PRIMER SEQUENCES FOR AMPLIFICATION AND SEQUENCING by mikesanye

VIEWS: 60 PAGES: 3

									              PRIMER SEQUENCES FOR SEQUENCING, PCR-RFLP’S AND ISSR’S

*= reverse primer
Internal Transcribed Spacer (ITS) region
Primer sequences to amplify the ITS region:
ITSleu1           5’—GTCCACTGAACCTTATCATTTAG—3’
ITS4*             5’—TCCTCCGCTTATTGATATGC—3’

Primer sequence to sequence the ITS1 spacer:
ITS5             5’—GGAAGTAAAAGTCGTAACAAGG—3’

Primer sequence to sequence the 5.8S exon and ITS2 spacer:
ITS3B              5’—GCATCGATGAAGAACGTAGC—3’
or (if trouble with ITS3B)
ITS6               5’—GCTTATTGATATGCTTAAA—3’               [empirically from potato]

trnT-trnF (“Taberlet”) region
Primers to amplify the trnT-trnF (“Taberlet”) region:
For the whole region
Tab a            5’—CATTACAAATGCGATGCTCT—3’
Tab f*           5’—ATTTGAACTGGTGACACGAG—3’
For only Tab a-b
Tab a            [above]
Tab b*           5’—TCTACCGATTTCGCCATATC—3’
For only Tab e-f
Tab c            5’—CGAAATCGGTAGACGCTACG—3’
Tab f* [above]
or
Tab e            5’—GGTTCAAGTCCCTCTATCCC—3’
Tab f* [above]

Primer to sequence the trnT-trnL (Tab a-b) intron:
Tab a            [above]

Primer to sequence the trnL-trnF (Tab e-f) intron:
Tab e            5’—GGTTCAAGTCCCTCTATCCC—3’

Other primers for particular purposes (we don’t use this):
Tab d             5’—GGGGATAGAGGGACTTGAAC—3’

Granule-Bound Starch Synthase (Gbss Or “Waxy”) region
Primer to amplify the central third of the “waxy” region:
waxy5’           5’—GGGTACTGAGGTTGGTCCTT—3’
waxy3’*          5’—GGGCTCACTGTAACCACCCT—3’

Primer to sequence exon-intron complex (from 5’ to 3’):
waxy a           5’—GGAGCAAAACTGGTGGACTA—3’
waxy b           5’—GACCACCCAATGTTCTTGGa—3’
waxy cr*         5’—ATGTGATTCTAATATCCCAG—3’

matK region
Primers to amplify 5' spacer and first 850 bp of coding region
matK5 [trnK-3914F]         5'—TGGGTTGCTAACTCAATGG—3'
matKHB850*                 5'—GGTCGCAAGCCACGCCGTACG—3'

Primers to amplify first 850 bp of coding region
matKHB1          5'—ATGGAGGAATTTCAAGGATATTTAG—3'
matKHB850*       [above]

Primers to sequence above [NOTE: must design reverse primer to get rest of spacer]
matK5            [above; gets 5' 1/3 or 1/2 of spacer]
matKHB1          [above]
matKHBAR         5'—GGAGCCCCCCTTCCCGCGGTC—3'
matKHBBR         5'—GAGGGTCCACCAACGCTTCAT—3'

GENE REGIONS FOR PCR-RFLP ANALYSIS
The following regions can be amplified and then cut into (hopefully) species-specific fragments in
individual reactions with 4bp-recognition enzymes; the best (=most frequently cutting) enzymes based on
Sequencher restriction maps from GenBank Solanaceae sequences of the regions below, are Alu I, Hae III,
Hha I, Hpa II, Mbo I, Nla III, and Rsa I. All but Nla III are available cheaply through Fisher; Nla III is
available through New England Biolabs.

Intergenic Spacer (IGS) of nrDNA (includes ETS region)
IGS5’           5’—GCCTTGCTGCCACGATCCACTG—3’                           [5’ end]
ETS3’*          5’—CACATGCATGGCTTAATCTTTG—3’                           [3’ end]

External Transcribed Spacer (ETS) of nrDNA (3’ third of IGS):
ETS5            5’—CATATATAAGGGGGGTAGA—3’
ETS3’*          [see above]

Alcohol Dehydrogenase (adh) locus, single-copy to low-copy nuclear DNA (10 exons and 9 introns)
adh5’             5'—GTCAGATCATCAAGTGCAGAGGT—3'
[in 5’-most exon #1]
adh3’*            5'—CCCCTTTCAACATGTAATCAAAAGC—3'
[in 3’-most exon #10]

rbcL-ORF106, chloroplast DNA (all of rbcL plus spacer between it and ORF106 exon)
rbcL 5’        5'—ATGTCACCACAAACAGAAACTAAGCAAGT—3'
ORF106*        5'—ACTACAGATCTCATACTACCCC—3'

rpoC1-rpoC2 region of chloroplast DNA (2 exons and intron)
rpoC1          5'—AAGCGGAATTTGTGCTTGTG—3'
rpoC2*         5'—TAGACATCGGTACTCCAGTGC—3'

trnK region of chloroplast DNA (intron)
trnKHB5’         5’—GGGTTGCCCGGGACTCGAAC—3’                            [got from tobacco]
trnKHB3’*        3’—CAACGGTAGAGTACTCGGCTTTTA—3’                        [“]

trnQHB5’         5’—GCGGGACCAAAACCCGTTGCC—3’
trnRHB3’*        5’—CCTATCCATTAGACAATGGACGC—3’

psaA5’           5’—ACTTCTGGTTCCGGCGAACGAA—3’
trnS3’*          5’—AACCACTCGGCCATCTCTCCTA—3’

matK
entire coding region plus flanking spacers
matK5 [trnK-3914F]          5'—TGGGTTGCTAACTCAATGG—3'
matK3 [trnK-2R*]            5'—AACTAGTCGGATGGAGTAG—3'

5' spacer and first 850 bp of coding region--better for degraded DNA
matK5               [above]
matKHB850*          5'—GGTCGCAAGCCACGCCGTACG—3'
PRIMERS FOR ISSR (INTER-SIMPLE SEQUENCE REPEAT) AMPLIFICATION
Our name    Wolfe's name Sequence
ISSR 1      17899B       (CA)6GG
ISSR 2      844A         (CT)8AC
ISSR 3      814          (CT)8TG
ISSR 4      17898A       (CA)6AC
ISSR 5      844B         (CT)8GC
ISSR 6      17899A       (CA)6AG
ISSR 7      17898B       (CA)6GT
ISSR 8      ---          (GA)6GG
ISSR 9      ---          (GT)6GG
ISSR 10     ---          (GA)6CC
ISSR 11     ---          (GT)6CC
ISSR 12     ---          (CAC)3GC
ISSR 13     ---          (GAG)3GC
ISSR 14     ---          (CTC)3GC
ISSR 15     ---          (GTG)3GC

								
To top