and Moderate Hypothyroidism A Premature Stopcodon in Thyroglobulin by hkksew3563rd

VIEWS: 2 PAGES: 7

									A Premature Stopcodon in Thyroglobulin Messenger RNA Results in Familial Goiter
                        and Moderate Hypothyroidism
Simone A. R. van de Graaf, Carrie Ris-Stalpers, Geertruda J. M. Veenboer, Marianne Cammenga, Cécilia Santos, Héctor M.
                              Targovnik, Jan J. M. de Vijlder and Geraldo Medeiros-Neto

                        J. Clin. Endocrinol. Metab. 1999 84: 2537-2542, doi: 10.1210/jc.84.7.2537




   To subscribe to Journal of Clinical Endocrinology & Metabolism or any of the other journals published by The Endocrine
                               Society please go to: http://jcem.endojournals.org//subscriptions/




                         Copyright © The Endocrine Society. All rights reserved. Print ISSN: 0021-972X. Online
0021-972X/99/$03.00/0                                                                                                                 Vol. 84, No. 7
The Journal of Clinical Endocrinology & Metabolism                                                                                 Printed in U.S.A.
Copyright © 1999 by The Endocrine Society




A Premature Stopcodon in Thyroglobulin Messenger
RNA Results in Familial Goiter and Moderate
Hypothyroidism
SIMONE A. R. VAN DE GRAAF, CARRIE RIS-STALPERS,
                                                    ´
GEERTRUDA J. M. VEENBOER, MARIANNE CAMMENGA, CECILIA SANTOS,
HE´ CTOR M. TARGOVNIK, JAN J. M. DE VIJLDER, AND GERALDO MEDEIROS-NETO
Academic Medical Center (S.A.R.v.d.G., C.R.-S., G.J.M.V., J.J.M.d.V.), University of Amsterdam,
Emma Children’s Hospital AMC, Laboratory of Pediatric Endocrinology, Amsterdam, The
                    ´           ´                                             ´
Netherlands; Laboratorio de Tireoide (LIM-25) (C.S., G.M.-N.), Hospital das Clınicas, Universidade de
 ˆ           ˆ                                        ´                             ´         ´
Sao Paulo, Sao Paulo 01065–970, Brazil; Division Genetica (H.M.T.), Hospital de Clınicas “Jose de
                                         ´              ´            ´
San Martin”, Facultad de Medicina and Catedra de Genetica y Biologıa Molecular, Facultad de
                 ´
Farmacia y Bioquımica, Universidad de Buenos Aires, 1120, Buenos Aires, Argentina


ABSTRACT                                                                 expressed in rabbit reticulocyte lysate resulting in a truncated protein
   Impaired thyroglobulin (Tg) synthesis is one of the putative causes   of 30 kDa. Expression in the presence of microsomal membranes
for dyshormonogenesis of the thyroid gland. This type of hypothy-        resulted in a gel shift of this Tg molecule, indicating glycosylation
roidism is characterized by intact iodide trapping, normal organifi-     ability. Two other siblings had a clinical presentation like the index
cation of iodide, and usually low serum Tg levels in relation to high    patient, while their parents were unaffected. Additional restriction
TSH, and when untreated the patients develop goiter. In thyroid          fragment length polymorphism analysis of the pedigree verified that
tissue from a 13-yr-old patient suspected of a thyroglobulin synthesis   the homozygous nonsense mutation cosegregated with the clinical
defect, the Tg mRNA was studied. The complete coding region of 8307      phenotype. Clinically, hypothyroidism was not severe in the affected
bp was directly sequenced and revealed a homozygous point mutation:      siblings because the truncated Tg glycoprotein was still capable of
a C886T transition in exon 7. Upon translation this mutation would       thyroid hormonogenesis. (J Clin Endocrinol Metab 84: 2537–2542,
result in a stopcodon at amino acid position 277, replacing the argi-    1999)
nine residue. A Tg cDNA construct containing the mutation was




P    RIMARY congenital hypothyroidism (CH) is caused by
        disorders of thyroid gland development (80%) or dy-
shormonogenesis (20%). In thyroid dyshormonogenesis a
                                                                         polymorphisms have been identified in the thyroglobulin
                                                                         gene locus, of which 8 result in amino acid residue variation
                                                                         (8 –10). Furthermore, at least 12 alternative splice products
mutation is expected in one of the genes encoding a key                  have been identified in normal Tg mRNAs (10 –16). Beside
protein involved in the biosynthesis of thyroid hormones                 these wildtype variations, some mutations in the Tg gene
(1, 2).                                                                  have been identified in animal models and in man, resulting
   One of these proteins is thyroglobulin (Tg), the predom-              in aberrant Tg protein expression and linked to subsequent
inant glycoprotein (660 kDa) of the thyroid gland, which                 impaired thyroid hormone synthesis.
functions as matrix protein in thyroid hormonogenesis. Cat-                 In Afrikander cattle a homozygous nonsense mutation,
alyzed by thyroid peroxidase (TPO), tyrosine residues in the             Arg697OPA (exon 9), results in the expression of a truncated
Tg molecule are iodinated, and subsequently some specific                Tg protein of 75 kDa. In this case also, an alternatively spliced
ones are coupled to form mainly T4 and some T3 (2, 3). The               mRNA lacking exon 9 sequence is observed, encoding a Tg
human Tg gene, located on chromosome 8 (8q24.2– 8q24.3),                 protein of 250 kDa (17, 18). In Dutch goats, a homozygous
is over 300 kb and contains over 37 exons (4 – 6). We recently           nonsense mutation, Tyr296AMB, results in a truncated Tg
revised the Tg messenger RNA (mRNA) sequence that was                    protein product (40 kDa in vivo) and causes hypothyroidism
originally reported in 1987 (7). This revealed 8307 nucleo-              with goiter (19, 20). Furthermore, in a mouse model, con-
tides of coding sequence (instead of 8304), of which 66 triplets         genital goiter (cog/cog) is linked to the Tg locus (21), and the
(instead of 67) encode a tyrosine residue (8). Until now, 19             mutation has recently been identified as Leu2366Pro (22).
                                                                            So far in only three patients with congenital hypothyroid-
                                                                         ism and goiter has a mutation in the Tg gene been elucidated.
   Received December 30, 1998. Revised March 25, 1999. Accepted April
8, 1999.                                                                 A homozygous mutation at the acceptor splice site of intron
   Address all correspondence and requests for reprints: Simone A.R.     3 results in the in-frame deletion of exon 4 sequences (nt 275
van de Graaf, Academic Medical Center G2–123, Laboratory of Pediatric    - 478) from the mRNA, which results in an aberrant Tg
Endocrinology, PO Box 22700, 1100 DE, Amsterdam, The Netherlands,        protein lacking hormonogenic site Tyr130 (15). A homozy-
Fax: **31.20.6916396, e-mail: S.A.vandeGraaf@amc.uva.nl.
   This work was supported in part by the Ludgardine Bouwman Foun-
                                                                         gous in-frame mRNA deletion is described of 138 bp (nt
dation (The Netherlands) and by Grant 96/00998 from the Sao Paulo
                                                            ˆ            5552–5789)(23). The preferential accumulation of a Tg mRNA
State (Brazil) Research Foundation (FAPESP).                             alternative splice product with an in-frame deletion of 171 bp

                                                                     2537
2538                                                              VAN DE GRAAF                                                            JCE & M • 1999
                                                                                                                                            Vol 84 • No 7


(nt 4529 – 4699, exon 22) has also been reported, linked to a                 cells and follicular lumen devoid of colloid. Immunostaining for Tg
homozygous nonsense mutation at position 1510 (13).                           indicated the presence of Tg-related antigens only inside the cells.
  In the present study, we have identified a homozygous
nonsense mutation in the thyroglobulin mRNA of a mod-                         RNA isolation and complementary DNA (cDNA)
erately hypothyroid patient with goiter.                                      preparation, genomic DNA isolation
                                                                                 Total RNA was isolated from goitrous (patient IV-6) and control
                                                                              thyroid tissue using TRIzol®Reagent (Life Technologies BV). cDNA was
                     Materials and Methods                                    synthesized using random hexamers and reverse transcriptase accord-
Patients                                                                      ing to standard procedures.
                                                                                 Genomic DNA of patient IV-6 was isolated from one of the TRIzol
    Figure 1 shows the pedigree of a Brazilian family with goiter in three    fractions, and genomic DNA of the indicated family members was
affected siblings (Table 1).                                                  isolated from white blood cells by the SDS-proteinase K method (24).
    Patient IV-2: female, first examined at the age of 17. She developed
normally and had menarche at 15 yr of age. Her height was 149 cm, and         DNA amplification
her weight 43.5 kg. The thyroid gland was diffusely enlarged (65 g;
normal: 7.4 2.2 g), and ultrasonography indicated a nodule of 15 mm              PCR amplification (25) was performed using 100 ng cDNA as tem-
in the left lobe with micro-calcifications. She has two unaffected children   plate in a total reaction volume of 25 L.
(V-1, V-2) from a consanguineous marriage.                                       For nucleotide sequencing, fragments of 500 bp (with 20 –70 bp over-
    Patient IV-6 (index patient): male, first examined at the age of 13. At   lap) were amplified with 2.5 units of AmpliTaq DNA polymerase (Per-
presentation, he showed clinical signs of hypothyroidism and stunted          kin Elmer) using the protocol: 2 min 94 C; 35 cycles of 15 sec 94 C, 1 min
growth (bone age, 7 yr). His mental function was normal. The thyroid          60 C, 1 min 72 C; 10 min 72 C. The human Tg specific oligonucleotides
gland was diffusely enlarged (60 g; normal: 7.4          2.2 g), and ultra-   (synthesized on Expedite Nucleic Acid Synthesis System, Millipore
sonography indicated a nodule of 13 mm in the right lobe.                     Corp.) coupled to M13 tags are already described (10). Reactions were
    Patient IV-10: male, first examined at the age of 2. He developed         electrophoresed on 0.8 agarose gel and purified using the Quiaquick
slowly and showed retarded growth (bone age, 3 months). His mental            DNA gel extraction kit (Quiagen).
function appeared to be normal. Ultrasonography of the thyroid gland             For determination of alternative splice products, a cDNA fragment
indicated a diffuse heterogeneous goiter of 13.5 g (normal: 4.1 1.1 g).       ranging from exon 4 to exon 9 (nt 400-1350) was amplified with 2.5 units
    Patients IV-2 and IV-6 were subjected to subtotal thyroidectomy to        of AmpliTaq DNA polymerase (Perkin Elmer) using the protocol: 2 min
correct compressive symptoms and have received total thyroxine sup-           94 C; 35 cycles of 15 sec 94 C, 1 min 57 C, 1.5 min 72 C; 10 min 72 C. M13
plementation since that time.                                                 linked oligonucleotides 2F (nt 400) and 3R (nt 1350) were used (10).
    Both anti-TPO and anti-Tg antibody tests were repeatedly negative            For subcloning purposes, the same conditions and oligonucleotides
in all three patients. No data were available on iodine intake and urinary    were used.
secretion.                                                                       For restriction fragment length polymorphism (RFLP) analysis,
    Microscopic examination of the goitrous tissue revealed the classic       genomic DNA was amplified using the protocol: 5 min 95 C; 35 cycles
macro-follicular pattern, with dilated follicles lined with high columnar     of 1 min 95 C, 1 min 57 C, 1.5 min 72 C; 10 min 72 C, 2.5 units of AmpliTaq




FIG. 1. Family pedigree of index pa-
tient.
                                    PREMATURE STOP IN Tg mRNA IN A GOITROUS PATIENT                                                               2539

TABLE 1. Clinical and laboratory data from the affected siblings

      No           Year of birth    TT4 nmol/L      TT3 nmol/L      TSh mU/L         Serum Tg g/L: basal/48 ha          % RAI uptake: at 2 h/at 24 hb
IV-2                   1970            82.3             2.6            13                      1.5/1.6                             55/54
IV-6                   1976            38.6             1.5           112                      3.5/4.0                             54/71
IV-10                  1985            25.7             1.2            96                      2.8/5.6                              8/35
Normal range                          70 –160         1.1–3.1           4.5               12   6.5/34    16
  a
    Serum Tg levels: basal and 48 h after 10 IU of bovine TSH im (mean and SD from ref. 27).
  b
    Administration of perchlorate in radioactive iodide uptake studies (RAI) had no effect in any of the siblings.


DNA polymerase (Perkin Elmer), and the following oligonucleotides:            Tg (26) coupled to protein A-sepharose CL-4B (Pharmacia Biotech) and
(794) 5 TGGACCTTCCTTCCACCTTCACTG 3 and (1002) 5 CCTTC-                        were analyzed identically.
CGTCTGGCACTGCA 3 .
                                                                              Restriction fragment length polymorphism analysis
Nucleotide sequence analysis
                                                                                  The mutation detected by nucleotide sequencing at position 886 cre-
   DNA amplification resulted in 20 fragments of approximately 500 bp         ated an AlwN I recognition site. This enzyme was used according to the
covering the entire thyroglobulin cDNA of patient IV-6.                       manufacturers protocol to screen for the presence of the mutation in the
   Both the sense and antisense strand were sequenced using either the        amplified genomic DNA Tg fragment of the indicated family members
M13 tags linked to the PCR fragments with the Big Dye Primer Cycle            (III-1, III-2, IV-6, IV-10, IV-2, V-1, V-2) and of a wildtype control. The
Sequencing Kit or the Tg-specific oligonucleotides with the Big               samples were run on 2.5% agarose gel and stained with ethidium
Dyedeoxyterminator Cycle Sequencing Kit, depending on the GC con-             bromide.
tent of the fragment (both kits from PE Applied Biosystems/Perkin
Elmer). After electrophoresis on a sequencing gel, the samples were
analyzed on the ABI Prism 377 DNA sequencer and aligned to the Tg                                             Results
cDNA sequence (8, 10) using AutoAssembler software (PE Applied                   The index patient (IV-6), suspected of having a defect in
Biosystems/Perkin Elmer).
                                                                              thyroglobulin synthesis as a cause for hypothyroidism, was
Determination of alternative splice products                                  subjected to subtotal thyroidectomy, and thyroid tissue was
                                                                              available to screen for Tg mutations. RT-PCR was performed
   The coding region of nt 400-1350 (exon 4 –9) was amplified on mRNA
                                                                              on the total RNA isolated from this tissue, resulting in 20
of patient IV-6 and of wildtype, and the reactions were run on a 1.2%
agarose gel stained with ethidium bromide.                                    overlapping fragments of 500 bp each, covering the total
                                                                              coding region of 8307 bp. Direct sequencing revealed a cy-
Subcloning of mutated Tg fragment                                             tosine-to-thymidine mutation at nt position 886 (Fig. 2A). Its
                                                                              position in the gene near the end of exon 7 is schematically
   The TGI construct (8) containing wildtype Tg nucleotides 6 to 2110
in the pcDNA3 plasmid (TG-WT) was restricted with Bsu36 I, thereby            given in Fig. 2B, and the supposed amino acid sequence after
deleting the wildtype sequence from nt 686-1137, and purified from a          translation is also shown. Instead of encoding for an arginine
0.8% agarose gel. The amplified product of 950 bp, containing the mu-         residue on position 277, the triplet harboring the mutation
tation at nt position 886 was also restricted with Bsu36 I. The mutant        encodes a stopcodon.
fragment of 451 bp was purified from a 1.2% agarose gel and ligated into
the digested TG-WT resulting in TG-M. By automatic sequencing using              Because the C886T transition induces a AlwN I restriction
Tg specific primers, the nt sequence was validated.                           site, carriership for the mutation could be established using
   The protocols used for digesting with Bsu36 I (Biolabs) and for li-        RFLP analysis. Therefore a fragment ranging from exon 7 to
gation with T4 ligase (Boehringer Mannheim; rapid DNA ligation kit)           8 (including intron 7 of 200 bp) was amplified on genomic
were according to the manufacturer. For gel purification, the Quiaquick
                                                                              DNA, isolated from blood of different family members: III-1,
DNA gel extraction kit (Quiagen) was used. Standard heat shock trans-
formation was performed with DH5 competent cells (Gibco BRL).                 III-2, IV-6 (index patient), IV-10, IV-2, V-1, and V-2 (Fig. 1).
                                                                              The wildtype amplified fragment of 400 bp was not digest-
Expression of Tg in rabbit reticulocyte lysate and analysis                   ible by AlwN I. The AlwN I digestion of the mutated frag-
                                                                              ment resulted in two fragments of about 300 and 100 bp (Fig.
    For in vitro transcription and translation a TnT® T7 Coupled Reticu-
locyte Lysate System was used (Promega Corp.), providing rabbit re-           2C). All affected siblings (IV-6, -10, -2) showed two fragments
ticulocyte lysate, a reaction buffer, T7 RNA polymerase, and an amino         after digestion (300 and 100 bp) and are homozygous for the
acid mixture lacking cysteine. Reactions of 25 L were done, adding            mutation. Both parents (III-1, -2) and the youngest offspring
Rnasin® Ribonuclease Inhibitor (Promega Corp.), a mixture of 35S-me-          (V-1, -2) showed three fragments after digestion (400, 300,
thionine and 35S-cysteine (ICN Pharmaceuticals, Inc.; Tran35S-label). To
obtain glycosylation, Canine Pancreatic Microsomal Membranes                  and 100 bp) and are heterozygous (carriers).
(CPMM) (Promega Corp.) were added. In each reaction 300 ng plasmid               To determine whether the nonsense mutation caused al-
DNA was used as template (TG-WT or TG-M or positive control). Pos-            ternative splicing of exon 7, a cDNA fragment ranging from
itive control 1 was used to check for expression of a protein of 61 kDa       exon 4 to 9 was amplified from mRNA of patient IV-6 and
mol wt. Control sample 2 was used to check for glycosylation. Incubation
                                                                              a wildtype control (data not shown). No difference in either
was done at 30 C for 90 min.
    Aliquots of 5 L (minus CPMM) or 10 L (plus CPMM) of reticulocyte          splicing or abundance of the amplified product was detected.
lysate reactions, together with a molecular weight marker (Biolabs;              The mutation was expected to result in a truncated Tg
Rainbow general), were subjected to SDS-PAGE according to Laemmli’s           molecule upon translation, still harboring putative N-glyco-
method (17.5%), and the gel was dried afterwards. The radioactive signal      sylation sites. To examine translation and putative glycosyl-
of expressed proteins was detected using a Phosphorimager and Image
Quant software (Molecular Dynamics, Inc.).                                    ation in relation to the mutation, a cell-free in vitro transcrip-
    Protein products from 40 L reticulocyte lysate reactions, were im-        tion/translation system (rabbit reticulocyte lysate T7 RNA
munoprecipitated using a rabbit polyclonal antibody specific for human        polymerase) was used in which glycosylation conditions
2540                                                          VAN DE GRAAF                                                        JCE & M • 1999
                                                                                                                                    Vol 84 • No 7




FIG. 2. Screening for mutation in Tg mRNA. A, Part of wildtype and mutated (patient IV-6) thyroglobulin mRNA sequence. The arrow points
to the homozygous C886T transition. B, Schematic drawing of thyroglobulin mRNA. Top: coding region from nt 1– 8307 (italics) appears as an
open box, 5 and 3 untranslated regions are indicated as solid lines. Middle: part of the Tg gene showing exon 7 and exon 8 (introns as dashed
lines). Bottom: coding nt sequences and corresponding aa sequences are shown (AlwN I recognition site is underlined). C, Agarose electrophoresis
and ethidium bromide visualization of AlwN I RFLP analysis. Shown are the mol wt marker lane (bp), wildtype control plus or minus AlwN
I, respectively, and the PCR amplified genomic DNA fragment (exon 7 - 8) of several family members after digestion. The open arrow indicates
undigested wildtype fragment, and the filled arrows indicate mutant fragments resulting from AlwN I digestion.
                                  PREMATURE STOP IN Tg mRNA IN A GOITROUS PATIENT                                                2541

                                                                       Mendelian pattern of inheritance of an autosomal recessive
                                                                       mutation. The affected family members all showed goiter
                                                                       with moderate hypothyroidism. Serum Tg levels were rel-
                                                                       atively low despite the high serum TSH levels and did not
                                                                       increase after exogenous bovine TSH stimulation (27). The
                                                                       absence of an iodide organification defect was based on the
                                                                       results of the radioactive iodide uptake studies (RAI): a high
                                                                       and rapid uptake and no iodide washout effect by admin-
                                                                       istered perchlorate ions (Table 1). These characteristics in-
                                                                       dicated a defect in thyroglobulin synthesis.
                                                                          After sequencing the total Tg cDNA of patient IV-6, a
                                                                       homozygous nonsense mutation was determined, which re-
                                                                       sulted in an AlwN I recognition site (Fig. 2). RFLP analysis
                                                                       demonstrated that both parents were heterozygous for this
                                                                       mutation and that all three affected siblings carried the same
                                                                       mutated Tg alleles. The mutation is a cytosine-to-thymidine
                                                                       transition at nt position 886 in exon 7, creating a stopcodon
                                                                       at amino acid Arg277. The change occurs in a CpG dinucle-
                                                                       otide and can be caused by deamination of a methylated
                                                                       cytosine to thymine (28). Furthermore, the CGA arginine
                                                                       codon is considered a “hot spot” for mutations (29).
                                                                          RNA transcripts containing a premature stopcodon may
FIG. 3. In vitro expression of wildtype and mutant Tg fragment. In-    be relatively unstable because the untranslated part of the
cubations of rabbit reticulocyte lysates with wildtype (TG-WT) or      messenger is not protected by ribosomes (13, 19). However,
mutant (TG-M) or control (provided by the kit) templates or no tem-    we have no indication that the mRNA of patient IV-6 was
plate (none) were performed with 35S-labeled amino acids. After SDS-
PAGE, proteins were visualized using the Phosphorimager. Open          very unstable because, after total RNA isolation and RT-PCR
arrows indicate wildtype Tg proteins, and filled arrows indicate mu-   amplification of 500 - 950 bp fragments, the results of normal
tant Tg proteins. Panels A and C correspond with the arrows on the     and patient’s thyroid tissues were similar with respect to the
left. In the reactions shown in panels B and D, microsomal mem-        quantity of the generated products. The amount of tissue,
branes were added to provide glycosylation (corresponding with ar-
rows on the right). Panels C and D show the electrophoresis of im-
                                                                       however, was not sufficient to perform a Northern blot.
munoprecipitated samples. The mol wt marker bands are indicated           No differences were detected in expression of the de-
(kDa).                                                                 scribed alternative transcripts (10) compared with normals
                                                                       (data not shown). After RT-PCR amplification of a fragment
                                                                       from nt 400-1350 (exon 4 to 9) no differences in product
could be established by addition of microsomal membranes               length and abundance were detected between patient and
(CPMM). For comparison two expression constructs were                  wildtype samples. This excluded an alternative splice event
used containing the first 2110 bp of coding Tg sequence:               of the Tg RNA, as is described for Afrikander cattle (17) and
wildtype (TG-WT) and mutant (TG-M). 35S-labeled me-                    human (13), where a nonsense mutation at amino acid res-
thionine and cysteine were incorporated, enabling visu-                idue 687 and residue 1510, respectively, results in a relatively
alization of the expressed protein after SDS-PAGE using                increased expression of a smaller messenger RNA species
the Phosphorimager. The apparent mol wts of the proteins               lacking the mutated exon. The specific skipping of exons
expressed from TG-WT and TG-M were respectively                        containing a nonsense mutation has also been described else-
76,000 and 30,000 (Fig. 3A). After addition of CPMM, both              where (30).
TG-WT and TG-M proteins were glycosylated, as observed                    Upon translation the mutated Tg transcript generated a Tg
by a shift in apparent molecular weight, although the                  protein, validated by immunoprecipitation with a specific
expression of the TG-WT was low (Fig. 3B). The controls                antihuman-Tg antibody, with an apparent mol wt of 30,000
1 and 2 provided by the manufacturer showed that both                  (Fig. 3). This was in good accordance with the predicted mol
translation (Fig. 3A, lane control 1) and glycosylation (Fig.          wt of 30,778 (276 amino acid residues). Three putative N-
3B, lane control 2) occurred. To validate that the expressed           linked glycosylation sites are still present in this truncated
proteins were human thyroglobulin fragments, the reac-                 protein, of which two have been shown to be glycosylated in
tion samples were immunoprecipitated with an anti-                     the mature protein (Asn57 and Asn179) (31). The use of
human-Tg polyclonal. Specific recognition of the Tg wild-              microsomal membranes in the in vitro expression assay in-
type and mutant proteins with and without glycosylation                dicated that the aberrant Tg protein could indeed be
is shown in Fig. 3C and 3D respectively.                               glycosylated.
                                                                          It has been reported that the phenotypic expression of
                           Discussion
                                                                       defective Tg protein varies considerably when different fam-
   In this paper we present the results of studies conducted           ilies or affected siblings within the same family are compared
in a family in which goiter and hypothyroidism occur. Three            (32). Although the laboratory tests were performed at a
siblings out of ten, from a consanguineous marriage, showed            younger age in patient IV-10 than in patients IV-2 and IV-6,
thyroid function abnormalities (Fig. 1), in accordance with a          it seems that the consequences of the defective Tg synthesis
2542                                                                    VAN DE GRAAF                                                                     JCE & M • 1999
                                                                                                                                                           Vol 84 • No 7


in patient IV-2 are less severe. Apparently the goiter is able                            roglobulin variant: the guanine-to-adenine transition resulting in substitution
                                                                                          of arginine 2510 by glutamine. Thyroid. 7:587–591.
to compensate for the hypothyroid status with a somewhat                            10.   van de Graaf SAR, Cammenga C, Ponne NJ, et al. 1999 The screening for
elevated TSH. Her brothers show diminished total T4 levels                                mutations in the thyroglobulin cDNA from six patients with congenital hy-
while their total T3 levels are in the normal range (Table 1).                            pothyroidism. Biochimie. 81:425– 432.
                                                                                    11.   Mason ME, Dunn D, Wortsman J, et al. 1995 Thyroids from siblings with
   Thyroid hormone synthesis involves a two-step modifi-                                  Pendred’s syndrome contain thyroglobulin messenger ribonucleic acid vari-
cation of tyrosine residues. Iodination and subsequent cou-                               ants. J Clin Endocrinol Metab. 80:497–503.
pling take place at the apical membrane of the cell, and both                       12.   Bertaux F, Noel M, Lasmoles F, Fragu P. 1995 Identification of the exon
                                                                                          structure and four alternative transcripts of the thyroglobulin-encoding gene.
reactions are catalyzed by thyroid peroxidase (2, 3). The                                 Gene. 156:297–301.
specific iodinated tyrosine residues that are involved in the                       13.   Targovnik HM, Medeiros-Neto G, Varela V, Cochaux P, Wajchenberg BL,
                                                                                          Vassart G. 1993 A nonsense mutation causes human hereditary congenital
coupling reaction can either accept (hormonogenic sites) or                               goiter with preferential production of a 171-nucleotide-deleted thyroglobulin
donate iodinated phenyl groups. The most important accep-                                 ribonucleic acid messenger. J Clin Endocrinol Metab. 77:210 –215.
tor site in all vertebrate species examined is at Tyr5, while                       14.   Targovnik HM, Cochaux P, Corach D, Vassart G. 1992 Identification of a
                                                                                          minor Tg mRNA transcript in RNA from normal and goitrous thyroids. Mol
priority for hormonogenesis at the other acceptor sites                                   Cel Endocrinol. 84:R23–R26.
Tyr1291, Tyr2554, and Tyr2747 varies among species (2). For                         15.   Ieiri T, Cochaux P, Targovnik HM, et al. 1991 A 3 splice site mutation in the
human Tg, three potential donor sites have been identified                                thyroglobulin gene responsible for congenital goiter with hypothyroidism.
                                                                                          J Clin Invest. 88:1901–1905.
so far (Tyr130, Tyr847, Tyr1488) (33). The truncated form of                        16.   Bertaux F, Noel M, Malthiery Y, Fragu P. 1991 Demonstration of a hetero-
                                                                                                                         `
Tg described here harbors both the acceptor Tyr5 and the                                  genous transcription pattern of thyroglobulin mRNA in human thyroid tis-
                                                                                          sues. Biochem Biophys Res Commun. 178:586 –592.
donor Tyr130 residues. This feature, as well as its size and                        17.   Ricketts MH, Simons MJ, Parma J, Mercken L, Dong Q, Vassart G. 1987 A
ability to become glycosylated, makes it comparable to the                                nonsense mutation causes hereditary goitre in the Afrikander cattle and un-
truncated Tg product in the goitrous Dutch goats. In these                                masks alternative splicing of thyroglobulin transcripts. Proc Natl Acad Sci
                                                                                          USA. 84:3181–3184.
animals the glycosylated Tg fragment (mol wt of 40,000) was                         18.   Tassi VPN, Di Lauro R, van Jaarsveld P, Alvino CG. 1984 Two abnormal
able to synthesize T4 in vivo, and the amounts produced were                              thyroglobulin-like polypeptides are produced from Afrikander cattle congen-
comparable to normal when 1 mg iodide/day was admin-                                      ital goiter mRNA. J Biol Chem. 259:10507–10510.
                                                                                    19.   Veenboer GJM, de Vijlder JJM. 1993 Molecular basis of the thyroglobulin
istered, although goiter remained (34). It has also been re-                              synthesis defect in Dutch goats. Endocrinology. 132:377–381.
ported that, in man, oral administration of excess iodine can                       20.   Sterk A, van Dijk JE, Veenboer GJM, Moorman AFM, de Vijlder JJM. 1989
                                                                                          Normal sized thyroglobulin mRNA in Dutch goats with a thyroglobulin syn-
partially correct the hypothyroid condition in patients with                              thesis defect is translated into a 35,000 molecular weight N-terminal fragment.
defective Tg synthesis (35). Therefore iodide administration                              Endocrinology. 124:477– 483.
may explain in part the variability in the clinical presentation                    21.   Taylor BA, Rowe L. 1987 The congenital goiter mutation is linked to the
                                                                                          thyroglobulin gene in the mouse. Proc Natl Acad Sci USA. 84:1986 –1990.
of the affected individuals within this family.                                     22.   Kim PS, Hossain SA, Park YN, Lee I, Yoo SE, Arvan P. 1998 A single amino
   In conclusion, molecular analysis of a family with hered-                              acid change in the acetylcholesterase-like domain of thyroglobulin causes
itary hypothyroidism and goiter reveals a novel autosomal                                 congenital goiter with hypothyroidism in the cog/cog mouse - a model of
                                                                                          human endoplasmatic storage diseases. Proc Natl Acad Sci USA. 95:9909 –9913.
recessive mutation in the thyroglobulin gene. The mutation                          23.   Targovnik HM, Vono J, Billerbeck AEC, et al. 1995 A 138-nucleotide-deletion
is a C-to-T transition at nt position 886 in exon 7, creating a                           in the thyroglobulin ribonucleic acid messenger in a congenital goiter with
                                                                                          defective thyroglobulin synthesis. J Clin Endocrinol Metab. 80:3356 –3360.
stopcodon at amino acid Arg277. The expressed truncated Tg                          24.   Sambrook J, Fritsch EF, Maniatis T. 1989 Molecular cloning-a laboratory
protein has a mol wt of 30,778, can be glycosylated, and is still                         manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory.
able to produce thyroid hormone.                                                    25.   Saiki RK, Gelfland DH, Stoffel S, et al. 1988 Primer-directed enzymatic
                                                                                          amplification of DNA with a thermostable DNA polymerase. Science.
                                                                                          239:487– 491.
                         Acknowledgments                                            26.   Den Hartog MT, de Boer M, Veenboer GJM, de Vijlder JJM. 1990 Generation
                                                                                          and characterization of monoclonal antibodies directed against noniodinated
  We thank J. Vono, M.D., for the clinical work on this family.                           and iodinated thyroglobulin, among which are antibodies against hormono-
                                                                                          genic sites. Endocrinology. 127:3160 –3165.
                               References                                           27.   Medeiros-Neto G, Marcondes JA, Cavaliere H, Wajchenberg BL, Knobel M.
                                                                                          1985 Serum thyroglobulin (Tg) stimulation with bovine TSH: an useful test for
1. de Vijlder JJM, Vulsma T. 1996 Hereditary metabolic disorders causing hy-              diagnosis of congenital goitrous hypothyroidism due to defective Tg synthesis.
   pothyroidism. In: Braverman LE, Utiger RD, eds. Werner’s & Ingbar’s The                Acta Endocrinol (Copenh). 110:61– 65.
   Thyroid. Philadelphia: J.B. Lippincott Company; 749 –755.                        28.   Coulondre C, Miller JH, Farabaugh PJ, Gilbert W. 1978 Molecular basis of
2. Dunn JT. 1996 Thyroglobulin: chemistry and biosynthesis. In: Braverman LE,             base substitution hotspots in Escherichia coli. Nature. 274:775–780.
   Utiger RD, eds. Werner’s & Ingbar’s The Thyroid. Philadelphia: J.B. Lippincott   29.   Antonarakis SE, Kazazian HH. 1988 The molecular basis of hemophilia A in
   Company; 85–95.                                                                        man. Trends Genet. 4:233–237.
3. de Vijlder JJM, den Hartog MT. 1997 Anionic iodotyrosine residues are            30.   Dietz HC, Valle D, Francomano CA, Kendzior RJ, Pyeritz RE, Cutting GR.
   required for iodothyronine synthesis. Eur J Endocrinol. 138:227–231.                   1993 The skipping of constitutive exons in vivo induced by nonsense mutations.
4. Baas F, Bikker H, Geurts van Kessel A, et al. 1985 The human thyroglobulin             Science. 259:680 – 683.
   gene: a polymorphic marker localized distal to c-myc on chromosome 8 band        31.   Yang S-X, Pollock HG, Rawitch AB. 1996 Glycosylation in human thyroglob-
   q24. Hum Genet. 69:138 –145.                                                           ulin: location of the N-linked oligosaccharide units and comparison with
5. Berge-Lefranc JL, Cartouzou G, Mattei MG, Passage E, Malezet-Desmoulins
         ´                                                                                bovine thyroglobulin. Arch Biochem Biophys. 327:61–70.
   C, Lissitzky S. 1985 Localization of the thyroglobulin gene by in situ hybrid-   32.   Medeiros-Neto G, Targovnik HM, Vassart G. 1993 Defective thyroglobulin
   ization to human chromosomes. Hum Genet. 69:28 –31.                                    synthesis and secretion causing goiter and hypothyroidism. Endocr Rev.
6. Baas F, van Ommen GJ, Bikker H, Arnberg AC, de Vijlder JJM. 1986 The                   14:165–183.
   human thyroglobulin gene is over 300 kb long and contains introns of up to       33.   Lamas L, Anderson PC, Fox JW, Dunn JT. 1989 Consensus sequences for early
   64 kb. Nucleic Acids Res. 14:5171–5186.                                                iodination and hormonogenesis in human thyroglobulin. J Biol Chem.
7. Malthiery Y, Lissitzky S. 1987 The primary structure of human thyroglobulin
           `                                                                              264:13541–13545.
   deduced from the sequence of its 8448 base complementary DNA. Eur J Bio-         34.   de Vijlder JJM, van Voorthuizen WF, van Dijk JE, et al. 1978 Hereditary
   chem. 165:491– 498.                                                                    congenital goiter with thyroglobulin deficiency in a breed of goats. Endocri-
8. van de Graaf SAR, Pauws E, de Vijlder JJM, Ris-Stalpers C. 1997 The revised            nology. 102:2105–2111.
   8307 base pair coding sequence of human thyroglobulin transiently expressed      35.   Vono J, Lima N, Knobel M, Medeiros-Neto GA. 1996 The effect of oral
   in eukaryotic cells. Eur J Endocrinol. 136:508 –515.                                   administration of iodine to patients with goiter and hypothyroidism due to
9. Mendive FM, Vassart G, Targovnik HM. 1997 Identification of a new thy-                 defective synthesis of thyroglobulin. Thyroid. 6:11–15.

								
To top