Goldstein

Document Sample
Goldstein Powered By Docstoc
					Haplotype mapping in pharmacogenetics


 1. The identification of tagging SNPs in ADME
    genes
 2. An application of haplotype tagging




                    What is a tagging SNP
                          anyway?


Haplotype
   1        C   C       T   T    T   A   C   C   C    T     T     C
   2        C   C       T   T    T   A   C   C   C    T     A     A
   3        C   G       T   T    A   G   C   G   C    T     T     C
   4        T   C       T   T    T   A   C   C   G    T     T     C
   5        T   C       A   A    A   G   G   G   G    A     T     C




                Haplotype
                    1        C   C   T   T   T
                    2        C   C   T   T   A
                    3        C   G   T   A   T       In this (unrealistic!) case the five
                    4        T   C   T   T   T
                    5        T   C   A   A   T
                                                     haplotypes can be represented by just five
                                                     tagging SNPs




                            A paradigm for indirect
                              association studies
                                  (HapMap)

 • Genotype “control” individuals (LD data set)
 • Assess LD and select tSNPs
 • Type tSNPs in “phenotyped” individuals




                                                                                                  1
                      Questions about ht
                          mapping
• How to select and test performance of tSNPs?
• How many samples are required to select tSNPs?
• How does performance depend on MAF?
• How does performance depend on density?
• Is functional variation represented as well as non
  functional variation?
• How many more tSNPs are required to perform well
  in multiple populations?




                      Selection of Tags
    • Select “tagging” SNPs that define G haplotypes that
      satisfy performance criteria in a regression model in
      which the G haplotypes are used as independent
      predictors to predict the allelic states of other
      “tagged” SNPs.
    • Yi = xi1b1 + xi2b2 + … + xiGbG



    Refs: Weale ME et al. (2003) American Journal of Human Genetics 73: 551-565
          Goldstein DB et al. (2003) Trends in Genetics 19: 615-622
    Software implementation:
          Weale ME & Goldstein DB (2003) TagIT software, http://popgen.biol.ucl.ac.uk




                           The data set …
• 60 genes encoding most of the important DMEs
• Genotype approximately 1,000 SNPs in 64 CEPH
  and 64 Japanese individuals for a target density of
  one SNP / 2kb
           -- GSK / UCL Collaboration --




                                                                                        2
                 *     *                             * ****        *    *




                           Assessing the
                       Performance of tSNPs
                                                    This experiment predicts the
                                                       expected performance of
                                                       tSNPs the way they will be
                               Population
                                                       used in the “basic paradigm”


(1) Drop SNP i and
find best tSNP set S
for Sample 1           Sample 1          Sample 2




                  (2) Test S against
                  SNP i in a different
                  sample.




                                                                                      3
                                                     Sample size and MAF

                               (A)
                                                          1



                                                         0.8
                                 Average haplotype r 2




                                                         0.6



                                                         0.4



                                                         0.2



                                                          0
                                                              2%




                                                                                5%
                                                                        %




                                                                                        10%


                                                                                                   5%


                                                                                                             0%


                                                                                                                       5%


                                                                                                                                 0%


                                                                                                                                            5%


                                                                                                                                                      0%


                                                                                                                                                                5%


                                                                                                                                                                          0%
                                                                     3.5


                                                                              5-
                                                           5-




                                                                                                 -1


                                                                                                           -2


                                                                                                                     -2


                                                                                                                               -3


                                                                                                                                          -3


                                                                                                                                                    -4


                                                                                                                                                              -4


                                                                                                                                                                        -5
                                                                                      5-
                                                         0.




                                                                            3.
                                                                   2-




                                                                                              10


                                                                                                        15


                                                                                                                  20


                                                                                                                            25


                                                                                                                                       30


                                                                                                                                                 35


                                                                                                                                                           40


                                                                                                                                                                     45


                                                                                                                   MAF




                                                                       Initial genotyping
                                                                             density
 (A)
                          1



                         0.9
   2




                         0.8
   Average haplotype r




                         0.7



                         0.6



                         0.5



                         0.4
                                                  5-10%              10-15%          15-20%       20-25%           25-30%             30-35%         35-40%           40-45%   45-50%
                                                                                                                     MAF




                                                               Cosmopolitan SNPs
• Europe                                                                                                                                         196
• Japan                                                                                                                                          179




                                                                                                                                                                                        4
                                       Cosmopolitan SNPs
                      • Europe                                                     196
                      • Japan                                                      179

                      • Europe and Japan                                           226




                                                 Representing
                                              functional variation
(a)                                    BootSTRP64_CEPH         Functional_CEPH      NS_CEPH

                       1




                      0.8
Haplotype r (Other)




                      0.6
2




                      0.4




                      0.2




                       0
                            0   0.05    0.1     0.15     0.2     0.25     0.3    0.35   0.4   0.45   0.5
                                                                MAF




                                               Will tags hold in a
                                              different population
                      • Tags defined in CEPH
                      • Genotyped in a large sample from Aberdeen
                      • And tested against the panel of functional
                        variants




                                                                                                           5
                        Application in a new
                             population

                  1




                 0.8




                 0.6
   2
   Haplotype r




                 0.4




                 0.2




                  0
                   0%   5%   10%   15%   20%   25%   30%   35%   40%   45%   50%

                                               MAF




                        Tagging the major
                          human DMEs

• Density > 1 SNP / 5 kb results in detectable (but
  modest?) improvement in power
• Cosmopolitan tSNP sets require only modest
  increases in numbers over single population
  sets
• Functional SNPs can be represented as well as
  non functional ones




                        Tagging the major
                          human DMEs

• Density > 1 SNP / 5 kb results in detectable (but
  modest?) improvement in power
• Cosmopolitan tSNP sets require only modest
  increases in numbers over single population
  sets
• Functional SNPs can be represented as well as
  non functional ones
• SNPs with low MAF are trouble!




                                                                                   6
            Tagging the major
              human DMEs

  • Approximately 200 SNPs are sufficient to
    represent the greater than 4,000 common
    polymorphisms in key genes regulating
    drug plasma levels




                  Phenytoin
• A once widely used and effective anti epileptic
  drug that is now less often used (especially in
  Europe), in part because of adverse reactions
  (gum hyptertrophy, vision, headache)




             Carbamazepine
• Overall a safer drug than PHT, and more
  commonly used in the UK
• Identification of therapeutic dose can take
  months, and is complicated by tolerance




                                                    7
                           Distribution of Phenytoin
                                     Doses
                      80

                      70
                      60
 Number of Patients




                      50

                      40
                      30

                      20

                      10

                      0
                            <


                                                10


                                                          20


                                                                    30


                                                                              40


                                                                                        50


                                                                                                  60


                                                                                                            70


                                                                                                                       80


                                                                                                                                 90
                               10




                                                                                                                                   0
                                                                                                              0-7
                                                  0-


                                                            0-


                                                                      0-




                                                                                          0-


                                                                                                    0-




                                                                                                                         0-
                                                                                0-




                                                                                                                                   +
                                                    19


                                                              29


                                                                        39




                                                                                            59


                                                                                                      69




                                                                                                                           89
                                                                                  49
                                 0




                                                                                                                 99
                                                      9


                                                                9


                                                                          9




                                                                                              9


                                                                                                        9




                                                                                                                             9
                                                                                    9




                                                                        Maximum Dose




Distribution of Carbamazepine
             Doses
                                              100
                                               90
                                               80
                            No. Individuals




                                               70
                                               60
                                               50
                                               40
                                               30
                                               20
                                               10
                                                0
                                                                                                                          0
                                                        99




                                                        99

                                              12 199




                                                         9
                                                        99
                                                       99




                                              22 99

                                              24 99



                                                                                                                        60
                                                      79
                                              14 9

                                              16 9



                                              20 9




                                                      99
                                                    0-3




                                                    0-9
                                                    0-7
                                                    0-5




                                                      9

                                                      9




                                                      9
                                                   -21

                                                   -23



                                                                                                                      >2
                                                    -1




                                                    -1
                                                  -13

                                                  -15




                                                  -19




                                                  -25
                                                 20




                                                 80
                                                 60
                                                 40




                                                 00




                                                 00



                                                00

                                                00
                                                00

                                                00




                                                00




                                                00
                                              10




                                              18




                                                                      Maximum Carbamazepine Dose




Phenytoin
Pathway




                                                                                                                                       8
                       Strategy
  Phenytoin
  • Assess functional variants in CYP2C9
  • Assess putative functional variant in ABCB1
  • Assess tagging SNPs in SCN1A
  Carbamazepine
  • Assess putative functional variant in ABCB1
  • Assess tagging SNPs in SCN1A
  • Assess variation in PXR, regulator of CYP3A4




       CYP2C9 alleles *2 and *3
                Exon      Mutation resulting in aa change



Arg144Cys
                         *2



                         *3                    Ile359Leu




            Representing variatiion
                 in SCN1A
  Gene Size (Kb) # SNPs        Density             # Tags


  SCN1a      139 15            9.26667                      4




                                                                9
                                                               Results
    CYP2C9                   Freq.                     Average Phenytoin Dose (mg)                                                           Sig.
     Allele                   (%)
                                                           wt/wt                     wt/var                      var/var
        *2                    11.9                         357                           339                      317                        0.38


        *3                     9.7                         362                           304                      250                        0.005




                                              SCN1A – “tag 7”
                                                  AA                                                AG                         GG                          Sig



       Phenytoin:                              373                                                 340                         326                    P=0.0046




       Carbamazepine :                        1312                                                 1225                    1083                       P=0.0014




            Genomic structure of SCN1A surrounding exon 5N and exon 5A

                                                                                      rs3812718

                                              1.5 Kb                                                              860 bp
                                                                                   92 bp               92 bp

                             exon 4                                                  5N            5A                                    exon 6

                         192 bp                                                            95 bp                                         270 bp




                                                                                                                      A = Splice site disrupted, only 5A expressed
                                                                                                                      G = Both 5N and 5A expressed

Complete sequence of exon 5N aligned with 5A                                                                                                             rs3812718
                                                                                                                                                            A

exon 5N TCTACAGGTTTGTAACAGAATTTGTAAACCTAGGCAATTTTTCAGCTCTTCGCACTTTCAGAGTCTTGAGAGCTTTGAAAACTATTTCGGTAATTCCAGGTAAGAAGTG
                F   V    T     E      F   V   N    L   G   N   F   S   A   L   R     T     F   R   V    L   R   A L   K    T    I    S   V   I    P
                    ¦    ¦     ¦      ¦   ¦        ¦   ¦   ¦       ¦   ¦   ¦   ¦     ¦     ¦   ¦   ¦    ¦   ¦   ¦ ¦   ¦    ¦    ¦    ¦   ¦   ¦    ¦
                Y   V    T     E      F   V   D    L   G   N   V   S   A   L   R     T     F   R   V    L   R   A L   K    T    I    S   V   I    P

exon 5A TATTCAGGTACGTCACAGAGTTTGTGGACCTGGGCAATGTCTCGGCATTGAGAACATTCAGAGTTCTCCGAGCATTGAAGACGATTTCAGTCATTCCAGGTGAGAGCAA




                                                                                                                                                                     10
            Some good news
               (finally)…
• Haplotype tagging can identify unknown
  functional variants




        PHT and CBZ dosing
• PHT: Combining SCN1A and CYP2C9, the
  average maximum dose range between
  genetically sub-defined groups is 130 mg
• For CBZ, the average maximum dose range
  across SC1NA genotypes is 300 mg per day.




          Clinical relevance?

• Rate at which AED dose can be safely increased
• Only prospective trials can determine whether
  PGx can improve clinical use will determine
  whether the clinical use of these medicines




                                                   11
                Pgx is a simpler
                 complex trait
• Obvious candidate genes often carry PGx
  variants (drug specific)
• There may be direct clinical importance,
  although the demonstration will generally require
  prospective trials




            Acknowledgments

• Tagging human drug metabolism
   – GlaxoSmithKline and University College
     London
• Epilepsy genetics
   – Gianpierro Cavalleri, Chantal Depondt,
     Stephanie Schorge, Nicole Soranzo, Asra
     Siddiqui, Mike Weale,, Chantal Depondt, Ley
     Sander, Mari Wyn Burley, Richard Marguerie,
     Nicholas Wood, Sanjay Sisodiya




                                                      12

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:11
posted:5/6/2011
language:English
pages:12