsson et al. / FEMS Microbiology Letters 245 (2005) 139–144

colonize. To our knowledge, the competitive capacity               crushed separately in 200 ll TE buffer, and washed in
of mixed populations of cyanobacterial strains form-               500 ll of the same buffer 4 times before direct use in
ing symbiotic or artificial associations with plants is             hetR-PCR.
unknown.                                                              To investigate the hormogonial spreading of the
   The aim of the present study was to examine if com-             four Nostoc strains, they were allowed to grow in
petition may occur among selected Nostoc strains with              equal amounts (OD 3.0 at 720 nm) on agar plates
known associative competence [15]. A prerequisite for              (1.5%) containing BG110. All four strains (5 ll of
our analyses was that the selected Nostoc strains be-              each) were added to the same plate and the spreading
longed to genetically different groups as verified by                and possible dominance of one strain was measured
short tandemly repeated repetitive (STRR)-PCR finger-               during a period of 9 days. Hormogonial spreading
printing [16] and hetR-DGGE (denaturing gradient gel               were measured as radial growth from original spot
electrophoresis) patterns [17]. Secondly, the strains              in mm.
were examined depending on hormogonial (motile cell
stage acting as infection unit [1]) spreading, chemotac-           2.3. Denaturing gradient gel electrophoresis (DGGE)
tic behavior towards rice, hormogonia induction by
rice, and depending on the capability of the individual               PCR was performed on crushed rice roots with asso-
tested cyanobacterial strains to inhibit growth of each            ciated cyanobacteria, using primers toward the cyano-
other.                                                             bacterial hetR gene, designed to amplify a 270 bp
                                                                   region [17]. The forward primer was attached to a GC-
                                                                   clamp in the 5 0 -end. Primers sequences were synthesized
2. Material and methods                                            at Cybergene, Novum, Sweden:

2.1. Organisms                                                        Forward: 5 0 -CGCCCGCCGCGCCCCGCGCCCG-
                                                                      GCCCGCCGCCCCCGCCCCAAGTGTGCAATA-
    Four Nostoc strains (8901:1, 8964:3, 8981, 9104) orig-            TACATGAC-3 0
inally isolated from Gunnera spp. plants (Dr. E. Soder-
                                                     ¨                Revers: 5 0 -TCAATTTGTCTTTTTTCTTC-3 0
back, Stockholm University, Sweden) were used. All
  ¨
strains were previously proven to successfully associate              Two ll template of cyanobacterial suspension (indi-
with rice roots as shown in artificial association assays           vidual strains; free-living or from crushed root) was
[15]. They were cultivated in liquid BG110 media [18]              added. The conditions of the PCR were: one cycle
and grown with constant gentle shaking and illumina-               of 95 °C for 6 min, 30 cycles of 93 °C for 1 min,
tion of 18 lmol photons mÀ2 sÀ1 at 24 °C.                          52 °C for 1 min, 70 °C for 1 min, one cycle of 70 °C
    The rice cultivar IET-13783, previously tested for             for 10 min and final step at 4 °C. The PCR reaction
cyanobacterial association [15], was used as test plant.           (total 50 ll) contained 100 pmol of each primer, 1U
Seeds were surface sterilized and germinated as de-                of DNA polymerase (Dynazyme, Oy, Espoo, Finland),
scribed by Nilsson et al. [15]. After germination, the             10 lM of dNTP, and the buffer supplied with the
seedlings were transferred to tubes containing 10 ml of            enzyme was used according to instructions of the
1/10 BG11 with nitrogen. After growth for 4–7 days,                manufacturer. The PCR reactions were performed in
plants were transferred to new media, with or without              Perkin–Elmer GeneAmp PCR system 2400 (Shelton,
nitrogen depending on the experiment. The plants were              Conneticut, USA). The generated PCR products were
grown in 30 °C, 80% humidity and 12 h light (20 lmol               separated through DGGE on 8% (wt/vol) polyacryl-
photons mÀ2 sÀ1) 12 h dark cycles.                                 amide gradient gels in 0.5 mM TAE buffer (20 mM
    The liverwort Blasia, used for chemotactic experi-             Tris-acetate [pH 7.4], 10 mM sodium acetate, 0.5
ments was grown as described by Knight and Adams                   mM di-sodium EDTA). The denaturing gradient ran-
[19].                                                              ged from 20–45%. The gradients were formed with
                                                                   8% (wt/vol) acrylamide stock solutions through mixing
2.2. Competition                                                   of one stock with no denaturant and one with 100%
                                                                   denaturant (7 M urea, 40% [vol/vol] formamide).
   Competition experiments were performed on rice                  The gels were electrophorized for 3–4 h at 60 °C
roots under the conditions described for rice cultiva-             and 200 V in BioRad DCodeä System (Hercules, Cal-
tion. The roots of 10 days old rice plants were chal-              ifornia, USA). The gels were stained in 5 lg ethidium
lenged with 1 ml of a mixture of 2 or 3 strains,                   bromide/ml. As control, DGGE was performed on
added in equal amounts (OD 3.0 at 720 nm). After                   PCR products from cultured cyanobacteria either
7 days co-culture, the roots were rinsed and sonicated             one by one, or in combinations of four. To exclude
for three minutes to remove loosely attached cyano-                that the plant roots influenced the result, DGGE pat-
bacteria. The roots from each competition setup were               terns of cyanobacteria associated individually with rice
                                M. Nilsson et al. / FEMS Microbiology Letters 245 (2005) 139–144                                       141

roots were compared to those of cultured isolates. The             3. Results
experiments were repeated three times.
                                                                   3.1. Cyanobacterial competition
2.4. Inhibition experiments
                                                                      During competition assays, only one Nostoc strain at
   Investigations were made to see if the four cyano-              a time associated with the rice roots. The hetR-DGGE
bacterial strains could inhibit the growth of the others.          analyses demonstrated a single band per competition
The cyanobacterial strains were grown individually in              experiment, corresponding to a single strain (Fig. 1).
15 ml Falcon tubes on semisolid (0.5%) agar slopes                 One strain, Nostoc strain 8964:3, was dominating on
containing BG110, and in liquid cultures of the same               the rice roots as its hetR-DGGE fingerprint was the only
media for three weeks. After three weeks, the four                 to appear when combined with the other strains (Fig. 1).
strains from the liquid cultures were spread over indi-            When strain 8964:3 was not included, the second most
vidual agar plates (1.5%) containing BG110 and were                successful strain was Nostoc strain 9104 (Fig. 1). How-
allowed to dry. Semisolid agar (0.5%), also containing             ever, when using non-associated, cultured isolates, each
BG110, was poured onto the same plates. The new agar
layer was left to set, after which small pieces of grow-
ing cyanobacteria from the Falcon tubes were placed
on the agar plates. The pieces, containing the putative
inhibiting strains, were put one by one, or two at a
time on the plate. The plates were incubated in condi-
tions described for cyanobacterial cultivation for three
weeks. Any inhibition would be detected as a clear
zone in the basal growing mat surrounding the inhibi-
tory Nostoc strain. The experiment was repeated two
times.

2.5. Chemotaxis

   Chemotaxis was investigated by the capillary method
developed by Knight and Adams [19]. Exceptions to the
method were that hormogonia was induced by red light
for 18 h and that 5 ml of hormogonial suspension were
used in each Petri dish compartment. Putative attrac-
tants were: crushed rice root or stem from plants grown
with or without nitrogen, Blasia exudates from plants
with or without nitrogen, and as control cyanobacterial
media BG110. After 24 h incubation under the same
conditions as described for rice growth, as well as in
the conditions described for cyanobacterial cultivation,
the number of hormogonia in the microslides was
counted using a light microscope. The experiment was
repeated six times.

2.6. Hormogonia induction

   To investigate the capacity of rice to induce hormo-
gonia, the method described by Rasmussen et al. [20]
was used. Cyanobacteria (1 g FW, OD 3.0 at 720 nm)
                                                                   Fig. 1. Denaturing gradient gel electrophoresis (DGGE) patterns of
were placed in Eppendorf tubes and the putative hormo-             cyanobacteria competing on rice roots, using a PCR amplified region
gonia inductant were added: i.e., crushed rice roots from          of the hetR gene. (a) Competition of two cyanobacterial strains in the
plants grown with or without nitrogen. As control the              combinations described above each lane. The first four lanes represent
cyanobacterial media BG11 ± nitrogen were used. After              the hetR products obtained from cultured Nostoc strains 8901:1,
                                                                   8964:3, 8981 and 9104. (b) Competition of three strains in the
18 h incubation in 24 °C and 18 lmol photons mÀ2 sÀ1,
                                                                   combinations described above each lane. The last four lanes, represent
the number of hormogonia was counted in a light micro-             (as in (a)) the individual cyanobacterial patterns from the strains when
scope. The experiment was repeated three times with                in culture. To the far right are hetR-DGGE patterns from all four
three replicates in each trial.                                    strains when mixed from pure cultures.
142                                              M. Nilsson et al. / FEMS Microbiology Letters 245 (2005) 139–144

Nostoc strain was amplified with the same PCR effi-                                                               350
ciency, as all bands of the four strains appeared with                                                         300          Root
the same intensity using hetR-DGGE (Fig. 1(b)). More-




                                                                                     Hormogonia / microslide
                                                                                                                            Stem
                                                                                                               250
over, the bands from cultured cyanobacteria migrated to                                                                     Control
the same position on the DGGE gels as bands from cya-                                                          200
nobacteria co-cultured individually with rice, indicating                                                      150
that the plant material did not interfere with the cyano-
                                                                                                               100
bacterial DGGE patterns.
   When the four strains were grown together and com-                                                           50
peted on BG110-agar plates, the same result as from the                                                          0
hetR-DGGE investigation was obtained. The strain that                                                                     Nostoc        Nostoc     Nostoc 8981   Nostoc 9104
appeared dominating and displayed the largest hor-                                   (a) -50                              8901:1        8964:3
mogonial spreading on the plate was Nostoc strain
8964:3, expanding its radius almost 28 mm (Fig. 2).                                                             900
Again, the second most dominating strain was Nostoc




                                                                                     Hormogonia / microslide
                                                                                                                800        Root
strain 9104, spreading 22 mm during the same time per-                                                          700        Stem
iod (Fig. 2).                                                                                                   600        Control
                                                                                                                500
3.2. Chemotaxis                                                                                                 400
                                                                                                                300
   Rice was found to chemotactically attract Nostoc                                                             200
strain 9104 (Fig. 3), but the attraction varied depending                                                       100
on temperature and whether the plant had been grown                                                                  0
                                                                                                               -100       Nostoc        Nostoc     Nostoc 8981 Nostoc 9104
with or without nitrogen. The highest attraction                                     (b)                                  8901:1        8964:3
(approximately 550 hormogonia/microslide) was seen
using stem extract from rice plants grown with nitrogen
                                                                                                               160
and at 24 °C (Fig. 3(b)). Contrary, at the same temper-                                                                    Root
                                                                                                               140
                                                                                     Hormogonia / microslide




ature, using rice grown in absence of nitrogen, the root                                                                   Stem
extract attracted most hormogonia (approximately 250                                                           120         Control
hormogonia/microslide, Fig. 3(a)). At 30 °C, fewer total                                                       100
hormogonia were detected, approximately 80 hormogo-                                                            80
nia/microslide (Fig. 3(c) and (d)).                                                                            60
   In order to evaluate the chemotactic method, the                                                            40
investigations performed by Knight and Adams [19]
                                                                                                               20
were repeated using Nostoc strain LBG1. We obtained
                                                                                                                0
similar attraction towards Blasia exudates, although
                                                                                                                         Nostoc       Nostoc     Nostoc 8981 Nostoc 9104
                                                                                     (c)                                 8901:1       8964:3
                    35
                             Nostoc 8901:1                                                                      80
                    30       Nostoc 8964:3                                                                      70         Root
                                                                                     Hormogonia / microslide




                             Nostoc 8981                                                                        60
                                                                                                                           Stem
                    25                                                                                                     Control
                             Nostoc 9104                                                                        50
      Growth (mm)




                    20                                                                                          40
                                                                                                                30
                    15
                                                                                                                20
                    10                                                                                          10
                                                                                                                 0
                    5                                                                (d) -10                             Nostoc        Nostoc      Nostoc 8981 Nostoc 9104
                                                                                                                         8901:1        8964:3
                    0
                         Day 1   Day 2   Day 3   Day 7    Day 8   Day 9             Fig. 3. Chemotactic attraction (hormogonia/microslide) of Nostoc
                                                                                    strains 8901:1, 8964:3, 8981, and 9104 towards extracts of crushed rice
Fig. 2. Hormogonial spreading (radial spread from original spot in                  root and stem. The experiments were performed at 24C ((a) and (b)),
mm) of Nostoc strains 8901:1, 8964:3, 8981 and 9104 cultivated                      and at 30 °C ((c) and (d)), using extracts from plants grown with (+N,
together four at a time on agar plates containing cyanobacterial media,             (b) and (d)) or without (ÀN, (a) and (c)) nitrogen. As control, pure
BG110, during nine days incubation. The values are means ± SE of 6                  cyanobacterial media (BG110) were used. The values are means ± SE
experiments.                                                                        of 6 experiments.
                                        M. Nilsson et al. / FEMS Microbiology Letters 245 (2005) 139–144                            143

              300
                     Control
                                                                           as natural hosts have been shown to release a hormogo-
                     +N
                                                                           nia inducing factor (HIF) to aid establishment of cyano-
              250                                                          bacterial symbioses [19–24]. Our data show that not
                     -N
                                                                           only natural host plants [19] but also non-host plants
              200
 Hormogonia




                                                                           can induce hormogonia, supporting earlier investiga-
              150
                                                                           tions [10,13]. Interestingly, Nostoc 8964:3 did not form
                                                                           the highest number of hormogonia, indicating that com-
              100                                                          petitive fitness is not directly related to the number of
                                                                           hormogonia formed initially. However, competitive fit-
              50                                                           ness may require a continuous high production of hor-
                                                                           mogonia, or perhaps more importantly, a high speed
               0                                                           of hormogonial motility and spreading, as indicated by
                    Nostoc     Nostoc    Nostoc 8981 Nostoc 9104
                                                                           our results. Our results therefore suggest rapid hor-
                    8901:1     8964:3
                                                                           mogonial spreading, a prominent feature in the highly
Fig. 4. Hormogonia induction of Nostoc strains 8901:1, 8964:3, 8981,       competitive Nostoc strain 8964:3, to be more important
and 9104, caused by rice root extracts from plants grown with (+N) or      for competitive success during artificial association than
without nitrogen (ÀN), as indicated. Pure cyanobacterial media
                                                                           chemotaxis, inhibition of competing strains, and initial
(BG110) were used as control. The values are means ± SE of 9
experiments.                                                               hormogonia formation.
                                                                              Nostoc strain 8964:3 displayed a low positive chemo-
with fewer hormogonia (data not shown). Blasia exu-                        taxis towards rice compared to Nostoc strain 9104.
dates did not attract the Nostoc strains used in this                      However, cyanobacteria were in the competition assay
study. However, Nostoc strain LBG1 was attracted to                        added to rice roots in comparatively large quantities,
rice roots, mainly towards extracts from rice grown with                   and co-cultivation occurred in a restricted space where
nitrogen at 24 °C (data not shown).                                        long-distance attraction may not have been needed for
                                                                           association to occur. Chemotaxis may, however, be
3.3. Hormogonia induction                                                  important in establishment of natural cyanobacterial
                                                                           symbioses [19,24].
   Rice root extract induced hormogonia in all four                           Nostoc strain 9104 was attracted to different plant or-
Nostoc strains (Fig. 4). The highest induction (approxi-                   gans depending on whether the plant was grown with or
mately 220 hormogonia) was found in Nostoc strain                          without nitrogen (N). Potentially roots, the natural site
9104. Most hormogonia were generally induced by rice                       for N-uptake in plants, excrete some attracting signal un-
root extract from plants grown without nitrogen. The                       der N-deplete conditions aimed at nitrogen-fixing organ-
exception was Nostoc strain 9104, which formed most                        isms. The reason for the high chemo-attraction observed
hormogonia in the presence of rice root extract from                       towards rice stem under N-replete conditions can at pres-
plants grown on nitrogen.                                                  ent stage only be speculative and call for further experi-
                                                                           ments. However, also during single strain co-cultivation
3.4. Inhibition                                                            with rice roots [15], Nostoc strain 9104 displayed the
                                                                           highest association to rice plants grown with nitrogen.
   Finally, the ability of individual cyanobacteria to in-                    In conclusion, the data show that Nostoc strains com-
hibit growth and spread of neighboring cyanobacterial                      pete when associating with rice roots and that one strain
strains was examined. However, none of the four Nostoc                     can out-compete other strains. Of the four tested Nostoc
strains prevented the growth of the other three strains                    strains, strain 8964:3 was the most competitive. We pro-
(data not shown).                                                          pose this capacity to be ascribed to a highly efficient
                                                                           spreading of hormogonia. Neither inhibition of compet-
                                                                           ing cyanobacterial strains or ability to respond to che-
4. Discussion                                                              motactic attraction seemed to be crucial for associative
                                                                           success, although they may be of importance under nat-
   To our knowledge, this is the first time competition at                  ural conditions. As in natural cyanobacterial symbioses
the strain level has been identified among Nostoc strains                   where only a specific range of cyanobacteria is allowed
forming artificial associations with rice roots. Of the                     entry into a specific host [25], selectivity at the strain le-
four tested strains, Nostoc strain 8964:3 was the most                     vel also is apparent in artificial associations. Further-
competitive, even though all strains were selected for                     more, the specificity seen in natural cyanobacterial
having a high rice root associating capacity and all being                 symbioses [25] may be a consequence of the competitive
symbiotically competent [15,16].                                           fitness of individual cyanobacterial strains, rather than a
   Hormogonia are known prerequisites for symbiotic                        physical or chemical barrier established by the host or
competence and their importance can be understood                          the environment.
144                                     M. Nilsson et al. / FEMS Microbiology Letters 245 (2005) 139–144

Acknowledgements                                                           [12] Gantar, M., Rowell, P., Kerby, N.W. and Sutherland, I.W. (1995)
                                                                                Role of extracellular polysaccharides in the colonization of wheat
                                                                                (Triticum vulgare L.) roots by N2-fixing cyanobacteria. Biol. Fert.
   We thank SAREC, SIDA (Sweden) for financial sup-                              Soils 19, 41–48.
port. We are grateful to Dr. E. Soderback (Stockholm
                                   ¨    ¨                                  [13] Svircev, Z., Tamas, I., Nenin, P. and Drobac, A. (1997) Co-
University), who collected the cyanobacteria used. We                           cultivation of N2-fixing cyanobacteria and some agriculturally
also thank Dr. A. Liaimer (Stockholm University) for                            important plants in liquid and sand cultures. Appl. Soil Ecol. 6,
                                                    ˚
generous help with the inhibition assays and to L. Mar-                         301–308.
                                                                           [14] Gusev, M.V., Baulina, O.I., Gorelova, O.A., Lobakova, E.S. and
tensson (Stockholm University) for assisting with                               Korzhenevskaya, T.G. (2002) Artificial cyanobacterial–plant
DGGE.                                                                           symbioses In: Cyanobacteria in Symbiosis (Rai, A.N., Bergman,
                                                                                B. and Rasmussen, U., Eds.), pp. 253–312. Kluwer Academic
                                                                                Press, The Netherlands.
References                                                                 [15] Nilsson, M., Bhattacharya, J., Rai, A.N. and Bergman, B. (2002)
                                                                                Colonization of roots of rice (Oryza sativa) by symbiotic Nostoc
 [1] Rai, A.N., Bergman, B. and Rasmussen, U., Eds., (2002).                    strains. New Phytol. 156, 517–525.
     Cyanobacterial–plant Symbiosis, p. 355. Kluwer Academic Pub-          [16] Nilsson, M., Bergman, B. and Rasmussen, U. (2000) Cyanobac-
     lishers, Dordrecht.                                                        terial diversity in geographically related and distant host plants of
 [2] Adams, D.G. and Duggan, P.S. (1999) Heterocyst and akinete                 the genus Gunnera. Arch. Microbiol. 173, 97–102.
     differentiation in cyanobacteria. New Phytol. 144, 3–33.               [17] Rasmussen, U. and Svenning, M. (2001) Characterization by
 [3] Dodds, K., Gudder, D.A. and Mollenhauer, D. (1995) The                     genotypic methods of symbiotic Nostoc strains isolated from five
     ecology of Nostoc. J. Phycol. 31, 2–18.                                    species of Gunnera. Arch. Microbiol. 176, 204–210.
 [4] Gusev, M.V., Butenko, R.G. and Korzhenevskaya, T.G. (1984)            [18] Stanier, R.Y., Kunisawa, R., Mandel, M. and Cohen-Bazire, G.
     Cyanobacteria in association with cultivated cells of higher plants        (1971) Purification and properties of multicellular blue-green
     In: Soviet Scientific Reviews (Skulachev, V.P., Ed.), vol. 4, pp. 1–        algae (order Chlorococcales). Bacteriol. Rev. 35, 171–205.
     40. Harwood Academic Publisher, NY.                                   [19] Knight, C.D. and Adams, D.G. (1996) A method for studying
 [5] Korzhenevskaya, T.G., Baulina, O.I., Gorelova, O.A., Lobacova,             chemotaxis in nitrogen fixing cyanobacterium–plant symbioses.
     E.S., Butenko, R.G. and Gusev, M.V. (1993) Artificial syncya-               Physiol. Mol. Plant Pathol. 49, 73–77.
     noses: the potential for modeling and analysis of natural             [20] Rasmussen, U., Johansson, C. and Bergman, B. (1994) Early
     symbioses. Symbioses 15, 77–103.                                           communication in the Gunnera-Nostoc symbiosis: plant-induced
 [6] Korzhenevskaya, T.G., Gorelova, O.A., Baulina, O.I. and Gusev,             cell differentiation and protein synthesis in the cyanobacterium.
     M.V. (1999) Accumulation of reserve polymers by Nostoc                     Mol. Plant–Microbe Interact. 7 (6), 696–702.
     muscorum CALU 304 cells grown in mixed culture with plant             [21] Campbell, E.L. and Meeks, J.C. (1989) Characteristics of
     tissue. Microbiology 68, 158–163.                                          hormogonia formation by symbiotic Nostoc species in response
 [7] Spiller, H. and Gunasekaran, M. (1991) Simultaneous oxygen                 to the presence of Anthoceros punctatus or its extracellular
     production and nitrogenase activity of an ammonia-excreting                products. Appl. Environ. Microbiol. 55, 125–131.
     mutant of cyanobacterium Anabaena variabilis in co-culture with       [22] Bergman, B., Matveyev, A. and Rasmussen, U. (1996) Chemical
     wheat. Appl. Microbiol. Biotechnol. 35, 798–804.                           signaling in cyanobacterial–plant symbioses. Trends Plant Sci. 1,
 [8] Gantar, M., Kerby, N.W., Rowell, P. and Obreht, Z. (1991)                  191–197.
     Colonization of wheat (Triticum vulgare L.) by N2-fixing cyano-        [23] Cohen, M.F. and Meeks, J.C. (1997) A hormogonia regulating
     bacteria: I. A survey of soil cyanobacterial isolates forming              locus, hrmUA, of the cyanobacterium Nostoc punctiforme strain
     associations with roots. New Phytol. 118, 477–483.                         ATCC 29133 and its response to an extract of a symbiotic plant
 [9] Gantar, M., Kerby, N.W. and Rowell, P. (1991) Colonization of              partner Anthoceros punctatus. Mol. Plant–Microbe Interact. 10
     wheat (Triticum vulgare L.) by N2-fixing cyanobacteria: II. An              (2), 280–289.
     ultrastructural study. New Phytol. 118, 485–492.                      [24] Watts, S.D., Knight, C.D. and Adams, D.G. (1999) Character-
[10] Gantar, M., Kerby, N.W. and Rowell, P. (1993) Colonization of              ization of plant exudates inducing chemotaxis in nitrogen-fixing
     wheat (Triticum vulgare L.) by N2-fixing cyanobacteria: III. The            cyanobacteria In: The Phototrophic Prokaryotes (Peschek, G.A.,
     role of a hormogonia-promoting factor. New Phytol. 124, 505–               Loffenhardt, W. and Schmetter, G., Eds.), pp. 679–684. Kluwer
                                                                                  ¨
     513.                                                                       Academic/Plenum Publishers, New York.
[11] Spiller, H., Stallings Jr., W., Woods, T. and Gunasekaran, M.         [25] Rasmussen, U. and Nilsson, M. (2002) Diversity and specificity in
     (1993) Requirement for direct association of ammonia-excreting             cyanobacterial symbioses In: Cyanobacteria in Symbiosis (Rai,
     Anabaena variabilis mutant (SA-1) with roots for maximal growth            B., Bergman, B. and Rasmussen, U., Eds.), pp. 313–328. Kluwer
     and yield of wheat. Appl. Microbiol. Biotechnol. 40, 557–566.              Academic Press, The Netherlands.
                                            FEMS Microbiology Letters 245 (2005) 145–153
                                                                                                                   www.fems-microbiology.org




       Diversity of carbazole-degrading bacteria having the car gene
                 cluster: Isolation of a novel gram-positive
                       carbazole-degrading bacterium
     Kengo Inoue, Hiroshi Habe, Hisakazu Yamane, Toshio Omori 1, Hideaki Nojiri                                                      *

                    Biotechnology Research Center, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan

                                               Received 4 February 2005; accepted 2 March 2005

                                                      First published online 14 March 2005

                                                            Edited by H-P.E. Kohler




Abstract

   Twenty-seven carbazole-utilizing bacterial strains were isolated from environmental samples, and were classified into 14 groups
by amplified ribosomal DNA restriction analysis. Southern hybridization analyses showed that 3 and 17 isolates possessed the car
gene homologs of Pseudomonas resinovorans CA10 and Sphingomonas sp. strain KA1, respectively. Of the 17 isolates, 2 isolates also
have the homolog of the carAa gene of Sphingomonas sp. strain CB3. While the genome of one isolate, a Gram-positive Nocardioides
sp. strain IC177, showed no hybridization to any car gene probes, PCR and sequence analyses indicated that strain IC177 had tan-
demly linked carAa and carC gene homologs whose deduced amino acid sequences showed 51% and 36% identities with those of
strain KA1.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Carbazole; Biodegradation; Carbazole 1,9a-dioxygenase; Nocardioides




1. Introduction                                                            bacteria in bioremediation [2–15]. The carbazole-cata-
                                                                           bolic car genes from Pseudomonas resinovorans CA10
   Carbazole is an N-heterocyclic aromatic compound                        (carCA10 genes) have been studied extensively, and the
derived from creosote, crude oil, and shale oil. Carba-                    carbazole biodegradation pathway of this organism
zole is known to be both mutagenic and toxic but has                       has been elucidated [3,16–21]. The proteins and genes in-
been used as an industrial raw material for the production                 volved in this process are carbazole 1,9a-dioxygenase
of dyes, medicines, and plastics [1]. Various Gram-                        (carAa, carAc, carAd), meta-cleavage enzyme (carBa,
negative carbazole-degrading bacteria have been reported                   carBb), and the meta-cleavage compound hydrolase
in studies examining the mechanisms of biodegradation                      (carC), which together convert carbazole to anthranilic
of this recalcitrant compound and the application of                       acid and 2-hydroxy-4-pentenoate [16,17]. In strain
                                                                           CA10, the car genes are located on a 199-kb circular
 *
                                                                           plasmid, pCAR1 [18]. The complete nucleotide sequence
    Corresponding author. Tel.: +81 3 5841 3064; fax: +81 3 5841 8030.     of pCAR1 showed that the tra and trh genes, which are
    E-mail address: anojiri@mail.ecc.u-tokyo.ac.jp (H. Nojiri).
  1
    Present address: Department of Industrial Chemistry, Shibaura
                                                                           potentially involved in conjugative transfer, are present
Institute of Technology, 3-9-14 Shibaura, Minato-ku, Tokyo 108-8548,       in pCAR1, suggesting that pCAR1 is a self-transmissi-
Japan.                                                                     ble plasmid [19]. The nucleotide sequence of pCAR1

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.03.009
146                              K. Inoue et al. / FEMS Microbiology Letters 245 (2005) 145–153

also indicates that the carCA10 gene cluster is contained          2.2. Isolation of carbazole-degrading bacteria
within a 72.8-kb class II type transposon, Tn4676 [19].
These genetic elements, pCAR1 and Tn4676, are                         We collected 71 samples from cultivated soils, river
thought to play an important role in the distribution              water, river sediments, seawater, sea sediments, and acti-
(or recruitment) of the car gene cluster in nature [20].           vated sludge from different areas in Japan. A 50-mg or
In addition, another carbazole-degrading Sphingomonas              50-ll aliquot of each sample was suspended in 5 ml of
sp. strain KA1 also possesses a large carbazole-catabolic          CNFMM (carbon- and nitrogen-free mineral medium)
plasmid, pCAR3, which harbors the carAaBaBbCAc                     [18] containing 0.1% (wt/vol) carbazole and incubated
genes [10,14]. In the carbazole 1,9a-dioxygenase encoded           at 25 or 30 °C with reciprocal shaking (285 strokes per
by the car gene cluster of strain KA1 (carKA1 gene clus-           min). When bacterial growth was observed, 50 ll of cul-
ter), a putidaredoxin-type ferredoxin mediates electron            ture were transferred into fresh medium. After four cy-
transport from unidentified reductases to the terminal              cles of transfer to fresh medium, the culture was
oxygenase, although strain CA10 has a Rieske-type fer-             diluted and spread onto a CNFMM agar plate contain-
redoxin [14]. An ORF (designated carR) upstream of the             ing carbazole. Colonies that were surrounded by a clear
carKA1 gene cluster shows amino acid sequence homol-               zone, as a result of carbazole degradation, were trans-
ogy to the GntR family of transcriptional regulators               ferred onto nutrient broth agar medium (Eiken Chemical,
[14]. Sphingomonas sp. strain CB3, a different carba-               Co., Ltd., Japan) to isolate the carbazole-degrading bac-
zole-utilizing bacterium from above described two                  teria completely. For sea samples, filtered seawater was
strains, had a unique carbazole dioxygenase putatively             used as a substitute for CNFMM.
encoded by carAa, carAb, carAc, and carAd [8]. While
the carbazole 1,9a-dioxygenase of strains CA10 was                 2.3. PCR, sequencing, and phylogenetic analysis
affiliated with class III dioxygenase, the putative initial
dioxygenase of strain CB3 belonged to class IIB [8].                   Total cellular DNA was extracted from carbazole-uti-
The deduced amino acid sequences of CarAa, CarAc,                  lizing strains grown on Luria–Bertani (LB) medium [22],
and CarAd showed 13%, 31%, and 10% identities with                 1/3 LB (0.33% tryptone, 0.16% yeast extract, and 0.5%
corresponding amino acid sequences of strain CA10,                 NaCl), or Marine Broth 2216 (Difco, Detroit, Michigan,
respectively [8].                                                  USA) at 30 °C using standard protocols [22]. The 16S
    In this work, we analyzed the diversity of carbazole-          rRNA genes of each strain were amplified using the for-
degrading microorganisms isolated from different soils              ward primer 27f (5 0 -AGAGTTTGATC[A/C]TGGCT-
and activated sludge in Japan. Taxonomic characteriza-             CAG-3 0 ) and the reverse primer 1492r (5 0 -TACGG[A/T/
tion of the isolates was conducted using amplified ribo-            C]TACCTTGTTACGACTT-3 0 ), which correspond to
somal DNA restriction analysis (ARDRA) and                         positions 8-27 and 1492-1513, respectively, of the Esche-
sequencing of the 16S rDNA gene. The occurrence of                 richia coli 16S rRNA sequence. Total DNA from each
known carbazole-degrading genes (the carAaBaBbCAc                  strain was used as a template for PCR with reaction con-
genes of strain CA10, carRAaBaBbCAc genes of strain                ditions as described by Polz Cavanaugh [23]. PCR prod-
KA1, and carAa gene of Sphingomonas sp. strain CB3                 ucts were digested with the restriction endonucleases
CarAaCB3 [8]) in each isolate was determined by South-             Hae III, Hha I, and Sau 3AI, and the restriction fragments
ern hybridization analysis. PCR amplification of DNA                were analyzed by electrophoresis on 3% agarose gels.
from an isolate belonging to the Gram-positive genus                   A portion of the gene encoding the terminal oxygen-
Nocardioides with degenerate primers for the carAa gene            ase component (carAa) of carbazole 1,9a-dioxygenase
produced an amplicon of an unexpected size. The nucle-             was amplified by degenerate PCR using the carAa shar-
otide sequence of this amplified DNA fragment revealed              ing primers described by Habe et al. [10] with total DNA
regions of homology to the carAa and carC genes. This              of the isolates as the template. Appropriate PCR prod-
is the first report of a Gram-positive carbazole-utilizing          ucts were cloned into the pT7Blue T-vector (Novagen,
bacterium.                                                         Madison, Wisconsin, USA) for sequence analysis. The
                                                                   nucleotide sequences were determined using methods
                                                                   described previously [18] and analyzed using DNASIS-
2. Materials and methods                                           Mac software (version 3.7, Hitachi Software Engineer-
                                                                   ing Co., Ltd., Yokohama, Japan). We searched the
2.1. Chemicals                                                     DDBJ/EMBL/GenBank databases for homologous se-
                                                                   quences with the BLASTn and BLASTp programs. Phy-
  Carbazole and other aromatic compounds were pur-                 logenetic trees were produced with the TreeView
chased from Kanto Chemical Co., Inc. (Tokyo, Japan)                program [24]. The deduced amino acid sequences of
and Wako Pure Chemical (Osaka, Japan). N-Methyl-                   the partial carAa and carC homologs of strain IC177
N-trimethylsilyltrifluoroacetamide (MSTFA) was pur-                 were aligned by ClustalW through DDBJ (http://
chased from Nacalai Tesque, Inc. (Kyoto, Japan).                   www.ddbj.nig.ac.jp).
                                        K. Inoue et al. / FEMS Microbiology Letters 245 (2005) 145–153                                          147

2.4. Southern hybridization                                                  quences. Custom primers were designed for carRKA1
                                                                             (5 0 -ATCCGGAAGGTCAGCAAAAA-3 0 and 5 0 -TTT-
   Southern hybridization analysis of EcoRI-digested                         CAACGACCATGACTTCG-3 0 ), carAaKA1 (5 0 -TAAC-
total DNA of the isolates was performed under stringent                      CAACCATCAATCGCC-3 0 and 5 0 -TCAACGTGCTT-
conditions according to previously described methods                         CCTGAATGC-3 0 ), and carAcKA1 (5 0 -CAAAGGTCC-
[18]. The isolates were screened for regions of DNA                          GCGTGATCTT-3 0 and 5 0 -TCATGACTGTGCCTTC-
homologous to the car genes of strains CA10, KA1,                            GGCA-3 0 ).
and CB3 [8,14,16]. Probes of the car gene clusters of
strains CA10 (carCA10 probe) and KA1 (carKA1 probe)                          2.5. Growth tests
were prepared from a 6.9-kb fragment from pUCA1
[17] (containing carAaBaBbCAcAd and partial carD)                               The growth of strains IC177 and CA10 using various
and a 4.5-kb Xho I-Hin dIII fragment with an insert of                       aromatic compounds was examined in CFMM (carbon-
pBKA102 (containing carRAaBaBbCAc) [14], respec-                             free mineral medium) liquid culture [18] containing
tively, using methods described previously [18]. We pre-                     0.1% wt/vol of the carbon substrate. Xylene, toluene,
pared a probe of the carAa gene of Sphingomonas sp.                          phenol, benzoic acid, salicylic acid, gentisic acid, phthalic
strain CB3 [8] from a 0.9-kb fragment amplified from to-                      acid, protocatechuic acid, anthranilic acid, naphthalene,
tal DNA of strain CB3 by PCR using carAa sharing                             biphenyl, anthracene, fluoranthene, phenanthrene, pyr-
primers (carAaCB3 probe). The 0.9-kb fragment was                            ene, dibenzofuran, dibenzo-p-dioxin, dibenzothiophene,
cloned into the pT7Blue T-vector and the nucleotide se-                      dibenzothiophene sulfone, fluorene, 9-fluorenone, in-
quence of the fragment was checked with the original se-                     dole, and carbazole were tested as the sole source of car-
quence of the carAaCB3. Strain CB3 was a gift from Dr.                       bon and energy. Each substrate was dissolved at 10%
Lloyd-Jones, of University of Waikato. The gene orga-                        (wt/vol) in dimethyl sulfoxide to make a highly concen-
nization and physical maps of the regions used as the                        trated stock solution. N,N-dimethylformamide was used
carCA10 probe and the carKA1 probe are shown in Fig.                         instead of dimethyl sulfoxide as the solvent for pyrene,
1. The probes of the carR, carAa, and carAc genes of                         phenanthrene, and dibenzo-p-dioxin. Following starva-
strain KA1 (carRKA1, carAaKA1, and carAcKA1, respec-                         tion of the cells for a week in CFMM liquid culture,
tively), were prepared from PCR-amplified internal se-                        approximately 103 cells of each strain were inoculated




Fig. 1. Genetic maps of the car gene clusters of Pseudomonas resinovorans CA10 and Sphingomonas sp. strain KA1 and the partial regions of car gene
homologs of Nocardioides sp. strain IC177. The pentagons indicate the sizes, locations, and directions of transcription of the ORFs; car genes are
shown by hatched pentagons. The black box represents the DNA region used as the carCA10 or the carKA1 probe. A schematic overview of the
Southern blot analysis of Eco RI-digested total DNA prepared from 17 strains and strain CB3 using the carKA1 probe, the carRKA1 probe, and the
carAcKA1 probe is also shown. Shaded boxes represent the sizes of EcoRI fragments conserved in respective strains. Open boxes represent the sizes of
EcoRI fragments that hybridized with the carKA1 probe, the carRKA1 probe, or the carAcKA1 probe but were not identical to the corresponding
EcoRI fragments of strain KA1. Homologous DNA regions among strains IC177, CA10, and KA1 are represented by shading, and amino acid
identities (%) are shown. The EcoRI restriction site is indicated by ‘‘E’’.
148                               K. Inoue et al. / FEMS Microbiology Letters 245 (2005) 145–153

into 5 ml of CFMM containing a single carbon source.                the 16S rRNA gene sequences are as follows: IC001, no.
Bacteria were enumerated by plate counts after 1 and 3              AB196244; IC017, no. AB196245; IC033, no. AB1-
weeks of incubation at 30 °C.                                       96246; IC049, no. AB196247; IC074, no. AB196248;
                                                                    IC075, no. AB196249; IC081, no. AB196250; IC114, no.
2.6. Carbazole degradation by strain IC177                          AB196251; IC138, no. AB196252; IC145, no. AB1-
                                                                    96253; IC161, no. AB196254; IC177, no. AB196255;
   The biodegradation of carbazole was monitored in                 IC193, no. AB196256; and IC961, no. AB196257. The
growing cell cultures in 200 ml CFMM medium contain-                nucleotide sequence data for the PCR-amplified DNA
ing 0.1% (wt/vol) carbazole. Cultures of strain IC177               fragment containing the car gene homolog from strain
were incubated at 30 °C with agitation at 120 rpm, and              IC177 was registered under accession no. AB196258.
after a period of incubation, triplicate samples were ta-
ken for analysis of cell numbers and the remaining
amount of carbazole. Growing cultures of strain IC177               3. Results and discussion
were analyzed for bacterial numbers by plate counts
and then extracted with ethyl acetate. The ethyl acetate            3.1. Isolation and phylogenetic grouping of
layer was dried over anhydrous sodium sulfate. A por-               carbazole-utilizing bacteria
tion of each extract was analyzed using a model JMS-
Automass 150 gas chromatography-mass spectrometry                      We isolated 27 carbazole-utilizing bacterial strains
(GC–MS) system (JEOL, Ltd., Tokyo, Japan) fitted                     from different environmental samples, such as river sed-
with a fused-silica chemically-bonded capillary column              iment, sea soils, cultivated soils, and activated sludge.
(DB-5; 0.25 mm [inside diameter] by 15 m, 0.25 lm film               All carbazole-degrading strains were characterized by
thickness; J & W Scientific Inc., Folsom, California,                ARDRA with three restriction endonucleases (Hae III,
USA). Each sample was injected into the column at                   Hha I, and Sau 3AI). ARDRA allowed discrimination
80 °C in the splitless mode. After 2 min at 80 °C, the col-         among 14 different ARDRA types. The 16S rDNA
umn temperature was increased at 16 °C minÀ1 to                     genes from representative isolates of each ARDRA type
280 °C. The head pressure of the helium carrier gas                 were sequenced, and the obtained sequences were
was 65 kPa. To quantify the carbazole remaining, the                aligned with sequences from the GenBank database.
proportion of the peak area for the total ion current               The percentages of similarity are shown in Table 1.
of carbazole was compared to that of the dibenzo-p-di-              The strains of ARDRA types C, F, G, and J were clas-
oxin which was used as the internal standard and ex-                sified as genus Sphingomonas, ARDRA types D and I
pressed relative to the amount present at 0 h.                      were classified as genus Burkholderia, ARDRA type B
                                                                    was classified as genus Pseudomonas, and ARDRA type
                                                                    K was classified as genus Janthinobacterium. Several car-
2.7. Characterization of carbazole degradation                      bazole-degrading bacteria that have been reported have
intermediates                                                       also belonged to these genera [3–12,14]. However, AR-
                                                                    DRA types A, E, H, L, M, and N were classified into
   In order to identify the products formed during car-             the genera Acinetobacter, Acromobacter, Erythrobacter,
bazole degradation by strain IC177, thin layer chroma-              Nocardioides, Stenotrophomonas, and Marinobacterium,
tography (TLC) and GC–MS analyses were conducted.                   respectively. None of the previously described carba-
Strain IC177 was grown at 30 °C for 4 d in 5 ml of                  zole-utilizing bacteria have belonged to these genera.
CNFMM containing carbazole (0.1%, wt/vol). The cul-                 Hence, to our knowledge, this is the first report of rep-
ture of strain IC177 was extracted with ethyl acetate               resentatives of these genera being capable of mineraliz-
after acidification to pH 3.0 with 1 N HCl. The dried                ing carbazole. Moreover, it is noteworthy that
ethyl acetate extract was developed on a silica gel plate           although all of the known carbazole-utilizing bacteria
(TLC aluminium sheet Silica gel 60 F254, Merck) with                are Gram-negative bacteria, strain IC177 was identified
a solvent system of toluene–dioxane–acetate (90:25:4,               as a Gram-positive Nocardioides sp. (Fig. 2). Nocardio-
by volume). In addition to the TLC analysis, a portion              ides species have previously been shown to degrade a
of each culture extract was directly analyzed by GC–                variety of aromatic compounds, including 2,4,6-trinitro-
MS as described above, following trimethylsilylation                phenol, 2,4,5-trichlorophenxyacetic acid, p-nitrophenol,
(TMS) with MSTFA at 70 °C for 20 min.                               phenanthrene, and dibenzofuran [25–29].

2.8. Nucleotide sequence accession numbers                          3.2. Occurrences of the car genes

  The nucleotide sequences reported in this study have                 We performed Southern hybridization of EcoRI-di-
been deposited in the DDBJ, EMBL, and GenBank                       gested total DNA of the isolates with the carCA10 probe,
nucleotide sequence databases. The accession nos. for               the carKA1 probe, or the carAaCB3 probe, under high
                                        K. Inoue et al. / FEMS Microbiology Letters 245 (2005) 145–153                             149

Table 1
Phenotypic and genotypic characterization of carbazole-utilizing strains.
Strain           Closest phylogenetic relative                                                           ARDRA           Hybridization
                 %                                                                  Accession no.
IC001            99            Acinetobacter johnsonii S35                          AB099655             A               –
IC017            99            Pseudomonas pseudoalcaligenes LMG 1225T              PPZ76666             B               CA10
IC033            99            Sphingomonas xenophaga                               AY611716             C               KA1 and CB3
IC049            92            Burkholderia sp. strain NE-7                         AY568508             D               CA10
IC074            99            Achromobacter xylosoxidans ATCC 9220                 AF411021             E               KA1
IC075            99            Sphingomonas sp. strain Y2                           AB084247             F               KA1
IC081            99            Sphingomonas sp. strain KA1                          AB064271             G               KA1 and CB3
IC097            99            Sphingomonas sp.a                                    –                    F               KA1
IC114            99            Erythrobacter-like sp. strain V4.BO.03               AJ244716             H               –
IC129            –             Burkholderia sp.a                                    –                    I               –
IC138            93            Burkholderia sp. strain NW-1                         AY568509             I               –
IC145            99            Sphingomonas sp. strain J40                          AB097175             J               KA1
IC161            96            Janthinobacterium sp. strain J3                      AB097172             K               CA10
IC177            99            Nocardioides sp. strain H-1                          AB087721             L               –
IC193            99            Stenotrophomonas sp. strain LMG 19833                AJ300772             M               KA1
IC209            –             Sphingomonas sp.a                                    –                    F               KA1
IC258            –             Sphingomonas sp.a                                    –                    F               KA1
IC268            –             Sphingomonas sp.a                                    –                    F               KA1
IC273            –             Sphingomonas sp.a                                    –                    F               KA1
IC290            –             Sphingomonas sp.a                                    –                    F               KA1
IC291            –             Sphingomonas sp.a                                    –                    F               KA1
IC300            –             Sphingomonas sp.a                                    –                    F               KA1
IC306            –             Sphingomonas sp.a                                    –                    F               KA1
IC315            –             Sphingomonas sp.a                                    –                    F               KA1
IC321            –             Sphingomonas sp.a                                    –                    F               KA1
IC961            99            Marinobacterium georgiense IAM 1419T                 AB021408             N               –
IC977            –             Marinobacterium sp.a                                 –                    N               –
 a
     Genus was determined by ARDRA pattern.



stringency conditions. Hybridization to the total DNA                       ported carbazole-degrader Janthinobacterium sp. strain
of three isolates for the carCA10 probe, 17 isolates for                    J3 [14]. Strain J3 also had a 5.6-kb EcoRI fragment that
the carKA1 probe, and two isolates for the carAaCB3                         contained a car gene cluster highly homologous to that
probe was observed (Table 1). There was no hybridiza-                       of strain CA10 [14], implying that strain IC161 has a
tion in the other seven isolates (IC001, IC114, IC129,                      car gene cluster almost identical to strain J3.
IC138, IC177, IC961, and IC977), indicating that these                         For the strains that hybridized with the carKA1 probe,
strains have novel carbazole-degradative genes. We also                     we classified the 17 isolates into five types based on the
investigated the occurrence of novel carAa gene homo-                       sizes of the DNA fragments that hybridized with the
logs in the genomes of these strains by degenerate                          carKA1 probe (Fig. 1). All of the 17 isolates had three
PCR using carAa sharing primers that could amplify                          hybridization signals. To confirm which signal corre-
the internal DNA fragment of the carAa gene (the termi-                     sponded to the upstream or downstream region of the
nal oxygenase component of carbazole 1,9a-dioxygen-                         carAa gene in each strain, we also performed Southern
ase) from well-known carbazole-degrading strains [10].                      hybridization of EcoRI-digested total DNA from the
The nucleotide sequences of the resultant amplicons                         strains with carRKA1 and carAcKA1 as probes (carRKA1
from each isolate were not similar to those of car genes                    probe and carAcKA1 probe, respectively). The results of
(data not shown), except for a 991-bp PCR product                           the hybridization analyses are shown in Fig. 1. Three
from strain IC177 (see ‘‘PCR amplification and isolation                     strains (IC033, IC081, and IC145) showed a hybridiza-
of the carbazole-degradative genes in strain IC177’’).                      tion pattern (>19-, 0.4-, and 3.7-kb EcoRI fragments)
   The hybridization patterns of the three strains                          identical to strain KA1. Five strains (IC074, IC075,
(IC017, IC049, and IC161) that hybridized with the car-                     IC097, IC306, and IC315) had conserved 0.4- and 3.7-
CA10 probe were all different. Strain IC017 was identical                    kb EcoRI fragments, similar to strain KA1, suggesting
to strain CA10 and hybridized with the 6.9-kb EcoRI                         that these strains possessed a gene organization down-
fragment [17], whereas strains IC049 and IC161 hybrid-                      stream of the carAa gene identical to that of strain
ized with 8.0- and 5.6-kb EcoRI fragments, respectively.                    KA1. The results of the hybridization analyses, how-
Strain IC161 was identified as Janthinobacterium and                         ever, indicated that the organization of the region up-
thus was taxonomically the same as the previously re-                       stream of the carAa gene in these five strains differed
150                                     K. Inoue et al. / FEMS Microbiology Letters 245 (2005) 145–153


                                                               Rhodococcus         Mycobacterium tuberculosis
                                               Nocardia
                                               asteroides      rhodochrous

                                                                                                              Corynebacterium diphtheriae

                      Pseudonocardia thermophila




      Streptomyces coelicolor                                                                          Actinoplanes philippinensis




                                                                                                     Nocardioides plantarum

                             Arthrobacter globiformis

                                                  Nocardioides                        Nocardioides jensenii
                                                  simplex    Nocardioides
                                                             sp. IC177
                                    0.01                       Nocardioides
                                                               luteus       Nocardioides albus

Fig. 2. Unrooted phylogenetic tree showing the position of Nocardioides sp. strain IC177, other representatives of the genus Nocardioides, and some
other actinomycete taxa. The GenBank accession numbers of the 16S rDNA sequences used for phylogenetic analysis are: Actinoplanes philippinensis
(D85474), Arthrobacter globiformis (M23411), Corynebacterium diphtheriae (X84248), Mycobacterium tuberculosis (X52917), Nocardia asteroides
(X84850), Nocardioides albus (AF005001), Nocardioides jensenii (AF005006), Nocardioides luteus (AF005007), Nocardioides simplex (AF005013),
Nocardioides plantarum (X69973), Pseudonocardia thermophila (AJ252830), Rhodococcus rhodochrous (X79288), Streptomyces coelicolor (Z76678).




from that of strain KA1. Nine strains (IC193, IC209,                        mediated by other mobile genetic elements, such as
IC258, IC268, IC273, IC290, IC291, IC300, and                               transposons, or by transformation. Further genetic
IC321) possessed a 0.4-kb EcoRI fragment in common                          analysis is needed to determine the existence of
with strain KA1, whereas the results of the hybridiza-                      pCAR3-like elements in the 17 newly isolated strains.
tion analyses revealed that the gene organization of                           Two strains (IC033 and IC081) had an EcoRI frag-
the regions both upstream and downstream of the carAa                       ment that hybridized with the carAaCB3 probe. Length
gene was not identical to that of strain KA1 (Fig. 1).                      of the hybridized fragment was approximately 7.4-kb
   In this study, we isolated 17 bacterial strains having                   both in strains IC033 and IC081, though approximately
car genes homologous to the carKA1 genes. This study                        8.0-kb in strain CB3. Interestingly, these two strains
also demonstrated the existence of divergent structures                     hybridized with the carKA1 probe too (Table 1). More-
of the flanking region of car gene clusters homologous                       over, the hybridization analyses of EcoRI-digested total
to the carKA1 gene cluster. The carKA1 gene cluster is                      DNA of strain CB3 with the carKA1 probe, the carRKA1
known to be located on the large plasmid pCAR3 [10]                         probe, or the carAcKA1 probe revealed that strain CB3
whose entire nucleotide sequence has been determined                        also had a carKA1 homolog and the hybridization pat-
(unpublished data). The 17 isolates may have a                              tern was identical to that of strain IC097 (Fig. 1) (data
pCAR3-like mobile genetic element that mediates lateral                     not shown). These results implied that strains IC033,
gene transfer. Interestingly, hybridization analysis indi-                  IC081, and CB3 possessed two different types of car
cated the presence of carR, carAa, and carAc genes                          gene clusters (KA1-type and CB3-type) and the prod-
highly homologous to those of strain KA1 in Achromo-                        ucts of these car gene clusters might work cooperatively
bacter sp. strain IC074 and Stenotrophomonas sp. strain                     to utilizing carbazole efficiently.
IC193, which belong to the b-proteobacteria and the c-
proteobacteria, respectively, whereas Sphingomonas sp.                      3.3. Biodegradation of carbazole by isolate IC177
strain KA1 belongs to the a-proteobacteria. These re-
sults suggest that the pCAR3-like element may be trans-                        Isolate IC177 is the first isolated example of a carba-
missible to these bacterial genera and widely dispersed in                  zole-utilizing Gram-positive bacterium. To monitor the
nature, or that lateral gene transfer of car genes has been                 growth of Nocardioides sp. strain IC177, we investigated
                                     K. Inoue et al. / FEMS Microbiology Letters 245 (2005) 145–153                                    151

the increase in colony-forming units concomitant with                   Strain IC177 was also able to utilize dibenzothioph-
the removal of carbazole. Strain IC177 was inoculated                   ene-sulfone and anthracene (Table 2). Incubation with
into 200 ml CFMM with carbazole (0.1%, wt/vol) and                      anthracene and anthranilic acid produced yellow and
at various times a sample was analyzed for bacterial                    brown compounds in the medium, respectively. In com-
numbers by plate counts and extracted in order to quan-                 parison with strain CA10, there were clear differences in
tify the carbazole degraded over time (Fig. 3). After a                 the utilization of mono-aromatic compounds. Strain
lag phase (<24 h), strain IC177 started to grow on car-                 CA10 utilized phenol and benzoic acid, whereas strain
bazole. Within 4 d, strain IC177 reached a stationary                   IC177 did not. These differences may reflect variations
phase and had degraded 18% of the carbazole, com-                       in catabolic pathways, the functions of catabolic genes,
pared to a sterile control. The incubated culture turned                and the regulation of catabolic operons. Further de-
brown after 4 d. The degradation profile showed that                     tailed studies are required to attribute the differences
80% of carbazole was degraded by 30 d of incubation                     to specific mechanisms.
(data not shown).
    To identify the intermediates produced during the                   3.5. PCR amplification and isolation of the carbazole-
degradation of carbazole by strain IC177, the ethyl ace-                degradative genes in strain IC177
tate extract of a culture (5 ml CNFMM containing 0.1%
carbazole [wt/vol]) incubated for 4 d after inoculation of                 The results of Southern hybridization analysis of
IC177 cells was analyzed by GC–MS. TMS-derivatized                      EcoRI-digested total DNA of strain IC177 using the
acidified extracts of the culture contained metabolites                  carCA10 probe, the carKA1 probe, and the carAaCB3
that had the same GC retention times and mass spectra                   probe indicated that strain IC177 did not possess genes
as the TMS-derivatives of authentic anthranilic acid.                   highly homologous (more than 90% identity at the
TMS-derivatized anthranilic acid had two GC peaks                       nucleotide sequence level) with the car gene clusters
thought to be derived from compounds that were trim-                    from strains CA10 and KA1. However, as the result of
ethylsilylated at a COOH group and at both COOH                         a PCR amplification using the carAa sharing primers,
and NH2 groups. Each mass-fragmentation pattern                         an approximately 1000-bp DNA fragment was amplified
was as follows: 209 (M+, 60), 194 (78), 176 (13), 150                   from the total DNA of strain IC177. The predicted 810-,
(27), 119 (86), 92 (100), 75 (44), 65 (64), and 281 (M+,                1100-, and 918-bp DNA fragments were detected in a
2), 266 (46), 73 (100; numbers in parentheses represent                 control experiment using total DNA from strains
% base peak), respectively. This result indicated that                  CA10, KA1, and CB3 as a template, respectively (data
the degradation pathway for carbazole to anthranilic                    not shown). The PCR product from strain IC177 was
acid in the Gram-positive strain IC177 was similar to                   cloned into pT7Blue T-vector and the nucleotide se-
that of the Gram-negative strain CA10 [3].                              quence was determined. Sequence analysis revealed that
                                                                        the 991-bp PCR product had a high G + C content
3.4. Growth of strain IC177 with aromatic compounds                     (65.4%) typical of Actinomycetales and contained part
                                                                        of two possible ORFs (ORF1 and ORF2). The deduced
   Strain IC177 was tested for its ability to grow on a                 amino acid sequence of ORF1 showed 51% and 48%
variety of carbon sources. Strain CA10 was also exam-                   identity with the corresponding region of CarAa of
ined in order to compare growth substrate specificity be-                strains KA1 and CA10, respectively (Fig. 1). The de-
tween the two strains. Both strains could utilize                       duced amino acid sequence of ORF2 showed 36% and
protocatechuic acid and anthranilic acid (Table 2).                     34% identity with the corresponding region of the




       Fig. 3. Degradation of carbazole by Nocardioides sp. strain IC177 concomitant with an increase in colony-forming units (cfu).
152                                    K. Inoue et al. / FEMS Microbiology Letters 245 (2005) 145–153

Table 2                                                                  sponding enzymes, the genetic analysis of the flanking
Growth substrate profiles of Nocardioides sp. strain IC177 and            DNA regions of the carAa and carC homologs of strain
Pseudomonas resinovorans CA10
                                                                         IC177 is currently in progress.
Substrate                               IC177                 CA10
Xylene                                  –                     –
Toluene                                 –                     –          Acknowledgments
Phenol                                  –                     ++
Benzoic acid                            –                     ++
Salicylic acid                          –                     –             This work was supported by grants from the Program
Gentisic acid                           –                     –          for Promotion of Basic Research Activities for Innova-
Phthalic acid                           –                     –          tive Bioscience (PROBRAIN). We thank Lloyd-Jones
Protocatechuic acid                     ++                    ++         of University of Waikato for providing Sphingomonas
Anthranilic acid                        ++                    ++
Naphthalene                             –                     –
                                                                         sp. strain CB3.
Biphenyl                                –                     –
Anthracene                              +                     –
Fluoranthene                            –                     –          References
Phenanthrene                            –                     –
Pyrene                                  –                     –           [1] Benedik, M.J., Gibbs, P.R., Riddle, R.R. and Willson, R.C.
Dibenzofuran                            –                     –               (1998) Microbial denitrogenation of fossil fuels. Trends Biotech-
Dibenzo-p-dioxin                        –                     –               nol. 16, 390–395.
Dibenzothiophene                        –                     –           [2] Grosser, R.J., Warshawsky, D. and Vestal, J.R. (1991) Indigenous
Dibenzothiophene sulfone                ++                    –               and enhanced mineralization of pyrene, benzo[a]pyrene, and
Fluorene                                –                     –               carbazole in soils. Appl. Environ. Microbiol. 57, 3462–3469.
9-Florenone                             –                     –           [3] Ouchiyama, N., Zhang, Y., Omori, T. and Kodama, T. (1993)
Indole                                  –                     –               Biodegradation of carbazole by Pseudomonas spp. CA06 and
Carbazole                               ++                    ++              CA10. Biosci. Biotechnol. Biochem. 57, 455–460.
The two strains were grown in liquid CFMM supplemented with 0.1%          [4] Hisatsuka, K. and Sato, M. (1994) Microbial transformation of
(wt/vol) of the compounds shown as the sole carbon source. Growth             carbazole to anthranilic acid by Pseudomonas stutzeri. Biosci.
was quantified by plate counts after incubation for 1 and 3 weeks. ++          Biotechnol. Biochem. 58, 213–214.
Good growth (>107 cfu/ml after 1 week of incubation), + growth            [5] Gieg, L.M., Otter, A. and Fedorak, P.M. (1996) Carbazole
(>107 cfu/ml after 3 weeks of incubation), – no growth (<107 cfu/ml           degradation by Pseudomonas sp. LD2: metabolic characteristics
after 3 weeks of incubation).                                                 and the identification of some metabolites. Environ. Sci. Technol.
                                                                              30, 575–585.
                                                                          [6] Shotbolt-Brown, J., Hunter, D.W.F. and Aislabie, J. (1996)
                                                                              Isolation and description of carbazole-degrading bacteria. Can. J.
meta-cleavage compound hydrolase CarC of strains                              Microbiol. 42, 79–82.
KA1 and CA10, respectively (Fig. 1). The DNA region                       [7] Ouchiyama, N., Miyachi, S. and Omori, T. (1998) Cloning and
                                                                              nucleotide sequence of carbazole catabolic genes from Pseudo-
containing both carAa and carC homologous genes in                            monas stutzeri strain OM1, isolated from activated sludge. J. Gen.
strain IC177 could be amplified, although the primer                           Appl. Microbiol. 44, 57–63.
set was originally designed for amplifying only the inter-                [8] Shepherd, J.M. and Lloyd-Jones, G. (1998) Novel carbazole
nal region of the carAa gene. The putative GTG start                          degradation genes of Sphingomonas CB3: sequence analysis,
codon of the carC-like gene overlapped the stop codon                         transcription, and molecular ecology. Biochem. Biophys. Res.
                                                                              Commun. 247, 129–135.
of the preceding carAa-like gene in strain IC177. It is                   [9] Kirimura, K., Nakagawa, H., Tsuji, H., Matsuda, K., Kurane, R.
noteworthy that the carC-like gene was discovered                             and Usami, S. (1999) Selective and continuous degradation of
immediately downstream of the carAa-like gene in strain                       carbazole contained in petroleum oil by resting cells of Sphingo-
IC177, although there is a carBa gene or carAb gene clo-                      monas sp. CDH-7. Biosci. Biotechnol. Biochem. 63, 1563–1568.
sely downstream of the carAa gene in all known carba-                    [10] Habe, H., Ashikawa, Y., Saiki, Y., Yoshida, T., Nojiri, H. and
                                                                              Omori, T. (2002) Sphingomonas sp. strain KA1, carrying a
zole-degradative gene clusters [7,8,10,11,14,16].                             carbazole dioxygenase gene homologue, degrades chlorinated
   In this study, we isolated three strains whose total                       dibenzo-p-dioxins in soil. FEMS Microbiol. Lett. 211, 43–49.
DNA hybridized with the carCA10 probe. We revealed                       [11] Kilbane II, J.J., Daram, A., Abbasian, J. and Kayser, K.J. (2002)
the occurrence of carR, carAa, and carAc genes highly                         Isolation and characterization of Sphingomonas sp. GTIN11
homologous to those of strain KA1 in 17 newly isolated                        capable of carbazole metabolism in petroleum. Biochem. Biophys.
                                                                              Res. Commun. 297, 242–248.
carbazole-utilizing strains. We also demonstrated that                   [12] Yoon, B.-J., Lee, D.-H., Kang, Y.-S., Oh, D.-C., Kim, S.-I., Oh,
strains CB3, IC033, and IC081 possessed both KA1-                             K.-H. and Kahng, H.-Y. (2002) Evaluation of carbazole degra-
type and CB3-type car gene clusters. Moreover, we iso-                        dation by Pseudomonas rhodesiae strain KK1 isolated from soil
lated a carbazole-degrading Gram-positive bacterium                           contaminated with coal tar. J. Basic Microbiol. 42, 434–443.
and a car gene homolog from the bacterium. To analyze                    [13] Fuse, H., Takimura, O., Murakami, K., Inoue, H. and Yamaoka,
                                                                              Y. (2003) Degradation of chlorinated biphenyl, dibenzofuran, and
differences in the metabolism of carbazole between                             dibenzo-p-dioxin by marine bacteria that degrade biphenyl,
Gram-negative and Gram-positive bacteria, the genetic                         carbazole, or dibenzofuran. Biosci. Biotechnol. Biochem. 67,
features of carbazole-degradative genes, and their corre-                     1121–1125.
                                         K. Inoue et al. / FEMS Microbiology Letters 245 (2005) 145–153                                        153

[14] Inoue, K., Widada, J., Nakai, S., Endoh, T., Urata, M.,               [21] Urata, M., Miyakoshi, M., Kai, S., Maeda, K., Habe, H., Omori,
     Ashikawa, Y., Shintani, M., Saiki, Y., Yoshida, T., Habe,                  T., Yamane, H. and Nojiri, H. (2004) Transcriptional regulation of
     H., Omori, T. and Nojiri, H. (2004) Divergent structures of                the ant operon, encoding two-component anthranilate 1,2-dioxy-
     carbazole degradative car operons isolated from Gram-                      genase, on the carbazole-degradative plasmid pCAR1 of Pseudo-
     negative bacteria. Biosci. Biotechnol. Biochem. 70, 1467–                  monas resinovorans strain CA10. J. Bacteriol. 186, 6815–6823.
     1480.                                                                 [22] Sambrook, J. and Russell, D.W. (2001) Molecular Cloning: a
[15] Li, L. and Blankespoor, H.D. (2004) Degradation of carbazole in            Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory
     the presence of non-aqueous phase liquids by Pseudomonas sp.               Press, Cold Spring Harbor, NY.
     Biotechnol. Lett. 26, 581–584.                                        [23] Polz, M.F. and Cavanaugh, C.M. (1998) Bias in template-to-
[16] Sato, S., Nam, J.-W., Kasuga, K., Nojiri, H., Yamane, H. and               product ratios in multitemplate PCR. Appl. Environ. Microbiol.
     Omori, T. (1997) Identification and characterization of genes               64, 3724–3730.
     encoding carbazole 1,9a-dioxygenase in Pseudomonas sp. strain         [24] Page, R.D.M. (1996) Treeview: an application to display phylo-
     CA10. J. Bacteriol. 179, 4850–4858.                                        genetic trees on personal computers. Comput. Appl. Biosci. 12,
[17] Sato, S., Ouchiyama, N., Kimura, T., Nojiri, H., Yamane, H. and            357–358.
     Omori, T. (1997) Cloning of genes involved in carbazole degra-        [25] Golovleva, L.A., Pertsova, R.N., Evtushenko, L.I. and Baskunov,
     dation of Pseudomonas sp. strain CA10: nucleotide sequences of             B.P. (1990) Degradation of 2,4,5-trichlorophenoxyacetic acid by a
     genes and characterization of meta-cleavage enzymes and hydro-             Nocardioides simplex culture. Biodegradation 1, 263–271.
     lase. J. Bacteriol. 179, 4841–4849.                                   [26] Rajan, J., Valli, K., Perkins, R.E., Sariaslani, F.S., Barns, S.M.,
[18] Nojiri, H., Sekiguchi, H., Maeda, K., Urata, M., Nakai, S.,                Reysenbach, A.L., Rehm, S., Ehringer, M. and Pace, N.R. (1996)
     Yoshida, T., Habe, H. and Omori, T. (2001) Genetic character-              Mineralization of 2,4,6-trinitrophenol (picric acid): characteriza-
     ization and evolutionary implications of a car gene cluster in the         tion and phylogenetic identification of microbial strains. J. Ind.
     carbazole degrader Pseudomonas sp. strain CA10. J. Bacteriol.              Microbiol. 16, 319–324.
     183, 3663–3679.                                                       [27] Cho, Y.G., Yoon, J.H., Park, Y.H. and Lee, S.T. (1998) Simulta-
[19] Maeda, K., Nojiri, H., Shintani, M., Yoshida, T., Habe, H. and             neous degradation of p-nitrophenol and phenol by a newly isolated
     Omori, T. (2003) Complete nucleotide sequence of carbazole/                Nocardioides sp. J. Gen. Appl. Microbiol. 44, 303–309.
     dioxin-degrading plasmid pCAR1 in Pseudomonas resinovorans            [28] Iwabuchi, T., Inomata-Yamauchi, Y., Katsuta, A. and Haray-
     strain CA10 indicates its mosaicity and the presence of large              ama, S. (1998) Isolation and characterization of marine Nocar-
     catabolic transposon Tn4676. J. Mol. Biol. 326, 21–33.                     dioides capable of growing and degrading phenanthrene at 42 °C.
[20] Shintani, M., Habe, H., Omori, T. and Nojiri, H. (in press) Large          J. Mar. Biotechnol. 6, 86–90.
     plasmid pCAR2 and class II transposon Tn4676 are functional           [29] Futamata, H., Uchida, T., Yoshida, N., Yonemitsu, Y. and
     mobile genetic elements to distribute the carbazole/dioxin-degra-          Hiraishi, A. (2004) Distribution of dibenzofuran-degrading bac-
     dative car gene cluster in different bacteria. Appl. Microbiol.             teria in soils polluted with different levels of polychlorinated
     Biotechnol.                                                                dioxins. Microbes Environ. 19, 172–177.
                                               FEMS Microbiology Letters 245 (2005) 155–159
                                                                                                                       www.fems-microbiology.org




                  Interactive optical trapping shows that confinement
                  is a determinant of growth in a mixed yeast culture
           Nils Arneborg a, Henrik Siegumfeldt a, Grith H. Andersen a, Peter Nissen a,
                 Vincent R. Daria b, Peter John Rodrigo b, Jesper Gluckstad b,*
                                                                    ¨
                       a
                            Department of Food Science, Food Microbiology, The Royal Veterinary and Agricultural University,
                                                Rolighedsvej 30, DK-1958 Frederiksberg C, Denmark
                           b
                             Optics and Plasma Research Department, Risø National Laboratory, DK-4000 Roskilde, Denmark

                             Received 10 December 2004; received in revised form 3 March 2005; accepted 3 March 2005

                                                        First published online 14 March 2005

                                                                Edited by L.F. Bisson




Abstract

    Applying a newly developed user-interactive optical trapping system, we controllably surrounded individual cells of one yeast
species, Hanseniaspora uvarum, with viable cells of another yeast species, Saccharomyces cerevisiae, thus creating a confinement
of the former. Growth of surrounded and non-surrounded H. uvarum cells was followed under a microscope by determining their
generation time. The average generation time of surrounded H. uvarum cells was 15% higher than that of non-surrounded cells,
thereby showing that the confinement imposed by viable S. cerevisiae cells on H. uvarum inhibits growth of the latter. This study
is the first to demonstrate that confinement is a determinant of growth in a microbial ecosystem.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Interactive optical trapping; Confinement; Growth inhibition; Yeast




1. Introduction                                                               (e.g., carbon and nitrogen sources and oxygen) and
                                                                              growth-inhibitory compounds (e.g., ethanol and killer
   We have previously demonstrated that viable cells of                       toxins [3]), as a result of the growth and metabolism
the yeast Saccharomyces cerevisiae at a high density                          of S. cerevisiae.
cause growth arrest of two non-Saccharomyces yeast                               Accordingly, verification of our confinement-stress
species in mixed cultures [1,2]. This finding made us                          hypothesis requires an experimental approach that
speculate whether viable S. cerevisiae cells are able to af-                  should clearly separate the effect of confinement from
fect growth of non-Saccharomyces yeast cells in a mixed                       the effects of the other factors mentioned above on
culture by simply surrounding them; i.e., whether the                         growth of non-Saccharomyces yeast. That is, first, it
former can impose a confinement stress on the latter.                          should ensure non-Saccharomyces yeast cells to be con-
In mixed cultures with S. cerevisiae, however, non-                           trollably surrounded by viable S. cerevisiae cells. Sec-
Saccharomyces yeasts may be exposed to several                                ond, it should uncouple the effect of high-cell-density
growth-inhibiting factors, including nutrient limitation                      growth of S. cerevisiae from the effect of its metabolism
                                                                              on growth of a non-Saccharomyces yeast while still
 *
     Corresponding author. Tel.: +45 46774506; fax: +45 46774565.             exposing all cells to identical nutrient and metabolite
     E-mail address: jesper.gluckstad@risoe.dk (J. Gluckstad).
                                                     ¨                        concentrations. However, fulfilment of these two

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.03.008
156                             N. Arneborg et al. / FEMS Microbiology Letters 245 (2005) 155–159

requirements in combination has not been possible with
existing experimental set-ups.
   Conventional optical traps, commonly known as
optical tweezers, consist of a single, highly focused laser
beam that requires immersion objectives with high
numerical aperture (NA) to obtain only one trap [4].
In contrast, a recently proposed user-interactive optical
trapping system [5] can generate a specified number of
traps where size, shape and position of the individual
traps can be adjusted by the user during the experiment
via a graphical user interface. Furthermore, high-NA
immersion objectives are not a prerequisite, which al-
lows for longer working distance objectives that facili-
tates imaging in a multitude of standard lab-ware.
This novel system enables real-time interactive optical            Fig. 1. The system for generating arbitrary arrays of optical traps for
manipulation of multiple, growing cells without affect-             simultaneous manipulation of multiple cells. A phase-only spatial light
                                                                   modulator is used to encode the phase of an incident laser beam to
ing their generation times [5]. Here, we apply this system
                                                                   generate the desired optical trapping configuration. The user can
on a mixed culture of the two facultatively fermentative           interactively manipulate cells while directly observing the cells under
yeasts, S. cerevisiae and Hanseniaspora uvarum, and we             the microscope.
provide evidence that a confinement stress imposed by
viable S. cerevisiae cells on H. uvarum inhibits growth            cient transformation of the phase pattern into a high-
of the latter.                                                     contrast intensity distribution that can be used as optical
                                                                   traps for manipulating cells. Using a graphical computer
                                                                   interface, the user can interactively encode the phase
2. Materials and methods                                           patterns that relates to the desired number, size and
                                                                   shape of the optical traps. Cells, being dielectrics of
2.1. Micro-scale, mixed-culture growth experiments                 higher refractive index relative to the YPD medium,
                                                                   get attracted to the array of optical traps. User-defined
2.1.1. Yeast strains and media                                     optical traps were used to arrange and maintain the
   H. uvarum CBS 314 and S. cerevisiae (Saint Georges              S. cerevisiae cells in a ring configuration centred about
S101, Bio Springer, France) were used. Small aliquots of           a H. uvarum cell and also to locally isolate such region
culture broth from 22-h-old single cultures of H. uvarum           of interest from other potentially interfering cells. It
and S. cerevisiae, grown with agitation (140 rpm) in rich          should be stressed that the laser wavelength of 830 nm
YPD medium (9 g lÀ1 glucose, pH 5.6) at 25 °C, were                has very low absorption of water and biological mole-
transferred to a perfusion chamber (CoverWell, Sigma-              cules and therefore causes minimal photo damage of
Aldrich) with fresh YPD medium, and the cells were al-             the cells [10].
lowed to settle on the glass cover-slip.
                                                                   2.1.3. Calculation of generation time
2.1.2. Microscopy and interactive optical trapping                    Image frames were extracted from real-time recorded
   The chamber was sealed with grease and subse-                   videos of the growth experiments with frame-to-frame
quently mounted on an inverted microscope (DM-                     time intervals of 1.7 min. Division of two H. uvarum
IRB, Leica) with a non-immersion objective lens (63·,              cells was detected by the two cells exhibiting a distinct
NA = 0.75; C PLAN, Leica). Interactive optical trap-               break during each cytokinesis (Fig. 3(c)–(h)). Genera-
ping system based on the generalized phase contrast                tion time of a given cell was calculated as the time
method [6,7] allows synthesis of real-time reconfigurable           difference between two successive cytokinetic events;
light intensity patterns that are brought to the sample            e.g., time (Fig. 3(f)) À time (Fig. 3(d)) = 186.0 min À
chamber through the microscope fluorescence port                    116.2 min = 69.8 min. It should be noted that the
[8,9]. Fig. 1 shows the diagram of the system for gener-           distinct cell break at cytokinesis could always be
ating arbitrary arrays of optical traps for multiple-cell          observed in two successive image frames (see, e.g.,
manipulation. An incident light from an expanded and               Fig. 3(c) and (d)), thus rendering the maximum inaccu-
collimated Titanium:Sapphire continuous-wave laser                 racy of each generation time measurement to be
source (3900S, Spectra Physics), operating at a wave-              2 · 1.7 min = 3.4 min. Furthermore, due to the number
length of 830 nm, is dynamically encoded with spatial              of cells within a given location being too large for proper
phase patterns using a computer-programmable phase-                analysis after three generations (data not shown), we
only spatial light modulator (PPM, Hamamtsu). The                  could only track growth of the cells for this number of
succeeding components in the optical train facilitate effi-          generations.
                                        N. Arneborg et al. / FEMS Microbiology Letters 245 (2005) 155–159                                       157

Table 1
Growth characteristics of Hanseniaspora uvarum cells from micro-
scale, mixed-culture fermentations
Cell type              n    Averagegt      SEMgt     Mingt     Maxgt
                            (min)          (min)     (min)     (min)
Surrounded             67   91.7           2.7       64.7      167.7
Non-surrounded         97   77.9           1.4       46.5      116.2
gt, generation time.


2.2. Statistical analysis of data

   Twenty growth experiments were performed, and all
cells from these experiments were analyzed ($164 cells,
Table 1). Data were normally distributed (data not
shown), and statistical analysis of data was performed
using the two-sample t-test, assuming unequal variances
and considering both sides of the distribution (two-
tailed distribution).


3. Results and discussion                                                  Fig. 2. Preparing the Hanseniaspora uvarum and Saccharomyces
                                                                           cerevisiae cells for micro-scale, mixed-culture fermentation applying
                                                                           the user-interactive optical trapping system. Dynamically reconfigura-
   Using our experimental set-up, multiple S. cerevisiae                   ble optical traps simultaneously bring S. cerevisiae cells to surround an
and H. uvarum cells in a microscopy sample chamber                         individual H. uvarum cell. Arrows show the direction of movement.
can be non-invasively manipulated and brought to a re-                     Images from one representative experiment were recorded at (a) 0 s;
gion of interest (Fig. 2). This allows us to conduct                       (b) 30 s; (c) 60 s; and (d) 90 s. Scale bar represents 10 lm.
controlled and repeatable micro-scale, mixed-culture
growth experiments. Noticeably, neither mechanical mi-                     by trapping several ($6–7) S. cerevisiae cells in a real-
cro-manipulation systems nor conventional optical traps                    time adjustable optical beam pattern (Fig. 3). We were
can be used for this kind of experiments, as the positions                 able to keep this region free of any interference from
of cells, and thereby interactions between several partic-                 other cells by making a boundary in form of a larger
ular cells, cannot be controlled.                                          ring-shaped optical beam pattern, trapping any poten-
   Moreover, all cells within a microscopic image frame                    tially interfering cells (Fig. 3(e)–(h)). Furthermore, we
will be exposed to the same solute concentrations                          were able to follow concurrently the growth of non-sur-
throughout a growth experiment, since distances be-                        rounded H. uvarum cells within the same image frame
tween cells are mainly less than 100 lm. According to                      (Fig. 3). As mentioned above, this is an advantage of
FickÕs second law of diffusion, a solute with a typical dif-                our experimental approach, since both surrounded and
fusion coefficient of 1 · 10À6 cm2 sÀ1 will travel a root                    non-surrounded H. uvarum cells within an image frame
mean square distance of this order ($100 lm) within                        are exposed to the same concentration of nutrients and
1 min, which is considerably less than the duration of                     metabolites. Moreover, any effect of the optical beams
a typical growth experiment.                                               (with an order of 10 mW total power in the inner beam
   Thus, to determine whether S. cerevisiae is able to im-                 pattern) on the growth of H. uvarum can be excluded,
pose a growth-inhibiting, confinement stress on a non-                      since the surrounded H. uvarum cells are not directly
Saccharomyces yeast, we performed micro-scale,                             illuminated by the trapping beams, and since the aver-
mixed-culture growth experiments with S. cerevisiae                        age generation times of those non-surrounded H. uva-
and the non-Saccharomyces yeast, H. uvarum, by com-                        rum cells trapped in the beams and those untrapped
bining the use of video microscopy with the interactive                    are statistically indistinguishable (P = 0.16, data not
optical trapping system. H. uvarum was selected due to                     shown). Finally, any effect of local nutrient competition
its special budding feature (bipolar budding), making                      on the growth of H. uvarum can be neglected, since the
it easily distinguishable from S. cerevisiae (multilateral                 average generation times of both surrounded and non-
budding) in the microscope. Images recorded from a                         surrounded cells do not increase from first to third gen-
typical experiment are shown in Fig. 3. Throughout                         eration (data not shown). This indicates that excess
the growth experiments we were able, within a user-                        nutrients are available for all H. uvarum cells through-
defined region of interest, to controllably surround                        out the growth experiments.
individual H. uvarum cells with S. cerevisiae cells, thus                      Our study for the first time provides evidence that a
creating a two-dimensional confinement of the former,                       confinement stress imposed by viable cells of one yeast
158                                     N. Arneborg et al. / FEMS Microbiology Letters 245 (2005) 155–159

                                                                             previously suggested that growth inhibition of other
                                                                             non-Saccharomyces yeasts by high densities of viable
                                                                             S. cerevisiae cells is mediated by cell–cell contact [1].
                                                                             This may also be the case in the current study.
                                                                                Space is considered a typical object of competition
                                                                             among species in a variety of biological ecosystems,
                                                                             e.g., forests, grasslands, coral reefs, and the marine ben-
                                                                             thic zone [11]. In microbial ecosystems, however, no re-
                                                                             ports exist on spatial constraints being a determinant of
                                                                             growth. It may be hypothesized that the physical avail-
                                                                             able space of the surrounded H. uvarum cells in our
                                                                             study would be restricted, and that physical space limi-
                                                                             tation therefore would play a role in the growth inhibi-
                                                                             tion of these cells. This issue, however, needs further
                                                                             investigation.
                                                                                The average generation time of surrounded
                                                                             (91.7 min) and non-surrounded (77.9 min) cells (Table
                                                                             1), corresponding to specific growth rates of 0.45 and
                                                                             0.53 hÀ1, respectively, are comparable to population-
                                                                             averaged data reported in literature on aerobically
                                                                             grown H. uvarum [12]. Together with the fact that
                                                                             H. uvarum grows much slower under strict-anaerobic
                                                                             conditions[13], these results suggest that oxygen is avail-
                                                                             able to the H. uvarum cells in the sealed sample chamber.
                                                                                Our results reveal large variations in the generation
                                                                             times of individual cells within the population of H. uva-
                                                                             rum (Table 1); the coefficients of variation (CV), defined
                                                                             as the standard deviation divided by the mean value,
                                                                             being 24% and 18% for the surrounded and non-sur-
                                                                             rounded H. uvarum cells, respectively. Similar results
                                                                             were recently reported for prokaryotic Escherichia coli
                                                                             cells with a CV of 33% [14] and may be explained by
                                                                             the fact that regulation of the prokaryotic cell cycle is
                                                                             not perfect [15]. In [14], it was further concluded that
                                                                             eukaryotic cells are able to control their cell cycle more
                                                                             tightly than prokaryotic cells, since the generation times
                                                                             of individual eukaryotic Chlamydomonas cells had a CV
Fig. 3. Micro-scale, mixed-culture fermentation of Hanseniaspora             of less than 5% [14]. However, the average generation
uvarum and Saccharomyces cerevisiae. Images from one representative          time of Chlamydomonas ($600 min) [14] is an order of
experiment were recorded at (a) 5.0 min; (b) 51.5 min; (c) 114.5 min;        magnitude higher than the one of our eukaryotic cul-
(d) 116.2 min; (e) 184.3 min; (f) 186.0 min; (g) 217.5 min; (h) 219.2 min.   tures. Large cell-to-cell variation in generation times
S. cerevisiae cells (white arrow) were trapped in a ring-shaped optical
beam pattern (full line circle), surrounding an individual H. uvarum cell
                                                                             may therefore simply be a consequence of cells having
(dashed black arrow). This region of interest was kept free of any           low generation times, regardless of their phylogenetic
interference with other cells by a larger ring-shaped optical beam           domain.
pattern (dashed line circle). Black arrows show cytokinesis of
individual, surrounded H. uvarum cells at 114.5–116.2 min ((c) and
(d)), 184.3–186.0 min ((e) and (f)), and 217.5–219.2 min ((g) and (h)) of
fermentation. Non-surrounded H. uvarum cells are located at the top
                                                                             4. Conclusion
centre of the images. Scale bar represents 10 lm.
                                                                                Our study is the first to show that confinement is a
                                                                             determinant of growth in a microbial ecosystem. Given
species, S. cerevisiae, on another yeast species, H. uva-                    that crowding of yeast cells at a surface is a special fea-
rum, inhibits growth of the latter. That is, the sur-                        ture of this work, our finding may contribute to a better
rounded H. uvarum cells divide significantly slower                           understanding of cell growth regulation in, e.g., biofilms
($15%, P = 1.6 · 10À5) than the non-surrounded cells                         in medical, environmental and industrial settings, as well
(Table 1). The molecular mechanisms explaining this                          as probiotic and pathogenic communities in the gastro-
phenomenon remain to be found. We have, however,                             intestinal tract.
                                      N. Arneborg et al. / FEMS Microbiology Letters 245 (2005) 155–159                                    159

References                                                                 [8] Daria, V.R., Rodrigo, P.J. and Gluckstad, J. (2004) Dynamic
                                                                                                                     ¨
                                                                               array of dark optical traps. Appl. Phys. Lett. 84, 323–325.
[1] Nissen, P., Nielsen, D. and Arneborg, N. (2003) Viable Saccha-         [9] Rodrigo, P.J., Daria, V.R. and Gluckstad, J. (2004) Real-time
                                                                                                                    ¨
    romyces cerevisiae cells at high concentrations cause early growth         interactive optical micromanipulation of a mixture of high- and
    arrest of non-Saccharomyces yeasts in mixed cultures by a cell–cell        low-index particles. Opt. Express 12, 1417–1425.
    contact-mediated mechanism. Yeast 20, 331–341.                        [10] Svoboda, K. and Block, S.M. (1994) Biological applications of
[2] Nissen, P. and Arneborg, N. (2003) Characterization of                     optical forces. Ann. Rev. Biophys. Biomol. Struct. 23, 247–285.
    early deaths of non-Saccharomyces yeasts in mixed cultures            [11] Buttel, L.A., Durrett, R. and Levin, S.A. (2002) Competition and
    with Saccharomyces cerevisiae. Arch. Microbiol. 180, 257–                  species packing in patchy environments. Theor. Popul. Biol. 61,
    263.                                                                       265–276.
[3] Heard, G.M. and Fleet, G.H. (1987) Occurrence and growth of           [12] Venturin, C., Boze, H., Moulin, G. and Galzy, P. (1995) Glucose
    killer yeasts during wine fermentation. Appl. Environ. Microbiol.          metabolism, enzymatic analysis and product formation in che-
    53, 2171–2174.                                                             mostat culture of Hanseniaspora uvarum. Yeast 11, 327–336.
[4] Ashkin, A., Dziedzic, J.M., Bjorkholm, J.E. and Chu, S. (1986)        [13] Visser, W., Scheffers, W.A., Batenburg van der Vegte, W.H. and
    Observation of a single-beam gradient force optical trap for               van Dijken, J.P. (1990) Oxygen requirements of yeasts. Appl.
    dielectric particles. Opt. Lett. 11, 288–290.                              Environ. Microbiol. 56, 3785–3792.
[5] Rodrigo, P.J., Daria, V.R. and Gluckstad, J. (2004) Real-time
                                           ¨                              [14] Yasuda, K.J. (2004) On-chip single-cell-based microcultivation
    three-dimensional optical micromanipulation of multiple particles          method for analysis of genetic information and epigenetic
    and living cells. Opt. Lett. 29, 2270–2272.                                correlation of cells. J. Mol. Recognit. 17, 186–193.
[6] Gluckstad, J. (1996) Phase contrast image synthesis. Opt. Com-
       ¨                                                                  [15] Ingraham, J.L., Maaløe, O. and Neidhardt, F.C. (1983) Growth
    mun. 130, 225–230.                                                         of the Bacterial Cell. Sinauer Ass., Inc., Sunderland, Massachu-
[7] Gluckstad, J. (2000) Phase contrast imaging. US Patent 6011874.
       ¨                                                                       setts, 435 pp.
                                             FEMS Microbiology Letters 245 (2005) 161–168
                                                                                                                      www.fems-microbiology.org




   Evidence for functional laccases in the acidophilic ascomycete
  Hortaea acidophila and isolation of laccase-specific gene fragments
                          Larissa Tetsch, Jutta Bend, Martina Janßen, Udo Holker
                                                                           ¨                                            *

           Institut fur Zellulare und Molekulare Botanik, Rheinische-Friedrich-Wilhelms Universitat, Kirschallee 1, D-53115 Bonn, Germany
                     ¨        ¨                                                                  ¨
                          Received 22 December 2004; received in revised form 26 February 2005; accepted 3 March 2005

                                                       First published online 16 March 2005

                                                               Edited by L.F. Bisson




Abstract

   Hortaea acidophila is a pigmented, yeast-like ascomycete that is able to grow at a pH as low as 0.6. This study presents evidence
that H. acidophila possesses at least two functional laccases that seem to be involved in melanin synthesis. This evidence is supported
by PCR amplification of laccase-specific gene fragments by using primers derived from conserved copper-binding-regions and by
Southern Blot analysis. Due to their low pH optimum the laccases may be of special interest for biotechnological use.
Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Hortaea; Black yeast; Laccase; Acidophilic fungus; Dihydroxynaphthalene; Melanin synthesis



1. Introduction                                                              these enzymes polymerize biopolymers, such as lignin
                                                                             and melanin [3,4]. While the degradative properties of
    Hortaea acidophila, recently described in [1], is an aci-                laccases have been industrially used for years (e.g., in
dophilic, pigmented ascomycete. It is closely related to                     bioremediation processes), potential applications for
the halophilic opportunistic Hortaea werneckii that has                      their polymerizing activity have not been discussed until
been shown to produce dihydroxynaphthalene melanin                           recently [6]. Although many basidiomycetous laccases
commonly found in ascomycetous fungi [2]. The appro-                         have been analyzed at the molecular level, the study of
priate polyketide synthesis pathway often involves a lac-                    ascomycetous laccase genes still remains problematic
case for the catalyzation of the last reaction step [3].                     due to a low level of conservation among these genes.
    Laccases are copper containing enzymes and in gen-                          This report demonstrates the presence of at least two
eral catalyze the oxidation of various polyphenols form-                     laccase genes in H. acidophila. Moreover, it presents
ing free phenoxy-radicals which are able to polymerize                       enzymatic evidence for catalytic active laccases in fungal
spontaneously while the electrons are transferred to                         cultures whose activity at low pH values makes them
molecular oxygen. Thereby substances like lignin, mela-                      interesting for biotechnological application.
nin or humic substances can be synthesized or degraded
[4]. In basidiomycetous white-rot fungi such as Trametes
versicolor, laccases in combination with peroxidases cat-                    2. Material and methods
alyze the degradation of lignin in wood [5]. In plants and
in most ascomycetes, which exhibit a laccase activity,                       2.1. Organisms and culture conditions

 *
     Corresponding author. Tel.: +49 228 73 5510; fax: +49 228 73 5504.        H. acidophila CBS 113389 was isolated and cultivated
     E-mail address: u.hoelker@uni-bonn.de (U. Holker).
                                                   ¨                         on complex medium as described before [1]. The liquid

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsle.2005.03.007
162                              L. Tetsch et al. / FEMS Microbiology Letters 245 (2005) 161–168

medium had a pH of 3.5, the solid medium a pH of 5.1.              conserved in laccases (Fig. 3). A third primer (int) was
To stimulate laccase activity the copper concentration in          deduced from an internal sequence between cbs2 and
liquid medium was varied between 0 lM (control) and                cbs3 that proved to be especially conserved in laccases.
10 mM by addition of copper sulfate. Screening for lac-            Laccase sequences of six ascomycetous and one basidio-
case activity was performed on solid medium containing             mycetous fungi were aligned for the detection of most
0.03% ABTS and 3 g/l KNO3 instead of trypton. In or-               conserved regions. After deduction all primers were
der to inhibit melanin synthesis 0.2% ascorbic acid was            compared to the fungal protein data base SWISS-PROT
added to the liquid medium. Inhibition of the melaniza-            of EMBL by using the FASTA program in order to
tion process was observed visually.                                examine their specificity.
   Escherichia coli XL 1-Blue was obtained from Strata-
gene (La Jolla/CA, USA) and was grown on LB-med-                   2.4. Isolation and analysis of nucleic acids
ium [7]. Ampicillin (100 lg/ml) was added to the
medium for the selection of plasmid-containing cultures.                H. acidophila cells grown for 5 days in liquid medium
                                                                   were harvested and grinded mechanically with glass
2.2. Enzyme assays                                                 beads. High-molecular-weight DNA was prepared
                                                                   according to [8]. PCR was performed using 5 0 -primer
   The enzyme activity was determined by monitoring                cbs2 (5-acg tc(gt) tgg tac cac t(gc)g cac t(at)c-3), 3 0 -pri-
the increase of absorbance (420 nm) with a spectro-                mer cbs3 (5-(gc)cc gtg cag gtg gat (gc)gg gtg-3), 5 0 -pri-
photometer (Ultraspec 2000, Pharmacia Biotech,                     mer 5 0 -int (5-gg(ac) cag cgc tac gac gt(gc) atc atc-3)
Cambridge/England) following addition of 2,2 0 -azino-             and 3 0 -primer 3 0 -int (5-gat gat (gc)ac gtc gta gcg ctg
bis(3-ethyl-2,3-dihydro-1,3-benzthiazole-6-sulfonate)              (gt)cc-3) in the combinations cbs2/cbs3, cbs2/3 0 -int and
(ABTS) as substrate. The enzyme activity is given in               5 0 -int/cbs3.
units (U) defined as lmol substrate oxidized per minute.                 The resulting fragments were purified on an agarose
For the detection of laccase activity in culture superna-          gel, excised and extracted from the gel via the Gel
tant, a liquid culture was centrifuged for 5 min at                Extraction Kit (Qiagen, Hilden/Germany) and ligated
14,000g. The supernatant was concentrated approxima-               into the plasmid pGEM-T Easy (Promega, Madison/
tively 100-fold with a Vivacell-250 (30 kD) ultrafiltration         USA). The plasmids were transformed into E. coli
device (Vivascience AG, Hannover/Germany). The as-                 XL1-Blue by the method of [9]. The presence of the
say contained 20 ll concentrated supernatant, 100 ll               PCR-product within the plasmid of selected clones was
ABTS (3 mM) and 880 ll citrate-phosphate-buffer                     examined by colony PCR. Plasmids from positive clones
(McIlvaine, pH 2.6). For the detection of laccase activity         were isolated and sequenced by Sequiserve (Vaterstet-
associated with the cells 1 ml of culture was centrifuged          ten/Germany). The FASTA program was used to search
(5 min, 14,000g) and the pellet was resuspended in 1350            DNA and protein databases for identities. The CLUS-
ll citrate-phosphate-buffer (McIlvaine, pH 2.6). After              TAL W program was used for alignment of amino acid
the addition of 150 ll ABTS (3 mM) the assay was incu-             sequences.
bated in an open reaction cap while stirring for 2–10
min. The reaction was stopped by centrifugation and                2.5. Southern Blot analysis
the supernatant was monitored directly in the spectro-
photometer. As reference a solution of 900 ll citrate-                Genomic DNA of H. acidophila was completely di-
phosphate-buffer (McIlvaine, pH 2.6) and 100 ll ABTS                gested in three separate reactions with BamHI, EcoRI
(3 mM) was used.                                                   and HindIII and analyzed in Southern Blot hybridiza-
   To inhibit laccase activity, NaN3 at a final concentra-          tion [7]. Digested genomic DNA was separated on a
tion of 15 mM was added to the ABTS test reaction mix-             0.8% agarose gel and transferred to positively charged
ture 1 min after start of the reaction. At this time the           nylon membranes (Hybond-N+, Amersham Biosci-
oxidation was in its exponential phase so that an inhibi-          ences). As a probe laccase gene fragments cbs2/int,
tion could easily be monitored. A control without azide            cbs2/3 and int/cbs3 were used which were digoxigenin la-
was allowed to oxidize the substrate completely. Oxida-            belled with the PCR Dig probe synthesis kit (Roche,
tion of tyrosine and dihydroxyphenylalanine (L-DOPA)               Mannheim). Hybridization was performed overnight at
was examined with an oxygen electrode at a pH of 4.5               42 °C using the Dig Easy Hyb Solution (Roche, Mann-
with a final substrate concentration of 30 lM.                      heim). Following incubation the membrane was washed
                                                                   with 2· SSC, 0.1% SDS (1· SSC is 0.15 M NaCl,
2.3. Primer design                                                 0.015 M sodium citrate, pH 7) twice for 5 min at room
                                                                   temperature and with 0.5· SSC, 0.1% SDS twice for 15
   In order to amplify a part of the laccase genes a               min at 68 °C. The hybridization signals were detected
degenerate oligonucleotide primer set was designed                 colorimetrically by following the manufacturerÕs instruc-
around the copper-binding-sites (cbs) 2 and 3 that are             tion for detection of digoxigenin-labelled probes with
                                                    L. Tetsch et al. / FEMS Microbiology Letters 245 (2005) 161–168                                                          163

alkaline phosphatase–antibody                               conjugates    (Roche,     was inhibited when 0.2% ascorbic acid was added to cul-
Mannheim).                                                                            ture medium before inoculation with H. acidophila thus
                                                                                      serving as alternative substrate for the laccase.
2.6. GenBank accession numbers
                                                                                      3.2. Dependence of laccase activity on copper
   Partial nucleotide sequences of the laccase genes lacc1                            concentration
and lacc2 were deposited in GenBank under the acces-
sion numbers AY351908 (lacc1) and AY351909 (lacc2).                                      Laccase activity was dependent on the copper con-
                                                                                      centration provided in the medium (Fig. 2). In the ab-
                                                                                      sence of copper, there was almost no activity
3. Results                                                                            detectable neither in the supernatant nor bound to the
                                                                                      cells. The laccase activity in both fractions could be in-
3.1. Localization and inhibition of laccase activity                                  duced by addition of 1–1000 lM copper with an
                                                                                      optimum between 100 and 500 lM. However, the
   Extracellular oxidase activity was detected by grow-                               cell associated laccase reached up to 10-fold higher
ing H. acidophila on agar plates containing ABTS (not
shown). In the next step the localization of the oxidase
later characterized as laccase was examined (Fig. 1).                                                                30
The culture was grown in liquid medium containing

                                                                                            600)
250 lM copper. After 2–3 days of growth laccase activ-                                                               25
ity was detected both associated to the cells and in the                                    biomass production (OD
culture supernatant. Activity amounted to a maximum                                                                  20
of 25.6 mU on day 7 for enzymes associated to the cells
present in 1 ml culture volume. In the supernatant the                                                               15
highest activities measured were 11.7 mU/ml on day 9.
   Samples boiled for 20 min did not show any oxidative                                                              10
activity indicating the enzymatic nature of the measured
oxidation reaction. Furthermore, the oxidase activity                                                                 5
was completely inhibited by azide. Melanin synthesis
                                                                                                                      0

                                                                                                                                                  0




                                                                                                                                                                         0
                                                                                                                                                        00

                                                                                                                                                               00
                                                                                                                                 1
                                                                                                                          0




                                                                                                                                      1

                                                                                                                                           10

                                                                                                                                                10




                                                                                                                                                                      00
                                                                                                                              0,




                                                                                                                                                      10

                                                                                                                                                             50

                                                                                                                                                                    10
                            30
                                                                                       (a)                                           copper concentration (µM)

                            25                                                                                       90
                                                                                        laccase activity (mU/ml)




                                                                                                                     80
  enzyme activity (mU/ml)




                                                                                                                     70
                            20
                                                                                                                     60
                                                                                                                     50
                            15
                                                                                                                     40
                                                                                                                     30
                            10                                                                                       20
                                                                                                                     10

                             5                                                                                        0
                                                                                                                          0


                                                                                                                                1


                                                                                                                                      1

                                                                                                                                           10


                                                                                                                                                  0

                                                                                                                                                        00


                                                                                                                                                                00


                                                                                                                                                                 0
                                                                                                                              0.




                                                                                                                                                10




                                                                                                                                                               00
                                                                                                                                                      10


                                                                                                                                                              50

                                                                                                                                                             10




                             0                                                         (b)                                           copper concentration (µM)
                                 0   2   4   6          8       10       12   14
                                                 days                                 Fig. 2. Biomass (a) and laccase activity (b) in dependence on the
                                                                                      copper concentration. After 5 days of growth in liquid medium with
Fig. 1. Time course of laccase activity in the culture supernatant                    different copper concentrations the laccase activity was measured in the
(squares) and associated with the cells (triangles). The cells grew on                culture supernatant (light grey columns) and associated with the cells
liquid medium with 250 lM copper for 14 days. Enyzme activity was                     (dark grey columns). Biomass was determined by measuring optical
measured with ABTS. Standard deviation was determined for atleast                     density (OD600). Standard deviation was determined for atleast three
three independent measurements (error bars).                                          independent measurements (error bars).
164                                         L. Tetsch et al. / FEMS Microbiology Letters 245 (2005) 161–168

oxidation rates than that from culture supernatant. On                                          cbs2/3 and int/cbs3. In order to optimize the PCR con-
the other hand, cell growth was inhibited with increasing                                       ditions the annealling temperature was varied over a
copper concentration as measured by optical density.                                            range from 56 to 64 °C. A specific fragment cbs2/3 of
Since copper addition may enhance melanin production                                            about 1000 bp and a specific fragment int/cbs3 of about
and thereby influences optical density, dry weight was                                           500 bp could be obtained, when an annealling tempera-
also determined and compared to optical density values.                                         ture of 62–64 °C was used (not shown). The fragment
Both measurements yielded comparable results. The                                               sizes confirmed the expectations from sequence analysis
range of dry weights varied between 0.1 and 3.8 mg/ml,                                          of other laccase genes. When using the primers cbs2 and
the latter corresponding to an optical density (600 nm)                                         3 0 -int, multiple signals were obtained at all temperatures
of 26.9. On the basis of these data 250 lM copper was                                           tested. Altogether seven distinct bands were distinguish-
determined as optimal for laccase activity and was used                                         able ranging from 250 bp to 1 kb. Because of this a PCR-
for all following experiments. Neither L-DOPA nor tyro-                                         product at the expected size of 450 bp was excised from the
sine were oxidized by the laccase thus excluding the pos-                                       agarose gel and cloned into the vector pGEM-T Easy
sibility of tyrosine activity.                                                                  along with the specific products cbs2/3 and int/cbs3.

3.3. Primer design and amplification of laccase gene                                             3.4. Sequence analysis of the putative laccase gene
fragments from H. acidophila by PCR                                                             fragments

   Primers were designed around the copper-binding-se-                                             The three cloned PCR-products were sequenced and
quences 2 and 3 in a way that whenever possible they                                            compared to each other. The fragment cbs2/3 has a length
were more specific for laccases than for other copper-                                           of 1092 bp whereas the fragments cbs2/int and int/cbs3
binding-proteins (Fig. 3). Interestingly, between cbs2                                          contain 441 and 506 bp, respectively. As cbs2/int and
and cbs3 another conserved region (int) was found that                                          int/cbs3 differ from the corresponding parts of cbs2/3
to our knowledge has not been used for primer design                                            (cbs2/int: 35% identity, int/cbs3: 39% identity), it is prob-
before. PCR was performed on genomic DNA using                                                  able that in H. acidophila at least two laccases exist. They
primers described above in the combinations cbs2/int,                                           are hereby named laccase I (cbs2/3) and laccase II (the




                                               cbs1               cbs2                    int                  cbs3                 cbs4
                                       5‘                                         Laccase genes                                            3‘

                                                                                      1092 bp
                                                                                                                           cbs2/3
                                                      cbs2/int                                                       int/cbs3
                                                                          441 bp                  506 bp

                                                                  cbs2                                         int                                  cbs3
                                                                      Y
                  Primer sequence                     - T S W Y H S H                              G Q R Y D V I                I           H P I H L H G
                                                                      F
                  Neurospora crassa                   G   T   S   W   Y   H   S   H   F            G   Q   R   Y   D   V    I   I           H   P   I   H   L   H   G
                  Melanocarpus albomyces              G   T   S   W   Y   H   S   H   F            G   Q   R   Y   D   V    V   I           H   P   M   H   L   H   G
                  Botrytis cinerea                    G   S   S   W   Y   H   S   H   F            A   Q   R   Y   D   I    I   V           H   P   I   H   L   H   G
                  Mycosphaerella spec.                G   T   R   W   Y   H   W   H   Y            G   Q   R   Y   D   V    I   I           H   P   -   D   L   E   R
                  Colletotrichum lagenarium           G   T   S   W   Y   H   S   H   F            G   Q   R   Y   D   V    I   I           H   P   I   H   L   H   G
                  Gaeumannomyces graminis             G   T   A   W   Y   H   S   H   F            G   Q   R   Y   D   V    T   I           H   P   M   H   L   H   G
                  Cryptococcus neoformans             G   T   Y   W   W   H   S   H   Y            G   E   R   Y   S   A    I   I           H   P   Y   H   L   H   G
                                        1
                  Dihydrogeodin oxidase               G   T   S   W   Y   H   S   H   F            G   Q   R   Y   E   I    V   V           H   P   I   H   L   H   G
                                      2
                  L-ascorbate oxidase                 G   T   F   F   Y   H   G   H   L            G   E   S   Y   S   V    L   I           H   P   W   H   L   H   G
                                        3
                  Superoxide dismutase                G   P   H   G   F   H   I   H   -            -   -   -   -   -   -    -   -           -   -   -   -   -   -   -
                                      4
                  Multicopper oxidase                 G   T   H   W   Y   H   G   H   M            G   E   R   Y   D   I    L   I           H   P   F   H   L   H   G

Fig. 3. Deduction of the primers cbs2, cbs3 and int and schematic representation of the laccase genes with primer-binding-sites (arrows). Primers
were deduced from the sequences around the copper-binding-sites 2 (cbs2) and 3 (cbs3) and around the int-sequence taking into account the
sequences of the laccase genes from the organisms listed above. Apart from the basidiomycete Cryptococcus neoformans, all fungi are ascomycetes. As
a control four copper-binding-proteins that are not laccases were aligned with the deduced primers. Dark grey boxes represent amino acids that are
identical. Light grey boxes indicate similar amino acids. The size statements relate to the PCR-amplified fragments. Laccases from: Neurospora crassa
(P06811), Melanocarpus albomyces (Q70KY3), Botrytis cinerea (Q12570), Mycosphaerella sp. (Q8J240), Colletotrichum lagenarium (Q9C497),
Gaeumannomyces graminis (Q8TFE2), C. neoformans (Q5KEA0). 1 Aspergillus terreus (BAA08486), 2 Cucurbita pepo (A51027), 3 Clostridium tetani
(Q897Y0), 4 Caenorhabditis elegans (NP_501502).
                                               L. Tetsch et al. / FEMS Microbiology Letters 245 (2005) 161–168                                                                                     165


                  (a)   cbs2/int partial fragment 1 Q T Y E G M F G P L                   V      I   EGP    S   TL   SY        DE      EQ - F V   I   LQ    DWN H
                        Botrytis cinerea        QYGDG L FGP L                             V      I   NGP    A   TA   NY        DV      D L GM L   F   LN    DWN H
                        Gaeumannomyces graminis Q A W Q G V F G G I                       I      I   NGP    A   SA   NY        DE      D VGM V    V   LS    D WG H
                        Phaeosphaeria halima    QYGDGV VG TM                              I      I   DGP    A   TS   NY        DE      DLGT L     P   L T   DWY Y
                        Fusarium proliferatum   QY ADGL AGP I                             T      I   FGP    S   SA   HY        DE      AKDP I     L   I T   DWN H
                        Stagonospora spec.      Q Y S D G V WG T M                        I      I   NGP    S   TK   NY        D I     DLGTY      P   L T   DWF H

                        cbs2/int partial fragment 2 G K S Y R L R V L N                   AA I QS T F K F H                   I DGHS        FQV I A         MD F        V   P   I HP   Y
                        Botrytis cinerea        GL           KYR      I R     V   VN      T A V DGH F Q F S                   I DGHS        FQV I A         MD F        V   P   I VP   Y
                        Gaeumannomyces graminis G K          SYR      FR      I   VN      TA I DTHFKFG                        I DNHT        LTV I A         LDF         I   P   VEP    Y
                        Phaeosphaeria halima    NK           KYR      I R     I   I N     PS VDNY F S VS                      MDGH P        FTV I T         SDF         V   P   I KP   Y
                        Fusarium proliferatum   GK           KYL      LR      I   I N     TSVDT T FVFG                        I DNHY        F E VMS         SDF         V   P   I HP   Y
                        Stagonospora spec.      GK           SHS      I R     L   LN      V G I N NWA H V A                   L DGHK        FTVVS           ADF         V   P   I VP   Y

                        Organism                     Accession                 Identity   Identity    Identity
                                                        No.                   (complete    (partial    (partial
                                                                              fragment) fragment 1) fragment 2)
                        Botrytis cinerea                 Q12 570              50,68 %                52,94 %      69,23 %
                        Phaeosphaeria halima             Q8J 251              45,64 %                40,63 %      50,00 %
                        Gaeumannomyces graminis       Q8T FD9                 45,40 %                44,12 %      58,97 %
                        Fusarium proliferatum         Q96 UP9                 45,33 %                44,12 %      56,41 %
                        Stagonospora spec.               Q8J 247              44,60 %                41,18 %      48,72 %


                  (b) cbs2/3 partial fragment       K T Y R L R L I N A G A E GMQ K F S I                                     DGH TMT V I AN                DFVPLKPYQT
                        Fusarium proliferatum   KVHR              L   R   L   I NP       S   A   EA I QR F        S   I       DGH TMK        V   I   AN     D   F   V   P   VQP    Y   DT
                        Neurospora crassa       KRHR              L   R   L   VNT        S   A   DN T F V V       S   I       V GHNMT        V   I   ET     D   F   V   P   VEP    Y   AV
                        Cryphonectria parasiticaKRHR              L   R   I   I NT       S   V   ENNFQV           S   I       VGH SMT        V   I   ES     D   F   V   P   VDS    F   TT
                        Gaeumannomyces graminis K K H L           I   R   I   I NN       S   A   DAHFQF           S   I       DGHD L T       V   V   AN     D   L   V   P   I  P   F   KT
                        Phaeosphaeria halima    KKYR              I   R   I   I NT       S   V   DNY F S V        S   L       DGH P F T      V   I   TS     D   F   V   P   I KP   Y   VT


                        cbs2/3 partial fragment     D V V T L G I GQR S D I I V T A T GK                                      A G Q S Y WM R
                        Fusarium proliferatum   K V V T L GVGQR                          TDV          L   VRA    NGK          L   -   D S Y WM R
                        Neurospora crassa         Q L Y L T VGQR                         YDV          V   I KA   DQE          V   -   D N YW I N
                        Cryphonectria parasiticaD S L F VG I GQR                         YDV          T   I DA   SQA          T   -   D N Y WM N
                        Gaeumamonnyces graminis K S V R V S I G Q R                      YDV          I   VEA    NAK          P   -   GN YW L R
                        Phaeosphaeria halima    DQ I T L A I GQR                         YDV          I   I SA   NQT          V   -   GN YWF -


                         Organism                    Accession Identity                       Identity
                                                        No.    (complete                       (partial
                                                               fragment)                     fragment)
                         Fusarium proliferatum   Q96 WI1                  43,92 %            69,12 %
                         Neurospora crassa       Q87 2X3                  32,79 %            43,28 %
                         Cryphonectria parasiticaQ03 966                  32,88 %            47,76 %
                         Gaeumannomyces graminis Q8T FE1                  32,29 %            51,47 %
                         Phaeosphaeria halima    Q8J 250                  32,15 %            51,47 %


                  (c)   int/cbs3 partial fragment G S - - W E W E I N                   GQ T Y R A D Y N N                P L L Y DAADGQ                  T S F PSDPQYN                    LY
                        Fusarium proliferatum       NV   T   -   - LWT L G              GV    AARTNYNS                    P   T   L L L   S K L GN        H T F E - - P EWN                V I
                        Buergenerula spartinae      GS   I   T   V Y WQ I N             GS    A L A V DWE K               P   T   LEY     VR TGN          TSYP          -   -   SDAN       L   I
                        Colletotrichum lagenarium   GE   K   I   Y RWR V N              GS    S M D V QW D K              P   T   L QY    I A EGN         D SWP         -   -   HQAN       V   V
                        Podospora anserina          GT   P   L   F VWK V N              GS    S I N V DWD K               P   I   VDY     V I AQN         TSYP          -   -   PQAN       V   I
                        Botrytis cinerea            GP   I   -   V T WG I N             LS    A I D V DWK K               P   I   L QY    V L DGN         N SWP         -   -   ASEN       L   I

                        Organism                    Accession Identity                        Identity
                                                       No.    (complete                        (partial
                                                              fragment)                      fragment)

                        Podospora anserina           P78722               32,22 %             30,0 %
                        Botrytis cinerea             Q96UM2               32,00 %             32,5 %
                        Buergenerula spartinae       Q8J239               31,46 %             37,5 %
                        Fusarium proliferatum        Q96WI1               30,64 %             27,5 %
                        Colletotrichum lagenarium    Q96C497              28,41 %             30,0 %

Fig. 4. Sequence analysis of the laccase gene fragments cbs2/int (a), cbs2/3 (b) and int/cbs3 (c). The complete fragments were aligned to the fungal protein
data base SWISS-PROT via FASTA. Identities to the five best matches are given. The most conserved sections of the fragments (partial fragment) were
chosen and aligned again with the same five sequences shown above. All identities are ungapped. Dark grey boxes represent amino acids that are identical.
Light grey boxes indicate similar amino acids. (a) Laccases from: Botrytis cinerea (Q12570), Phaeosphaeria spartinicola (Q8J251), Gaeumannomyces
graminis (Q8TFD9), Fusarium proliferatum (Q96UP9) and Stagonospora sp. (Q8J247). (b) Laccases from: F. proliferatum (Q96WI1), Neurospora crassa
(Q872X3), Cryphonectria parasitica (Q03966), G. graminis (Q8TFE1) and Phaeosphaeria halima (Q8J250). (c) Laccases from: Podospora anserina
(P78722), B. cinerea (Q96UM2), Buergenerula spartinae (Q8J239), F. proliferatum (Q96WI1) and Colletotrichum lagenarium (Q9C497).
166                                    L. Tetsch et al. / FEMS Microbiology Letters 245 (2005) 161–168

                                                                         fragment was used. When using the probes cbs2/int
                                                                         and cbs2/3 one signal could be detected for each DNA
                                                                         fraction digested with a different restriction enzyme.
                                                                         These signals were highly reproducible and were differ-
                                                                         ent for both probes used. The sizes for the restriction
                                                                         fragments detected were >10 kb (HindIII), 4.5 kb
                                                                         (EcoRI) and 2.5 kb (BamHI) for cbs2/int and >10 kb
                                                                         (HindIII), 8–9 kb (EcoRI) and 5.5 kb (BamHI) for
                                                                         cbs2/3 (Fig. 5). Probe int/cbs3 did not yi