CNT binding fragments interact with neurons

Document Sample
CNT binding fragments interact with neurons Powered By Docstoc
					Journal of Cell Science 112, 2715-2724 (1999)                                                                                     2715
Printed in Great Britain © The Company of Biologists Limited 1999
JCS4674



Functional characterisation of tetanus and botulinum neurotoxins binding
domains

Giovanna Lalli1,*, Judit Herreros1,*, Shona L. Osborne1, Cesare Montecucco2, Ornella Rossetto2 and
Giampietro Schiavo1,‡
1Molecular Neuropathobiology, Imperial Cancer Research Fund, 44 Lincoln’s Inn Fields, London WC2A 3PX, UK
2Centro CNR Biomembrane and Dipartimento di Scienze Biomediche, Università di Padova, via Colombo 3, 35121            Padova, Italy
*These two authors contributed equally to the work
‡Author for correspondence (e-mail: g.schiavo@icrf.icnet.uk)


Accepted 3 June; published on WWW 21 July 1999




SUMMARY

Tetanus and botulinum neurotoxins constitute a family of            following the neurotoxin-dependent cleavage of their
bacterial protein toxins responsible for two deadly                 targets VAMP/synaptobrevin and SNAP-25. In addition,
syndromes in humans (tetanus and botulism, respectively).           the recombinant binding fragments cause a significant
They bind with high affinity to neurons wherein they cause          delay in the paralysis induced by the corresponding
a complete inhibition of evoked neurotransmitter release.           holotoxin on the mouse phrenic nerve-hemidiaphragm
Here we report on the cloning, expression and use of the            preparation. Taken together, these results show that the
recombinant fragments of the heavy chains of tetanus                carboxy-terminal domain of tetanus and botulinum
neurotoxin and botulinum neurotoxin serotypes A, B and              neurotoxins is necessary and sufficient for the binding and
E as tools to study the neurospecific binding of the                 internalisation of these proteins in neurons and open the
holotoxins. We found that the recombinant 50 kDa                    possibility to use them as tools for the functional
carboxy-terminal domains of tetanus and botulinum                   characterisation of the intracellular transport of clostridial
neurotoxins alone are responsible for the specific binding           neurotoxins.
and internalisation into spinal cord cells in culture.
Moreover, we provide evidence that the recombinant
fragments block the internalization of the parental                 Key words: Tetanus toxin, Botulinum neurotoxin, Spinal cord
holotoxins in a dose-dependent manner, as determined by             neuron, SNARE protein



INTRODUCTION                                                        (Schiavo et al., 1992, 1993a,c, 1994; Yamasaki et al., 1994a,b,c).
                                                                    BoNT/A and E instead cleave synaptosomal-associated protein
The clostridial neurotoxin (CNT) family is composed of              of 25 kDa (SNAP-25) (Blasi et al., 1993a; Schiavo et al.,
tetanus neurotoxin (TeNT) and seven different serotypes of          1993a,b), whilst BoNT/C has a dual-specificity for SNAP-25
botulinum neurotoxins (BoNT) (Minton, 1995). The active             and syntaxin 1 (Blasi et al., 1993b; Schiavo et al., 1995; Foran
holotoxin is comprised of two fragments, termed heavy (H, 100       et al., 1996; Osen Sand et al., 1996; Williamson et al., 1996;
kDa) and light (L, 50 kDa) chains (Fig. 1A) and blocks              Vaidyanathan et al., 1999). Both syntaxin and SNAP-25 are
neurotransmitter release in vitro and in vivo (Schiavo and          mainly localised on the plasma membrane (Garcia et al., 1995).
Montecucco, 1997). The L chain is responsible for the               They are therefore defined as target SNAREs or t-SNAREs,
intracellular activity of CNTs and contains the catalytic domain    whilst VAMP/synaptobrevin is a vesicular SNARE or v-
of the neurotoxins. CNTs are zinc-endoproteases which               SNARE. v-and t-SNAREs form a very stable complex, possibly
specifically cleave a family of proteins, named SNAREs               promoting a strict apposition of the vesicular and target lipid
(soluble NSF attachment protein receptor) (Söllner et al.,          bilayers which is likely to drive membrane fusion (Sutton et al.,
1993). These proteins, whose integrity is necessary to sustain      1998; Weber et al., 1998). CNTs alter the formation and
regulated secretion, are involved in multiple steps leading to      assembly of this complex by reducing its stability (Hayashi
the docking and fusion of small synaptic vesicles (SSVs) with       et al., 1994, 1995) and in the case of syntaxin and VAMP/
the presynaptic plasma membrane and in a variety of other           synaptobrevin, by detaching the cytoplasmic portion from their
intracellular trafficking events (Hanson et al., 1997; Hay and      membrane anchors (Schiavo and Montecucco, 1997).
Scheller, 1997; Robinson and Martin, 1998).                            Despite the widespread distribution of the cleavable
   Vesicle-associated membrane protein (VAMP)/synaptobrevin         isoforms of VAMP, SNAP-25 and syntaxin, the action of CNTs
is localised on SSVs and other vesicular compartments and is        in vivo is absolutely neurospecific. All the clinical symptoms
cleaved by TeNT and four serotypes of BoNT (B, D, F and G)          of botulism can be ascribed to the inhibition of acetylcholine
2716 G. Lalli and others

release at the neuromuscular junction (NMJ), whilst the spastic      and Perriard, 1991). This epitope tag is followed by the motif
paralysis of tetanus is due to TeNT targeting to the inhibitory      recognised by protein kinase A (Kaelin et al., 1992). The same
interneurons of the spinal cord (Halpern and Neale, 1995;            procedure was followed to prepare the vector pGEX-4T3-HA in
Schiavo and Montecucco, 1997). The neurospecificity and the           which the sequence YPYDVPDYA corresponding to the influenza
differential trafficking of BoNTs and TeNT appear to be due          virus hemagglutinin epitope (HA) replaces the VSV-G epitope. In this
                                                                     case, the oligonucleotides GATCTTACCCCTACGACGTGCCCGA-
to structural elements present at the level of their H chains.       CTACGCCGGATCCCGTCGTGCATCTGTTCATATGCCATGG and
These contain two functional domains: a carboxy-terminal             AATTCCATGGCATATGAACAGATGCACGACGGGATCCGGCGT-
portion (HC) that is likely to play a role in the interaction with   AGTCGGGCACGTCGTAGGGGTAA were inserted in the BamHI/
the receptor(s), and an amino-terminal part (HN) of 50 kDa           EcoRI site of pGEX-4T3.
involved in the translocation of the L chain in the cytosol (Fig.
1A) (Montecucco and Schiavo, 1993). The recently reported            PCR amplification and cloning
crystal structure of TeNT HC domain (Umland et al., 1997;            Polymerase chain reaction (PCR) was performed using as a template
Knapp et al., 1998) and of BoNT/A (Lacy et al., 1998) show           crude genomic DNA from selected toxigenic C. botulinum strains
that the HC domains of CNTs are highly related and consist of        (Fach et al., 1995). The strain P64 which is related to strain 62A (Binz
two sub-domains with folds related to those of lectin sugar-         et al., 1990) was used for BoNT/A, NCTC 11219 (Whelan et al.,
                                                                     1992) for BoNT/E and the proteolytic strain B600 for BoNT/B (kind
binding proteins and the trypsin inhibitor family, respectively.     gifts of Dr M. R. Popoff, Institute Pasteur, Paris, France). The
   The presence of two putative binding elements in the HC           following primers were used: for BoNT/A, residues 845-1295,
fragment supports a dual receptor model for the binding of           CCATGGAGTACAGATATACCTTTTCAGCTTTC and GTCGACT-
CNTs to neuronal membranes (Montecucco, 1986). Low (Kd               TACAGTGGCCTTTCTCCCCATC (GenBank accession number
in the nMolar range) and high (Kd, sub-nM) affinity receptors        M30196); for BoNT/E, residues 820-1252, CCATGGAATAATAG-
for CNTs have been described and experimental evidence               TATTCCTTTTAAGCTTTCTTC and GTCGACTTATTTTTCTTGC-
indicates that both lipid and protein receptors are essential for    CATCCATGTTCTTCAG (accession number X62683); for BoNT/B,
high affinity binding (Halpern and Neale, 1995). Whilst the          residues 832-1290, CCATGGAAAACCATTATGCCGTTTGATC-
contribution of certain polysialogangliosides of the G1b series      TTTCAA and GTCGACTTATTCAGTCCACCCTTCATCTTTAG.
to CNTs binding is well documented (Habermann and Dreyer,            The resulting BoNT/B HC fragment constitutes a new BoNT/B variant
                                                                     and its sequence is now available with the accession number
1986; Halpern and Neale, 1995; Schiavo and Montecucco,               AJ242628. Following PCR amplification, DNA inserts were sub-
1997), the characterisation of their protein receptors at the        cloned into pCR2.1 (Invitrogen), excised with NdeI/XhoI (BoNT/A)
peripheral and central level has proved elusive.                     and NcoI/SalI (BoNT/B and E) and then ligated into pGEX-4T3-HA
Synaptotagmins, integral proteins of SSVs, have been                 (for BoNT/B and E) or pGEX-4T3-VSV-G (BoNT/A). TeNT HC
suggested as the neuronal receptors for BoNT/B, E and A (Li          (residues 855-1314; accession number X04436) was obtained in the
and Singh, 1998; Nishiki et al., 1994, 1996a,b), thus supporting     vector pTTQ8 (Amersham Pharmacia Biotech) from Dr J. Halpern
a model envisaging BoNTs entry at the NMJ via SSV recycling          (FDA, Bethesda, Maryland, USA) (Halpern et al., 1990). The insert
(Matteoli et al., 1996).                                             was excised with SalI/PstI, blunt-ended with T4 DNA polymerase
   Here we report on the expression and functional                   (New England Biolabs) following manufacturer recommendations
characterisation of the HC fragments of TeNT and of BoNT/A,          and ligated in the SmaI site of pGEX-4T3-VSV-G.
B and E which are the three botulinum neurotoxins more               Expression and purification of recombinant HC fragments
frequently involved in human botulism. We describe the               pGEX-4T3-VSV-G and pGEX-4T3-HA vectors containing the
purification to homogeneity of HC fragments that are able to          appropriate HC insert were used to transform TG1 or BL21(DE3)pLys
bind to the surface of murine spinal cord neurons, a model           strains (Stratagene) and protein expression was induced by incubation
system which contains physiological CNT receptors. These             for 4 hours at 30°C in the presence of 0.4 mM isopropyl-β-D-
fragments antagonise the binding and cellular trafficking of the     thiogalactoside (IPTG) (Guan and Dixon, 1991). For BoNT/B, TOPP3
native holotoxins, as assayed by the protection of the CNT-          cells (Stratagene) were used without induction by IPTG. Recombinant
mediated SNARE cleavage and by the delay in the onset of             GST-fusion proteins were adsorbed on glutathione-agarose beads
paralysis in the mouse phrenic nerve-hemidiaphragm.                  (Sigma) and sequentially incubated with 50 mM Tris-HCl, pH 7.4, 2
                                                                     mM ATP, 10 mM MgSO4 for 10 minutes at 37°C followed by
                                                                     phosphate-buffered saline containing 0.5 M NaCl and 0.05% Tween-
                                                                     20. The tagged HC fragments were released by thrombin cleavage
MATERIALS AND METHODS                                                (Guan and Dixon, 1991). When necessary, the eluted proteins were
                                                                     purified by metal-chelating chromatography using HiTrap columns
Vector preparation                                                   (Amersham Pharmacia Biotech) (Rossetto et al., 1992). Briefly, 1 ml
Oligonucleotides with the sequence GATCTTACACCGATATAGAG-             HiTrap column was preloaded with 5 ml of 100 mM ZnSO4, followed
ATGAACAGGCTGGGAAAGCGTCGTGCATCTGTTCATATG and                          by 10 ml of distilled water and then equilibrated with 50 mM Hepes-
AATTCATATGAACAGATGCACGACGCTTTCCCAGCCTGTTCA-                          Na, pH 7.4, 150 mM NaCl (buffer A). After loading and extensive
TCTCTATATCGGTGTAA were phosphorylated with T4                        washing with buffer A, the HC fragments were eluted with a linear
polynucleotide kinase (New England Biolabs) for 30 minutes at 37°C   gradient of imidazole in buffer A (0-25 mM). Pooled fractions were
and then annealed at a final concentration of 1 µM in 40 mM Tris-     dialysed against 20 mM Hepes-NaOH, pH 7.4, 150 mM NaCl, 10%
HCl, pH 7.5, 20 mM MgCl2, 50 mM NaCl. The double strand linker       glycerol, 0.1 mM dithiothreitol (DTT) and, after freezing in liquid
was then ligated into the BamHI/EcoRI site of pGEX-4T3 (Amersham     nitrogen, stored at −80°C.
Pharmacia Biotech). The resulting vector (pGEX-4T3-VSV-G)
encodes for glutathione S-transferase (GST) which is fused at the    Spinal cord cells primary culture
carboxy terminus, downstream of the thrombin cleavage site, to the   Spinal cords from 14-day foetal mice were isolated, dissociated and
sequence YTDIEMNRLGK, corresponding to the vesicular stomatitis      plated in 12-well plates (Corning Costar) or on glass coverslips,
virus protein G epitope (VSV-G) (Gallione and Rose, 1985; Soldati    coated with a mixture of polyornithine and collagen (Fitzgerald,
                                                                                 CNT binding fragments interact with neurons 2717

1989; Williamson et al., 1996). Cultures were grown for two weeks          For quantitation, protein recovery was normalised using syntaxin 1
in a humidified 10% CO2 incubator at 37°C. Culture medium was               immunoreactivity as internal standard.
MEM (minimum essential medium with Earle’s salts, with sodium
bicarbonate 3.7 g/l, glucose 6 g/l, pH 7.3-7.4), containing B27            Mouse phrenic nerve-hemidiaphragm recording
supplement (Gibco-BRL), heat-inactivated horse serum (5% v/v)              Mouse phrenic nerve-hemidiaphragms were dissected from animals
and L-glutamine (2 mM). Five days after plating, 35 µg/ml of               weighing about 20 g, mounted in 10 ml of oxygenated (95% CO2 -
uridine and 15 µg/ml of 5′-fluoro-2′-deoxyuridine (both from                5% O2) Krebs-Ringer solution containing 11 mM glucose, pH 7.4,
Sigma) were added to the medium for 96 hours to block cell                 and kept at 37°C. The phrenic nerve was stimulated via two ring
proliferation. Medium was changed every 3-4 days.                          platinum electrodes by supramaximal stimuli of 3-6 V amplitude and
                                                                           0.1 millisecond pulse duration with a frequency of 0.1 Hz. Isometric
CNT binding and internalisation                                            muscle contraction was monitored via a displacement force transducer
Spinal cord cultures were cooled to 4°C, washed twice with 0.1%            connected to a recorder. In control experiments (without any added
bovine serum albumin (BSA) in Hanks’ solution (20 mM Hepes-Na,             toxin), the amplitude of muscle contraction under stimulation was
pH 7.4, 0.44 mM KH2PO4, 0.42 mM Na2HPO4, 5.36 mM KCl, 136                  constant for at least 8 hours. CNTs were added to the bath at a
mM NaCl, 0.81 mM MgSO4, 1.26 mM CaCl2, 6.1 mM glucose) and                 concentration of 10 nM for TeNT and 0.2 nM for BoNTs under
incubated with recombinant TeNT HC, native TeNT, BoNT/B HC (80             conditions that allow binding to go to completion (Simpson, 1980).
nM), BoNT/A HC or BoNT/E HC (200 nM) for 1 hour at 4°C. In                 For this purpose, tissues were incubated with toxin in physiological
selected samples, native TeNT (20 µM) was pre-incubated at 4°C for         medium at 25°C for 60 minutes without nerve stimulation. At the end
15 minutes before addition of the recombinant HC. For internalisation      of incubation, tissues were washed and transferred to 37°C in a bath
studies, cells were incubated for 1 hour at 37°C with the recombinant      without CNTs. Nerve stimulation was applied until a reduction of
TeNT HC (80 nM) and BoNT/E HC (100 nM) domains diluted in                  90% of the initial muscle twitch was observed. In the competition
culture medium. After washing, cells were transferred to room              assays, mouse phrenic nerve-hemidiaphragms were incubated with
temperature and fixed in 4% paraformaldehyde, 20% sucrose in                each HC fragment (HC:CNT ratio 100:1 for TeNTand 1,300:1 for
phosphate-buffered saline (PBS) without calcium and magnesium for          BoNTs) for 15 minutes at 25°C followed by a co-incubation with the
15 minutes. After rinsing twice with PBS, cells were incubated for 20      parental CNT at the same concentration of the control for 60 minutes
minutes with 50 mM NH4Cl in PBS, washed and then blocked with              at 25°C without nerve stimulation. After incubation, all tissues were
2% BSA, 0.25% porcine skin gelatin, 0.2% glycine, 15% foetal calf          washed and paralysis times were monitored. Results were expressed
serum in PBS for 1 hour. Coverslips were then incubated for 30-60          as the time necessary to obtain a 50% reduction of the initial muscle
minutes with mouse anti-VSV-G (1:100) (Soldati and Perriard, 1991),        response following nerve stimulation. Data are the average of n=3
mouse anti-HA (1:50) (Niman et al., 1983) or polyclonal anti-TeNT          experiments.
(1:1,500) antibodies diluted in PBS containing 1% BSA, 0.25%
porcine skin gelatin. After rinsing, cells were incubated for 25 minutes
with Alexa 488 goat anti-mouse IgG or Alexa 488 goat anti-rabbit           RESULTS
IgG (1:200) (Molecular Probes). To monitor internalisation, cell were
treated with the same solutions with the addition of 0.1% Triton X-        Expression and characterisation of TeNT and BoNTs
100. Coverslips were mounted on slides with Mowiol 4-88 (Harco)            HC fragments
and stored at 4°C.                                                         Experimental evidence suggests that the HC fragment is mainly
   HC binding to purified polysialogangliosides was monitored               responsible for the specific binding of CNTs to their
by dot-blot assay (Thomas et al., 1999) by using 0.5 µg of
phosphatidylcholine (PC) (Avanti) or purified gangliosides GM1,
                                                                           acceptor(s) in neurons. However, with the exception of TeNT,
GD1b, GT1b and GQ1b (Sigma) adsorbed on nitrocellulose. After              the molecular analysis of this process has been hampered by
blocking with 5% dried skimmed milk in PBS, HC fragments (80               the lack of suitable protocols for the expression of this domain
nM) were diluted in 20 mM Tris-acetate, pH 6.0, 5% milk and                in a recombinant form. Here we used variants of the expression
incubated for 2 hours at room temperature. Binding was detected            vector pGEX, encoding glutathione S-transferase, for the
with anti-VSV-G (1:1,000) and anti-HA (1:200) antibodies,                  purification of fusion proteins containing the HC fragments of
followed by an anti-mouse peroxidase-conjugated IgG and                    TeNT and three BoNT serotypes (A, B and E) (Fig. 1A). These
Enhanced Chemi-Luminescence method (ECL, Amersham                          new vectors contain either the VSV-G (pGEX-4T3-VSV-G) or
Pharmacia Biotech, UK).                                                    the HA (pGEX-4T3-HA) epitopes after the thrombin cleavage
CNT treatment and SNARE analysis in spinal cord cells                      site. We adopted a PCR approach using as a template crude
Spinal cord cultures were rinsed twice with MEM and incubated for
                                                                           genomic DNA from selected toxigenic C. botulinum strains.
20 hours at 37°C in serum-free culture medium with different CNTs          Whilst the amplification with BoNT/A and E specific primers
(TeNT and BoNT/A 100 pM, BoNT/E 500 pM, BoNT/B 2.5 nM)                     generated fragments corresponding to the published sequences,
purified as previously described (Schiavo and Montecucco, 1995).            the same procedure also allowed the isolation of a new
Some samples were pre-incubated with the recombinant HC (1 nM,             BoNT/B variant with 91% identity to M81186 and Y13630
10 nM, 100 nM and 1 µM, unless otherwise stated) for 1 hour at 37°C        (strain Danish, ATCC 43757) and 88% identity to X71343
before adding the corresponding CNT. For immunocytochemistry,              (strain Eklund, ATCC25765, non-proteolytic) at the amino acid
cells were fixed and treated as described with the addition of 0.1%         level. The neurotoxin corresponding to this new variant is fully
Triton X-100 in all solutions. SNARE detection was carried out with        toxic and is immunologically indistinguishable from the
a polyclonal antibody recognising the carboxy terminus of SNAP 25          classical B serotype.
(1:200) (Osen Sand et al., 1993) or with a monoclonal anti-VAMP-2
(1:100) (Edelmann et al., 1995). For western blot analysis, spinal cord
                                                                              The length of the sequences corresponding to the different
cells were washed twice with PBS and then scraped in the same buffer.      HCs was chosen on the basis of sequence alignments and the
Proteins were recovered by precipitation with 6.5% trichloroacetic         crystal structures (Umland et al., 1997; Knapp et al., 1998;
acid (TCA) and analysed by SDS-PAGE containing urea (Söllner et            Lacy et al., 1998), which highlight the similar organisation of
al., 1993). Western blotting was performed by using anti-VAMP-2            CNT HC fragments. This structure predicts that both the
antibody (1:200) (Edelmann et al., 1995), followed by ECL detection.       folding and the binding activity of the HC domains are
2718 G. Lalli and others




                                                                kDa

Fig. 1. Expression of clostridial neurotoxin HC fragments and
binding to polysialogangliosides. (A) Schematic
representation of CNTs. The active holotoxin is composed of
two chains (H and L) held together by a single disulfide
bridge. The L chain is responsible for the intracellular
proteolytic activity. The H chain, which can be further
subdivided into two functional subdomains, is involved in the
neurospecific binding (HC) and membrane translocation (HN).
The HC fragments were tagged with the VSV-G (TeNT and
BoNT/A) or with the HA epitope (BoNT/B and /E) at the
amino terminus (star) and expressed as GST-fusion proteins.
(B) SDS-PAGE profile of the recombinant HC fragments
stained with Coomassie Blue (left panel, 1 µg/lane) or after
western blotting with anti-VSV-G or anti-HA antibodies
followed by ECL. (C) The HC fragments of BoNT/B and
TeNT bind to polysialogangliosides in a dot-blot assay.
Lipids (0.5 µg) were immobilised onto nitrocellulose,
overlayed with TeNT and BoNT/B HC (80 nM) and detected
as described in B.

independent of the remainder of the neurotoxin molecule. To           Whilst BoNT/E HC mirrors the binding behaviour of BoNT/B,
test this hypothesis, we expressed and purified GST-fusion             the HC of BoNT/A presents a much lower interaction with
proteins containing the different HC fragments in E. coli (Guan       these glycolipids (not shown).
and Dixon, 1991). In the case of TeNT, BoNT/A and E, this                In order to test the HC fragments in a more physiological
procedure allowed the isolation of recombinant proteins with          context, their binding was assayed on the most appropriate
an apparent molecular mass ranging from 44 to 47 kDa (Fig.            cellular system presently available to study CNT activity, a
1B, left panel) depending on the serotype, which are                  mixed population of foetal spinal cord cells containing
specifically recognised by either anti-VSV-G (Fig. 1B, central         motoneurons, dorsal root ganglia, glial and stromal cells
panel) or anti-HA antibodies (Fig. 1B, right panel). In contrast,     (Ransom et al., 1977). The neuronal components of this culture
the same procedure applied to BoNT/B was not successful and           display evoked neurotransmitter release which can be blocked
allowed the expression of only a very small amount of HC              by physiological concentrations of CNTs (Williamson et al.,
within inclusion bodies. When another E. coli strain (TOPP3,          1996), thus indicating the presence of functional CNT binding
Stratagene) was used for expression, a soluble fusion protein         sites on their surface.
was obtained which, after thrombin cleavage, gave a 48 kDa               As shown in Fig. 2, native TeNT and its recombinant HC
homogeneous band recognised by an anti-HA antibody (Fig.              fragment bind to mouse spinal cord cells in culture with similar
1B, left and right panels).                                           distribution. At 4°C, the immunoreactivities of both the VSV-
                                                                      G tagged HC fragment (Fig. 2A) and TeNT (Fig. 2B), present
Binding and internalisation of recombinant HC                         in the incubation medium at a final concentration of 80 nM,
fragments                                                             revealed a punctate surface distribution. Membrane staining is
CNTs are known to bind to polysialogangliosides in vitro and          not homogenous and is distributed all along the neurites and
this interaction is mediated by the HC domain (reviewed by            on the cell soma. In some cases, labelling has the
Habermann and Dreyer, 1986; Halpern and Neale, 1995). We              morphological appearance of neuronal varicosities, areas
tested the competence of our recombinant fragments to bind            where neurotransmitter release and active endocytosis are
polysialogangliosides by using a dot-blot assay (Thomas et al.,       suggested to take place (Bennett et al., 1997; Brain et al., 1997;
1999). As shown in Fig. 1C, TeNT HC interacts with GT1b and           Bennett, 1998). The staining of HC fragment is specific as
to a less extent to GD1b, whereas BoNT/B binds GT1b and GQ1b.         demonstrated by competition with excess of native TeNT (Fig.
No interaction was observed with PC or the monosialilated             2C). The absence of staining of the homogenous layer of non-
ganglioside GM1, thus confirming the preference of CNTs for            neuronal supporting cells, further demonstrates that TeNT and
a subset of polysialogangliosides (Habermann and Dreyer,              HC bind selectively to neurons.
1986; Schengrund et al., 1991; Halpern and Neale, 1995).                 The binding of the recombinant HC fragments of BoNT/A,
                                                                            CNT binding fragments interact with neurons 2719




Fig. 2. Binding of clostridial
neurotoxin HC fragments to
mouse spinal cord cells.
Spinal cord cells were
incubated at 4°C with the
HC fragment of TeNT
(A,C), native TeNT (B), the
HC fragments of BoNT/A
(D), of BoNT/B (E) or of
BoNT/E (F). In C, pre-
incubation with native TeNT
was able to compete the
binding of the TeNT HC.
Binding was detected using
anti-VSV-G (A,C,D), anti-
TeNT (B) or anti-HA (E,F)
antibodies as described in
Materials and Methods. Bar,
5 µm.

B and E is very similar to that observed with TeNT, as shown           in bright clusters corresponding to synaptic contacts and to
in Fig. 2D-F. Staining is concentrated in distinct patches on          points of accumulation of SSVs. Treatment of the culture for
the plasma membrane of neurites and the cell soma.                     20 hours at 37°C with 100 pM native TeNT caused the
Qualitatively, the extent of binding with the three BoNT HCs           complete disappearance of VAMP immunostaining (Fig. 4B),
is lower than the one observed with TeNT. This may reflect              following its specific proteolysis by this neurotoxin. As
a reduced number of membrane acceptors, which in turn                  previously reported (Osen Sand et al., 1996; Williamson et al.,
could explain the higher concentration of native BoNTs                 1996), TeNT-dependent VAMP ablation did not alter neuronal
required to observe a physiological intracellular effect (see          morphology nor affect cell survival.
below). Alternatively, the reduced staining seen with BoNT                Pre-treatment of the cells with the HC fragment of TeNT
HCs could be due to an overall lower binding affinity of these         potently inhibited the proteolytic action of the neurotoxin in a
fragments.                                                             dose dependent manner (Fig. 4C-F). Complete protection of
   The same cellular system was then used to monitor the               VAMP immunostaining was achieved by pre-treatment of the
ability of the HC fragments to be internalised following surface       culture with 100 nM of TeNT HC. This result was confirmed
binding. After incubation at 37°C, confocal microscopic                by western blotting of the treated cells and analysis of the
analysis revealed that HC immunostaining was concentrated in           VAMP immunoreactivity (Fig. 4, inset).
bright intracellular structures with very few patches still               The effect of the HC fragment of BoNT/A, B and E on the
present on the cell surface (Fig. 3). These endocytic vesicles         intoxication mediated by the native neurotoxin was similarly
and their intracellular distribution appear to be identical for        tested. In this case, spinal cord cells were probed with an
BoNT and TeNT HC fragments. Future biochemical                         antibody against the substrate of the botulinum neurotoxin
experiments are necessary to assess the precise nature of these        (VAMP-2 for BoNT/B and SNAP-25 for BoNT/A and E),
vesicles and to test the possibility that TeNT and BoNTs use,          whose staining disappears upon toxin cleavage (Blasi et al.,
at least in part, the same internalisation pathway.                    1993a; Schiavo et al., 1993a,b). As shown in Fig. 5A and G,
                                                                       SNAP-25 localises along the neurite membrane without a
Recombinant HC fragments block the binding and                         clear concentration at the synapses or at varicosities (Garcia
intracellular activity of the native CNTs in spinal                    et al., 1995). Cell treatment for 20 hours at 37°C with 100
cord cell cultures                                                     pM of BoNT/A (Fig. 5B) and 500 pM BoNT/E (Fig. 5H)
In order to establish that the HC is able to bind to the               abolished       SNAP-25        immunostaining.        SNAP-25
physiological receptor of the parental CNT, and therefore              immunoreactivity was preserved when the cells were pre-
represents the bona fide binding domain, we tested the different        incubated with 1 µM of the corresponding HC fragment (Fig.
HC fragments for their ability to inhibit the intracellular activity   5C,I). BoNT/B was less potent than the other CNTs on these
of the corresponding holotoxin in spinal cord cultures. As             cells and a concentration of 2.5 nM of BoNT/B was necessary
shown in Fig. 4A, the neuronal components of this preparation          to achieve complete loss of VAMP immunostaining (Fig. 5E).
express the SSV protein VAMP/synaptobrevin, which localises            Under such conditions, only partial protection was elicited by
2720 G. Lalli and others




Fig. 3. Internalisation of HC fragments in
mouse spinal cord cells. Spinal cord cells
were incubated with the HC fragment of
TeNT (A,B) or BoNT/E (C,D) for 1 hour at
37°C before fixing and permeabilisation.
Binding was detected using anti-VSV-G
(A,B) or anti-HA (C,D) antibodies as
described in Materials and Methods and
images were collected with a confocal laser
scanning microscope. (A and C) Two z-
sections obtained at 1.5 µm from the
substrate, whereas B and D display the
merged images of the z-sections (14×0.4
µm) corresponding to the entire cell. Bars,
5 µm.

pre-incubation of the spinal cord cells with BoNT/B HC (500              BoNT/B HC, only a fraction of which are competent for
nM, Fig. 5F). This is consistent with a lower ratio between              binding). The immunofluorescence protection experiments
HC and native neurotoxin present in the medium, although                 were confirmed by western blot using an anti-VAMP-2
other explanations are also possible (i.e. the presence of               antibody and, for SNAP-25, an antibody recognising both the
different conformational isoforms in the preparation of                  intact protein and the cleaved fragment (not shown).




                                                                                                                          kDa




Fig. 4. The recombinant HC fragment of TeNT blocks the binding and intracellular activity of the native neurotoxin. Mouse spinal cord cells
were incubated for 20 hours at 37°C in the absence (A) or in the presence (B-F) of TeNT holotoxin. Before TeNT addition, samples C-F were
treated with increasing amounts of the recombinant TeNT HC (C, 1 nM; D, 10 nM; E, 100 nM; F, 1 µM). Intact VAMP was then
immunodetected with an anti-VAMP-2 antibody. In parallel samples, cells were recovered and levels of VAMP-2 analysed by western blot
(upper right panel) as described in Materials and Methods. Bar, 5 µm.
                                                                          CNT binding fragments interact with neurons 2721




Fig. 5. The recombinant HC
fragments of BoNT/A, /B and /E
block the intracellular activity of
the corresponding native CNTs.
Mouse spinal cord cells were
incubated for 20 hours at 37°C in
the absence (A,D,G) or in the
presence of native BoNT/A (B,C),
BoNT/B (E,F) or BoNT/E (H,I).
Prior to CNT addition, samples in
C, F and I were treated with the
corresponding HC fragment (C,
BoNT/A HC, 1 µM; F, BoNT/B HC,
0.5 µM; I, BoNT/E HC, 1 µM).
Target SNAREs were then detected
with an anti-SNAP-25 antibody
directed against the carboxy
terminus (A-C and G-I) or with an
anti-VAMP-2 antibody (D-F) as
described in Materials and
Methods. Bar, 5 µm.


Recombinant HC fragments antagonise CNT-                            have been one of the most successful and frequently used tools
dependent inhibition of neuromuscular transmission                  in neurobiology and cell biology. CNT-dependent SNARE
BoNTs elicit an irreversible paralysis of the well-established      ablation is an effective method to analyse the function of this
system of the mouse phrenic nerve-hemidiaphragm                     family of proteins in intact cellular systems (Schiavo and
preparation. Its onset of paralysis (which is commonly              Montecucco, 1997). Despite their importance in the cell
expressed as 50% of paralysis time) is dose-and temperature-        intoxication process, considerably less attention has been paid
dependent and ranges from 23 to 37 minutes (Table 1). Due to        in recent years to the entry and trafficking of these toxins in
its site of action, TeNT is less potent on peripheral synapses      neuronal cells. A vast literature exists on the preliminary
with a longer (110 minutes) 50% of paralysis time (Schmitt et       characterisation of the in vivo CNT binding sites, but the
al., 1981; Simpson, 1984a,b). We tested the protective activity     neuronal receptor(s) of these neurotoxins have not yet been
of the recombinant HC fragments on the CNT-dependent                identified. One possible explanation is the lack of suitable
inhibition of neuromuscular transmission by adding them to          molecular biology and biochemical tools. Apart from the
the electrophysiological bath. All the recombinant HC
fragments antagonised the action of the parental CNT which is
seen as a delay in the onset of paralysis (Table 1). The increase   Table 1. Effect of recombinant HC fragments on the 50%
in the 50% of paralysis time ranged from 75% for BoNT/A and         time of paralysis in mouse phrenic nerve-hemidiaphragm
TeNT to more than 150% in the case of BoNT/B and E. This                 preparations intoxicated with TeNT and BoNTs
protective effect of HC is strictly serotype-dependent. In fact,                           Control CNT*        CNT + HC*           (+%)‡
the HC fragment of BoNT/B did not interfere with the paralysis            BoNT/A               37±6                65±8             (+75)
induced by BoNT/E (not shown), as expected from serotypes                 BoNT/B               23±5                60±9            (+160)
not competing for the same cellular acceptors (Evans et al.,              BoNTE                24±3                61±7            (+154)
                                                                          TeNT                111±11              195±20            (+75)
1986; Habermann and Dreyer, 1986).
                                                                      *The values given are the 50% paralysis time (in minutes) of tissues (n=3)
                                                                    exposed to CNTs alone or in the presence of their HC fragment. Each value
DISCUSSION                                                          represents the mean ± s.d.
                                                                      ‡Increase in the 50% of paralysis time following pre-treatment with HC
Following the identification of their intracellular targets, CNTs    (percentage of the control).
2722 G. Lalli and others

analysis of the TeNT HC (Halpern and Loftus, 1993), no further      lumen and then enter the neuronal cytoplasm (Matteoli et al.,
data on the precise definition of the neurotoxin binding domain      1996). Although the distribution of the neurotoxin binding sites
is currently available for the different BoNT serotypes. In         observed here is compatible with areas of SSV exocytosis, our
particular, the purification of these domains from bacteria has      experimental work does not provide direct evidence in support
been hampered by low expression levels and relatively high          of this model nor for the role of synaptotagmins as BoNTs
insolubility. Here we demonstrate the suitability of distinct E.    receptors.
coli expression systems for the production of functional               We also showed that the HC domains of CNTs inhibit the
binding domains of CNTs which are able to antagonise the            intracellular proteolytic activity of the native neurotoxins,
activity of the native neurotoxins in different experimental        which was conveniently followed by immunofluorescence and
systems.                                                            immunoblotting. This represents a very sensitive approach to
   Despite the relatively low level of sequence homology, the       test the binding, entry and translocation of native CNTs at a
structures of the HC domain of TeNT and BoNT/A are very             concentration as low as picoMolar in different cellular systems
similar (Umland et al., 1997; Knapp et al., 1998; Lacy et al.,      (Williamson et al., 1996; Schiavo and Montecucco, 1997). All
1998), suggesting an analogous function and folding for the         four HC fragments effectively inhibited the proteolysis of the
uncharacterised BoNT/B and E. In fact, the HC comprises two         parental native neurotoxin in a concentration dependent
similarly sized sub-domains which have virtually no or very         manner, indicating that the HC fragments bind to functional
limited surface interactions with the other half of the H chain.    acceptor(s), which mediate the “productive” entry of the
The tertiary structure suggests that this part of the molecule      neurotoxin into the cell. This result is in contrast to the
folds independently and therefore constitutes a good candidate      conclusions of a recent study showing no competition between
for functional expression in an heterologous system.                the binding of native BoNT/A and its H chain, prepared by
   Using variants of the expression vector pGEX, the HC             chemical dissociation, at the murine NMJ (Daniels-Holgate
domain of TeNT, BoNT/A and E were expressed as a soluble            and Dolly, 1996). This preparation, which preserves the
fusion protein in E. coli. In contrast, no expression of soluble    integrity of a fully-developed neuromuscular junction, is
BoNT/B HC was observed in E. coli strains based on the K-12         widely used to study the effects of various neurotoxins,
genotype. The reason for this failure is unclear. Expression        including CNTs (Wohlfarth et al., 1997). In our experimental
levels are known to be lowered by the insertion of tandem rare      conditions, all four HC fragments were found to be potent
codons into homologous genes (Makoff et al., 1989). On              antagonists of the corresponding CNT, causing a significant
inspection, the number and type of rare codons (Sharp and Li,       delay in the onset of paralysis (75-150%). The discrepancy
1986) in BoNT/B HC are similar to those present in the other        between the two results could be due to loss of biological
expressed HCs. However, the HC of BoNT/B does contain               function of the entire H chain during isolation or alternatively,
multiple triplets of consecutive rare codons concentrated in the    the isolated fragments may have different conformations or
first third of the sequence, a fact that may explain its poor        aggregation states which would result in different biological
expression. To overcome this problem, three non K-12                activities.
bacterial strains were tested and a homogeneous BoNT/B HC              Although the final concentrations necessary to delay the
of the expected molecular mass was obtained in the TOPP3            onset of paralysis are similar for TeNT and BoNT HCs, the ratio
strain.                                                             between HC and the holotoxin is higher for BoNTs than for
   Recombinant        HC     fragments      bind     immobilised    TeNT (1,300:1 and 100:1, respectively). This reflects the well-
polysialogangliosides and their biological activity was further     documented fact that higher doses of TeNT compared to
tested in various functional assays. The first consisted of the      BoNTs are needed to observe a paralytic effect at the NMJ (10
binding of these domains to mouse embryonic spinal cord             nM vs 0.2 nM) (Dreyer and Schmitt, 1981; Schmitt et al., 1981;
cells. This mixed culture contains the cell types responsible for   Simpson 1984a,b, 1985). Due to the large volume of the
the uptake of CNTs and the target of their final physiological       electrophysiological bath, a ratio between HC and holotoxin
action in vivo. Recombinant HC fragments of TeNT and                higher than 100:1 was possible only for BoNTs. Experiments
BoNT/A, B and E bind efficiently to spinal cord neurons and         performed with lower excess of BoNT HCs revealed a reduced
reveal a punctate staining pattern with areas of high toxin         level of protection, possibly due to the sequestration of HC by
concentration, suggesting specialised arrangements of CNT           non-specific low affinity binding sites present on the tissue.
cellular receptors. This binding is functional, as demonstrated     These low affinity sites would release bound HC molecules
by the ability of the spinal cord neurons to internalise the        only slowly, resulting in an apparently lower protecting effect
different HCs in intracellular vesicular structures upon transfer   of BoNT HCs in this assay.
to 37°C. In this regard, these fragments and their mutants will        The specificity of the antagonism of the HC on the paralysis
play a central role for the future dissection of the endocytic      caused by the native neurotoxin is further demonstrated by its
pathway of TeNT and BoNTs in isolated neurons.                      strict serotype-dependency. We observed a complete lack of
   Recent findings indicate the involvement of synaptotagmins        competition with the HC fragment of BoNT/B on the action of
in the cellular recognition of BoNT/A, B and E (Nishiki et al.,     BoNT/E. This result is particularly relevant because it is
1994, 1996a,b; Li and Singh, 1998). The domain acting as            consistent with the well-documented lack of competition
BoNTs receptor is the amino-terminal domain of                      between BoNT/B and BoNT/E, which do not appear to share
synaptotagmin, which is localised in the lumen of the SSV           the same cellular receptor (Habermann and Dreyer, 1986). This
(Schiavo et al., 1998), but becomes accessible to the               last result was recently challenged by a series of reports
extracellular medium following the fusion of SSV with the           suggesting that BoNT/A, B and E bind to the SSV proteins
presynaptic membrane (Matteoli et al., 1992). CNTs might            synaptotagmin I and II (Li and Singh, 1998; Nishiki et al.,
exploit the SSV exo-endocytic cycle to gain access to the SSV       1994, 1996a,b). The physiological relevance of the interaction
                                                                                          CNT binding fragments interact with neurons 2723

between synaptotagmin and CNTs remains controversial                                  intact and permeabilized chromaffin cells: correlation with its blockade of
(Bakry et al., 1997). The recombinant HC fragments will                               catecholamine release. Biochemistry 35, 2630-2636.
                                                                                    Gallione, C. J. and Rose, J. K. (1985). A single amino acid substitution in a
provide a valuable tool to verify these conclusions in vitro and
                                                                                      hydrophobic domain causes temperature-sensitive cell-surface transport of
in vivo, allowing further investigation into the nature and                           a mutant viral glycoprotein. J. Virol. 54, 374-382.
distribution of their still uncharacterised neuronal receptors. In                  Garcia, E. P., McPherson, P. S., Chilcote, T. J., Takei, K. and De Camilli,
addition, they will provide an experimental system for the                            P. (1995). rbSec1A and B colocalize with syntaxin 1 and SNAP-25
precise mapping of the HC-receptor protein-protein interaction                        throughout the axon, but are not in a stable complex with syntaxin. J. Cell
                                                                                      Biol. 129, 105-120.
and the definition of the minimal effector domain which is                           Guan, K. L. and Dixon, J. E. (1991). Eukaryotic proteins expressed in
essential for their possible use as neurospecific protein carrier.                     Escherichia coli: an improved thrombin cleavage and purification procedure
                                                                                      of fusion proteins with glutathione S-transferase. Anal. Biochem. 192, 262-
   We thank Dr J. Halpern (FDA, Bethesda, Maryland) for providing                     267.
the TeNT HC fragment in pTTQ8 vector, Dr M. Popoff (Institute                       Habermann, E. and Dreyer, F. (1986). Clostridial neurotoxins: handling and
Pasteur, Paris, France) for the kind gift of genomic DNA from                         action at the cellular and molecular level. Curr. Top. Microbiol. Immunol.
BoNT/A, /B and /E producing strains of C. botulinum and M. Becker                     129, 93-179.
for the valuable help in preparing BoNT Hcs. We also thank Drs G.                   Halpern, J. L., Habig, W. H., Neale, E. A. and Stibitz, S. (1990). Cloning
                                                                                      and expression of functional fragment C of tetanus toxin. Infect. Immun. 58,
Stenbeck, C. Reis e Sousa and S. Tooze for discussion and critical                    1004-1009.
reading of the manuscript and the referees for excellent suggestions.               Halpern, J. L. and Loftus, A. (1993). Characterization of the receptor-binding
Work in the laboratories of the authors is supported by Human                         domain of tetanus toxin. J. Biol. Chem. 268, 11188-11192.
Frontier Science Program (J.H.), Telethon-Italia Grant 1068 and                     Halpern, J. L. and Neale, E. A. (1995). Neurospecific binding,
Biomed2 BMH4-97-2410 (C.M. and O.R.) and by the Imperial                              internalization, and retrograde axonal transport. Curr. Top. Microbiol.
Cancer Research Fund.                                                                 Immunol. 195, 221-241.
                                                                                    Hanson, P. I., Heuser, J. E. and Jahn, R. (1997). Neurotransmitter release.
                                                                                      Four years of SNARE complexes. Curr. Opin. Neurobiol. 7, 310-315.
                                                                                    Hay, J. C. and Scheller, R. H. (1997). SNAREs and NSF in targeted
REFERENCES                                                                            membrane fusion. Curr. Opin. Cell Biol. 9, 505-512.
                                                                                    Hayashi, T., McMahon, H., Yamasaki, S., Binz, T., Hata, Y., Südhof, T. C.
Bakry, N. M., Kamata, Y. and Simpson, L. L. (1997). Expression of                     and Niemann, H. (1994). Synaptic vesicle membrane fusion complex:
  botulinum toxin binding sites in Xenopus oocytes. Infect. Immun. 65, 2225-          action of clostridial neurotoxins on assembly. EMBO J. 13, 5051-5061.
  2232.                                                                             Hayashi, T., Yamasaki, S., Nauenburg, S., Binz, T. and Niemann, H.
Bennett, M. R., Gibson, W. G. and Robinson, J. (1997). Probabilistic                  (1995). Disassembly of the reconstituted synaptic vesicle membrane fusion
  secretion of quanta and the synaptosecretosome hypothesis. Evoked release           complex in vitro. EMBO J. 14, 2317-2325.
  at active zones of varicosities, boutons, and end-plates. Biophys. J. 73, 1815-   Kaelin, W. G. Jr, Krek, W., Sellers, W. R., DeCaprio, J. A., Ajchenbaum,
  1829.                                                                               F., Fuchs, C. S., Chittenden, T., Li, Y., Farnham, P. J., Blanar, M. A. et
Bennett, M. R. (1998). Neurotransmitter release at individual sympathetic             al. (1992). Expression cloning of a cDNA encoding a retinoblastoma-
  varicosities, boutons. Advan. Pharmacol. 42, 98-101.                                binding protein with E2F-like properties. Cell 70, 351-364.
Binz, T., Kurazono, H., Wille, M., Frevert, J., Wernars, K. and Niemann,            Knapp, M., Segelke, B. and Rupp, B. (1998). The 1.61 Angstrom structure
  H. (1990). The complete sequence of botulinum neurotoxin type A and                 of the tetanus toxin. Ganglioside binding region: solved by MAD and MIR
  comparison with other clostridial neurotoxins. J. Biol. Chem. 265, 9153-            phase combination. Am. Cryst. Abstract Papers 25, 90.
  9158.                                                                             Lacy, D. B., Tepp, W., Cohen, A. C., DasGupta, B. R. and Stevens, R. C.
Blasi, J., Chapman, E. R., Link, E., Binz, T., Yamasaki, S., De Camilli,              (1998). Crystal structure of botulinum neuro toxin type A and implications
  P., Südhof, T. C., Niemann, H. and Jahn, R. (1993a). Botulinum                      for toxicity. Nature Struct. Biol. 5, 898-902.
  neurotoxin A selectively cleaves the synaptic protein SNAP-25. Nature             Li, L. and Singh, B. R. (1998). Isolation of synaptotagmin as a receptor for
  365, 160-163.                                                                       type A and type E botulinum neurotoxin and analysis of their comparative
Blasi, J., Chapman, E. R., Yamasaki, S., Binz, T., Niemann, H. and Jahn,              binding using a new microtiter plate assay. J. Nat. Toxins 7, 215-226.
  R. (1993b). Botulinum neurotoxin C1 blocks neurotransmitter release by            Makoff, A. J., Oxer, M. D., Romanos, M. A., Fairweather, N. F. and
  means of cleaving HPC-1/syntaxin. EMBO J. 12, 4821-4828.                            Ballantine, S. (1989). Expression of tetanus toxin fragment C in E. coli:
Brain, K. L., Cottee, L. J. and Bennett, M. R. (1997). Varicosities of single         high level expression by removing rare codons. Nucl. Acids Res. 17, 10191-
  sympathetic-nerve terminals possess syntaxin zones and different                    10202.
  synaptotagmin N terminus labeling following stimulation. J. Neurocytol. 26,       Matteoli, M., Takei, K., Perin, M. S., Südhof, T. C. and De Camilli, P.
  491-500.                                                                            (1992). Exo-endocytotic recycling of synaptic vesicles in developing
Daniels-Holgate, P. U. and Dolly, J. O. (1996). Productive and non-                   processes of cultured hippocampal neurons. J. Cell Biol. 117, 849-861.
  productive binding of botulinum neurotoxin A to motor nerve endings are           Matteoli, M., Verderio, C., Rossetto, O., Iezzi, N., Coco, S., Schiavo, G.
  distinguished by its heavy chain. J. Neurosci. Res. 44, 263-271.                    and Montecucco, M. (1996). Synaptic vesicles endocytosis mediates the
Dreyer, F. and Schmitt, A. (1981). Different effects of botulinum A toxin and         entry of tetanus neurotoxin into hippocampal neuron. Proc. Nat. Acad. Sci.
  tetanus toxin on the transmitter releasing process at the mammalian                 USA 93, 13310-13315.
  neuromuscular junction. Neurosci. Lett. 26, 307-311.                              Minton, N. P. (1995). Molecular genetics of clostridial neurotoxins. Curr. Top.
Edelmann, L., Hanson, P. I., Chapman, E. R. and Jahn, R. (1995).                      Microbiol. Immunol. 195, 161-194.
  Synaptobrevin binding to synaptophysin: a potential mechanism for                 Montecucco, C. (1986). How do tetanus and botulinum toxins bind to
  controlling the exocytotic fusion machine. EMBO J. 14, 224-231.                     neuronal membranes? Trends Biochem. Sci. 11, 315-317.
Evans, D. M., Williams, R. S., Shone, C. C., Hambleton, P., Melling, J. and         Montecucco, C. and Schiavo, G. (1993). Tetanus and botulism neurotoxins:
  Dolly, J. O. (1986). Botulinum neurotoxin type B. Its purification,                  a new group of zinc proteases. Trends Biochem. Sci. 18, 324-327.
  radioiodination and interaction with rat-brain synaptosomal membranes.            Niman, H. L., Houghten, R. A., Walker, L. E., Reisfeld, R. A., Wilson, I.
  Eur. J. Biochem. 154, 409-416.                                                      A., Hogle, J. M. and Lerner, R. A. (1983). Generation of protein-reactive
Fach, P., Gibert, M., Griffais, R., Guillou, J. P. and Popoff, M. R. (1995).          antibodies by short peptides is an event of high frequency: implications for
  PCR and gene probe identification of botulinum neurotoxin A-, B-, E-, F-,            the structural basis of immune recognition. Proc. Nat. Acad. Sci. USA 80,
  and G-producing Clostridium spp. and evaluation in food samples. Appl.              4949-4953.
  Env. Microbiol. 61, 389-392.                                                      Nishiki, T., Kamata, Y., Nemoto, Y., Omori, A., Ito, T., Takahashi, M. and
Fitzgerald, S. C. (1989). A Dissection and Tissue Culture Manual of the               Kozaki, S. (1994). Identification of protein receptor for Clostridium
  Nervous System. New York: Alan R. Liss Inc.                                         botulinum type B neurotoxin in rat brain synaptosomes. J. Biol. Chem. 269,
Foran, P., Lawrence, G. W., Shone, C. C., Foster, K. A. and Dolly, J. O.              10498-10503.
  (1996). Botulinum neurotoxin C1 cleaves both syntaxin and SNAP-25 in              Nishiki, T., Tokuyama, Y., Kamata, Y., Nemoto, Y., Yoshida, A., Sato, K.,
2724 G. Lalli and others

  Sekiguchi, M., Takahashi, M. and Kozaki, S. (1996a). The high-affinity           Escherichia coli does not reflect selection for ‘rare’ codons. Nucl. Acids Res.
  binding of Clostridium botulinum type B neurotoxin to synaptotagmin II           14, 7737-7749.
  associated with gangliosides GT1b/GD1a. FEBS Lett. 378, 253-257.               Simpson, L. L. (1980). Kinetic studies on the interaction between botulinum
Nishiki, T., Tokuyama, Y., Kamata, Y., Nemoto, Y., Yoshida, A., Sekiguchi,         toxin type A and the cholinergic neuromuscular junction. J. Pharmacol. Exp.
  M., Takahashi, M. and Kozaki, S. (1996b). Binding of botulinum type B            Ther. 212, 16-21.
  neurotoxin to Chinese hamster ovary cells transfected with rat                 Simpson, L. L. (1984a). The binding fragment from tetanus toxin antagonizes
  synaptotagmin II cDNA. Neurosci. Lett. 208, 105-108.                             the neuromuscular blocking actions of botulinum toxin. J. Pharmacol. Exp.
Osen Sand, A., Catsicas, M., Staple, J. K., Jones, K. A., Ayala, G.,               Ther. 229, 182-187.
  Knowles, J., Grenningloh, G. and Catsicas, S. (1993). Inhibition of axonal     Simpson, L. L. (1984b). Fragment C of tetanus toxin antagonizes the
  growth by SNAP-25 antisense oligonucleotides in vitro and in vivo. Nature        neuromuscular blocking properties of native tetanus toxin. J. Pharmacol.
  364, 445-448.                                                                    Exp. Ther. 228, 600-604.
Osen Sand, A., Staple, J. K., Naldi, E., Schiavo, G., Rossetto, O.,              Simpson, L. L. (1985). Pharmacological experiments on the binding and
  Petitpierre, S., Malgaroli, A., Montecucco, C. and Catsicas, S. (1996).          internalization of the 50,000 dalton carboxy terminus of tetanus toxin at
  Common and distinct fusion proteins in axonal growth and transmitter             the cholinergic neuromuscular junction. J. Pharmacol. Exp. Ther. 234,
  release. J. Comp. Neurol. 367, 222-234.                                          100-105.
Ransom, B. R., Neale, E., Henkart, M., Bullock, P. N. and Nelson, P. G.          Soldati, T. and Perriard, J.-C. (1991). Intracompartimental sorting of
  (1977). Mouse spinal cord in cell colture. I. Morphology and intrinsic           essential myosin light chains: molecular dissection and in vivo monitoring
  neuronal electrophysiological properties. J. Neurophysiol. 40, 1132-             by epitope tagging. Cell 66, 277-289.
  1150.                                                                          Söllner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H.,
Robinson, L. J. and Martin, T. F. J. (1998). Docking and fusion in                 Geromanos, S., Tempst, P. and Rothman, J. E. (1993). SNAP receptors
  neurosecretion. Curr. Opin. Cell Biol. 10, 483-492.                              implicated in vesicle targeting and fusion. Nature 362, 318-324.
Rossetto, O., Schiavo, G., Polverino de Laureto, P., Fabbiani, S. and            Sutton, R. B., Fasshauer, D., Jahn, R. and Brunger, A. T. (1998). Crystal-
  Montecucco, C. (1992). Surface topography of histidine residues of tetanus       structure of a SNARE complex involved in synaptic exocytosis at 2.4
  toxin probed by immobilized-metal-ion affinity chromatography. Biochem.          angstrom resolution. Nature 395, 347-353.
  J. 285, 9-12.                                                                  Thomas, C. L., Steel, J., Prestwich, G. D. and Schiavo, G. (1999).
Schengrund, C.-L., DasGupta, B. R. and Ringler, N. J. (1991). Binding of           Generation of phosphatidylinositol-specific antibodies and their
  botulinum and tetanus neurotoxins to ganglioside GT1b and derivatives            characterisation. Biochem. Soc. Transact. 27, 32-36.
  thereof. J. Neurochem. 57, 1024-1032.                                          Umland, T. C., Wingert, L. M., Swaminathan, S., Furey, W. F., Schmidt,
Schiavo, G., Benfenati, F., Poulain, B., Rossetto, O., Polverino de Laureto,       J. J. and Sax, M. (1997). Structure of the receptor binding fragment Hc of
  P., DasGupta, B. R. and Montecucco, C. (1992). Tetanus and botulinum             tetanus toxin. Nature Struct. Biol. 4, 788-792.
  B neurotoxins block neurotransmitter release by proteolytic cleavage of        Vaidyanathan, V. V., Yoshino, K., Jahnz, M., Dorries, C., Bade, S.,
  synaptobrevin. Nature 359, 832-835.                                              Nauenburg, S., Niemann, H. and Binz, T. (1999). Proteolysis of SNAP-
Schiavo, G., Rossetto, O., Catsicas, S., Polverino de Laureto, P., DasGupta,       25 isoforms by botulinum neurotoxin types A, C, and E: Domains and amino
  B. R., Benfenati, F. and Montecucco, C. (1993a). Identification of the            acid residues controlling the formation of enzyme-substrate complexes and
  nerve terminal targets of botulinum neurotoxin serotypes A, D, and E. J.         cleavage. J. Neurochem. 72, 327-337.
  Biol. Chem. 268, 23784-23787.                                                  Weber, T., Zemelman, B. V., McNew, J. A., Westermann, B., Gmachl, M.
Schiavo, G., Santucci, A., Dasgupta, B. R., Mehta, P. P., Jontes, J.,              J., Parlati, F., Söllner, T. H. and Rothman, J. E. (1998). SNAREpins:
  Benfenati, F., Wilson, M. C. and Montecucco, C. (1993b). Botulinum               minimal machinery for membrane fusion. Cell 92, 759-772.
  neurotoxins serotypes A and E cleave SNAP-25 at distinct COOH-terminal         Whelan, S. M., Elmore, M. J., Bodsworth, N. J., Atkinson, T. and Minton,
  peptide bonds. FEBS Lett. 335, 99-103.                                           N. P. (1992). The complete amino acid sequence of the Clostridium
Schiavo, G., Shone, C. C., Rossetto, O., Alexander, F. C. and Montecucco,          botulinum type E neurotoxin deduced by nucleotide sequence analysis of
  C. (1993c). Botulinum neurotoxin serotype F is a zinc endopeptidase              the encoding gene. Eur. J. Biochem. 204, 657-667.
  specific for VAMP/synaptobrevin. J. Biol. Chem. 268, 11516-11519.               Williamson, L. C., Halpern, J. L., Montecucco, C., Brown, J. E. and Neale,
Schiavo, G., Malizio, C., Trimble, W. S., Polverino de Laureto, P., Milan,         E. A. (1996). Clostridial neurotoxins and substrate proteolysis in intact
  G., Sugiyama, H., Johnson, E. A. and Montecucco, C. (1994). Botulinum            neurons: botulinum neurotoxin C acts on synaptosomal-associated protein
  G neurotoxin cleaves VAMP/synaptobrevin at a single Ala-Ala peptide              of 25 kDa. J. Biol. Chem. 271, 7694-7699.
  bond. J. Biol. Chem. 269, 20213-20216.                                         Wohlfarth, K., Goschel, H., Frevert, J., Dengler, R. and Bigalke, H. (1997).
Schiavo, G. and Montecucco, C. (1995). Tetanus and botulism neurotoxins:           Botulinum A toxins: units versus units. Naunyn Schmiedebergs Arch.
  isolation and assay. Meth. Enzymol. 248, 643-652.                                Pharmacol. 355, 335-340.
Schiavo, G., Shone, C. C., Bennett, M. K., Scheller, R. H. and Montecucco,       Yamasaki, S., Baumeister, A., Binz, T., Blasi, J., Link, E., Cornille, F.,
  C. (1995). Botulinum neurotoxin type C cleaves a single Lys-Ala bond             Roques, B., Fykse, E. M., Südhof, T. C., Jahn, R. et al. (1994a). Cleavage
  within the carboxyl-terminal region of syntaxins. J. Biol. Chem. 270, 10566-     of members of the synaptobrevin/VAMP family by types D and F botulinal
  10570.                                                                           neurotoxins and tetanus toxin. J. Biol. Chem. 269, 12764-12772.
Schiavo, G. and Montecucco, M. (1997). Clostridial neurotoxins. In Bacterial     Yamasaki, S., Binz, T., Hayashi, T., Szabo, E., Yamasaki, N., Eklund, M.,
  Toxins. Tools in Cell Biology and Pharmacology (ed. K. Aktories), pp. 169-       Jahn, R. and Niemann, H. (1994b). Botulinum neurotoxin type G
  186. London: Chapman & Hall.                                                     proteolyses the Ala81-Ala82 bond of rat synaptobrevin 2. Biochem. Biophys.
Schiavo, G., Osborne, S. L. and Sgouros, J. G. (1998). Synaptotagmins:             Res. Commun. 200, 829-835.
  more isoforms than functions. Biochem. Biophys. Res. Commun. 248, 1-8.         Yamasaki, S., Hu, Y., Binz, T., Kalkuhl, A., Kurazono, H., Tamura, T.,
Schmitt, A., Dreyer, F. and John, C. (1981). At least three sequential steps       Jahn, R., Kandel, E. and Niemann, H. (1994c). Synaptobrevin/vesicle-
  are involved in the tetanus toxin-induced block of neuromuscular                 associated membrane protein (VAMP) of Aplysia californica: structure and
  transmission. Naunyn Schmiedebergs Arch. Pharmacol. 317, 326-330.                proteolysis by tetanus toxin and botulinal neurotoxins type D and F. Proc.
Sharp, P. M. and Li, W. H. (1986). Codon usage in regulatory genes in              Nat. Acad. Sci. USA 91, 4688-4692.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:34
posted:5/8/2011
language:English
pages:10
hkksew3563rd hkksew3563rd http://
About