Documents
Resources
Learning Center
Upload
Plans & pricing Sign in
Sign Out

FUNCTIONAL SIGNIFICANCE OF MINOR MLH GERMLINE ALTERATIONS FOUND

VIEWS: 20 PAGES: 85

									FUNCTIONAL SIGNIFICANCE OF MINOR MLH1
   GERMLINE ALTERATIONS FOUND IN
       COLON CANCER PATIENTS



                         Tiina E. Raevaara




                  Division of Genetics
  Department of Biological and Environmental Sciences
                 Faculty of Biosciences
                University of Helsinki




                         Academic Dissertation

             To be publicly discussed, with the permission of
            the Faculty of Biosciences, University of Helsinki,
   in the auditorium 1041 of the Biocenter II, Viikinkaari 5, Helsinki,
              on the 29th of April, 2005, at 12 o’clock noon.
Supervisor                Docent Minna Nyström, Ph.D.
                          Division of Genetics
                          Department of Biological and Environmental Sciences
                          Faculty of Biosciences
                          University of Helsinki, Finland

Reviewers                 Professor Juhani Syväoja, Ph.D.
                          Department of Biology
                          University of Joensuu
                          Finland

                          Docent Heli Nevanlinna, Ph.D.
                          Department of Obstetrics and Gynecology
                          Biomedicum Helsinki
                          Helsinki University Central Hospital
                          Finland

Opponent                  Professor Jorma Isola, Ph.D., MD
                          Institute of Medical Technology
                          University of Tampere
                          Finland




ISSN                      1239-9469
ISBN                      952-10-2400-3 (paperback)
                          952-10-2401-1 (pdf)


Helsinki University Printing House, Helsinki 2005.




                                             2
”…to boldly go where no one has gone before.”
           Jean-Luc Picard, Captain of Starship Enterprise




             3
CONTENTS



ORIGINAL PUBLICATIONS………………………………………………………………….. 6
ABBREVIATIONS……………………………………………………………………………….7
SUMMARY……………………………………………………………………………………..... 9
INTRODUCTION……………………………………………………………………………….. 11
REVIEW OF THE LITERATURE…………………………………………………………….. 13
  Overview of hereditary colorectal cancer………………………………………………….. 13
   Colorectal cancer in general………………………………………......………….………… 13
   Clinical features of hereditary nonpolyposis colorectal cancer……………………..……... 14
   Amsterdam Criteria I and II………………………………………………………………... 15
  Mismatch repair deficiency………………………………………………………………..... 15
   Postreplicative DNA mismatch repair in Escherichia coli………………………………… 15
   Mismatch repair mechanism in yeast and human..…………………… …………………... 18
   Role of MMR proteins in DNA damage signalling………………………………………... 22
   Replication errors as a driving force in CRC tumorigenesis…………..…………………… 23
   Constitutive lack of mismatch repair………………………………………………………. 24
  Germline mutations associated with HNPCC……………………………………………... 27
   Variety of HNPCC genotypes and phenotypes…………………………………………….. 27
   Cancer-predisposing mutations in MLH1………………………………………………….. 29
   Interpretation of pathogenicity of MMR gene mutations…………………………………...31
      Clinical investigations of patients and their families…………………………………... 31
      Functional characterization of mutations found in putative HNPCC patients…………. 32
AIMS OF THE PRESENT STUDY…………………………………………………………….. 36
MATERIALS AND METHODS………………………………………………………………... 37
  Study subjects: germline MLH1 mutations………………………………………………... 37
  Mutated MLH1 cDNAs and expression vectors…………………………………………… 40
   Site-directed mutagenesis and generation of baculoviruses………………………………... 40
   Construction of vectors for mammalian expression……………………………………….. 42
   Construction of vectors for localization studies……………………………………………. 42
  Production of recombinant proteins……………………………………………………….. 43
   Protein production in insect cells…………………………………………………………... 43
   Protein production in human cells………………………………………………………….. 43
   Total protein extraction from insect cells…………………………………………………...44




                                          4
    Total protein extraction from human cells…………………………………………………. 44
  Functional analyses………………………………………………………………………….. 45
    Western blot analysis………………………………………………………………………. 45
    In vitro MMR assay………………………………………………………………………... 45
        Nuclear protein extraction……………………………………………………………… 45
        Preparation of DNA heteroduplex……………………………………………………... 46
        Repair assay……………………………………………………………………………. 47
    Detection of fluorescence fusion proteins………………………………………………….. 47
    Combined co-immunoprecipitation and Western blot analysis……………………………. 48
RESULTS………………………………………………………………………………………… 49
  Most of the mutations affected the expression or stability of the MLH1 protein…………….. 49
  Mismatch repair deficiency was mainly associated with aminoterminal MLH1 mutations….. 50
  The unstable MLH1 variants affected subcellular localization of MutLα.…………………... 53
  Most MLH1 variants interacted with PMS2 in the co-immunoprecipitation assay………….. 54
  Genotype and phenotype correlations……………………………………………………….... 54
DISCUSSION…………………………………………………………………………………….. 57
  Minor aminoterminal MLH1 mutations cause protein instability and
  defective mismatch repair…………………………………………………………………….. 57
  MLH1-K84E may interfere with the nuclear import of MLH1………………………………. 59
  Pathogenicity of minor carboxylterminal MLH1 mutations is mainly linked to
  protein instability …………………………………………………………………………….. 60
  Minor deletions and proline substitutions cause instability of MLH1………………………... 61
  No support for pathogenicity of 9 MLH1 alterations found in putative
  HNPCC families……………………………………………………………………………… 62
  MLH1 alterations with multiple, mild, or no defects in functional assays
  are linked to distinct clinical phenotypes……………………………………………………... 64
  MLH1-P648S homozygosity is associated with mild Neurofibromatosis type I……………... 65
CONCLUSIONS AND FUTURE PROSPECTS………………………………………………. 68
ACKNOWLEDGEMENTS…………………………..…………………………………………. 70
REFERENCES…………………………………………………………………………………... 72
APPENDICES…………………………………………………………………………………….82




                                                5
ORIGINAL PUBLICATIONS



This thesis is based on the following original publications, which are referred to in the text by
their Roman numerals. Some unpublished data will also be presented.


I             Raevaara TE, Timoharju T, Lönnqvist KE, Kariola R, Steinhoff M, Hofstra
              RMW, Mangold E, Vos YJ, and Nyström-Lahti M (2002). Description and
              functional analysis of a novel in frame mutation linked to hereditary non-
              polyposis colorectal cancer. J Med Genet, 39: 747-750.


II            Raevaara TE, Vaccaro C, Abdel-Rahman WM, Mocetti E, Bala S, Lönnqvist
              KE, Kariola R, Lynch HT, Peltomäki P, and Nyström-Lahti M (2003).
              Pathogenicity of the hereditary colorectal cancer mutation hMLH1 del616
              linked to shortage of the functional protein. Gastroenterology, 125: 501-509.


III           Raevaara TE, Gerdes A-M, Lönnqvist KE, Tybjærg-Hansen A, Abdel-Rahman
              WM, Kariola R, Peltomäki P, and Nyström-Lahti M (2004). HNPCC mutation
              MLH1 P648S makes the functional protein unstable and homozygosity
              predisposes to mild neurofibromatosis type 1. Genes Chromosomes Cancer, 40:
              261-265.


IV            Raevaara TE, Siitonen M, Lohi H, Hampel H, Lynch E, Lönnqvist KE,
              Holinski-Feder E, Sutter C, McKinnon W, Duraisamy S, Gerdes A-M,
              Peltomäki P, Kohonen- Corish M, Mangold E, Macrae F, Greenblatt M, de la
              Chapelle A, and Nyström M (2005). Functional significance and clinical
              phenotype of nontruncating mismatch repair variants of MLH1.
              Gastroenterology, in press.




                                               6
ABBREVIATIONS


ADP             Adenosine-diphosphate
ATP             Adenosine-triphosphate
CA              Colorectal adenoma
cDNA            Complementary DNA
CRC             Colorectal cancer
CTH             Carboxyl-terminal homology motif
DAPI            4’,6’-diamidino-2-phenylindole
DNA             Deoxyribonucleic acid
dNTP            Deoxynucleotriphosphate
EC              Endometrial cancer
EGFP            Enhanced green fluorescent protein
ESE             Exonic splicing exhancer
EXO1            Exonuclease 1
fA              Forward primer for fragment A
FAP             Familial adenomatous polyposis
fB              Forward primer for fragment B
GHKL            Gyrase-HSP-Kinase-MutL ATPase superfamily
HNPCC           Hereditary nonpolyposis colorectal cancer
HSP             Heat shock protein
IDL             Insertion/deletion loop
IHC             Immunohistochemistry
ICG-HNPCC       International Collaborative Group for HNPCC
InSiGHT         International Society for Gastrointestinal Hereditary Tumors
LOH             Loss of heterozygosity
MLH1/3          MutL homologue 1/3 gene (human, if not otherwise specified)
MLH1/3          MutL homologue 1/3 protein (human, if not otherwise specified)
MMR             Mismatch repair
MNNG            N-methyl-N'-nitro-N-nitrosoguanidine
MNU             N-methyl-N-nitrosourea
mRNA            Messenger RNA




                                     7
MSI        Microsatellite instability
MSH2/3/6   MutS homologue 2/3/6
MSS        Microsatellite stable
MutHLS     Mutator HLS
NCBI       National Center for Biotechnology Information
NCI        National Cancer Institute
NF1        Neurofibromatosis type 1 syndrome
NLS        Nuclear localization signal
PAGE       Polyacrylamide gel electrophoresis
PCNA       Proliferating cell nuclear antigen
PCR        Polymerase chain reaction
PMS1/2     Post-meiotic segregation increased 1/2
rA         Reverse primer for fragment A
rB         Reverse primer for fragment B
RCF        Replication factor C
RNA        Ribonucleic acid
RPA        Replication protein A
Sf9        Spodoptera frugiperda 9
SIFT       Sorting Intolerant From Tolerant program
UVB        Ultraviolet B light
WT         Wild-type




                                 8
SUMMARY


Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by a dominantly
inherited predisposition to early onset cancer, mostly colorectal (CRC) and endometrial
cancers (EC). It accounts for 1–6% of all CRC cases and is the most common form of
hereditary colon cancer.


HNPCC is associated with a deficiency of mismatch repair (MMR) machinery, which is
responsible for repairing polymerase errors occurring during DNA replication and re-
combination. As a consequence of replication errors, HNPCC tumor cells show instability in
their genomes, especially in repetitive sequences such as microsatellites. HNPCC-
predisposing germline mutations have been found in four MMR genes: MLH1, MSH2,
MSH6, and PMS2. MLH3 and PMS1 have also been linked to HNPCC susceptibility, but
their roles are less clear. One half of ∼450 mutations reported in an HNPCC mutation
database affect the MLH1 gene, 39% affect MSH2, and 7% MSH6. So far it is relatively
unclear whether, and how, the different types of MMR gene mutations cause different
disease phenotypes. Furthermore, a significant number of mutations, especially in MLH1, are
of the missense type, whose pathogenicity is difficult to interpret.


Here, the functional significance of 31 nontruncating MLH1 mutations found in clinically
characterized colorectal cancer families and three other variations listed in a mutation
database were studied for protein expression/stability, subcellular localization, interaction,
and repair efficiency. Furthermore, by correlating the genetic and biochemical data with
clinical data, we aimed to determine genotype-phenotype correlations in the families under
study and in HNPCC in general.


Twenty out of 34 mutations affected the quantity of the MLH1 protein, whereas only 15
mainly aminoterminal mutations were defective in an in vitro repair assay. Altogether, 22
mutations were pathogenic in more than one assay. Two variants were impaired only in one
assay, and 10 variants acted like the wild type protein in all assays. We found that amino-
terminal MLH1 mutations caused protein instability and defective mismatch repair, whereas
the pathogenicity of carboxylterminal MLH1 mutations was mainly linked to protein




                                                9
instability. The MLH1 alterations which were pathogenic in several functional assays were
found in families with typical HNPCC characteristics such as early age of cancer onset and
high MSI phenotype in tumors. Mutations with no defects in the functional assays are
associated with variable and mild clinical phenotypes.


Our results show that pathogenic nontruncating alterations in MLH1 may interfere with
different biochemical mechanisms, but generally more than one. MLH1 alterations with
multiple, mild, or no defects in functional assays are linked to distinct clinical phenotypes.




                                               10
INTRODUCTION


Hereditary nonpolyposis colorectal cancer (HNPCC) is an autosomal dominantly inherited
cancer syndrome characterized by an overall penetrance of 80%, cancer diagnosis before the
age of 50 years, proximal colon cancers as well as extracolonic cancers, namely endometrial,
gastric, small bowel, hepatobiliary, ureteric, and ovarian (Lynch et al. 1993). On the other
hand, clustering of the tumors belonging to the HNPCC spectrum is observed in
approximately 15–25% of all colorectal cancer (CRC) kindreds (Wagner et al. 2003).
HNPCC accounts for 1–6 % of all CRC cases and is the most common form of hereditary
colon cancer (Aaltonen et al. 1998).


Mutations linked to HNPCC affect the DNA mismatch repair (MMR) machinery, which is
responsible for repairing polymerase errors occurring during DNA replication and re-
combination. Cells deficient in MMR display hypermutability of their DNA, which leads to
clustering of mutations particularly in coding- and noncoding repetitive sequences and,
finally, to cancer development. As a characteristc of MMR deficiency, HNPCC tumor cells
show microsatellite instability (MSI) in their genomes (Aaltonen et al. 1994).


Since the mapping of the first susceptibility locus on the chromosome 2p and cloning of the
MSH2 gene (Fishel et al. 1993; Peltomäki et al. 1993), HNPCC-predisposing germline
mutations have been found in four MMR genes: MLH1, MSH2, MSH6, and PMS2 (Peltomäki
and Vasen 2004). In addition, MLH3 and PMS1 have been implicated in prediposition to the
syndrome, but their roles still need to be examined properly. One half of ∼450 HNPCC-
associated mutations registered in the InSiGHT (International Society for Gastrointestinal
Hereditary Tumors) database occur in the MLH1 gene, 39% in MSH2, and 7% in MSH6
(http://www.InSiGHT-group.org/; Peltomäki and Vasen 2004). The associations between
HNPCC genotypes and phenotypes are poorly understood (Peltomäki et al. 2001). Families
carrying a mutation either in MLH1 or MSH2 tend to display typical HNPCC, whereas MSH6
mutations are often associated with atypical HNPCC characteristics, such as small family
size, excess of extracolonic cancers, late age of onset, and reduced penetrance (Vasen et al.
2001; Hendriks et al. 2004; Peltomäki and Vasen 2004).




                                             11
Of all mismatch repair gene mutations reported in the InSiGHT database, 29% are of the
missense type, changing only one amino acid, whereas the majority of the mutations cause
truncation of the polypeptide (Peltomäki and Vasen 2004). The interpretation of the
functional significance of the minor nontruncating gene variants is difficult. Theoretically,
the criteria in support of pathogenicity of a missense alteration include evolutionary
conservation of the original residue, nonconservative nature of the amino acid change,
absence of the gene variant in the normal population, and its cosegregation with the disorder.
Moreover, in HNPCC tumors, pathogenicity is suggested by MSI and lack of the appropriate
protein. However, the lack of clinical samples or insufficient family size often hinder
conclusions, and the pathogenicity of a gene variant should be functionally characterized.


The present study was undertaken to evaluate the pathogenicity of 34 MLH1 germline
alterations, some of which were novel, and some have been reported in the InSiGHT
database. Our aims were to elucidate whether the minor MLH1 gene variants found in
suspected HNPCC families are pathogenic and the biochemical mechanism of their
pathogenicity. Finally, by comparing the biochemical data with clinical data obtained from
the families we aimed to find genotype-phenotype correlations useful in HNPCC diagnostics,
counseling and design of appropriate follow-up and treatment strategies for gene variant
carriers in the respective families as well as in HNPCC in general.




                                              12
REVIEW OF THE LITERATURE



Overview of hereditary nonpolyposis colorectal cancer

Colorectal cancer in general


Colorectal cancer (CRC) is the third most common cause of cancer-related death in the
western world (Nataryan and Roy 2003). It is estimated that 105,500 new colorectal cancers
occurred in the US in 2003. In Finland, approximately 2,200 new CRC cases are found
annually (Finnish Cancer Registry, http://www.cancerregistry.fi). The average age at
diagnosis for colorectal cancer is 70 years, and 55–60% of patients survive beyond five years
following diagnosis (http://www.cancerregistry.fi).


The development of cancer consists of complex events which may involve many environ-
mental factors in addition to possible genetic predisposition. Lifestyle-related factors such as
a high-fat/low-fiber diet and long-term smoking are known to be associated with an increased
risk for colorectal cancer (Potter 1999).


Cancer is the endpoint of a stepwise process which requires a series of different genetic
changes occurring mainly in two distinct types of cancer genes: oncogenes and tumor
suppressor genes. This classification is based on the change in gene expression needed for
carcinogenesis. Oncogenes promote cancer development in active or overexpressing form,
whereas tumor suppressors are required to be practically inactive to promote carcinogenesis.
Typically, oncogenes encode cell growth- and proliferation-stimulating proteins, such as
tyrosine kinases and transcription factors. The proteins encoded by tumor suppressors
regulate the balance between cell growth and growth-reducing signals. Inactivation of one
allele of a tumor suppressor gene may increase cancer susceptibility, but in contrast to the
dominantly behaving oncogenes, both alleles are assumed to be inactive before tumorigenesis
begins (“Two-hit hypothesis”; Knudson 1971). However, recent evidence suggests that some
such tumors may occur without a second hit (Tucker and Friedman 2002). Most cancer
syndromes are due to inherited mutations in tumor suppressor genes.



                                              13
The majority of CRCs occur sporadically, but it has been estimated that at least 15% of all
CRC’s have a strong genetic predisposition (Houlston et al. 1992). The main inherited
colorectal cancer syndromes are HNPCC and familial adenomatous polyposis (FAP)
(Wilmink 1997). HNPCC accounts for approximately 1–6% of all CRCs and is associated
with germline mutations in DNA mismatch repair (MMR) genes (Aaltonen et al. 1998;
Lynch et al. 2003). FAP is estimated to account for less than 1% of all CRCs, and is due to
mutations in the adenomatous polyposis coli (APC) gene (Groden et al. 1991). Patients
carrying an APC mutation in their germline are prone to develop hundreds or even thousands
of colorectal adenomas and early-onset carcinoma (Narayan and Roy 2003).


Clinical features of hereditary nonpolyposis colorectal cancer


HNPCC, also known as Lynch syndrome, is characterized by an autosomal dominant pattern
of inheritance, penetrance of 80%, and diagnosis of cancer in typical sites before the age of
50 years (Lynch et al. 1993). Most typically, HNPCC tumors are colorectal or endometrial.
Two-thirds of the colorectal tumors are located in the proximal colon. Additionally, the risk
for gastric, ovarian, small bowel, biliary tract and uroepithelial cancers as well as brain
tumors is increased, but the risk is much lower than the risk for the two main HNPCC
cancers. The endometrium is even more frequently affected than the colorectum among
female mutation carries (Aarnio et al. 1999). The cumulative lifetime risk for CRC to the age
of 70 years among male mutation carriers approaches 100%, whereas among females the risk
for CRC is approximately 50% and the risk for EC approximately 60% (Aarnio et al. 1999).


The cancer susceptibility in HNPCC is caused by inherited mutations in one of the MMR
genes. MMR deficiency leads to clustering of somatic mutations particularly in short
repetitive sequences, known as microsatellites. The resulting phenomenon in the tumor DNA,
known as microsatellite instability (MSI), is used when diagnosing HNPCC (Rodriguez-
Bigas et al. 1997). HNPCC tumor cells appear more likely to have diploid or near-diploid
DNA content compared to sporadic CRC cells (Kim et al. 1994). Although HNPCC-
associated colorectal cancers can be classified as poorly differentiated – which normally
suggests that the cancer would be aggressive – HNPCC colorectal tumors have a better
outcome than comparable sporadic tumors (Järvinen et al. 2000). Prognosis of colorectal




                                             14
cancer in general depends on the stage of the tumor at the time of diagnosis, and surgery is
the most effective treatment (Narayan and Roy 2003).


Amsterdam Criteria I and II


In 1991, the International Collaborative Group for HNPCC (ICG-HNPCC) standardized
diagnostic criteria for HNPCC. To fulfill the criteria the family should include i) at least three
affected relatives with colorectal cancer; ii) at least one should be a first-degree relative of
the other two; iii) at least two successive generations should be affected; iv) one colon cancer
should be diagnosed before 50 years of age; and v) FAP should be excluded (Vasen et al.
1991). These original criteria, known as Amsterdam Criteria I, take into account only
colorectal tumors. The revised form of HNPCC criteria, known as Amsterdam Criteria II,
took into account endometrial, stomach, ovary, ureter or renal pelvis, brain, small bowel,
hepatobiliary tract, and skin cancers as well (Vasen et al. 1999).




Mismatch repair deficiency


Post-replicative DNA mismatch repair in Escherichia coli


When a cell divides, its genome needs to be duplicated by the replication machinery,
consisting of a set of different proteins. DNA synthesis is also needed in many other DNA
transactions such as in recombination- and repair-linked events. The actual copying of the
DNA double-helix is carried out by a specific enzyme, DNA polymerase. Cells harbor
several types of DNA polymerases for different purposes.


Usually, DNA synthesis is carried out with high fidelity. Estimates for the probability of a
single base substitution occurring during DNA synthesis vary widely, between 10–2 and 10–8
per nucleotide (Kunkel 2004; Tippin et al. 2004). Replication errors can be either
spontaneous or induced. When post-replicative repair mechanisms and additional
environmental stress are absent, the spontaneous base substitution error rate in vivo ranges
from 10–7 to 10–8. These studies have been made with bacteriophage and Escherichia coli,




                                               15
and replication accuracy in eukaryotes is likely to be higher (Kunkel 2004). In addition to
base substitutions, spontaneous errors in DNA synthesis include insertions and deletions of
bases resulting from strand misalignment (Fig. 1). Rates for all types of replication errors
vary depending on the respective polymerase and DNA sequence (Kunkel 2004). Replication
errors can also be induced, i.e. originating as a result of environmental factors, for example
exposure to radiation, oxygen or some other chemicals. The spontaneous deamination of
cytosine to urasil is a common cause of errors (Tippin et al. 2004).


Correction of replication errors in the commonly used prokaryotic model organism E. coli is
carried out by the DNA mismatch repair (MMR) mechanism, alternately known as long-
patch mismatch repair, Mutator (Mut) HLS system, or mismatch proofreading system. MMR
improves the fidelity of the replication machinery 100–1,000 fold, and therefore lowers the
base mutation rate to one error per 1010 nucleotides (Bellacosa 2001). Inactive MMR causes
the accumulation of mutations in the genome, and the resulting cellular phenotype is referred
to as a "mutator phenotype" (Modrich and Lahue 1996; Schofield and Hsieh 2004).


                                            Figure 1. Emergence of insertion/deletion loops during
                                            DNA replication.
                                            Mispairing of the complementary DNA strands causes
                                            insertions and deletions on the newly synthesized strand,
                                            depending on which strand the slippage occurred. DNA
                                            regions containing repeat sequences are thought to be
                                            particularly prone   to strand slippage during DNA
                                            replication. (Modified from Levinson and Gutman, 1987.)




The MutHLS mechanism has been completely reconstructed in vitro, and is mediated by
three homodimeric Mut proteins: MutS, MutL, and MutH (Fig. 2) (Lu et al. 1983; Lahue et
al. 1989; Cooper et al. 1993). The first step of the repair reaction consists of the recognition



                                              16
of the replication error, i.e. base/base mismatch or small insertion/deletion loop (IDL), and is
carried out by the MutS homodimer (Modrich 1991). The discrimination between the
template strand and the repairable strand in E. coli is determined by the presence of adenine
methylation at GATC sequences (Lu et al. 1983). Methyl groups are added to all adenine
residues at GATC sequences, but not until some time after DNA synthesis. Thus only the
template strand will contain methylated GATC sites just behind the replisome. The
endonuclease MutH binds the hemimethylated sequence, and nicks the newly synthesized
strand at the unmethylated GATC sequence. MutS promotes DNA loop formation and
interacts with MutL in the presence of ATP, which leads to the assembly of the repairosome,
i.e. a multicomplex consisting of factors needed for excision and resynthesis of the error-
containing strand (Fig. 2) (Modrich 1991; Allen et al. 1997).



                                                Figure 2. Mismatch repair mechanism in
                                                Escherichia coli. Discrimination between the template
                                                and the newly synthesized strand is determined by the
                                                presence of methyl groups (CH3) in GATC sequences
                                                on the template strand. After nicking of the
                                                unmethylated strand by MutH, the endonucleases ExoI,
                                                RecJ, ExoVII, and ExoX can excise the error-
                                                containing fragment, which could be up to 1-2 kb long.
                                                DNA helicase II (MutU/UvrD) and single-strand
                                                binding protein Ssb participate in strand removal
                                                (Cooper et al. 1993). (Modified from Jacob and Praz,
                                                2002.)




MutL, an ATPase similar to MutS, has a poorly-known but central function in the repair
reaction. It stimulates the endonuclease activity of MutH, enhances the translocation of MutS
along DNA in search of the closest GATC site bound by MutH, and couples the mismatch



                                              17
recognition to further repair steps (Ban et al. 1999; Hall et al. 1999). The subsequent removal
of the newly-synthesized DNA strand can be carried out either in the 5'→3' or 3'→5'
direction, depending on which side of the mismatch/IDL MutH has prepared the single-
strand nick. Thus either the 5'→3' or 3'→5' single-strand exonuclease is required. At least
four exonucleases have been shown to participate in MMR in E. coli (Fig. 2) (Burdett et al.
2001). The removed fragment is then resynthesized by DNA polymerase III holoenzyme and
ligated by DNA ligase (Lahue et al. 1989).


Mismatch repair mechanism in yeast and human

After identification of the eukaryotic homologs of E. coli MutL and MutS genes, the high
conservation rate of MMR key elements has become obvious. The function of the eukaryotic
MMR has mostly been determined in the yeast Saccharomyces cerevisiae. The eukaryotic
MutS and MutL homologues, which participate in MMR, and their nomenclature and
locations in human chromosomes are listed in Table 1 (Bellacosa 2001). No indisputable
MutH homolog has been found in eukaryotic genomes to date.


                       Table 1. MutS/L homologs in yeast and human.

                   E. coli   S. cerevisiae   H. sapiens (chromosomal location)
                   MutS      MSH2            MSH2 (2p21–22)
                             MSH3            MSH3 (5q11–12)
                             MSH6            MSH6 (2p16)
                   MutL      MLH1            MLH1 (3p21.3)
                             MLH2            PMS1 (2q31–33)
                             MLH3            MLH3 (14q24.3)
                             PMS1            PMS2 (7p22)




In eukaryotes, the MutS/L-proteins act as heterodimers. The recognition of replication error
is carried out by two alternative heterodimers, MutSα and MutSβ, which consist of MSH2
and MSH6 or MSH2 and MSH3, respectively (Acharya et al. 1996; Alani 1996; Genschel et
al. 1998). The studies of yeast have demonstrated that MutSα is responsible for the binding
of base/base mismatches (except C•C mismatches) and for the binding of IDLs consisting of
one or a few extrahelical bases, whereas MutSβ is responsible for the recognition of IDLs
consisting of at least two bases (Fig. 3) (Alani 1996; Habraken et al. 1996; Iaccarino et al.




                                                 18
1996; Marsischky et al. 1996). In human cells, MutSα is present at much higher levels than
MutSβ and is mostly responsible for the recognition of base/base mismatches (Acharya et al.
1996; Palombo et al. 1996; Genschel et al. 1998; Marra et al. 1998). Because of the partially
redundant functions of MSH6 and MSH3, cells deficient in either one of these proteins have
only a weak mutator phenotype. Cells deficient in both MSH3 and MSH6 have a strong
mutator phenotype similar to cells defective in MSH2 (Marsischky et al. 1996; de Wind et al.
1999).


                                          Figure 3. Main events in the eukaryotic mismatch repair
                                          reaction. The DNA error is recognized by one of the two
                                          MutS complexes, after which the MutL complex,
                                          mostly MutLα, mediates the downstream repair events. The
                                          helicase possibly required in the excision of the error-
                                          containing strand has not been identified, nor has the ligase
                                          needed for the filling of gaps. DNA ligase I is a reasonable
                                          candidate because it is often associated with polymerase δ
                                          (Tomkinson et al. 1998). Proliferating cell nuclear antigen
                                          (PCNA) is a proposed candidate for mediating strand
                                          discrimination (Umar et al. 1996).




The most important eukaryotic homolog for E. coli MutL is the MLH1 protein (Table 1).
MLH1 forms heterodimers with three different partners, PMS2, MLH3 and PMS1 (Li and
Modrich 1995; Lipkin et al. 2000; Räschle et al. 1999, respectively). So far, only
heterodimers consisting of MLH1 and PMS2 (referred to as MutLα), and MLH1 and MLH3
have been shown to function in eukaryotic MMR. MutLα is involved in the repair of both
base/base mismatches and insertion/deletion loops (Fig. 3), and is the main MutL complex in
human cells (Li and Modrich 1995; Räschle et al. 1999). Studies in S. cerevisiae suggest that
the yeast heterodimer of MLH1 and MLH3, together with MutSβ, is involved in the repair of
a proportion of IDLs consisting of at least two bases (Flores-Rozas and Kolodner 1998).
However, the contribution of MLH1-MLH3 in human MMR remains putative. MutL hetero-




                                             19
dimers are proposed to act as a "molecular matchmaker", which forces the repair reaction
forward after the recognition of replication error (Jiricny and Nyström-Lahti 2000).


On the basis of structural and sequential data, MutL homologs belong to the so-called GHKL
ATPase superfamily, which is likely to have evolved from a common ancestor. In addition to
the MutL homologs, the GHKL family includes DNA gyrase b, HSP90 heat shock proteins,
and histidine kinases. These proteins contain four short conserved sequence motifs, in which
invariant residues are suggested to have an important role in the binding and hydrolysis of
ATP (Bergerat et al. 1997; Mushegian et al. 1997; Dutta and Inouye 2000).




Figure 4. ATP binding and hydrolysis by bacterial MutL homodimer. The aminoterminal part of the MutL
dimer is proposed to act as an ATP-driven hook that clamps the molecule onto DNA. (Modified from Ban et al.
1999.) N, aminoterminus; C, carboxylterminus.


Among the MutL homologs, only the crystal structure of 349 aminoterminal amino acids of
E. coli MutL has been determined so far (Ban and Yang 1998; Ban et al. 1999). This analysis
revealed that the elongated structure of MutL becomes globular upon binding of ATP or its
analog ADPnP. Binding of the nucleotide also triggers amino-terminal dimerization of the
MutL dimer, whereas the carboxyl-terminal interaction between the two monomers is
assumed to be stable and independent of ATP binding (Ban and Yang 1998; Ban et al. 1999).
The ATP→ADP cycle of MutL is represented in Figure 4. The conformational changes in the
N-terminus have been demonstrated also with human MutLα, and binding and hydrolysis of




                                                    20
the ATP nucleotide have been shown to be critical for the stability and function of the
heterodimer (Räschle et al. 2002). Although the ATP binding/hydrolysis motifs of human
PMS2 are similar to those of MLH1, the ATPase capacity of PMS2 is not critical to the
heterodimer (Räschle et al. 2002).


Although the human MMR reaction can be reconstructed in vitro in cell extracts (Holmes et
al. 1990), the mechanism for discrimination between template and nascent DNA strands
remains obscure. DNA methylation, responsible for strand discrimination in E. coli, is
excluded in humans (Drummond and Bellacosa 2001). One suggested factor in strand
discrimination is the proliferating cell nuclear antigen (PCNA), which is necessary for DNA
replication. PCNA is loaded onto DNA by replication factor C (RFC), and it forms a sliding
clamp which diffuses along the DNA and provides processivity to the replicative polymerase
(Fig. 3) (Hingorani and O'Donnell 2000). PCNA was originally found to interact with MLH1
in a yeast two-hybrid screen (Umar et al. 1996). Later it was shown to also interact with
PMS2 (Gu et al. 1998) and MutSα/β (Clark et al. 2000). PCNA has been suggested to
recognize the free DNA termini resulting from the replication machinery, and to guide the
mismatch repair proteins to the newly synthesized strand at an early stage of the MMR
process (Umar et al. 1996).


The signalling between mismatch recognition and further steps in repair is mostly ATP-
dependent. MutSα/β is able to bind mismatches and IDLs with strong affinity in its ADP-
bound state, and the damage recognition induces the ADP→ATP exchange (Gradia et al.
1997; Wilson et al. 1999). Apparently, the ATP-bound state of MutSα/β forms a clamp
which dissociates from the mismatch and diffuses along the DNA backbone in a hydrolysis-
independent manner (Gradia et al. 1999). Several studies have shown that the interaction
between MutS- and MutL-heterodimers requires ATP, and it happens only when attached to
the DNA (Blackwell et al. 2001; Plotz et al. 2002; Räschle et al. 2002).


The downstream components of MMR have been characterized much more poorly in
eukaryotes than in E. coli. Putative candidates for the excision and resynthesis of the error-
containing strand are the 5'→3'-active exonuclease EXO1, the single-strand binding
replication protein A (RPA), PCNA, RCF, polymerase δ and perhaps also ε, DNA ligase I,




                                             21
and an unidentified helicase (Fig. 3) (Jiricny 1998; Jiricny and Nyström-Lahti 2000).
Because the repair reaction is bidirectional, a 3'→5' exonuclease is also required. One
suggestion is that the ATP-bound form of MutSα induces a conformational change of the
replicative polymerase in such a way that DNA synthesis is stopped and the 3'→5'
exonuclease capability of the polymerase is activated, resulting in the removal of the error-
containing strand (Gradia et al. 1999; Fishel 1999).


Role of MMR proteins in DNA damage signalling


Although the MMR machinery repairs only DNA mismatches and short IDLs, the MMR
proteins are also involved in apoptosis and checkpoint activation in response to various forms
of DNA damage. It is not well understood how the MMR proteins participate in DNA
damage signalling, but it seems that without MMR, the cells with damaged DNA will not
undergo apoptosis because of a failed connection between the MMR and G2/M cell cycle
checkpoint (Hawn et al. 1995).


Cytotoxicity of some alkylating or anti-cancer agents requires functional MMR (Branch et al.
1993; Kat et al. 1993). N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), N-methyl-N-
nitrosourea (MNU) and their analogues in clinical use (temozolomide and dacarbazine) cause
DNA damage by methylating the O6 position of guanine to form O6-methylguanine. As a
normal cellular response to alkylating agents, MMR proteins recognize the DNA damage and
mediate the induction of apoptosis (Branch et al. 1993; Kat et al. 1993). Apparently, MMR is
required for p53 phosphorylation in response to DNA alkylator damage (Duckett et al. 1999).
UVB-induced apoptosis and p53 phosphorylation at serine 15 are remarkably diminished in
cell lines defective for MSH2 (Peters et al. 2003). MMR is also involved in the induction of
the p53-related transcription factor p73: cisplatin-induced accumulation of p73 depends on
functional MLH1 (Gong et al. 1999), and treatment with cisplatin induces an interaction
between PMS2 and p73, which leads to the stabilization and activation of p73 (Shimodaira et
al. 2003). Moreover, the MMR machinery was reported to be required in the activation of the
S-phase checkpoint in response to ionizing radiation (Brown et al. 2003).




                                              22
The function of MMR proteins in the repair process and DNA damage signalling may
involve different molecular processes. Consistent with this, subnormal levels of MLH1 have
been reported to be enough for efficient MMR, while the checkpoint activation requires a full
level of MLH1 (Cejka et al. 2003).


Replication errors as a driving force in CRC tumorigenesis


Mutation rates in MMR-deficient cells are 100–1,000 fold that of normal cells. In the absence
of any selective pressure, mismatches and insertions/deletions should occur at similar rates in
any coding or noncoding DNA region, depending only on the type of sequence. DNA regions
containing repetitive sequences, for example “microsatellites”, are particularily prone to
strand slippage during DNA replication (Fig. 1) (Levinson and Gutman, 1987). MMR
deficiency can be verified from cells by observing insertions/deletions in these microsatellite
sequences, a phenomenon called MSI (Aaltonen et al. 1994).


Repetitive sequences can exist within all types of genes, also in those important in regulating
normal cellular growth and proliferation. When certain tumor suppressors or oncogenes are
affected by frame-shift mutations in such sequences, a cell has a selective advantage
compared to normal cells (Fig. 5). Thus, the genetic instability leads to an evolutionary
process which can start the formation of a tumor, i.e. a large population of malignant cells.


The MMR-dependent CRC development differs from the general model of CRC
development, which is one of the best characterized models of tumor progression (Fig. 5).
According to the general model, the development of a malignant tumor is initiated by
alterations in genes such as APC or β-catenin (CTNNB1), and thus called as APC/β-catenin
pathway (Vogelstein and Kinzler 1993). In the MMR pathway, a complex signalling network
is established among inactivated and activated cellular pathways caused by accumulation of
replication errors and other genetic changes. Genes which are mutated at different stages of
CRC development encode proteins involved e.g. in signal transduction (TGFβRII, IGFIIR,
PTEN), apoptosis and inflammation (BAX, CASP1), transcription regulation (TCF4), and
DNA repair (MSH3, MSH6, MBD4), and are known as “target genes” (Peltomäki 2001a;
Jacob and Praz 2002) (Fig. 5). Some of these genes, e.g. the MMR genes MSH6 and MSH3,




                                              23
are commonly mutated in micro-satellite-unstable cancers, whereas others, such as TGFβRII
and TCF4, are typically mutated in gastrointestinal but not in endometrial cancers (Duval et
al. 1999; Markowitz et al. 1995; Malkhosyan et al. 1996; Peltomäki 2001a).


In a human cell, both alleles of an MMR gene need to be inactivated before the loss of the
MMR activity. This is consistent with the "two-hit hypothesis" (Knudson 1971), which
concerns tumor suppressor genes in general: in hereditary cancers, the first "hit" is a germline
mutation in one allele, and the second "hit" is a somatic mutation or loss of heterozygosity
(LOH) affecting the other allele. In sporadic cancers, both hits are somatic.




Figure 5. Two pathways to colorectal cancer. The APC/β-catenin pathway (top) is possibly the best
characterized pathway from normal epithelium to cancer (Vogelstein and Kinzler 1993). The mismatch repair
deficiency-driven pathway (bottom) is initiated by mutations in one or few mismatch repair genes, followed by
microsatellite instability for example in TGFβRII, BAX, MSH6, MSH3, TCF4, IGFIIR, AXIN2, CASP1, MBD4,
PTEN, and RIZ genes (Peltomäki, 2001a). (Modified from Narayan and Roy 2004.)



Constitutive lack of mismatch repair


There is an important difference whether the loss of tumor suppressor activity is acquired
only in a particular tissue, or is absent from the first stage of embryogenesis throughout the
entire body. Timing of the inactivation has a huge impact on the resulting phenotype, and as
in the case of MMR inactivity, on the resulting genotype as well.




                                                     24
There are some descriptions of individuals who are homozygous for an MMR gene mutation
or carry germline mutations in both alleles of an MMR gene (Table 2). Usually such
individuals are offspring from consanguineous marriages within HNPCC families. A
constitutive MMR-deficiency in humans is generally associated with hematological
malignancies and features of de novo neurofibromatosis type 1 syndrome (NF1) such as café-
au-lait spots, axillary freckles, and neurofibromas. Apparently, the constitutive lack of MMR
generates genetic instability in genes which are structurally the most fragile (such as the NF1
gene) or expressed in rapidly proliferating cells (such as hematopoietic genes) (Andrew
1999; Peltomäki 2001a). However, there are relatively few gastrointestinal malignancies
found in individuals who carry bi-allelic germline MMR gene mutations. This may be due to
early ages at the time of diagnoses, and death before gastrointestinal cancer develops. All the
reported colorectal malignancies have occurred after the age of nine years, whereas many of
the homozygous patients have already died before the age of five.


The development of hematological malignancies in homozygous patients is consistent with
the phenotypes of MMR-deficient mice strains (Table 3) (Wei et al. 2002). Homozygous
mice, which are used as mouse models for HNPCC, develop mostly lymphomas at
approximately 2–5 months of age (Baker et al. 1995; de Wind et al. 1995; Baker et al. 1996;
Edelmann et al. 1997). Gastro-intestinal carcinomas are rare and appear in older mice,
similarly to the characteristics of humans carrying bi-allelic MMR gene mutations. In
contrast to heterozygous HNPCC patients, heterozygous mice do not develop gastrointestinal
malignancies. This phenomenon is possibly due to the short lifetime of rodents, which does
not allow the occurrence of the "second hit" needed for inactivation of the appropriate MMR
gene (de Wind et al. 1995). It has been suggested that the differences in tumor spectra
between MMR-deficient humans and mice are partly due to differences in the critical target
sequences (Jacob and Praz 2002).




                                              25
Table 2. Bi-allelic germline mutations in MMR genes.
                                                                                         Clinical
Affected                       No of           Clinical characteristics of           characteristics
gene         Mutation(s)    individuals1       homozygous individuals 2               of the family    Reference
MLH1         c. 676C>T           3          Chronic myeloid leukemia (1 yr);         Typical HNPCC     Ricciardone
              (R226X)                       Non-Hodgin's lymphoma (3 yr);                 family       et al. 1999
                                                 Acute leukemia (2 yr);
                                                    Features of NF1
MLH1         c. 199G>T           2          Non-Hodgin's lymphoma (2 yr);            Typical HNPCC     Wang et al.
              (G67W)                         Acute myeloid leukemia (6 yr);              family          1999
                                                Medullo-blastoma (7 yr);
                                                    Features of NF1
PMS2            c. 2361-         2            Glioma (14 yr); CRC (18 yr);            No confirmed     De Rosa et
                2364del                          Neuroblastoma (13 yr)                cancer cases      al. 2000
              + 1221del
PMS2         c. 1169ins20      2–3 3         CRC (16 yr); Ovarian cancer (21            One CRC        Trimbath et
                                           yr); EC (23 yr); Brain tumor (24 yr);                        al. 2001
                                           Astrocytoma (7 yr); Acute lymphoid
                                             leukemia (4 yr); Features of NF1
MLH1           c. 1732-          1            Glioma (4 yr); Features of NF1          Not reported     Vilkki et al.
               1896del                                                                                    2001
              (exon 16)
MSH2         Splice-site         1          Acute lymphoid leukemia (4 yr);          No cancer cases   Whiteside
            mutation g>a                            Features of NF1                                    et al. 2002
            at 1662–1 bp
MSH2        Del of exons         2                  Lymphoma (1 yr);                 Two EC’s; one     Bougeard
                  1–6                               Glioblastoma (3 yr)               astrocytoma      et al. 2003
            + 1-bp del at
             codon 153
PMS2           R802X             3         Non-Hodgkin’s lymphoma (10 yr);      No cancer cases      De Vos et
                                               Brain tumor (8 yr, 14 yr);                             al. 2004
                                                   Features of NF1
MLH1        c. 2059C>T           3                 CRC (9yr, 11yr);              One CRC; one       Gallinger et
              (R687W)                              Features of NF1               gastric cancer       al. 2004
MSH6       3385-3390del          1            Glioma (10 yr); CRC (12 yr);       No confirmed        Menko et
              +insCTT                              Features of NF1                cancer cases        al. 2004
1
  Number of individuals homozygous for the mutation; 2 The numerals in parenthesis indicate the age (years) of
the patient at the time of diagnosis; 3 The homozygous status of one patient could not been verified because of
early death at the age of 4.


    Table 3. Characteristics of mice strains deficient for the most common HNPCC genes.
                                  Tumors
                 50% survival     Spectrum                    Incidence     Fertility
 Genotype         (months) 1                                              (male/female)          References
 Mlh1−/−              6           Lymphoma, gastro-           High             −/−            Baker et al. 1996;
                                  intestinal, skin, others                                    Prolla et al. 1998
 Msh2−/−               6          Lymphoma, gastro-           High             +/+           de Wind et al. 1995;
                                  intestinal, skin, others                                  Reitmair et al. 1995;
                                                                                             de Wind et al. 1998;
 Msh6−/−               11         Lymphoma, gastro-           High             +/+          Edelmann et al. 1997;
                                  intestinal, others                                         de Wind et al. 1999
 Pms2−/−               10         Lymphoma, sarcoma           High             −/+            Baker et al. 1995;
                                                                                              Prolla et al. 1998
    1
        normal lifespan approximately 16–18 months




                                                         26
Germline mutations associated with HNPCC

Variety of HNPCC genotypes and phenotypes


InSiGHT maintains a database which contains germline mutations found in HNPCC or
putative HNPCC families (http://www.InSiGHT-group.org/). At present, the database
includes 448 MMR gene mutations found in 748 families from different parts of the world
(as of July 31st, 2003) (Peltomäki and Vasen 2004). The majority of the mutations involve
MLH1 (50%), MSH2 (39%), or MSH6 (7%) (Table 4). PMS2 (1%) has also been linked to
HNPCC susceptibility, whereas the roles of MLH3 and PMS1 are less clear (Peltomäki and
Vasen 2004). The pathogenic significance of the 16 reported MLH3 mutations has remained
obscure, and in a family in which PMS1 variation has been reported, HNPCC also segregates
with a large MSH2 deletion, which is most probably the susceptibility mutation in this family
(Liu et al. 2001).


The HNPCC-associated mutations are generally scattered throughout the coding sequences
and exon/intron boundaries of MMR genes (http://www.InSiGHT-group.org/). Exons 1 and
16 in MLH1, exons 3 and 12 in MSH2, and exon 4 (a very large exon) in MSH6 represent
some kind of mutation hot-spots (Peltomäki and Vasen 2004). Almost all (13/16) MLH3
germline mutations are located in only one exon (1) (Wu et al. 2001; Liu et al. 2003). This
exon is proposed to code a domain which interacts with MLH1, the interaction partner of
MLH3 (Kondo et al. 2001).


The majority (81%) of MMR gene mutations are unique, i.e. specific to only one HNPCC
family (Peltomäki and Vasen 2004). Most are nonsense or frame-shift mutations and cause
truncation and loss-of-function of the respective polypeptide (Table 4). However, a
significant proportion of mutations, approximately 30% of MLH1 and MSH6, and nearly
90% of MLH3 mutations, are of the missense type. Because of the genetic diversity of
HNPCC-predisposing mutations, the search for a predisposing mutation in a new HNPCC
family generally requires many different time-consuming methods.




                                             27
Approximately 30% of the HNPCC families which fulfil the Amsterdam criteria I fail to
show a mutation in any known MMR gene (Liu et al. 1996; Peltomäki 2001b). Recent
studies have shown that an MMR defect can frequently be caused by large genomic deletions
and uncharacterized mutations, which lead to loss of expression of an MMR gene but are
difficult to identify (Charbonnier et al. 2002; Wang et al. 2002).


   Table 4. Germline alterations in different MMR genes, and the proportions of different
   types of mutations (http://www.InSiGHT-group.org/; Peltomäki and Vasen 2004).
  Gene          Total no of     Proportions of different mutation types                   No of non-
                mutations                                                                 pathogenic
                                Nonsense   Frameshift    Missense    In-frame 1   Other    variants
  MLH1           225 (50%)        11%         44%         32%           10%        3%         27
  MSH2           175 (39%)        49%         19%         18%            9%        5%         28
  MSH6            32 (7%)         22%         37%         38%             −        3%         43
  MLH3            16 (3%)          −          13%         87%             −         −         5
  PMS2             5 (1%)         20%         40%         20%           20%         −         5
  PMS1            1 (<1%)        100%          −            −             −         −         −
  Total         448 (100%)
   1
     in-frame insertions and deletions


The typical HNPCC phenotype is usually associated with MLH1 and MSH2 mutations (Liu et
al. 1996; Nyström-Lahti et al. 1996). Sixty-three % of the families with an identified MLH1
mutation and 50% of the families with an MSH2 mutation are reported to fulfill the stringent
Amsterdam criteria I, whereas less than 20% of MSH6 and PMS2 families fulfill the criteria
(Peltomäki and Vasen 2004). MSH2 mutations appear to be associated with a higher risk of
development of extracolonic cancers than are MLH1 mutations (Vasen et al. 1996), and
furthermore, the lifetime risk of any cancer may be higher among MSH2 mutation carriers
than among MLH1 mutation carriers (Vasen et al. 2001). Remarkably, among female MSH6-
mutation carriers, the risk for CRC is notably lower, but the risk for endometrial cancer
significantly higher than among MLH1 and MSH2 mutation carriers (Hendriks et al. 2004).
Overall, the risk for HNPCC-related tumors is significantly lower in MSH6-mutation-
associated families than in families with mutations in either MLH1 or MSH2 (Hendriks et al.
2004). In MSH6-mutation carriers, the cumulative risk for colorectal carcinoma was 69% for
men, 30% for women, and 71% for endometrial carcinoma at 70 years of age (Hendriks et al.
2004). In individuals carrying mutation in either MLH1 or MSH2, the risks are 100%, 50%,
and 60%, respectively (Aarnio et al. 1999).




                                                   28
MSH2 is primarily affected in the HNPCC-related Muir-Torre syndrome, which is charac-
terized by the occurrence of sebaceous gland tumors in addition to HNPCC-type
malignancies (Kruse et al. 1998). Turcot syndrome, which is characterized by the occurrence
of brain tumors together with colon carcinoma, involves mutations in the MLH1 and PMS2
genes (Hamilton et al. 1995). Individuals carrying bi-allelic mutations in a MMR gene
typically have hemato-logical malignancies and features of NF1 (Table 2).


The MMR gene involved in HNPCC predisposition appears to have an effect on the disease
phenotype. However, the role of the type and site of the mutations is less clear. In particular,
missense mutations appear to be associated with a wide range of clinical phenotypes
(Peltomäki et al. 1997). The severity of the resulting disease phenotype may partly depend on
the ability of the mutant MMR proteins to exert a dominant negative effect on the MMR
mechanism (Jäger et al. 1997). Missense mutations, which are shown to be MMR-proficient
in functional assays, are often associated with mild or atypical HNPCC phenotypes (Ellison
et al. 2001; Nyström-Lahti et al. 2002; Kariola et al. 2002, 2004). A splice-site mutation in
MLH1, which silences the affected allele, is associated with reduced frequency of
extracolonic cancers (Jäger et al. 1997). An analysis of Finnish HNPCC families suggested
that nontruncating aminoterminal MLH1 mutations were associated with milder phenotypes
than nontruncating mutations affecting the carboxylterminus (Peltomäki et al. 2001).
However, the association between different HNPCC genotypes and phenotypes is poorly
understood.

Cancer-predisposing mutations in MLH1

The human MLH1 gene includes 19 exons, and encodes a protein consisting of 756 amino
acids (∼86 kDa) (Han et al. 1995). The resulting MLH1 protein can be divided into two
functionally relatively divergent domains: the aminoterminal domain, which is responsible
for ATP binding and hydrolysis, and the carboxylterminal domain, which provides an
interaction site needed for heterodimerization (Figure 6) (Tran and Liskay 2000; Räschle et
al. 2002; Guerrette et al. 1999; Kondo et al. 2001). Interestingly, the three alternative
heterodimerization partners, PMS2, MLH3, and PMS1, share a common interaction site in
MLH1 (Kondo et al. 2001).




                                              29
MLH1 is the most common susceptibility gene in HNPCC. While over 50% of germline
MLH1 mutations lead to truncation of the polypeptide, 32% of mutations are of the missense
type (Table 4) (Peltomäki and Vasen 2004). The missense mutations associated with HNPCC
are mildly clustered in the two functional domains of the MLH1 polypeptide (Fig. 6)
(http://www. InSiGHT-group.org/).
There are only a few widespread recurring MLH1 mutations, namely MLH1-del616, in which
one lysine residue is deleted from a repeat of three lysines in exon 16; MLH1-K618A, in
which one of the three lysines is substituted by alanine; and MLH1-T117M, in which a
metionine replaces a threonine residue in exon 4 (Peltomäki and Vasen 2004;
http://www.InSiGHT-group.org/).


MLH1 mutations account for over 90% of all Finnish HNPCC-associated mutations
identified (Holmberg et al. 1998). This is likely due to two MLH1 “founder” mutations, a
3.5-kb genomic deletion affecting exon 16 and a splice acceptor site mutation of exon 6,
which together account for 63% of all Finnish HNPCC mutations (Nyström-Lahti et al. 1995;
Moisio et al. 1996). Only two MLH1 missense mutations (MLH1-I107R and MLH1-R659P)
have been found in Finland (Nyström-Lahti et al. 1996).




Figure 6. Distribution of missense mutations (black triangles) in the MLH1 polypeptide.
The four ATP binding/hydrolysis motifs (black) correspond the amino acids 31–43, 63–68, 97–107, and 146–
147. The PMS2/ MLH3/PMS1 interaction domain (striped) is located between the amino acids 492/506 and
743. The final 13 amino acids are identical in human and yeast MLH1 and comprise the carboxylterminal
homology motif (CTH) with unknown function (Pang et al. 1997). The numbers at the bottom of the figure
show the cor-responding exons in the MLH1 cDNA.




                                                  30
Interpretation of pathogenicity of MMR gene mutations


Clinical investigations of patients and their families
Proper information about the pathogenicity of an inherited gene variant is essential. It is
generally accepted that effective genetic testing for HNPCC requires determination of
functional significance of the minor MMR gene variants, such as missense mutations.
However, the differentiation between pathogenic and non-pathogenic nontruncating variants
can be difficult (http://www.InSiGHT-group.org/). Segregation studies can be used to
distinguish pathogenic missense mutations from polymorphisms. If an identified amino acid
change can be shown to segregate with the disease phenotype in the family, it suggests – but
does not prove – that an alteration is a pathogenic mutation. Unfortunately, insufficient
family size and unavailability of clinical samples often prevent such segregation studies.


Since HNPCC is considered as an MMR deficiency syndrome, one important phenotype
associated with pathogenicity of the mutation is MSI in the tumor sample. MSI analysis is
often used for choosing putative HNPCC patients for further studies. The Bethesda
guidelines, developed by InSiGHT, recommend testing colorectal tumors for MSI, if any of
the following criteria is fulfilled: i) an affected individual belongs to a family which fulfils
the Amsterdam Criteria; ii) the individual has two HNPCC-related malignancies, including
synchronous or metachronous CRCs or associated endometrial cancers; iii) the individual
with CRC has a first-degree relative with CRC and/or HNPCC-related extracolonic
carcinoma and/or colorectal adenoma, and one of the tumors is diagnosed at an age <
45years, and adenoma < 40 years; iv) the individual has CRC or endometrial carcinoma that
was diagnosed at age < 45 years; v) the individual has right-sided CRC with an
undifferentiated pattern on histopathology diagnosed at age < 45 years; vi) the individual has
signet ring cell-type CRC that was diagnosed at age < 45 years; or vii) the individual has
adenomas diagnosed at age < 40 years (Rodriguez-Bigas et al. 1997; Lynch et al. 2003).


The widely advocated National Cancer Institute (NCI) microsatellite marker panel contains
three dinucleotide markers and two mononucleotide markers (Dietmaier et al. 1997). The
MSI phenotype is classified as high if at least 2/5 or 40% of microsatellite markers used are
unstable; low, if 1/5 of the markers show instability; and stable, if none of the markers used




                                              31
are unstable. MSI occurs in 15-25% of sporadic colorectal and endometrial cancers as well,
and consequently, at least 90% of CRCs classified as MSI-high are sporadic cancers
(Kuismanen et al. 2000; Jass et al. 2002). MSI in sporadic cancers is mostly caused by
methylation of the promoter and silencing of the MLH1 gene (Kane et al. 1997). The MSI
status in an HNPCC tumor is dependent on the associated MMR gene: MLH1, MSH2, and
PMS2 mutations are usually associated with high MSI, whereas MSH6 and MLH3 mutations
are associated with variable MSI, from microsatellite stable (MSS) to high MSI (Peltomäki
and Vasen 2004).


In addition to MSI study, immunohistochemical (IHC) analysis with antibodies that
recognize MMR proteins has been utilized in HNPCC diagnostics for several years. Many
systematic studies for the ability to detect MMR deficiency from HNPCC tumors with IHC
has been published (Müller et al. 2001; Lindor et al. 2002; Wahlberg et al. 2002). Lack of an
MMR protein in the tumor tissue indicates pathogenicity of the mutation in the
corresponding MMR gene. Moreover, if the predisposing mutation has not been found, the
absence of an MMR protein indicates a mutation in the corresponding gene. It seems that
while MSH2 staining is technically reliable and succesful in most laboratories, MLH1
staining is more variable and often difficult to interpret (Müller et al. 2001; de la Chapelle
2002). In the study of Lindor et al. (2002), MSI and IHC for MLH1 and MSH2 proteins were
analyzed for over 1,000 colorectal cancer patients. HNPCC comprised 31% of MSI-positive
tumors. IHC analysis of MLH1 and MSH2 showed 92% sensitivity and 100% specifity for
MSI, which means that all tumors deficient in either MLH1 or MSH2 were MSI-positive,
whereas 8% of MSI-positive tumors showed normal MLH1 and MSH2 staining in IHC
analysis. This is consistent with the variable effects of different mutations on the resulting
protein: missense mutations, minor in-frame deletions or insertions, or mutations that
truncate the encoded protein near the carboxyl-terminal end, may display normal staining in
IHC analysis (Wahlberg et al. 2002).


Functional characterization of mutations found in putative HNPCC patients
Several methods have been established which provide information about the effect of
HNPCC mutations on the function of the respective polypeptide. Such functional
characterization of MMR gene variants can be unambiguous in the case of mutations that




                                             32
bring about premature termination of translation. However, mutations that do not cause
premature termination are more difficult to interpret. Thus, functional assays particularly
focus on such mutations.


One of the earliest functional assays is based on the dominant mutator effect of human
MLH1 expressed in S. cerevisiae (Shimodaira et al. 1998). In the assay, human wild-type
MLH1 and some polymorphism-like alterations interact with yeast MMR machinery and
interfere with its function. The resulting MMR deficiency can be detected with a reporter
gene which contains repetitive sequences. This assay presupposes that human MLH1 protein
interferes with the MMR system of S. cerevisiae and that any mutation that affects important
functional domains of MLH1 would abolish the interactions between the human and yeast
proteins.


In the second yeast-based assay, mutations are introduced into the S. cerevisiae genome. The
mutations studied with this assay affected mostly the amino-terminus of the Mlh1 protein and
mimicked MLH1 mutations found in HNPCC patients (Shcherbakova and Kunkel 1999).
Haploid yeast strains carrying these mutations were tested for a mutator phenotype. Diploid
yeast strains heterozygous for the mutation were also analysed. An interesting finding
derived from the study was that in diploid heterozygous yeast strains the mutator effect
resulted from the loss of the wild-type yeast allele, not from reduced MMR efficiency. An
advantage of this method is its homologous conditions: the yeast Mlh1 protein is analyzed in
the yeast MMR system. However, its weakness is that only the amino acid residues which are
conserved between human and yeast MLH1 can be studied. The principles of the assay
described above were later utilized and modified in the study of Ellison et al. (2001). They
constructed human-yeast hybrid MLH1 and MSH2 proteins where the residue under study
was not conserved between human and yeast.


The effects of HNPCC-related MSH2 and MLH1 mutations on the assembly of MutSα
and MutLα, respectively, have been determined using glutathione-s-transferase (GST) fusion
protein interaction assays (Guerrette et al. 1998, 1999). The assay relied on the use of a GST
fusion protein expressed in E. coli as a “bait” and an in vitro transcribed and translated
protein as a “prey”. The heterodimers were precipitated with glutathione beads and




                                             33
fractionated with gel electrophoresis. Unfortunately, the MMR gene mutations, which have
no effect on the interaction but affect the polypeptide in some other way, don’t produce a
pathogenic phenotype in this assay.


The effects of mutations in MLH1, MSH2, and MSH6 genes on the ability of the protein
variants to interact with their counterparts have also been studied using a coimmuno-
precipitation method. In this assay, the recombinant human MMR protein variants were
incubated with their heterodimerization partners. The heterodimers were then precipitated
with agarose beads covered by appropriate antibodies, and the interactions were verified with
Western blot analysis (Nyström-Lahti et al. 2002; Kariola et al. 2002, 2003, 2004).


The in vitro MMR assay is possibly the most sophisticated method for testing the effect of
human MMR-gene mutations on the repair reaction, since it studies the phenotypic con-
sequences of HNPCC mutations in a homologous human MMR system (Nyström-Lahti et al.
2002). The assay was originally developed from in vitro MMR assays, where human nuclear
extracts were analysed for their ability to correct DNA heteroduplexes (Holmes et al. 1990;
Thomas et al. 1991). Later, MutSα and MutLα proteins, either recombinant or extracted
from human cells, have been shown to complement the MMR capacity in cell extracts, which
lack these heterodimers (Li and Modrich 1995; Iaccarino et al. 1996; Räschle et al. 1999;
Drummond et al. 2001). Before the present study, the in vitro MMR assay has been used to
study the MMR capability of four MLH1 missense mutations and two large in-frame
deletions in MLH1, as well as some MSH6 and MSH2 missense mutations (Nyström-Lahti et
al. 2002; Kariola et al. 2002, 2003, 2004).


Kondo et al. (2003) have recently used a two-hybrid yeast assay to determine the
pathogenicity of a large number of HNPCC-associated MLH1 mutations. They tested the
ability of MLH1 variants to interact with its counterpart PMS2 and with its propable
counterpart EXO1 (Tran et al. 2001). The EXO1-interaction region is between the amino
acids 411 and 650 in the MLH1 carboxylterminus (Schmutte et al. 2001). However, EXO1 is
also shown to interact with MSH2 (Schmutte et al. 2001) and the importance of the MLH1-
EXO1 interaction for the human MMR reaction is unclear. Surprisingly, the MLH1 variants
which carried amino-terminal mutations were the most defective in interaction with both




                                              34
PMS2 and EXO1 in the two-hybrid yeast assay (Kondo et al. 2003). This result is
inconsistent with previous data, which suggest that both PMS2 and EXO1 interaction regions
in MLH1 are in the carboxylterminus (Guerrette et al. 1999; Kondo et al. 2001).




                                            35
AIMS OF THE PRESENT STUDY



The present study was undertaken to evaluate the functional significance of 31 non-
truncating MLH1 germline alterations. The alterations were found in putative HNPCC
families and collected for functional characterization through an international HNPCC
collaboration. In addition, three MLH1 alterations were selected from the InSiGHT database.


The aims of the present study were as follows:


– to determine whether the MLH1 gene variants found in suspected HNPCC families are
pathogenic
– to find out whether these alterations affect the function and/or quantity of the MLH1
protein
– to correlate the genetic and biochemical information with clinical data available from these
families to identify genotype-phenotype correlations




                                              36
MATERIALS AND METHODS




Study subjects: germline MLH1 mutations (I–IV)


The present study is based on 34 MLH1 germline alterations, including 28 missense and six
in-frame deletion type changes. Thirty-one alterations were found in suspected HNPCC
families, and three alterations were selected from the InSiGHT database.


The mutations, their locations in the MLH1 gene, and the respective nucleotide and coding
changes are listed in Table 5. The mutations are referred to in the text mostly by their amino
acid changes. The 34 alterations are scattered throughout the MLH1 polypeptide, but are
mainly clustered in its aminoterminus, which is responsible for ATP binding and hydrolysis
(Ban et al. 1999; Tran and Liskay 2000; Räschle et al. 2002), and in the carboxylterminus,
which contains the region where MLH1 interacts with its counterparts, PMS2, MLH3, and
PMS1 (Fig. 7) (Guerrette et al. 1999; Lipkin et al. 2000; Kondo et al. 2001). The MMR
capability of protein variants C77R, S93G, I107R, del633-663, and R659P had been
functionally investigated in a previous study (Nyström-Lahti et al. 2002), but were included
in the present study for further functional characterization.


Thirty-one germline MLH1 alterations were found in suspected HNPCC families and
collected for functional studies through an international collaboration. Some of the alterations
are already included in the InSiGHT database, and some are novel. The gene variant carriers
and their kindreds have been subjected to clinical and molecular studies such as MSI and
immunohistochemical analysis of the MMR proteins in the tumors. The clinical
characteristics and results of the molecular studies are summarized in Table 5.


One MLH1 mutation, c. 1942C>T (P648S), was found in a typical HNPCC family with 10
colorectal cancer patients (Bisgaard et al. 2002). A child conceived from a consanguineous
mating between first cousins was found to be homozygous for the mutation and to display
mild features of neurofibromatosis type 1 (NF1) – two café-au-lait spots and a skin tumor –
but no axillary freckles or hematological malignancies.



                                               37
Table 5. Genetic and clinical data of the MLH1 alterations under study. The amino acid
changes are predicted based on the nucleotide changes.
    MLH1                   Nucleotide        Amino acid      Conserv.       Familial     Index      Mean age of    MSI    IHC of
    variant      Exon    change in cDNA       change          of aa1      Background2   Patients3     onset4      status5 MLH16
    P28L          1         c. 83C>T         Pro → Leu         Yes          +ACI (1)    CRC/30          37         High    N.D.
                                                                            −ACI (1)    CRC/27          29         High No loss
    A29S          1            c. 85G>T      Ala → Ser         No           +ACI (1)    CRC/37         47          High    Loss
    TSI45–47CF    2         c. 133-141del    Thr, Ser, Ile   Yes (T, I)     +ACI (1)    CRC/32         43          N.D.    N.D.
                           ACAAGTATT         → Cys, Phe       No (S)
                             ins TGTTTT
    D63E          2           c. 189C>A      Asp → Glu          Yes        −ACI (1)     CRC/44          41        High     Loss
    G67R          2           c. 199G>A      Gly → Arg          Yes        −ACI (1)     CRC/36          36        High     N.D.
    del71         3      c. 211-213delGAA     Del Glu           No         −ACI (1)     CRC/24          27        High     Loss
                                                                           +ACI (1)     CRC/19          36        High     N.D.
    C77R          3         c. 229T>C        Cys → Arg          Yes        +ACI (1)     CRC/22          32        High     N.D.
    F80V          3         c. 238T>G        Phe → Val          Yes        +ACI (1)     CRC/51          52        High    No loss
    K84E          3         c. 250A>G        Lys → Glu          Yes        −ACI (1)     CRC/32          36        High     N.D.
    S93G          3         c. 277A>G        Ser → Gly          No         +ACI (1)     CRC/70          65        N.D.     N.D.
    I107R         4         c. 320T>G        Ile → Arg          Yes        +ACI (4)      EC/46          49        High     Loss
                                                                                        CRC/53          51        High     Loss
                                                                                        CA/46           46        N.D.     N.D.
                                                                                        CRC/30          54        High     Loss
    L155R         6         c. 467T>G        Leu → Arg          Yes        +ACI (1)     CRC/33          41        High     Loss
    V185G         7         c. 554T>G        Val → Gly          No         +ACI (1)     CRC/43          44        High     Loss
    V213M         8         c. 637G>A        Val → Met          No         −ACI (4)     CRC/64          58        Low     No loss
                                                                                         EC/44          53        High    No loss
                                                                                        CRC/67          67        High     Loss
                                                                                        CRC/46          42        High    No loss
    I219V         8         c. 655A>G        Ile → Val          No           ..            ..            ..        ..       ..
    S247P         9         c. 739T>C        Ser → Pro          No         −ACI (1)     CRC/43          44        N.D.     N.D.
                                                                           +ACI (1)     CRC/42          49        High     Loss
    H329P         11           c. 986A>C     His → Pro          No         +ACI (1)     CRC/32          44        High     Loss
    del330        11      c. 988-990delATC     Del Ile          No         +ACI (1)     CRC/29          41        High     Loss
    K443Q         12          c. 1327A>C     Lys → Gln          Yes        −ACI (1)     CRC/57          62        High     Loss
    L550P         14          c. 1649T>C     Leu → Pro          No         −ACI (1)     CRC/45          35        High     Loss
    A589D         16          c. 1766C>A     Ala → Asp          No         −ACI (1)     CRC/34          34        High     Loss
    del612        16    c. 1834-1836delTTG    Del Val           No         +ACI (1)     CRC/47          51        N.D.     N.D.
    del616        16         c. 1846-1848     Del Lys           No         +ACI (1)     CRC/44          50        High     Loss
                                delAAG
    K618A         16    c. 1852-1853AA>GC    Lys → Ala          No         −ACI (5)     CRC/43          41        High    No loss
                                                                                        CRC/33          43        N.D.     N.D.
                                                                                        CRC/76          77        Low      Loss
                                                                                        CRC/72          72        High     Loss
                                                                                        CRC/69          69        Low     No loss
                                                                           +ACI (2)     CRC/44          60        MSS     No loss
                                                                                        CRC/32          38        High     Loss
    K618T         16        c. 1853A>C       Lys → Thr          No             ..         ..             ..        ..       ..
    del633–663    17      c. 1897-1989del     Del of aa         ND             ..         ..             ..        ..       ..
                              (exon 17)       633–663
    Y646C         17        c. 1937A>G       Tyr → Cys          Yes        −ACI (1)     CRC/36          36        High    No loss
    P648L         17         c. 1943C>T      Pro → Leu          Yes        −ACI (1)     CRC/43          43        High    No loss
    P648S         17         c. 1942C>T      Pro → Ser          Yes        +ACI (1)     CRC/54          50        High     Loss
    P654L         17         c. 1961C>T      Pro → Leu          Yes        −ACI (3)     CRC/35          53        N.D.     N.D.
                                                                                        CRC/31          50        N.D.     N.D.
                                                                                        CRC/38          54        High     Loss
                                                                           +ACI (1)     CRC/41          50        High     Loss
    R659P         17       c. 1976G>C        Arg → Pro          Yes        +ACI (1)     CRC/35          45        High     Loss
    R659Q         17       c. 1976G>A        Arg → Gln          Yes        +ACI (1)     CRC/32          38        High     Loss
    A681T         18       c. 2041G>A        Ala → Thr          Yes        −ACI (1)     CRC/38          38        High     N.D.
    V716M         19       c. 2146G>A        Val → Met          No         −ACI (2)     CRC/65          67        Low     No loss
                                                                                         EC/39          45        High     Loss
                                                                           +ACI (2)     CRC/43          57        High     Loss
                                                                                        CRC/52          46        MSS      N.D.
1
 Conservation of the original amino acid between human and S. cerevisiae. 2 +/− indicates whether the families fulfil the
Amsterdam criteria I (number of the families). 3 The cancer site and the age of onset (years) of the index patient. 4 Average
age (years) of cancer onset in all affecteds. 5 MSI status of the tumor from the index patient, if available. 6 IHC analysis of
MLH1 protein in the tumor tissue. Aa, amino acid; ACI, Amsterdam criteria I; N.D., not determined.




                                                                 38
Figure 7. Schematic representation of the locations of the MLH1 mutations under study in the MLH1
polypeptide. A) The MLH1 alterations are clustered in the aminoterminus responsible for ATP binding and
hydrolysis, and in the carboxylterminus, consisting of the PMS2/MLH3/PMS1 interaction domain. B) The
conservation of the four ATP-binding sites between human MLH1, S. cerevisiae Mlh1 and E. coli MutL, and
the distribution of the MLH1 mutations around the invariant residues. Sequences were aligned with ClustalX
software version 1.81 (Thompson et al. 1997). Sequence accession numbers in the NCBI database: human
MLH1, P40692; yeast Mlh1, P38920; bacterial MutL, P2336 (http://www.ncbi.nlm.nih.gov/entrez/).




                                                   39
In addition to 31 mutations found in HNPCC families, three MLH1 variations listed in the
international HNPCC mutation database (http://www.insight-group.org/) were studied: (i) c.
655A>G (I219V), which has been shown to be non-pathogenic in previous functional assays
(Shimodaira et al. 1998; Ellison et al. 2001; Trojan et al. 2002; Kondo et al. 2003) and here,
used as a functional control, (ii) c. 1853A>C (K618T), whose pathogenicity according to
previous functional assays has remained partly unsettled (Guerrette et al. 1998; Shimodaira et
al. 1998; Trojan et al. 2002; Kondo et al. 2003), and (iii) an in-frame deletion c. 1897-
1989del (del633–663), comprising exon 17, which we previously found to be pathogenic
(Nyström-Lahti et al. 2002) and here, used as a nonfunctional control.



Mutated MLH1 cDNAs and expression vectors

Site-directed mutagenesis and generation of baculoviruses (I–IV)
The MLH1 mutations were generated in human MLH1 cDNA using a PCR-based site-
directed mutagenesis method. The primers, fragment lengths, annealing temperatures, and
cloning sites are listed in Table A.1 (see Appendices). All the plasmids used in the present
study are listed in detail in Table A.2.


Human MLH1 cDNA, which was previously cloned into the plasmid pFastBac1 (Invitrogen)
was used as template. First, two fragments, A and B, were produced in two separate
amplification reactions (1st PCR in Table A.1), each using a pair of oligonucleotides, where
the reverse primer for fragment A (primer rA), and the forward primer for fragment B
(primer fB) carried the nucleotide changes. The first PCR was carried out with 2.5 ng of
template DNA, 1× Pfu DNA Polymerase buffer (Promega), 2.5 units of Pfu DNA
Polymerase (Promega), 100 pmol of each primer, and 200 µM dNTPs. The PCR products
were purified, then 15 ng added as template for a second PCR, where the primers fA and rB
(100 pmol of each) were used to complete the PCR product in the presence of 1× Pfu DNA
Polymerase buffer (Promega), 2.5 units of Pfu DNA Polymerase (Promega), and 200 µM
dNTPs. The first and second amplification reactions were carried out in a total volume of 100
or 50 µl, respectively, for 30 cycles at 94ºC for 1 min, at the specified temperature for 1 min
(Table A.1), and at 72ºC for 2.5 min. The products of second PCR were purified, digested
with appropriate restriction enzymes (Table A.1) (Promega), and then ligated into similarly



                                              40
restricted pFastBac1-MLH1 vector. The recombinant plasmids were amplified in
electrocompetent E. coli DH5α cells, and finally the mutated MLH1 inserts were verified by
DNA sequencing. The recombinant baculoviruses were then generated using the Bac-to-Bac
system according to the manufacturer’s instructions (Fig. 8) (Invitrogen).




Figure 8. Production of recombinant baculoviruses with the Bac-To-Bac expression system.
A, cDNA of a foreign gene (MLH1 or PMS2) is cloned into the pFastBac1 donor plasmid which is then
transformed into electrocompetent E. coli DH10Bac cells (B). These cells contain bacmid DNA with a mini-
attTn7 target site and a helper plasmid. The mini-Tn7 element on the pFastBac1 plasmid can transpose into the
mini-attTn7 target site in the presence of transposition proteins provided by the helper plasmid. C, DH10Bac
colonies which contain recombinant bacmids are identified by disruption of a lacZα gene. D, high molecular
weight bacmid DNA is prepared from selected DH10Bac clones. E, recombinant DNA is then used to transfect
Sf9 insect cells using Cellfectin transfection reagent. F, when recombinant viruses are released from the cells,
they are collected and used to infect new Sf9 cells for viral amplification or protein production. (Modified from
Bac-To-Bac Baculovirus Expression System instruction manual; Invitrogen.)




                                                      41
Construction of vectors for mammalian expression (II–IV)
A human expression system was utilized to study the effects of the MLH1 alterations on the
stability and expression levels of the MutLα variants. For protein production, MLH1and
PMS2 cDNAs from plasmids pFastBac1-MLH1 (wild-type or mutated) or pFastBac1-PMS2
(wild-type) were cloned into pEGFP-N1 vector (Clontech) between BamHI and NotI sites, so
that the EGFP gene was replaced. These constructs are here named as pMLH1-N1 and
pPMS2-N1, respectively (Table A.2).


Construction of vectors for localization studies (IV)
MLH1 and PMS2 proteins were fused to fluorescent tags in order to allow studying the
effects of MLH1 mutations on subcellular localization of MutLα variants. For fluorescent
protein production, MLH1 and PMS2 were fused to the EGFP gene. For the cloning, the stop
codons were removed and some new restriction sites were generated in MLH1 and PMS2
cDNAs by the site-directed mutagenesis method described above at an annealing temperature
of 45°C, using pFastBac1-MLH1 and pFastBac1-PMS2 as templates. An NheI restriction site
was   generated   upstream    of   the   MLH1    start   codon   with   primer   pairs   5’-
CGGATTATTCATACCGTCCC-3’ (fA) and 5’-GAAGAGCCAAGGGCTAGCGTGGCCT-
CG-3’ (rA), and 5’-CGAGGCCACGCTAGCCCTTGGCTCTTC-3’ (fB), and 5’-TTCTCCC
GTGGCTATGTTG-3’ (rB), for fragments A and B, respectively. A SacI site was generated
to replace the MLH1 stop codon using primer pairs 5’-CGGGTGCAGCAGCACATCG-3’
(fA) and 5’-CATAAATAACCAGAGCTCACACCTCTC-3’ (rA), and 5’-GAGAGGTGT
GAGCTCTGGTTATTTATG-3’ (fB) and 5’-CTGATTATGATCCTCTAGTAC-3’ (rB). The
products of the second PCRs were cloned into the pFastBac1-MLH1 vector between BamHI
and PvuII or NsiI and NotI sites, respectively. In PMS2, the stop codon was replaced and an
AgeI restriction site generated with primer pairs 5’-GGCTTT GATTTTGTTATCGATG-3’
(fA) and 5’-CTACGGTCAGACCGGTGAAATGACAC-3’ (rA), and 5’-GTGTCATTTCAC
CGGTCTGACCGTAG-3’ (fB) and 5’-GCATGCCTCGAGACTG CAGGCTC-3’ (rB). The
product of the second PCR was cloned into the pFastBac1-PMS2 vector between restriction
sites SpeI and NotI. The MLH1 and PMS2 cDNAs without stop codons were then cloned into
the pEGFP-N1 vector (Clontech) between NheI and SacI and BamHI and AgeI sites,
respectively. The resulting constructs expressing MLH1-EGFP and PMS2-EGFP fluorescent
fusion proteins are here termed pMLH1-EGFP and pPMS2-EGFP (Table A.2).




                                            42
All MLH1 mutation variants from the plasmid pFastBac1-MLH1, except MLH1-P28L,
MLH1-A29S, MLH1-TSI45-47CF, MLH1-D63E, MLH1-G67R, and MLH1-E71del, were
cloned into the pMLH1-EGFP vector between the BglII and AccIII sites. The variants
MLH1-A29S, MLH1-TSI45-47CF, MLH1-D63E, and MLH1-G67R were generated to the
pMLH1-EGFP plasmid between the NheI And EcoNI sites by site-directed mutagenesis
described above at an annealing temperature of 45°C. The sequences of inner primers (rA
and fB) carrying the mutation were same to those in Table A.1, and the sequences of outer
primers were: 5’-CGTAACAACTCCGCCCCATTG-3’ (fA) and 5’-GAGCTTGCTCTCGAT
GTGCTG-3’(rB).


Production of recombinant proteins

Protein production in insect cells (I–IV)
The human MutLα heterodimers containing the mutated MLH1 variants were produced in
insect cells which allow high expression levels and protein amounts needed for in vitro repair
and interaction assays. The cell lines used in the study and their specific features are
presented in Table A.3.


Spodoptera frugiperda 9 (Sf9) insect cells were grown in Grace’s Insect Medium (Gibco) in
the presence of 10% fetal bovine serum, 2 mM L-glutamine, and 50 units/ml of penicillin-
streptomycin at 27°C. For the production of mutant and wild-type(WT) MutLα heterodimers,
9×105 Sf9 cells were transfected separately using 6 µl of Cellfectin reagent (Invitrogen) with
5 µl (2.5-5 µg) of bacmid-DNA containing either MLH1 (WT or mutated) or PMS2 insert
(Fig. 8). The viral stocks were harvested after 72 hrs and then amplified for 120 hrs. For
protein extraction, 2×107 Sf9 cells were co-infected with MLH1 and PMS2 recombinant
baculoviruses (Fig. 8). The cells were cultured for 48 hrs.


Protein production in human cells (II–IV)
A human expression system was used to study the stability and expression levels of mutated
MutLα variants. The 293T human embryonic kidney cell line, which lacks MLH1 protein
because of promoter hypermethylation (Trojan et al. 2001), was grown in Dulbecco’s



                                              43
Modified Eagle Medium/F12 (Gibgo) with 5% fetal bovine serum, 2 mM L-glutamine, and
50 units/ml of penicillin-streptomycin at 37°C in a 5% CO2 atmosphere. For protein
production, 3×105 293T cells were seeded in a 35-mm well. After 16 hrs culturing, the cells
were co-transfected with 0.5 µg of pMLH1-N1 (WT or mutant) and 0.5 µg of pPMS2-N1
vectors using 3 µl of FuGene6 transfection reagent (Roche). After 48 hrs, the cells were
collected by trypsinization.


To study the subcellular localizations of mutated MutLα variants, we expressed MLH1-
EGFP and PMS2-EGFP fluorescent fusion proteins in 293T human cells. Three different
transfection combinations for each MLH1 variant were performed: 1) each pMLH1-EGFP
variant was expressed alone, 2) with pPMS2-N1, and 3) each pMLH1-N1 variant was
expressed with pPMS2-EGFP. The transfection procedure was similar to that above, except
1×105 293T cells were seeded onto glass coverslips, and cultured for only 4 hrs prior to
transfection. After transfection the cells were cultured for 24 hrs.


Total protein extraction from insect cells (I–IV)
Total proteins were extracted from Sf9 cells in 200 µl of ice-cold lysis buffer (25 mM Hepes,
2 mM β-mercaptoethanol, 0.5 mM spermidine, 0.15 mM spermine, 0.5 mM phenylmethyl-
sulfonyl fluoride, 2× Complete protease inhibitor mixture [Roche]) for 30 min. After centri-
fugation at 12,000 g for 50 min at +4°C, the supernatant was collected and NaCl to 100 mM
and glycerol to 10% were added.


Total protein extraction from human cells (II–IV)
For total protein extraction from 293T cells, the collected cells were washed twice with cold
PBS. The cells were then lysed in 60 µl of ice-cold extraction buffer (50 mM Tris-Cl pH 8.0,
350 mM NaCl, 0.5% Nonidet-P40, 1 × Complete protease inhibitor mixture [Roche], 1 mM
phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, 0.7 µg/ml pepstatin) for 25 min followed
by centrifugation at 16,000 g for 3 min at 4°C, after which the supernatant was preserved.




                                               44
Functional analyses

Western blot analysis (I–IV)
The MutLα expression levels in Sf9 insect and 293T human cells were examined by SDS-
PAGE and western blot analysis. Aliquots of Sf9 total protein extracts (5 and 10 µl) and of
293T total protein extracts (30 µl) were run on 8% SDS-polyacrylamide gel, and then blotted
onto a Hybond C membrane (Amersham Pharmacia Biotech) with 30 V for 16 hrs. Non-
specific antibody binding sites were blocked with 5% non-fat powdered milk in TBS
containing 0.05% Tween 20 for 1 h. The membrane was then blotted with monoclonal
antibodies against MLH1 (0.5 µg/ml) (BD Biosciences/PharMingen, clone 168-15) and
PMS2 (0.2 µg/ml) (Calbiochem/Oncogene Research, Ab-1). The naturally expressed β-
tubulin protein (anti β-tub: clone 5H1, BD Biosciences/PharMingen) was used as a control to
compare the expression levels of MutLα variants produced in 293T cells. Horseradish
peroxidase-linked anti-mouse immunoglobulin was used as a secondary antibody (Amersham
Pharmacia Biotech). The antibody-bound proteins were visualized by the ECL Western
blotting analysis system (Amersham Pharmacia Biotech), and the signals were exposed to the
ECL Hyperfilms (Amersham Pharmacia Biotech).


In vitro MMR assay (I–IV)


MMR capacity of the mutated MutLα variants was examined using an in vitro MMR assay.
For this, nuclear extracts of an MMR-deficient human cell line HCT116 (Table A.3) were
complemented with the recombinant MutLα variants produced in the Sf9 insect cells. A
circular DNA heteroduplexes containing a G•T mispair was used as a repair substrate in the
assay.


Nuclear protein extraction
TK6 human lymphoblasts (MMR proficient) and HCT116 human colon carcinoma cells
(MLH1−/−, MMR deficient) were cultured in RPMI 1640 or McCoy’s medium (Gibco),
respectively, with 10% fetal bovine serum, 2 mM L-glutamine, and 50 units/ml of penicillin-
streptomycin at 37°C in 5% CO2 atmosphere.




                                             45
For preparation of nuclear protein extracts for the in vitro MMR assay, 6×108 cells were
collected by trypsinization and centrifuged at 500 g for 10 min at 4°C. The pellet was re-
suspended in 3.5 ml of ice-cold isotonic buffer (20 mM Hepes pH 7.9, 5 mM KCl, 1.5 mM
Mg2Cl, 250 mM sucrose, 0.2 mM phenylmethylsulfonyl fluoride, 1× Complete protease
inhibitor mixture [Roche], 0.25 µg/ml aprotinin, 0.7 µg/ml pepstatin, 0.5 µg/ml leupeptin, 1
mM DTT) and centrifuged as above. The supernatant was then removed, and the pellet
suspended in 3.5 ml of ice-cold hypotonic buffer (isotonic buffer without sucrose). After
centrifugation at 500 g for 10 min at 4°C, the cells were resuspended in 3 ml of ice-cold
isotonic buffer, transferred to a tissue grinder and incubated on ice for 5 min. After 20 strokes
with a cold pestle, the nuclei were collected by centrifugation at 3,000 g for 10 min at 4°C.
The pellets were suspended in ice-cold extraction buffer (25 mM Hepes pH 7.5, 10%
sucrose, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM DTT, 1 µg/ml leupeptine) and NaCl
up to 155 mM was added. The suspension was rotated for 1 h at 4°C, and then centrifuged
for 20 min at 14,500 g at 4°C. The supernatant was then dialyzed for 50 min in a Slide-A-
Lyzer 3.5 K dialysis cassette (Pierce) in cold dialysis buffer (25 mM Hepes pH 7.5, 50 mM
KCl, 0.1 mM EDTA pH 8, 10% sucrose, 1 mM phenylmethylsulfonyl fluoride, 2 mM DTT,
1 µg/ml leupeptine), after which the buffer was exchanged and the dialysis continued for 50
min. After centrifugation at 16,000 g for 15 min at 4°C, the supernatant containing the
nuclear proteins was preserved.


Preparation of DNA heteroduplex
The circular DNA heteroduplexes containing a G•T mispair and a single-strand nick were
prepared as reported previously (Lu et al. 1983; Lahue et al. 1989; Holmes et al. 1990). First,
single-stranded DNA was produced in the E. coli strain XL1 Blue with a helper phage
M13K07 (New England Biolabs) using pGEM phagemide with a T•A basepair (T on the +
strand) as a template (Table A.2). Then, double-stranded DNA from pGEM phagemide with
C•G basepair (C on the + strand) was linearized with BanII restriction enzyme. Finally, 680
µg of single-stranded DNA (with T) was annealed with 140 µg of double-stranded linearized
DNA (with C•G basepair), generating circular heteroduplex DNA with a G•T mispair 369 bp
downstream from a single-strand nick made by BanII, with G on the nicked strand.




                                               46
Repair assay
Sf9 total protein extracts estimated to contain equal amounts of recombinant MLH1 (8.0 µg
of Sf9 extracts for MutLα-WT) were incubated at 37ºC for 30 min, together with 75 µg of
HCT116 nuclear extract. The reaction was carried out in a total volume of 20 µl, using 100
ng of DNA heteroduplex as the repair substrate in the presence of 5 mM Mg2Cl, 1 mM
gluthathione, 50 mg/ml of bovine serum albumin, 0.4 mM dNTPs, and 1.5 mM ATP. The
total salt concentration of protein extracts used in the reaction was determined, and KCl was
added so that the final salt concentration was 110 mM. After incubation, the repair reaction
was stopped by adding 0.7% SDS, 25 mM EDTA and 1.8 µg of Proteinase K. Proteins were
removed with phenol-chlorophorm-isoamylalcohol precipitation, and the repaired or non-
repaired DNA was precipitated by a conventional ethanol-precipitation method, and the
heteroduplex DNA was cut with endonucleases BsaI and BglII. If the repair reaction
occurred, the G•T mismatch was converted to A•T basepair, and BglII was able to cut the
DNA duplex. Digested DNA was run in 1% agarose gel with ethidium bromide, and the
repair efficiency was measured by the cleavage efficiency (the proportion of the amount of
double-digested DNA to the amount of total DNA). The efficiencies were quantified with
Image-Pro Version 4.0 (MediaCybernetics).


Detection of fluorescent fusion proteins (IV)
We expressed the fluorescent MLH1-EGFP and PMS2-EGFP proteins in 293T cells to study
the effects of MLH1 mutations on the subcellular localization of MutLα. For the detection of
fluorescent proteins, 24 hours after transfection the 293T cells were washed twice with PBS
and fixed with 4% paraformaldehyde in PBS for 20 min at room temperature. After fixation,
the cells were washed with PBS, and the nuclei were stained by incubating cells in PBS with
300 nM 4’,6’-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) for three min. Slides were
mounted with Fluorescence Mounting Medium (DAKO).


Intracellular localization of recombinant proteins was analyzed by direct fluorescence using
an Axioplan 2 microscope (Carl Zeiss). Each transfection was repeated at least three times,
and at least 200 cells from each individual transfection were analyzed from randomly
sampled microscope fields of view. Thus, subcellular localizations of recombinant MLH1 or
PMS2 proteins were evaluated from over 600 cells in each experiment. Representative




                                             47
images were taken with Isis 3.4.3 software (Metasystems) and processed with Adobe
Photoshop 6.0 (Adobe). The images were representative of at least 90% of the transfected
cells analyzed.


Combined co-immunoprecipitation and Western blot analysis (I–IV)
The co-immunoprecipitation assay was performed to study the effect of MLH1 mutations on
MLH1/PMS2 heterodimerization. For the assay, Sf9 (I–IV) or 293T (II) protein extracts
estimated to contain equal amounts of mutated or WT MLH1 (8.0 µg of Sf9 and 100 µg of
293T total extracts for MutLα-WT) were incubated for 1 h at 4°C on a rotating wheel with
0.5 µg of anti-MLH1 antibody (BD Biosciences/PharMingen, clone G168-728) or anti-PMS2
antibody (BD Biosciences/PharMingen, clone A16-4) in a total volume of 1 ml in RIPA lysis
buffer (150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM
Tris-Cl pH 8.0). A total of 20 µl of protein A/G agarose suspension (Santa Cruz) was added
and incubation was continued for a further 1.5 hrs. The precipitates were centrifuged for five
min at 2,500 g, washed three times with cold RIPA buffer, run on an 8% SDS
polyacrylamide gel, and transferred onto a Hybond C membrane. The interactions between
MLH1 and PMS2 were detected with Western blot analysis as above.




                                             48
RESULTS



Most of the mutations affected the expression or stability of the MLH1
protein (II-IV)

To determine whether the MLH1 mutations affect the stability of the respective MLH1
polypeptide, we expressed the protein variants transiently in 293T human embryonic kidney
cells. This cell line lacks the constitutive MLH1 protein because of hypermethylation of the
MLH1 promoter, and as a consequence, the PMS2 protein degrades and cannot be detected
either (Trojan et al. 2002). Thus, also PMS2-WT was also transiently expressed in the cells.
The MLH1 and PMS2 expression levels were examined in total protein extracts from 293T
cells with Western blot analysis. Endogenous β-tubulin protein was used as a loading control.


Among the 34 MLH1 mutations, 20 affected either the expression or stability of the encoded
MLH1 protein so that the quantities of the respective variants were lower than the quantity of
the MLH1-WT (Table 6). These mutations were: MLH1-P28L, MLH1-TSI45–47CF, MLH1-
D63E, MLH1-G67R, MLH1-del71, MLH1-C77R, MLH1-I107R, MLH1-L155R, MLH1-
V185G, MLH1-S247P, MLH1-H329P, MLH1-del330, MLH1-L550P, MLH1-A589D, MLH1-
del612, MLH1-del616, MLH1-del633–663, MLH1-P648L, MLH1-P648S, and MLH1-P654L.
As a consequence of low amounts of these MLH1 variants, the amount of PMS2-WT was
also lower than that expressed with MLH1-WT. The amount of MutLα-del633–663 was
extremely low, so that both mutant MLH1 and PMS2-WT were barely detectable in the
protein extract.


The amounts of the MLH1 variants MLH1-A29S, MLH1-F80V, MLH1-K84E, MLH1-
S93G, MLH1-V213M, MLH1-I219V, MLH1-K443Q, MLH1-K618A, MLH1-K618T,
MLH1-Y646C, MLH1-R659P, MLH1-R659Q, MLH1-A618T, and MLH1-V716M were
similar to that of the MLH1-WT (Table 6). The amounts of PMS2 expressed with these
variants were similar to that expressed with MLH1-WT.




                                             49
Table 6. Functional characterization of the MLH1 protein variants under study. Deficiency is
indicated in gray. Variants are classified as pathogenic (P) or non-pathogenic (N) based on
the functional results.
                                         Localization of MLH11 Localization of
  MLH1           Expression in In vitro                                  PMS2         Interaction Variant
                                            alone     with PMS2
  variant         293T cells    MMR                                  with MLH12 with PMS2 status
  P28L             Decreased Deficient       n.d.3        n.d.        Decreased         Normal 4         P
  A29S              Normal      Normal     Normal       Normal          Normal           Normal          N
  TSI45-47CF Decreased Deficient Decreased Decreased                  Decreased          Normal          P
  D63E             Decreased Deficient Decreased Decreased            Decreased          Normal          P
  G67R             Decreased Deficient Decreased Decreased            Decreased          Normal          P
  del71            Decreased Deficient       n.d.         n.d.        Decreased          Normal          P
  C77R             Decreased Deficient Decreased Decreased            Decreased          Normal          P
  F80V              Normal     Deficient Normal         Normal          Normal           Normal          P
  K84E              Normal     Deficient Decreased 5 Normal             Normal           Normal          P
  S93G              Normal      Normal     Normal       Normal          Normal           Normal          N
  I107R            Decreased Deficient Decreased Decreased            Decreased          Normal          P
  L155R            Decreased Deficient Decreased Decreased            Decreased          Normal          P
  V185G            Decreased Deficient Decreased Decreased            Decreased          Normal          P
  V213M             Normal      Normal     Normal       Normal          Normal           Normal          N
  I219V             Normal      Normal     Normal       Normal          Normal           Normal          N
  S247P            Decreased Deficient Decreased Decreased            Decreased          Normal          P
  H329P            Decreased    Normal Decreased Decreased            Decreased          Normal          P
  del330           Decreased Deficient Decreased Decreased            Decreased          Normal          P
  K443Q             Normal      Normal     Normal       Normal          Normal           Normal          N
  L550P            Decreased    Normal     Normal Decreased 5         Decreased          Normal          P
  A589D            Decreased    Normal     Normal Decreased 5         Decreased          Normal          P
  del 612          Decreased    Normal     Normal Decreased 5         Decreased          Normal          P
  del 616          Decreased    Normal     Normal Decreased 5         Decreased          Normal          P
  K618A             Normal      Normal     Normal       Normal          Normal           Normal          N
  K618T             Normal      Normal     Normal Decreased 5         Decreased          Normal          P
  del633-663       Decreased Deficient Normal Decreased 5             Decreased        Decreased         P
  Y646C             Normal      Normal     Normal       Normal          Normal           Normal          N
  P648L            Decreased    Normal     Normal Decreased 5         Decreased          Normal          P
  P648S            Decreased    Normal     Normal Decreased 5         Decreased          Normal          P
  P654L            Decreased    Normal     Normal Decreased 5         Decreased          Normal          P
  R659P             Normal     Deficient Normal Decreased 5           Decreased        Decreased         P
  R659Q             Normal      Normal     Normal       Normal          Normal           Normal          N
  A681T             Normal      Normal     Normal       Normal          Normal           Normal          N
  V716M             Normal      Normal     Normal       Normal          Normal           Normal          N
1
  The proportion of MLH1-EGFP localized in the nucleus expressed without or with PMS2. 2 The proportion of
PMS2-EGFP localized in the nucleus when expressed with MLH1. 3 n.d.: not determined. 4 Normal: similar to
the result received with the MLH1 wild-type. 5 The nuclear proportion of the particular protein variant was only
slightly reduced when compared to the corresponding result derived from MLH1-WT.


Mismatch repair deficiency was mainly associated with
aminoterminal MLH1 mutations (I-IV)

The ability of the MLH1 protein variants to complement the MLH1-deficient HCT116
nuclear extract so that it can repair mismatches were examined in the in vitro MMR assay. In
complementation, we used Sf9 total extracts including the MutLα variants. Among the 34




                                                      50
MLH1 mutations, 15 disrupted the MMR function of the encoded MLH1 protein (Table 6).
The negative controls (mock and HCT116 without Sf9 extracts), repaired the heteroduplex
substrate with the efficiencies of 0% and 5% ± 3%, respectively (Fig. 9). The repair
efficiencies of the two MMR-proficient MutLα variants, 42% ± 6.5% for MutLα-WT and
37% ± 2% for MutLα-I219V, were used as reference levels. The repair efficiencies of 15
MutLα variants were lower than the reference levels (Fig. 9). These variants were: MutLα-
P28L, MutLα-TSI45–47CF, MutLα-D63E, MutLα-G67R, MutLα-del71, MutLα-C77R,
MutLα-F80V, MutLα-K84E, MutLα-I107R, MutLα-L155R, MutLα-V185G, MutLα-
S247P, MutLα-del330, MutLα-del633–663, and MutLα-R659P. The efficiencies of the two
variants MutLα-H329P and MutLα-del612 were slightly reduced (Fig. 9).


In addition to MutLα-I219V, 16 variants repaired with a similar efficiency to the wild-type
MutLα (Table 6). These variants were: MutLα-A29S, MutLα-S93G, MutLα-V213M,
MutLα-K443Q, MutLα-L550P, MutLα-A589D, MutLα-del616, MutLα-K618A, MutLα-
K618T, MutLα-Y646C, MutLα-P648L, MutLα-P648S, MutLα-P654L, MutLα-R659Q,
MutLα-A618T, and MutLα-V716M.


Since most of the MLH1 variants were shown to be unstable but still functional in the in vitro
MMR assay, we also wanted to find out whether the possible minor functional defects of the
protein variants were actually compensated by the high protein quantity used in the assay.
This was done by titrating the Sf9/MutLα protein amounts. First, we used MLH1-del616 and
showed that when the protein amounts were 1/10 of those originally used, no reduction in the
repair ability were detected with either MutLα-WT or MutLα-del616 (II). When the amounts
were 1/20 of the original amounts, the repair efficiency of MutLα-WT was decreased slightly
(from 33% ± 2.9% to 29% ± 3.1%), while the repair efficiency of MutLα-del616 was
decreased from 31% ± 3.7% to 7% ± 3.1%. The titration experiment was also performed
with MutLα-K443Q, MutLα-Y646C, MutLα-P648S, and MutLα-V716M, whose repair
efficiencies, however, were not different from MutLα-WT (unpublished data).




                                             51
Figure 9. Mismatch repair efficiency of HCT116 nuclear extract (MLH1–/–) complemented with MutLα
variants produced in Sf9 cells. Mock contains only heteroduplex DNA without any proteins, HCT116 is a
negative control. The repair efficiencies are indicated as percentages, and were as follows: Mock 0%; HCT116
alone, 5% ± 3%; MutLα-WT, 42% ± 6.5%; MutLα-P28L, 2% ± 1%; MutLα-A29S, 45% ± 10%; MutLα-
TSI45-47CF, 2% ± 1%; MutLα-D63E, 8% ± 5%; MutLα-G67R, 1% ± 1%; MutLα-E71del, 3.5% ± 3%;
MutLα-C77R, 1% ± 1%; MutLα-F80V, 6% ± 5%; MutLα-K84E, 1% ± 1%; MutLα-S93G, 58% ± 3%; MutLα-
I107R, 1% ± 1%; MutLα-L155R, 7% ± 7%; MutLα-V185G, 8% ± 5%; MutLα-V213M, 39% ± 2.5%; MutLα-
I219V, 37% ± 2%; MutLα-S247P, 17% ± 8%; MutLα-H329P, 30% ± 13%; MutLα-I330del, 10% ± 10%;
MutLα-K443Q, 48% ± 12%; MutLα-L550P, 40.5% ± 2.5%; MutLα-A589D, 41.5% ± 3.5%; MutLα-V612del,
32% ± 2%; MutLα-K616del, 35% ± 4%; MutLα-K618A, 43.5% ± 7.5%; MutLα-K618T, 45.5% ± 8.5%;
MutLα-Y646C, 47% ± 7%; MutLα-P648L, 43% ± 2%; MutLα-P648S, 53% ± 7%; MutLα-P654L, 46.5% ±
6.5%; MutLα-R659P, 19.5% ± 9%; MutLα-R659Q, 36% ± 3%; MutLα-A681T, 48.5% ± 6.5%; MutLα-
V716M, 46% ± 7.5%, MutLα-del633-663, 1% ± 1%. The data are presented as the average of 3–10 independent
experiments ± SD.




                                                     52
The unstable MLH1 variants affected subcellular localization of
MutLα (IV)


To study the subcellular localization of the MLH1 variants we first fused the MLH1 and
PMS2 cDNAs with cDNA of the EGFP gene and then transiently expressed the fluorescent
protein variants in 293T human cells.


In transfection, we used three combinations of vectors: (i) the pMLH1-EGFP variant alone,
(ii) the pMLH1-EGFP variant together with pPMS2-N1, and (iii) pPMS2-EGFP with each
pMLH1-N1 variant. Thus, we were able to study (i) the location of MLH1 alone; (ii) the
location of MLH1 when PMS2 was present; and (iii) the location of PMS2 expressed with
the respective MLH1 variant. The study situation was similar in (ii) and (iii), except a
different protein was fluorescent.


When expressed without PMS2, the wild-type MLH1 protein was detected almost completely
in the nucleus, and when PMS2 was added, a very small cytoplasmic proportion of the
MLH1-EGFP protein seen when PMS2 was not present was also imported into the nucleus.
In contrast, when expressed without MLH1, PMS2-EGFP was located mainly in the
cytoplasm, and the intensity of fluorescence was lower than that of MLH1-EGFP. When
expressed with MLH1, PMS2-EGFP was mainly nuclear with increased intensity of
fluorescence.


Altogether, the MLH1 variants which affected the subcellular localization of either MLH1 or
PMS2 in our localization study can be divided into two cathegories. The first group includes
the MLH1 variants i) which were located mostly in the cytoplasm when expressed without
PMS2, ii) the nuclear proportion was only slightly increased when PMS2 was added, and iii),
PMS2 was also mainly cytoplasmic when expressed with these MLH1 variants. The first
group consists of the aminoterminal variants MLH1-TSI45–47CF, MLH1-D63E, MLH1-
G67R, MLH1-C77R, MLH1-I107R, MLH1-L155R, MLH1-V185G, MLH1-S247P, MLH1-
H329P, and MLH1-del330 (Table 6). The second group includes the MLH1 variants i) which
were almost completely nuclear, like the wild-type MLH1 when expressed alone, ii) the
nuclear proportion was not increased when PMS2 was present, and iii) PMS2-EGFP



                                            53
remained mainly cytoplasmic when expressed with these MLH1 variants. The second group
consists of the carboxylterminal variants MLH1-L550P, MLH1-A589D, MLH1-del612,
MLH1-del616, MLH1-K618T, MLH1-del633–663, MLH1-P648L, MLH1-P648S, MLH1-
P654L, and MLH1-R659P (Table 6).


The nuclear localization of the variant MLH1-K84E was only slightly reduced without
PMS2. The subcellular localization of the variants MLH1-P28L and MLH1-del71 could not
be determined because of problems in the cloning phase. However, PMS2-EGFP was mainly
cytoplasmic when expressed with either of the two MLH1 variants. The variants MLH1-
A29S, MLH1-F80V, MLH1-S93G, MLH1-V213M, MLH1-I219V, MLH1-K443Q, MLH1-
K618A, MLH1-Y646C, MLH1-R659Q, MLH1-A681T, and MLH1-V716M were similar to
MLH1-WT in the localization study (Table 6).


Most MLH1 variants interacted with PMS2 in the co -
immunoprecipitation assay (I-IV)


The co-immunoprecipitation assay was performed to study the effect of MLH1 mutations on
MLH1/PMS2 heterodimerization. The analysis was performed using Sf9 total extracts with
overexpressed MLH1 variants and PMS2-WT. The protein extracts were incubated with
agarose beads covered with antibodies against either MLH1 or PMS2. The precipitants were
then detected with Western blot analysis. In study II, we also used total extracts of the 293T
cells to investigate the interactions of MLH1-WT and MLH1-del616 with PMS2.


Generally, the MLH1/PMS2 interaction was not inhibited (Table 6). Only the variants
MLH1-del633-663 and MLH1-R659P were defective in the MLH1/PMS2 interaction, so that
PMS2 could not be co-precipitated with either of these two variants (Table 6).


Genotype and phenotype correlations (I-IV)


We aimed to find genotype-phenotype correlations by comparing the results of functional
studies with clinical data obtained from the families under study. Based on the results of our
functional analysis, the MLH1 variants were interpreted as pathogenic or non-pathogenic.



                                             54
The interpretations were collected to Table 7 together with clinical characteristics of patients
and their families.


Thirty-one of the MLH1 alterations under study were found in 52 different families. Thirty-
one of these families carry alterations which were pathogenic in our assays, and 21 families
carry non-pathogenic alterations (Table 7). The index patient was diagnosed for CRC or EC
before the age of 50 in 28/31 families (90%) which carry pathogenic MLH1 alterations. In
three cases the age was over 50 years (Table 7). Among the families carrying non-pathogenic
variants, 12/21 (57%) index patients were diagnosed before the age of 50. In nine cases
(43%) the index patient was over 50 years of age at the time of cancer diagnosis.


In 75% (39/52) of all the families, the average age of cancer onset was < 55 years (Table 7).
The average includes all affecteds, not only mutation carriers. Among the families carrying
pathogenic MLH1 mutations, the average age was < 55 years in all families. In one case, the
index patient was the only affected one and the average was not determined. Among the
cases with non-pathogenic alterations, the average were determined in 16 cases. In five cases,
the index patient was the only affected. The average was < 55 years in 9/16 cases, and over
55 in 7/16 cases.


A total of 44 tumors were analysed for MSI and as a result, 38 tumors were reported to have
a high MSI status (Table 7). Sixty-six % of them (25) were found in families carrying
pathogenic MLH1 mutations. All the tumors reported to have low or no MSI were occurred
in the families carrying non-pathogenic MLH1 alterations.




                                              55
Table 7. Phenotypic characteristics of the patients and their families carrying the MLH1
alterations under study, and the result of functional interpretation of the corresponding
MLH1 variant.
    MLH1          No. of      Index      Average age             Functional      Additional MLH1
    variant      Patients1   Patient 2    of onset 3    MSI4   interpretation        mutations? 5
    P28L             4       CRC/30           37        High     Pathogenic            Not found
    P28L             2       CRC/27           29        High     Pathogenic            Not found
    A29S             4       CRC/37           47        High   Non-pathogenic    MLH1, g. –27C>A
    TSI45–47CF       4       CRC/32           43        N.D.     Pathogenic            Not found
    D63E             3       CRC/44           41        High     Pathogenic            Not found
    G67R             1       CRC/36        N.D. 6       High     Pathogenic            Not found
    del71            8       CRC/24           27        High     Pathogenic            Not found
    del71            9       CRC/19           36        High     Pathogenic            Not found
    C77R            10       CRC/22           32        High     Pathogenic            Not found
    F80V             3       CRC/51           52        High     Pathogenic            Not found
    K84E             2       CRC/32           36        High     Pathogenic            Not found
    S93G            13       CRC/70           65        N.D.   Non-pathogenic          Not found
    I107R            7        EC/46           49        High     Pathogenic            Not found
    I107R            7       CRC/53           51        High     Pathogenic            Not found
    I107R            7        CA/46           46        N.D.     Pathogenic            Not found
    I107R            4       CRC/30           54        High     Pathogenic            Not found
    L155R            5       CRC/33           41        High     Pathogenic            Not found
    V185G            8       CRC/43           44        High     Pathogenic            Not found
    V213M            3       CRC/64           58        Low    Non-pathogenic          Not found
    V213M            4        EC/44           53        High   Non-pathogenic          Not found
    V213M            1       CRC/67          N.D.       High   Non-pathogenic          Not found
    V213M            2       CRC/46           42        High   Non-pathogenic          Not found
    S247P           10       CRC/43           44        N.D.     Pathogenic            Not found
    S247P            4       CRC/42           49        High     Pathogenic            Not found
    H329P            8       CRC/32           44        High     Pathogenic            Not found
    del330           6       CRC/29           41        High     Pathogenic            Not found
    K443Q            8       CRC/57           62        High   Non-pathogenic          Not found
    L550P            3       CRC/45           35        High     Pathogenic            Not found
    A589D            3       CRC/34           34        High     Pathogenic            Not found
    del612           5       CRC/47           51        N.D.     Pathogenic            Not found
    del616          12       CRC/44           50        High     Pathogenic            Not found
    K618A            2       CRC/43           41        High   Non-pathogenic          Not found
    K618A            5       CRC/33           43        N.D.   Non-pathogenic          Not found
    K618A            3       CRC/76           77        Low    Non-pathogenic          Not found
    K618A            2       CRC/72           72        High   Non-pathogenic          Not found
    K618A            1       CRC/69          N.D.       Low    Non-pathogenic          Not found
    K618A            1       CRC/44          N.D.       MSS    Non-pathogenic          Not found
    K618A           10       CRC/32           38        High   Non-pathogenic MLH1, c. 1976G>A (R659Q)
    Y646C            1       CRC/36          N.D.       High   Non-pathogenic          Not found
    P648L            4       CRC/43           43        High     Pathogenic            Not found
    P648S           11       CRC/54           50        High     Pathogenic            Not found
    P654L            3       CRC/35           53        N.D.     Pathogenic            Not found
    P654L            6       CRC/31           50        N.D.     Pathogenic            Not found
    P654L            7       CRC/38           54        High     Pathogenic            Not found
    P654L            2       CRC/41           50        High     Pathogenic            Not found
    R659P            7       CRC/35           45        High     Pathogenic            Not found
    R659Q           10       CRC/32           38        High   Non-pathogenic          Not found
    A681T            1       CRC/38          N.D.       High   Non-pathogenic          Not found
    V716M            3       CRC/65           67        Low    Non-pathogenic          Not found
    V716M            6        EC/39           45        High   Non-pathogenic          Not found
    V716M            2       CRC/43           57        High   Non-pathogenic          Not found
    V716M           12       CRC/52           46        MSS    Non-pathogenic          Not found
1
 Number of affected patients with HNPCC tumors. 2 The type of tumor and the age of onset (years) of the index
patient. Ages < 50 years are indicated in gray. 3 Average age of cancer onset in all affecteds in the family.
Averages < 55 years are indicated in gray. 4 MSI status of the tumor from the index patient. High statuses are
indicated in gray. 5 Possible additional MMR gene mutations found in the family are indicated in gray. 6
Average ages were not determined, if the index patient is the only affected. N.D., not determined.




                                                       56
DISCUSSION



One of the central problems in the diagnosis of HNPCC is the interpretation of missense
mutations. Furthermore, the variety of clinical phenotypes of putative HNPCC kindreds
interferes with diagnostics, counselling and design of appropriate follow-up and treatment
strategies. The biological tools to predict the pathogenicity of the different mutations would
be of prime clinical importance.


The present study attempted to determine the pathogenicity of nontruncating MLH1 germline
alterations found in putative HNPCC patients. Furthermore, we wanted to characterize how
these alterations affect the MLH1 protein and cause the pathogenicity. Generally, mutations
can be pathogenic in four basic ways affecting the quality or quantity of the encoded protein,
or the location or timing of its production. Some mutations may affect the protein in more
than one of these ways.


Here, the functional significance of 34 minor MLH1 alterations was elucidated by
characterizing the stability/expression, MMR capability, and subcellular localization of the
mutated protein variants. The results suggested that 24 of the 34 alterations were pathogenic,
while 10 were non-pathogenic.


Minor aminoterminal MLH1 mutations cause protein instability and
defective mismatch repair (I, IV)


Most of the variants which carry mutations in the aminoterminal half of the MLH1
polypeptide (in codons 28–330) were both unstable when expressed in human cells and
defective in MMR. This group includes the variants MLH1-P28L, MLH1-TSI45–47CF,
MLH1-D63E, MLH1-G67R, MLH1-del71, MLH1-C77R, MLH1-I107R, MLH1-L155R,
MLH1-V185G, MLH1-S247P, and MLH1-del330. MLH1-F80V and MLH1-K84E were
defective in MMR but still stable. The average repair efficiencies of the deficient variants
varied between 1% and 10% excluding MLH1-S247P, whose repair efficiency (17%) was
higher but still lower than that of the WT protein (42%). In contrast, the repair efficiency of



                                              57
the variant MLH1-H329P, in which the mutation is located in the middle of the polypeptide,
was as high as 30%, indicating its repair proficiency.


The results derived from our expression and repair assays are consistent with the current
knowledge of the structure and function of the MLH1 protein. The aminoterminal MLH1
mutations are unlikely to affect the interaction between MLH1 and PMS2, because the
interaction region in MLH1 is carboxylterminal (Guerrette et al. 1999; Kondo et al. 2001).
Instead, the mutations in the aminoterminal part of the MLH1 polypeptide most likely disrupt
the binding and/or hydrolysis of the ATP molecule. Four aminoterminal motifs in MLH1
have been shown to be responsible for ATP binding/hydrolysis and are highly conserved
between the members of GHKL ATPase superfamily (Bergerat et al. 1997; Mushegian et al.
1997; Dutta and Inouye 2000). Furthermore, the binding and hydrolysis of ATP is shown to
be critical for stability and function of MutLα (Ban et al. 1999; Tran and Liskay 2000;
Räschle et al. 2002). Consistent with this, the pathogenicity of 11 aminoterminal MLH1
mutations associated with both malfunction and low amount of the encoded protein.


Some of the aminoterminal MLH1 mutations probably directly affect ATP binding and
hydrolysis, while the others alter the protein structure around the ATP-binding site. The
variant MLH1-D63E is interesting. Substitution of D63 has been previously shown to
dramatically reduce the expression of MutLα (Räschle et al. 2002), consistent with the fact
that the aspartic acid 63 (58 in E. coli) lies in the bottom of the ATP-binding pocket of MutL
and forms a direct hydrogen bond with the exocyclic aminogroup of the adenine base (Ban et
al. 1999). Analogously, in the present study, the expressed amount of MLH1-D63E was
lower than the amount of MLH1-WT both in Sf9 and 293T cells.


Evidence for the instability of the MLH1 variants carrying aminoterminal mutations was also
provided by detection of decreased amounts present in the nucleus, most likely caused by
degradation of the variants already in the cytoplasm. As a consequence, PMS2 degrades as
well. PMS2 is frequently reported to be unstable in the absence of MLH1, or more
specifically, ATP-binding by MLH1 (Tran and Liskay 2000; Räschle et al. 2002). The
subcellular localization of two variants, MLH1-P28L and MLH1-del71, could not be
determined because of the problems in the cloning phase. However, in the co-transfections,




                                              58
PMS2-EGFP localized similarly with these two variants as with the other variants, which
were unstable in the human expression system and defective in in vitro MMR. In the context
of ATP binding/hydrolysis, the mechanisms of pathogenicity of MLH1-F80V and MLH1-
K84E are different from the other aminoterminal mutations because they caused only
defective MMR, not protein instability.


MLH1-K84E may interfere with the nuclear import of MLH1 (IV)


MLH1-K84E was the only protein variant included in the study which was stable in 293T
cells, but, without PMS2, its nuclear proportion was reduced when compared to the
corresponding result derived from MLH1-WT. When PMS2 was present, the nuclear
proportions of MLH1-K84E and MLH1-WT were similar. This result suggests that the
substitution of a lysine by a glutamatic acid at position 84 affects the nuclear import of
MLH1. In the co-expression with PMS2 the variant was imported normally into the nucleus,
most probably by assistance of a functional nuclear localization signal (NLS) in PMS2,
which has been shown to import the whole MutLα into the nucleus (Wu et al. 2003).


A recent study performed with mouse protein homologues suggested that PMS2 expressed
alone does not reside in the nucleus because of impaired nuclear import, and that the
dimerization of MLH1 and PMS2 is essential for the nuclear import of MutLα (Wu et al.
2003). Furthermore, another study showed that MLH1 resides in the nucleus independently
of PMS2, whereas nuclear localization of PMS2 requires MLH1 (Luo et al. 2004). Consistent
with that, our unpublished studies with the human MLH1 and PMS2 proteins have shown
that the formation of MutLα is essential for nuclear transport of PMS2 but not of MLH1
(Raevaara et al., unpublished data).


The NLS of human and mouse MLH1 is suggested to consist of the residues PRKRHK. This
represents a "classical" NLS, originally identified in the simian virus SV40 large T antigen
(Kalderon et al. 1984). In our unpublished studies, the MLH1 polypeptide was shown to have
an NLS at codons 468–473, consistent with the NLS in the mouse Mlh1 at the similar
postition (Wu et al. 2003). However, the results of the present study suggest that residue 84
may have a role in the nuclear targeting of MLH1.




                                             59
Pathogenicity of minor carboxylterminal MLH1 mutations is mainly
associated with protein instability (II–IV)


In addition to the 11 aminoterminal mutations, which caused protein instability, eight
variants with carboxylterminal mutations were also unstable when expressed in the 293T
cells. Here, the instability is most probably associated with structural changes in the
polypeptide, not with the defective ATP binding/hydrolysis. The different cause of the
instability between the aminoterminal and carboxylterminal variants is supported by the
finding that carboxylterminal variants showed instability only when extracted from the 293T
cells and detected with Western blot analysis. When they were fused with EGFP and detected
by fluorescence in situ they were as stable as the wild-type MLH1.


Remarkably, among the carboxylterminal mutations (between the codons 443 and 716), only
MLH1-del633–663 and MLH1-R659P affected the mismatch repair function in vitro. Their
pathogenicity is associated with deficient interaction between MLH1 and PMS2, verified in
the co-immunoprecipitation assay. Furthermore, the repair efficiency of the variant MLH1-
del612 was slightly reduced (32%), but still classified as normal. The PMS2 interaction motif
in the MLH1 polypeptide is mapped to the amino acids 492–743 or 506–743 (Guerrette et al.
1999; Kondo et al. 2001). Accordingly, the pathogenicity of carboxylterminal MLH1
mutations are often proposed to be associated with the defective interaction with PMS2
(Guerrette et al. 1999; Brieger et al. 2002). However, previous studies have shown that all
amino acid substitutions in the interaction region do not prevent the interaction (Ellison et al.
2001; Kondo et al. 2003).


Eight carboxylterminal variants, MLH1-L550P, MLH1-A589D, MLH1-del612, MLH1-
del616, MLH1-K618T, MLH1-P648L, MLH1-P648S, and MLH1-P654L were proficient in
the in vitro MMR assay and showed interaction with PMS2. Furthermore, when fused with
EGFP, they were detected in the nucleus at similar levels as MLH1-WT. However, PMS2-
EGFP was still highly cytoplasmic when expressed with these MLH1 variants. Because
PMS2 is not imported into the nucleus without MLH1, the results may suggest problems in
their heterodimerization, which were undetectable in the co-immunoprecipitation assay.




                                               60
The previous results of the functionality and stability of MLH1-K618T are controversial
(Shimodaira et al. 1998; Guerrette et al. 1999; Brieger et al. 2002; Trojan et al. 2002; Kondo
et al. 2003). Based on our functional results, MLH1-K618T may slightly affect the MutLα
formation, but does not inhibit it totally. When the protein amount was adequate, it was
repair-proficient in the MMR assay.


In study II, we repeated the in vitro MMR assay and reduced the MutLα protein amounts
used. By lowering the optimal amount of the protein the repair efficiency of MLH1-del616
decreased much quicker than that of MLH1-WT, suggesting that the amount of protein is
critical to the repair function of MLH1-del616. This variant was previously shown to be
pathogenic, but its pathogenicity was suggested to be associated with defective formation of
MutLα (Shimodaira et al. 1998; Guerrette et al. 1999), whereas in our study MLH1-del616
was unstable but still able to repair mismatches, suggesting that its pathogenicity is linked to
shortage of the functional protein.


Minor deletions and proline substitutions cause instability of MLH1
(III, IV)


It is noteworthy that all deletions (MLH1-TSI45–47CF, MLH1-del71, MLH1-del330,
MLH1-del612, MLH1-del616, and MLH1-del633–663) independent of their location in
MLH1, caused protein instability in the human expression system. Especially the amount of
MLH1-del633–663 was nearly undetectable in the Western blot analysis.


Furthermore, excluding MLH1-R659P, all mutations (MLH1-P28L, MLH1-S247P, MLH1-
H329P, MLH1-L550P, MLH1-P648L, MLH1-P648S, MLH1-P654L) which lead to proline
substitutions caused protein instability. This phenomenon may be explained by the structure
of proline, which has an important role in protein folding (Eyles and Gierasch 2000). The
rigidity of the ring side-chain makes the folding of proline residues in protein structures
difficult. Proline often plays a role in turns of polypeptide chains, and also as a breaker of α
helices. Because of these unique characters, proline substitutions may seriously affect protein
structures (Eyles and Gierasch 2000).




                                              61
No support for pathogenicity of 9 MLH1 alterations found in putative
HNPCC families (IV)


We found no support for pathogenicity of protein variants MLH1-A29S, MLH1-S93G,
MLH1-V213M, MLH1-K443Q, MLH1-K618A, MLH1-Y646C, MLH1-R659Q, MLH1-
A681T, and MLH1-V716M. Additionally, the variant MLH1-I219V, which is classified as
polymorphism and has been shown to be non-pathogenic in previous functional assays
(http://www.InSiGHT-group.org; Shimodaira et al. 1998; Ellison et al. 2001; Trojan et al.
2002; Kondo et al. 2003), was also totally proficient in all our assays. MLH1-S93G and
MLH1-V213M are also classified as non-pathogenic based on previous functional results
(Ellison et al. 2001; Nyström-Lahti et al. 2002: Kondo et al. 2003), which is consistent with
the results of the present study.


In some cases, the cancer susceptibility has been later shown to be associated with another
MLH1 mutation. In the family carrying MLH1-A29S, another MLH1 mutation (g. –27C>A)
was found to segregate with the disease. This mutation affects the untranslated region and its
pathogenicity should be characterized by RNA-based methods.


Furthermore, the family, which showed the most severe HNPCC phenotype among MLH1-
K618A-carrying families in the present study, carries also another MLH1 mutation, c.
1976G>A (R659Q). Both of the resulting MLH1 protein variants, K618A and R659Q, were
non-pathogenic in our functional assays.


Remarkably, three previously described MLH1 alterations, a nonsense mutation c. 1975C>T
(R659X) and missense mutations c. 1976G>C (predicted coding change R659P) and c.
1976G>T (R659L), which affect the same codon as c. 1976G>A (R659Q), have been
reported to lead to an aberrant skipping of exon 17 (Nyström-Lahti et al. 1999). Nonsense,
missense, and even translationally silent mutations can affect resulting gene products by
inducing the splicing machinery to skip the mutant exons (Cartegni et al. 2002). Apparently,
these mutations in MLH1 codon 659 alter cis-elements, for example exonic splicing
enhancers (ESEs) that are important for correct splicing (Cartegni et al. 2002). The resulting
protein variant MLH1-del633–663 is both MMR-deficient and unstable (Nyström-Lahti et al.




                                             62
2002 and present study). We suggest that MLH1 mutation c. 1976G>A may also lead to
aberrant splicing of exon 17, as do all other published one-nucleotide mutations affecting
codon 659, and may be the susceptibility allele in the family carrying two MLH1 alterations.
Remarkably, our cDNA-based experiments can not be used to detect splicing defects.
Possible aberrant splicing should be verified from RNA derived from the patients carrying
these germline mutations.


MLH1-K618A affects a repeat of three lysine residues, located at codons 616–618 of the
MLH1 polypeptide. Two other MLH1 mutations, MLH1-del616 and MLH1-K618T, affect
the same region. However, it has been shown that different mutations even in the same codon
can cause either complete elimination of MMR function or have little-to-no effect on protein
function (Ellison et al. 2001). Consistent with this, the protein variant MLH1-K618A acted
similarly to WT MLH1 in all our assays, while MLH1-K618T had problems in the
localization assay, and MLH1-del616 had problems both in stability and localization. MLH1-
K618A is classified both as pathogenic and non-pathogenic in the InSiGHT database
(http://www.insight-group.org/). It has shown pathogenicity in a functional study, in which it
has been suggested to affect the interaction between MLH1 and PMS2 (Guerrette et al.
1999). In another study, it was suggested to be non-pathogenic or affect only slightly the
interaction between MLH1 and PMS2 (Kondo et al. 2003).


Basic criteria in support of pathogenicity of a missense alteration include evolutionary
conservation of the original residue and an amino acid change of a nonconservative nature.
Four of the 10 MLH1 alterations which acted similar to WT in our assays affect amino acids,
which are conserved between human and yeast S. cerevisiae. These residues are K443, Y646,
R659, and A681. The other six affect nonconserved amino acids. Seven of the 10 alterations
(MLH1-A29S, MLH1-S93G, MLH1-K443Q, MLH1-K618A, MLH1-Y646C, MLH1-R659Q,
and MLH1-A681T) lead to nonconservative substitutions, which change the polarity of the
residue in question.


To further estimate the significance of the MLH1 variants under study, our collaborators
constructed multiple sequence alignments of human MLH1 with 20 other eukaryotic species
using ClustalW software (Thompson et al. 1994) (IV). The SIFT (Sorting Intolerant From




                                             63
Tolerant) program was used to predict the outcome of all missense variants (deletions were
excluded) (Ng and Henikoff 2001). SIFT classifies each amino acid substitution as tolerated
or deleterious. SIFT correctly predicted the functional results for 23 out of 28 variants (IV).
Eight out of 10 functionally non-pathogenic variants were predicted as tolerated (A29S,
S93G, V213M, I219V, K443Q, K618A, R659P, V716M). Y646C and A681T were predicted
as deleterious. Statistically valid conclusions based on sequence homology are usually
limited by insufficient sample size of tested variants, insufficient size of sequence databases,
insufficient epidemiological data, or lack of reliable functional assays (Cooper et al. 2003;
Greenblatt et al. 2003; Fleming et al. 2003; Mooney et al. 2003; Goldgar et al. 2004). The
present study addresses all of these limitations.


MLH1 alterations with multiple, mild, or no defects in functional
assays are linked to distinct clinical phenotypes (I-IV)


By comparing the genetic and biochemical data derived from the functional assays with the
clinical data, we aimed to find genotype-phenotype correlations in the studied families.
Altogether, 22 of 34 mutations were shown to be pathogenic in more than one assay (Table
6). These multidefective MLH1 mutations are all associated with early age of cancer onset
and high MSI phenotype in the tumors (Table 7).


Two mutations, MLH1-F80V and MLH1-K618T, interfered only with a single protein
function in our assays. MLH1-F80V caused MMR defect but no protein instability or
dislocation. Consistent with this, MLH1-F80V caused high MSI phenotype but the MLH1
protein was still present in the tumor (Table 5). The variant MLH1-K618T affected the
nuclear localization of PMS2, but acted otherwise normally.


Many families that carry one of the variants whose pathogenicity remained obscure are
associated with nontypical or mild features of HNPCC. The variant MLH1-S93G was found
in a family in which the mean age of cancer onset was notably high (65 years), when it
normally is < 50 years (Lynch et al. 1993). The variant MLH1-V213M was found in four
families which do not fulfill the Amsterdam criteria (Table 5) (Vasen et al. 1991, 1999).
MLH1-K443Q was found in one family which does not fulfill the Amsterdam criteria, and in



                                               64
which the mean age of cancer onset was relatively high (62 years). MLH1-K618A is one of
the germline MMR gene mutations which are found worldwide (Peltomäki and Vasen 2004).
The present study includes 7 families with the MLH1-K618A alteration. In these families, the
mean ages of onset varying between 38 and 77, MSI phenotypes were of high, low or no
instability, and IHC analyses revealed loss or no loss of MLH1 in the tumors. MLH1-Y646C
was found only in one individual with CRC, and IHC analysis revealed no loss of MLH1
protein in the tumor tissue. Also MLH1-A681T was found only in one affected individual.
MLH1-V716M was found in four families in which the mean age of cancer onsets varied
between 45 and 67. The MSI phenotypes of tumor tissues were of high, low or no instability,
and the IHC analysis revealed loss or no loss of MLH1 protein.


As a conclusion, the MLH1 variants which remained non-pathogenic in our functional
assays, are likely to be harmless variants or cause in vivo a slight effect which is undetectable
by the methods used in the present study. This is supported by the mild or atypical HNPCC
characteristics of the families carrying these gene variants, and by the comparative sequence
analysis. On the other hand, there are families carrying these non-pathogenic MLH1
alterations, but which show typical HNPCC characteristics including highly MSI-positive
tumors and early ages at cancer onset. These families should be examined to evaluate
possible further MMR gene mutations.


MLH1-P648S homozygosity is associated with mild features of
neurofibromatosis type I (III)


The individuals who are homozygous for an MMR gene mutation or carry germline
mutations in both alleles of an MMR gene have usually hematological malignancies and
features of de novo neurofibromatosis type 1 syndrome (NF1) such as café-au-lait spots,
axillary freckles, and neurofibromas (Table 2) (Ricciardone et al. 1999; Wang et al. 1999; De
Rosa et al. 2000; Trimbath et al. 2001; Vilkki et al. 2001; Whiteside et al. 2002; Bougeard et
al. 2003; De Vos et al. 2004; Gallinger et al. 2004; Menko et al. 2004).


The mutation MLH1-P648S has been previously found in a Danish HNPCC family with 10
colorectal cancer patients (Bisgaard et al. 2002). A 6-year-old child conceived from a



                                               65
consanguineous mating between first cousins and homozygous for the mutation displayed
café-au-lait spots and a skin tumor clinically diagnosed as a neurofibroma, but no other
abnormalities. The mutation cosegregated with disease phenotype in the family, and was
associated with the typical HNPCC phenotype including excess of colorectal cancers in
affected individuals, average age of onset at 50 years, high MSI and lack of MLH1 protein in
the tumor tissues.


To date, four HNPCC families with individuals carrying homozygous germline MLH1
mutations have been described (Ricciardone et al. 1999; Wang et al. 1999; Vilkki et al. 2001;
Gallinger et al. 2004). The children, who carried a homozygous MLH1 mutation R226X,
were diagnosed with NF1 (Ricciardone et al. 1999). One of the patients developed atypical
chronic myeloid leukemia at 12 months, the other developed non-Hodgkin’s lymphoma at 39
months, and the third child has an acute leukemia diagnosed at the age of 24 months (Table
2). In the second reported case, two sisters carried a homozygous MLH1 mutation G67W
(Wang et al. 1999) and had the clinical features of NF1. One of the children died at the age
of 2 of non-Hodgkin’s lymphoma, and the other was diagnosed with acute myeloid leukemia
at age 6, and with medulloblastoma at age 7. Both of the mutations described above were
found in typical HNPCC families. The third published report of an MLH1-deficient child
describes a girl homozygous for the deletion of exon 16 (Vilkki et al. 2001). The child died
at the age of 4 of hemorrhage caused by a glioma, and had also clinical features of NF1. The
fourth homozygous mutation, MLH1-R687W, was found in three children (Gallinger et al.
2004). All the children showed features of NF1, and, remarkably, two children were
diagnosed for gastrointestinal malignancies, one at the age of 9 years, and another at the age
of 12 years. Furthermore, HNPCC-type malignancies were also found in other family
members.


The occurrence of a de novo NF1 syndrome in children homozygous for an MMR gene
mutation suggests that the NF1 gene is a target for the mutator phenotype, and that NF1
might be mutated at an early stage of embryogenesis. The mutations might be mosaic,
affecting small fractions but not all cells (Tinschert et al. 2000). A specific feature of the NF1
gene is its high rate of spontaneous mutations, which could be explained by the large size of
the gene (approx. 350 kb), the excess of repetitive sequences, and gene conversions caused




                                               66
by pseudogenes (Fahsold et al. 2000). A study with MLH1-deficient cell lines has revealed a
high mutation rate in the NF1 gene as well (Wang et al. 2003).


As discussed earlier, the alteration MLH1-P648S does not affect the functionality of the
mutant MLH1, but does affect the protein stability. This was supported by the data obtained
from our IHC analysis, which showed loss of MLH1 protein in the tumors of the family
members. Finally, it is tempting to speculate that there might be a connection between the
mild disease phenotype in the homozygote child and the pathogenicity of the mutation
associated with shortage of the functional protein. The 6-year-old homozygous boy had only
two small café-au-lait spots and one small skin tumor, and furthermore, he has not developed
any hematological malignancies. However, more information about this homozygous patient
is needed. For example, MSI analysis from different tissues would offer data about the
degree and timing of the MMR defect.




                                             67
CONCLUSIONS AND FUTURE PROSPECTS



The present study was undertaken to evaluate the pathogenicity of 34 minor MLH1
alterations. Thirty-one of these were found in putative HNPCC families with varying clinical
phenotypes and three were collected from the HNPCC mutation database. Using four
different functional assays, we concluded that 24 were pathogenic mutations and 10 non-
pathogenic alterations.


Twenty mutations affected the quantity of the MLH1 protein. Fourteen mostly aminoterminal
mutations were defective in the in vitro MMR assay. Altogether, 22 mutations were
pathogenic in more than one assay, two mutations were pathogenic only in one assay, and 10
MLH1 variants acted similarly to the wild-type protein in the functional assays.


Aminoterminal MLH1 mutations caused protein instability and repair deficiency most likely
by affecting the ATP binding/hydrolysis capability of MLH1. Carboxylterminal mutations
caused problems in protein stability and subcellular localization. Two carboxylterminal
mutations affected the heterodimerization of MLH1 and PMS2 so severely that the protein
variants were MMR deficient. Characterization of the biochemical defects facilitated the
definition of functional domains of the MLH1 protein and revealed different mechanisms
through which the pathogenic effects were mediated.


By comparing the functional data and the clinical information obtained from the families we
found that MLH1 variations with multiple, mild, or no defects in functional assays are linked
to distinct clinical phenotypes. Our classification of the investigated variants as either
pathogenic or non-pathogenic based on our in vitro results, was supported by the clinical
associations. The MLH1 mutations which caused multiple defects in our functional assays
were associated with the typical HNPCC phenotype, including early age of cancer onset and
high MSI. In contrast, the MLH1 variants which acted like the wild-type protein were found
in families with varying phenotypes including atypical or mild HNPCC characteristics. The
results of the present study are hopefully useful to HNPCC diagnostics, counselling and
design of appropriate follow-up strategies for mutation carriers in the respective families.




                                              68
It would be interesting to further characterize minor nontruncating MLH1 alterations,
especially those, whose pathogenicity remains unclear in the present study. This could be
done by
– studying the effect of these variations on the assembly of MLH1-MLH3 and MLH1-PMS1
heterodimers and the function of these heterodimers, especially of MLH1-MLH3, which is
proposed to act in the repair of IDLs
– studying the effect of these alterations on the interactions between MLH1 and other repair
components such as MutS heterodimers, PCNA, and EXO1
– studying the effect of these alterations on the mRNA level
– studying the function of MLH1 in DNA damage signalling pathways in general




                                             69
ACKNOWLEDGEMENTS



This work has been carried out during the years 2001–2005 in the Department of Biological
and Environmental Sciences at the University of Helsinki. I wish to thank the former and
acting heads of the Division of Genetics – professors Jim Schröder, Pekka Heino, Hannu
Saarilahti, and Tapio Palva – for providing excellent facilities for both research and studying.


Professor Juhani Syväoja and docent Heli Nevanlinna are acknowledged for the reviewing of
this thesis. Their encouraging comments have been most valuable for me.


I address my warmest acknowledgements to my supervisor, docent Minna Nyström, who has
gave me this wonderful opportunity to be a tiny part of the great universe of science. Minna
has always treated me with trust – and with patience, too.


The greatest acknowledgement is addressed to our collaborators around the world and to the
HNPCC patients and families under study. Science cannot exist without co-operation!


I want to thank several present and past people from our research group: Reetta Kariola has
always been there for me and helped in most variable matters. Mari Siitonen, Karin
Lönnqvist, and Tommi Timoharju have contributed to my work with great effort. Jukka
Kantelinen is warmly thanked for his work for the heteroduplex preparation. Saara Ollila and
Laura Sarantaus have been wonderful people: always kind and eager to help. My special
gratitude goes to Hannes Lohi, who has been an example for me by being enviable
innovative and enthusiastic about the molecular biology.


Professor Päivi Peltomäki and doctor Wael Abdel-Rahman are acknowledged for the fruitful
collaboration. Päivi is also thanked for her passionate attitude towards cancer research and
interesting towards my studies. I address my gratitude also to the other members of Päivi’s
research group – especially Saila Saarinen is thanked for her contribution.




                                              70
People at the Division of Genetics are thanked in general for a warm atmosphere, and Arja
Ikävalko and Arja Välimäki are especially acknowledged for their help with all kind of
practical issues.


My parents, Maija ja Pasi, are thanked for their love and support – and also for their peaceful
attitude towards my life and choises. My little brother Tapio is acknowledged for being (his
major skill). I wish to thank my parents-in-law for their kindness and especially for the baby-
sitting services. My grand-parents and other relatives – my numerous cousins above all – are
heartfelt thanked for their love and interesting. My dearest friend Emma is acknowledged for
her endless understanding during these seventeen years we share.


I would not have been able to accomplish or even start this thesis without the support by my
dear husband Markus. He is heartily thanked.


My son Emil is notably younger than the studies behind this thesis – but already he is far
more perfect than any thesis could ever be. I hope that science will someday play a part in his
life too.


This study was financially supported by the Sigrid Juselius Foundation, the European
Commission, the University of Helsinki, and the Finnish Cancer Foundation.




                                     Helsinki, April 2005




                                       Tiina Raevaara




                                               71
REFERENCES



Aaltonen LA, Peltomäki P, Mecklin JP, Järvinen H, Jass JR, Green JS, Lynch HT, Watson P,
               Tallqvist G, Juhola M, Sistonen P, Hamilton S, Kinzler K, Vogelstein B, and de la
              Chapelle A (1994). Replication errors in benign and malignant tumors from hereditary
              nonpolyposis colorectal cancer patients. Cancer Res, 54: 1645-1648.
Aaltonen LA, Salovaara R, Kristo P, Canzian F, Hemminki A, Peltomäki P, Chadwick RB,
               Kääriäinen H, Eskelinen M, Järvinen H, Mecklin JP, and de la Chapelle A (1998).
               Incidence of hereditary nonpolyposis colorectal cancer and the feasibility of molecular
               screening for the disease. N Engl J Med, 338: 1481-1487.
Aarnio M, Sankila R, Pukkala E, Salovaara R, Aaltonen LA, de la Chapelle A, Peltomäki P,
               Mecklin JP, and Järvinen HJ (1999). Cancer risk in mutation carriers of DNA-
               mismatch-repair genes. Int J Cancer, 81: 214-218.
Acharya S, Wilson T, Gradia S, Kane MF, Guerrette S, Marsischky GT, Kolodner R, and Fishel R
              (1996). hMSH2 forms specific mismatch repair complexes with hMSH3 and h
              MSH6. Proc Natl Acad Sci USA, 93: 13629-13634.
Alani E (1996). The Saccharomyces cerevisiae Msh2 and Msh6 proteins form a complex that
               specifically binds to duplex oligonucleotides containing mismatched DNA base pairs.
               Mol Cell Biol, 16: 5604-5615.
Allen DJ, Makhov A, Grilley M, Taylor J, Tresher R, Modrich P, and Griffith JD (1997). MutS
              mediates heteroduplex loop formation by a translocation mechanism. EMBO J, 16:
              4467-4476.
Andrew S (1999). Timing is everything: especially with loss of tumor suppressor genes.
              Clin Genet, 56: 186-188.
Baker SM, Bronner CE, Zhang L, Plug AW, Robatzek M, Warren G, Elliott EA, Yu J, Ashley T,
              Arnheim N, Flavell RA, and Liskay MR (1995). Male mice defective in the DNA
              mismatch repair gene PMS2 exhibit abnormal chromosome synapsis in meiosis. Cell,
              82: 309–319.
Baker SM, Plug AW, Prolla TA, Bronner CE, Harris AC, Yao X, Christie D-M, Monell C, Arnheim
              N, Bradley A, Ashley T, and Liskay RM (1996). Involvement of mouse Mlh1 in DNA
              mismatch repair and meiotic crossing over. Nat Genet, 13: 336–342.
Ban C and Yang W (1998). Crystal structure and ATPase activity of MutL: Implications for DNA
              repair and mutagenesis. Cell, 95: 541-552.
Ban C, Junop M, and Yang W (1999). Transformation of MutL by ATP binding and hydrolysis:
              a switch in DNA mismatch repair. Cell, 97: 85-97.
Bellacosa A (2001). Functional interactions and signaling properties of mammalian mismatch repair
              proteins. Cell Death Diff, 8: 1076-1092.
Bergerat A, de Massy B, Gadelle D, Varoutas PC, Nicolas A, and Forterre P (1997). An atypical
              topoisomerase II from Archaea with implications for meiotic recombination.
              Nature, 386: 414-417.
Bisgaard ML, Jager AC, Myrhoj T, Bernstein I, and Nielsen FC (2002). Hereditary non-polyposis
               colorectal cancer (HNPCC): phenotype-genotype correlation between patients with
               and without identified mutation. Hum Mutat, 20: 20-27.
Bougeard G, Charbonnier F, Moerman A, Martin C, Ruchoux MM, Drouot N, and
               Frébourg T (2003). Early-onset brain tumor and lymphoma in MSH2-deficient
               children. Am J Hum Genet, 72: 213-216.
Branch P, Aquilina G, Bignami M, and Karran P (1993). Defective mismatch binding and a mutator
               phenotype in cancer cell lines tolerant to DNA damage. Nature, 326: 652-654.
Brieger A, Trojan J, Raedle J, Plotz G, and Zeuzem S (2002). Transient mismatch repair gene
              transfection for functional analysis of genetic hMLH1 and hMSH2 variants.




                                                 72
              Gut, 51: 677-684.
Brown KD, Rathi A, Kamath R, Beardsley DI, Zhan Q, Mannino JL, and Baskaran R (2003).
              The mismatch repair system is required for S-phase checkpoint activation. Nat Genet,
              33: 80-84.
Burdett V, Baitinger C, Viswanathan M, Lovett ST, and Modrich P (2001). In vivo requirement for
               RecJ, ExoVII, ExoI, and ExoX in methyl-directed mismatch repair. Proc Natl Acad Sci
              USA, 98: 6765-6770.
Cartegni L, Chew SL, and Krainer AR (2002). Listening to silence and understanding nonsense:
              exonic mutations that affect splicing. Nature Rev, 3: 285-298.
Cejka P, Stojic L, Mojas N, Russell AM, Heinimann K, Cannavo E, di Pietro M, Marra G, and
              Jiricny J (2003). Methylation-induced G(2)/M arrest requires a full complement of the
              mismatch repair protein hMLH1. EMBO J, 22: 2245-2254.
Charbonnier F, Olschwang S, Wang Q, Boisson C, Martin C, Buisine MP, Puisieux A, and
              Frebourg T (2002). MSH2 in contrast to MLH1 and MSH6 is frequently inactivated by
              exonic and promoter rearrangements in hereditary nonpolyposis colorectal cancer.
              Cancer Res, 62: 848-853.
Clark AB, Valle F, Drotschmann K, Gary RK, and Kunkel TA (2000). Functional interaction of
              proliferating cell nuclear antigen with MSH2-MSH6 and MSH2.MSH3 complexes.
              J Biol Chem, 275: 36498-36501.
Cooper DL, Lahue RS, and Modrich P (1993). Methyl-directed mismatch repair is bidirectional.
              J Biol Chem, 268: 11823-11829.
Cooper GM, Brudno M, Green ED, Batzoglou S, and Sidow A (2003). Quantitative estimates
               of sequence divergence for comparative analyses of mammalian genomes. Genome
               Res, 13: 813-820.
De la Chapelle A (2002). Microsatellite instability phenotype of tumors: genotyping or
              immunohistochemistry? The jury is still out. Clin Oncol, 20: 897-899.
De Rosa M, Fasano C, Panariello L, Scarano MI, Belli G, Iannelli A, Ciciliano F, and Izzo P
              (2000). Evidence for a recessive inheritance of Turcot's syndrome caused by
              compound heterozygous mutations within the PMS2 gene. Oncogene, 19: 1719-1723.
De Vos M, Hayward BE, Picton S, Sheridan E, and Bonthron DT (2004). Novel PMS2
               pseudogenes can conceal recessive mutations causing a distinctive chilhood cancer
              syndrome. Am J Hum Genet, 74: 954-964.
De Wind N, Dekker M, Berns A, Radman M, and te Riele H (1995). Inactivation of the mouse
              Msh2 gene results in mismatch repair deficiency, methylation tolerance,
              hyperrecombination, and predisposition to cancer. Cell, 82: 321–330.
De Wind N, Dekker M, van Rossum A, M. van der Valk M, and te Riele H (1998). Mouse models
              for hereditary nonpolyposis colorectal cancer. Cancer Res, 58: 248–225.
De Wind N, Dekker M, Claij N, Jansen L, van Klink Y, Radman M, Riggins G, van der Valk M,
              van't Wout K, and te Riele H (1999). HNPCC-like cancer predisposition in mice
              through simultaneous loss of Msh3 and Msh6 mismatch-repair protein functions.
              Nat Genet, 23: 359-362.
Dietmaier W, Wallinger S, Bocker T, Kullmann F, Fishel R, and Ruschoff J (1997). Diagnostic
               microsatellite instability: definition and correlation with mismatch repair protein
               expression. Cancer Res, 57: 4749-4756.
Drummond JT and Bellacosa A (2001). Human DNA mismatch repair in vitro operates
               independently of methylation status of CpG sites. Nucl Acids Res, 29: 2234-2243.
Duckett DR, Bronstein SM, Taya Y, and Modrich P (1999). hMutSalpha- and hMutLalpha-
              dependent phosphorylation of p53 in response to DNA methylator damage. Proc Natl
              Acad Sci U S A, 96: 12384-12388.
Dutta R and Inouye M (2000). GHKL, an emergent ATPase/kinase superfamily. Trends Biochem
              Sci, 25: 24-28.
Duval A, Gayet J, Zhou XP, Iacopetta B, Thomas G, and Hamelin R (1999). Frequent frameshift
              mutations of the RCF-4 gene in colorectal cancers with microsatellite instability.




                                                73
              Cancer Res, 59: 4213-4215.
Edelmann W, Yang K, Umar A, Heyer J, Lau K, Fan K, Liedtke W, Cohen PE, Kane MF, Lipford
              JR, Yu N, Crouse GF, Pollard JW, Kunkel T, Lipkin M, Kolodner R, and
              Kucherlapati R (1997). Mutation in the mismatch repair gene Msh6 causes cancer
              susceptibility. Cell, 91: 467–477.
Ellison AR, Lofing J, and Bitter GA (2001). Functional analysis of human MLH1 and MSH2
               missense variants and hybrid human-yeast MLH1 proteins in Saccharomyces
               cerevisiae. Hum Mol Genet, 10: 1889-1900.
Eyles SJ and Gierasch LM. 2000. Multiple roles of prolyl residues in structure and folding.
               J Mol Biol, 301: 737-747.
Fahsold R, Hoffmeyer S, Mischung C, Gille C, Ehlers C, Kucukceylan N, Abdel-Nour M, Gewies
               A, Peters H, Kaufmann D, Buske A, Tinschert S, and Nurnberg P (2000). Minor lesion
               mutational spectrum of the entire NF1 gene does not explain its high mutability but
               points to a functional domain upstream of the GAP-related domain.
               Am J Hum Genet, 66: 790-818.
Fishel R, Lescoe MK, Rao MR, Copeland NG, Jenkins NA, Garber J, Kane M, and Kolodner R
               (1993). The human mutator gene homolog MSH2 and its association with hereditary
               nonpolyposis colon cancer. Cell, 75: 1027-1038.
Fishel R (1999). Signaling mismatch repair in cancer. Nat Med, 5: 1239-1241.
Fleming MA, Potter JD, Ramirez CJ, Ostrander GK, and Ostrander EA (2003). Understanding
               missense mutations in the BRCA1 gene: an evolutionary approach. Proc Natl Acad Sci
               USA, 100: 1151-1156.
Flores-Rozas H and Kolodner R (1998). The Saccharomyces cerevisiae MLH3 gene functions in
              MSH3-dependent suppression of frameshift mutations. Proc Natl Acad Sci USA, 95:
              12404-12409.
Gallinger S, Aronson M, Shayan K, Ratcliffe EM, Gerstle JT, Parkin PC, Rothenmund H, Croitoru
              M, Baumann E, Durie PR, Weksberg R, Pollett A, Riddell RH, Ngan BY, Cutz E,
              Lagarde AE, and Chan HS (2004). Gastrointestinal cancers and neurofibromatosis type
              1 features in children with a germline homozygous MLH1 mutation. Gastroenterology,
              126: 576-585.
Genschel J, Littman SJ, Drummond JT, and Modrich P (1998). Isolation of MutSbeta from human
              cells and comparison of the mismatch repair specifities of MutSbeta and MutSalpha.
              J Biol Chem, 273: 19895-19901.
Goldgar DE, Easton DF, Deffenbaugh AM, Monteiro AN, Tavtigian SV, and Couch FJ; Breast
               Cancer Information Core (BIC) Steering Committee (2004). Integrated evaluation of
               DNA sequence variants of unknown clinical significance: application to BRCA1 and
               BRCA2. Am J Hum Genet, 75: 535-544 (2004).
Gong JG, Costanzo A, Yang HQ, Melino G, Kaelin WG Jr, Levrero M, and Wang JY (1999).
              The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced
              DNA damage. Nature, 399: 806-809.
Gradia S, Acharya S, and Fishel R (1997). The human mismatch recognition complex hMSH2-
              hMSH6 functions as a novel molecular switch. Cell, 91:995-1005.
Gradia S, Subramanian D, Wilson T, Acharya S, Makhov A, Griffith J, and Fishel R (1999).
              hMSH2-hMSH6 forms a hydrolysis-independent sliding clamp on mismatched DNA.
              Mol Cell, 3: 255-261.
Greenblatt MS, Beaudet JG, Gump JR, Godin KS, Trombley L, Koh J, and Bond JP (2003).
               Detailed computational study of p53 and p16: using evolutionary sequence analysis
               and disease-associated mutations to predict the functional consequences of allelic
               variants. Oncogene 22: 1150-1163.
Groden J, Thliveris A, Samowitz W, Carlson M, Gelbert L, Albertsen H, Joslyn G, Stevens J,
              Spirio L, Robertson M, Sargeant L, Krapcho K, Wolff E, Burt R, Hughes JP,
              Warrington J, McPherson J, Wasmuth J, le Paslier D, Abderrahim H, Cohen D,
              Leppert M, and White R (1991). Identification and characterization of the familial




                                               74
               adenomatous polyposis coli gene. Cell, 66: 589-600.
Gu L, Hong Y, McCulloch S, Watanabe H, and Li GM (1998). ATP-dependent interaction of
               human mismatch repair proteins and dual role of PCNA in mismatch repair. Nucl
               Acids Res, 26: 1173-1178.
Guerrette S, Wilson T, Gradia S, and Fishel R (1998). Interactions of human hMSH2 with hMSH3
                and hMSH2 with hMSH6: examination of mutations found in hereditary nonpolyposis
                colorectal cancer. Mol Cell Biol, 18: 6616-6623.
Guerrette S, Acharya S, and Fishel R (1999). The interaction of the human MutL homologues in
               hereditary nonpolyposis colon cancer. J Biol Chem, 274: 6336-6341.
Habraken Y, Sung P, Prakash L, and Prakash S (1996). Binding of insertion/deletion DNA
               mismatches by the heterodimer of yeast mismatch repair proteins MSH2 and MSH3.
               Cur Biol, 6: 1185-1187.
Hall MC, Matson SW, Yamaguchi M, Dao V, and Modrich P (1999). The Escherichia coli MutL
               protein physically interacts with MutH and stimulates the MutH-associated
               endonuclease activity. J Biol Chem, 274: 1306-1312.
Han HJ, Maruyama M, Baba S, Park JG, and Nakamura Y (1995). Genomic structure of human
                mismatch repair gene, hMLH1, and its mutation analysis in patients with hereditary
                non-polyposis colorectal cancer (HNPCC). Hum Mol Genet, 4: 237-242.
Hamilton SR, Liu B, Parsons RE, Papadopoulos N, Jen J, Powell SM, Krush AJ, Berk T, Cohen Z,
               Tetu B, Burger PC, Wood PA, Taqi F, Booker SV, Petersen GM, Offerhaus GJA,
               Tersmette AC, Giardiello FM, Vogelstein B, and Kinzler KW (1995). The molecular
               basis of Turcot's syndrome. N Engl J Med, 332: 839-847.
Hawn MT, Umar A, Marra G, Kunkel TA, Boland CR, and Koi M (1995). Evidence for a
               connection between the mismatch repair system and the G2 cell cycle checkpoint.
               Cancer Res, 55: 3721-3725.
Hendriks YM, Wagner A, Morreau H, Menko F, Stormorken A, Quehenberger F, Sandkuijl L,
               Moller P, Genuardi M, Van Houwelingen H, Tops C, Van Puijenbroek M, Verkuijlen
               P, Kenter G, Van Mil A, Meijers-Heijboer H, Tan GB, Breuning MH, Fodde R,
               Wijnen JT, Brocker-Vriends AH, and Vasen H (2004). Cancer risk in hereditary
               nonpolyposis colorectal cancer due to MSH6 mutations: impact on counseling and
               surveillance. Gastroenterology, 127: 17-25.
Hingorani MM and O'Donnell M (2000). Sliding clamps: a (tail)ored fit. Curr Biol, 10: R25-29.
Holmberg M, Kristo P, Chadwicks RB, Mecklin JP, Järvinen H, de la Chapelle A, Nyström-Lahti
               M, and Peltomäki P (1998). Mutation sharing, predominant involvement of the MLH1
               gene and description of four novel mutations in hereditary nonpolyposis colorectal
               cancer. Mutations in brief no. 144. Hum Mutat, 11: 482.
Holmes J Jr, Clark S, and Modrich P (1990). Strand-specific mismatch repair in nuclear extracts of
               human and Drosophila melanogaster cell lines. Proc Natl Acad Sci USA, 87:
               5837-5841.
Houlston RS, Collins A, Slack J, and Morton NE (1992). Dominant genes for colorectal cancer are
                not rare. Ann Hum Genet, 56: 99-103.
Iaccarino I, Palombo F, Drummond J, Totty NF, Hsuan JJ, Modrich P, and Jiricny J (1996). MSH6,
               a Saccharomyces cerevisiae protein that binds to mismatches as a heterodimer with
               MSH2. Cur Biol, 6: 484-486.
Jacob S and Praz F (2002). DNA mismatch repair defects: role in colorectal carcinogenesis.
               Biochimie, 84: 27-47.
Jass JR, Walsh MD, Barker M, Simms LA, Young J, and Leggett BA (2002). Distinction between
               familial and sporadic forms of colorectal cancer showing DNA microsatellite
               instability. Eur J Cancer, 38: 858-866.
Jiricny J (1998). Replication errors: cha(lle)nging the genome. EMBO J, 17: 6427-6436.
Jiricny J and Nyström-Lahti M (2000). Mismatch repair defects in cancer. Curr Opin Genet Dev,
               10: 157-161.
Jäger AC, Bisgaard ML, Myrhoej T, Bernstein I, Rehfeld JF, and Nielsen FC (1997). Reduced




                                                75
              frequency of extracolonic cancer families with monoallelic hMLH1 expression.
              Am J Hum Genet, 61: 129-138.
Jäger AC, Rasmussen M, Bisgaard HC, Singh KK, Nielsen FC, and Rasmussen LJ (2001). HNPCC
              mutations in the human DNA mismatch repair gene hMLH1 influence assembly of
              hMutLalpha and hMLH1-hEXO1 complexes. Oncogene, 20: 3590-3595.
Järvinen HJ, Aarnio M, Mustonen H, Aktan-Collan K, Aaltonen LA, Peltomäki P, de la Chapelle A,
               and Mecklin JP (2000). Controlled 15-year trial on screening for colorectal cancer in
              families with hereditary nonpolyposis colorectal cancer. Gastroenterology, 118:
              829-834.
Kalderon D, Roberts BL, Richarson WD, and Smith AE (1984). A short amino acid sequence able
               to specify nuclear location. Cell, 39: 499-509.
Kane MF, Loda M, Gaida GM, Lipman J, Mishra R, Goldman H, Jessup JM, and Kolodner RD
               (1997). Methylation of the hMLH1 promoter correlates with lack of expression of
               hMLH1 in sporadic colon tumors and mismatch repair-defective human tumor cell
               lines. Cancer Res, 57: 808-811.
Kariola R, Raevaara TE, Lönnqvist KE, and Nyström-Lahti M (2002). Functional analysis of
              MSH6 mutations linked to kindreds with putative hereditary non-polyposis colorectal
              cancer syndrome. Hum Mol Genet, 11: 1303-1310.
Kariola R, Otway R, Lönnqvist KE, Raevaara TE, Macrae F, Vos YJ, Kohonen-Corish M, Hofstra
               RMF, and Nyström-Lahti M (2003). Two mismatch repair gene mutations found in a
               colon cancer patient - which one is pathogenic? Hum Genet, 112:105-109.
Kariola, Hampel H, Frankel WL, Raevaara TE, de la Chapelle A, and Nyström-Lahti M (2004).
               MSH6 missense mutations are often associated with no or low cancer susceptibility.
               Br J Cancer, 91: 1287-1292.
Kat A, Thilly WG, Fang WH, Longley MJ, Li GM, and Modrich P (1993). An alkylation-tolerant,
              mutator human cell line is deficient in strand-specific mismatch repair. Proc Natl Acad
              Sci USA, 90: 6424-6428.
Kim H, Jen J, Vogelstein B, and Hamilton SR (1994). Clinical and pathological characteristics of
              sporadic colorectal carcinomas with DNA replication errors in microsatellite
              sequences. Am J Pathol, 145: 148-156.
Knudson AG (1971): Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci
               USA, 68: 820-823.
Kohonen-Corish M, Ross VL, Doe WF, Kool DA, Edkins E, Faragher I, Wijnen J, Khan PM,
              Macrae F, and St John DJ (1996). RNA-based mutation screening in hereditary
               nonpolyposis colorectal cancer. Am J Hum Genet, 59: 818-824.
Kondo E, Horii A, and Fukushige S (2001). The interaction domains of three MutL heterodimers in
               man: hMLH1 interacts with 36 homologous amino acid residues within hMLH3,
               hPMS1 and hPMS2. Nucl Acid Res, 29: 1695-1708.
Kondo E, Suzuki H, Horii A, and Fukushige S (2003). A yeast two-hybrid assay provides a simple
              way to evaluate the vast majority of hMLH1 germ-line mutations. Cancer Res, 63:
              3302-3308.
Kruse R, Rutten A, Lamberti C, Hosseiny-Malayeri HR, Wang Y, Ruelfs C, Jungck M, Mathiak M,
              Ruzicka T, Hartschuh W, Bisceglia M, Friedl W, and Propping P (1998). Muir-Torre
              phenotype has a frequency of DNA mismatch-repair-gene mutations similar to that in
              hereditary nonpolyposis colorectal cancer families defined by the Amsterdam criteria.
              Am J Hum Genet, 63: 63-70.
Kuismanen SA, Holmberg MT, Salovaara R, de la Chapelle A, and Peltomäki P (2000). Genetic
              and epigenetic modification of MLH1 accounts for a major share of microsatellite-
              unstable colorectal cancers. Am J Pathol, 156: 1773-1779.
Kunkel, TA (2004). DNA replication fidelity. J Biol Chem, 279: 16895-16898.
Lahue RS, Au KG, and Modrich P (1989). DNA mismatch correction in a defined system.
              Science, 245: 160-164.
Levinson G and Gutman GA (1987). Slipped strand mispairing: a major mechanism for DNA




                                                 76
             sequence evolution. Mol Biol Evol, 4: 203-221.
Li GM and Modrich P (1995). Restoration of mismatch repair to nuclear extracts of H6 colorectal
             tumor cells by a heterodimer of human MutL homologs. Proc Natl Acad Sci USA,
             92: 1950-1954.
Lindor NM, Burgart LJ, Leontovich O, Goldberg RM, Cunningham JM, Sargent DJ,
             Walsh-Vockley C, Petersen GM, Walsh MD, Leggett BA, Young JP, Barker MA, Jass
             JR, Hopper J, Gallinger S, Bapat B, Redston M, and Thibodeau SN (2002).
             Immunohistochemistry versus microsatellite instability testing in phenotyping
             colorectal tumors. J Clin Oncol, 20: 1043104-8.
Lipkin SM, Wang V, Jacoby R, Banerjee-Basu S, Baxevanis AD, Lynch HT, Elliott RM, and
             Collins FS (2000). MLH3: a DNA mismatch repair gene associated with mammalian
             microsatellite instability. Nature Genet, 24: 27-35.
Liu B, Parsons R, Papadopoulos N, Nicolaides NC, Lynch HT, Watson P, Jass JR, Dunlop M,
             Wyllie A, Peltomäki P, de la Chapelle A, Hamilton SR, Vogelstein B, and Kinzler KW
             (1996). Analysis of mismatch repair genes in hereditary non-polyposis colorectal
             cancer patients. Nat Med, 2: 169-174.
Liu T, Yan H, Kuismanen S, Percesepe A, Bisgaard ML, Pedroni M, Benatti P, Kinzler KW,
             Vogelstein B, Ponz de Leon M, Peltomäki P, and Lindblom A (2001). The role of
             hPMS1 and hPMS2 in predisposing to colorectal cancer. Cancer Res, 61: 7798-7802.
Liu HX, Zhou XL, Liu T, Werelius B, Lindmark G, Dahl N, and Lindblom A (2003). The role of
             hMLH3 in familial colorectal cancer. Cancer Res, 63: 1894-1899.
Lu AL, Clark S, and Modrich P (1983). Methyl-directed repair of DNA base-pair mismatches in
             vitro. Proc Natl Acad Sci USA, 80: 4639-4643.
Luo Y, Lin FT, and Lin WC (2004). ATM-mediated stabilization of hMutL DNA mismatch repair
              proteins augments p53 activation during DNA damage. Mol Cell Biol, 24: 6430-6444.
Lynch HT, Smyrk TC, Watson P, Lanspa SJ, Lynch JF, Lynch PM, Cavalieri RJ, and Boland CR
              (1993). Genetics, natural history, tumor spectrum, and pathology of hereditary
              nonpolyposis colorectal cancer: an updated review. Gastroenterology, 104:
              1535-1549.
Lynch HT and de la Chapelle A (2003). Hereditary colorectal cancer. N Engl J Med, 348: 919-932.
Malkhosyan S, Rampino N, Yamamoto H, and Perucho M (1996). Frameshift mutator mutations.
             Nature, 382: 499-500.
Markowitz S, Wang J, Myeroff L, Parsons R, Sun L, Lutterbaugh J, Fan RS, Zborowska E, Kinzler
             KW, Vogelstein B, Brattain M, and Willson JKV (1995). Inactivation of the type II
             TGF-β receptor in colon cancer cells with microsatellite instability.
             Science, 268: 1336-1338.
Marra G, Iaccarino I, Lettieri T, Roscilli G, Delmastro P, Jiricny J, Marsischky GT, Lee S, Griffith
             J, and Kolodner RD (1998). Mismatch repair deficiency associated with
             overexpression of the MSH3 gene. Proc Natl Acad Sci USA, 95: 8568-8573.
Marsischky GT, Filosi N, Kane MF, and Kolodner R (1996). Redundancy of Saccharomyces
             cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev, 10:
             407-420.
 Menko FH, Kaspers GL, Meijer GA, Claes K, van Hagen JM, and Gille JJP (2004). A homozygous
              MSH6 mutation in a child with café-au-lait spots, oligodendroglioma and rectal
              cancer. Fam Cancer, 3: 123-127.
Modrich P (1991). Mechanism and biological effects of mismatch repair. Annu Rev Genet, 25:
             229-253.
Modrich P and Lahue R (1996). Mismatch repair in replication fidelity, genetic recombination,
             and cancer biology. Annu Rev Biochem, 65: 101-133.
Moisio AL, Sistonen P, Weissenbach J, de la Chapelle A, and Peltomäki P (1996). Age and origin
             of two common MLH1 mutations predisposing to hereditary colon cancer. Am J Hum
             Genet, 59: 1243-1251.




                                                 77
Mooney SD, Klein TE, Altman RB, Trifiro MA, and Gottlieb, B (2003). A functional analysis of
               disease-associated mutations in the androgen receptor gene. Nucl Acid Res 31:
               e42 (2003).
Mushegian AR, Bassett DE Jr, Boguski MS, Bork P, and Koonin EV (1997). Positionally cloned
              human disease genes: patterns of evolutionary conservation and functional motifs.
              Proc Natl Acad Sci USA, 94: 5831583-6.
Müller W, Burgart LJ, Krause-Paulus R, Thibodeau SN, Almeida M, Edmonston TB, Boland CR,
              Sutter C, Jass JR, Lindblom A, Lubinski J, MacDermot K, Sanders DS, Morreau H,
              Muller A, Oliani C, Orntoft T, Ponz De Leon M, Rosty C, Rodriguez-Bigas M,
              Ruschoff J, Ruszkiewicz A, Sabourin J, Salovaara R, and Moslein G; ICG-HNPCC
              (International Collaborative Group) (2001). The reliability of immunohistochemistry
              as a prescreening method for the diagnosis of hereditary nonpolyposis colorectal
              cancer (HNPCC) - results of an international collaborative study. Fam Cancer,
              1: 87-92.
Narayan S and Roy D (2003). Role of APC and DNA mismatch repair genes in the development of
              colorectal cancers. Mol Cancer, 2: 41-56.
Ng PC and Henikoff S. SIFT: predicting amino acid changes that affect protein function.
              Nucl Acid Res, 31: 3812-3814.
Nyström-Lahti M, Kristo P, Nicolaides NC, Chang SY, Aaltonen LA, Moisio AL, Järvinen HJ,
               Mecklin JP, Kinzler KW, Vogelstein B, de la Chapelle A, and Peltomäki P (1995).
               Founding mutations and Alu-mediated recombination in hereditary colon cancer. Nat
               Med, 1: 1203-1206.
Nyström-Lahti M, Wu Y, Moisio AL, Hofstra RM, Osinga J, Mecklin JP, Järvinen HJ, Leisti J,
              Buys CH, de la Chapelle A, and Peltomäki P (1996). DNA mismatch repair gene
              mutations in 55 kindreds with verified or putative hereditary non-polyposis colorectal
              cancer. Hum Mol Genet, 5: 763-769.
Nyström-Lahti M, Holmberg M, Fidalgo P, Salovaara R, de la Chapelle A, Jiricny J, and Peltomäki
              P (1999). Missense and nonsense mutations in codon 659 of MLH1 cause aberrant
              splicing of messenger RNA in HNPCC kindreds. Genes Chromosomes Cancer, 26:
              372-375.
Nyström-Lahti M, Perrera C, Raschle M, Panyushkina-Seiler E, Marra G, Curci A, Quaresima B,
              Costanzo F, D'Urso M, Venuta S, and Jiricny J (2002). Functional analysis of MLH1
              mutations linked to hereditary nonpolyposis colon cancer. Genes Chromosomes
              Cancer, 33: 160-167.
Palombo F, Iaccarino I, Nakajima E, Ikejima M, Shimada T, and Jiricny J (1996). hMutSbeta, a
              heterodimer of hMSH2 and hMSH3, binds to insertion/deletion loops in DNA. Cur
              Biol, 6: 1181-1184.
Pang Q, Prolla TA, and Liskay RM (1997). Functional domains of the Saccharomyces cerevisiae
              Mlh1p and Pms1p DNA mismatch repair proteins and their relevance to human
              hereditary nonpolyposis colorectal cancer-associated mutations. Mol Cell Biol,
              17: 4465-4473.
Peltomäki P, Aaltonen LA, Sistonen P, Pylkkänen L, Mecklin JP, Järvinen H, Green JS, Jass JR,
              Weber JL, Leach FS, Petersen GM, Hamilton SR, de la Chapelle A, and Vogelstein B
              (1993). Genetic mapping of a locus predisposing to human colorectal cancer. Science,
              260: 810-812.
Peltomäki P (2001a): DNA mismatch repair and cancer. Mutation Res, 488: 77-85.
Peltomäki P (2001b): Deficient DNA mismatch repair: a common etiologic factor for colon cancer.
               Hum Mol Genet, 10: 735-740.
Peltomäki P, Gao X, and Mecklin JP (2001). Genotype and phenotype in hereditary nonpolyposis
               colorectal cancer: a study of families with different vs. shared predisposing mutations.
               Fam Cancer, 1: 9-15.
Peltomäki P and Vasen H (2004). Mutations associated with HNPCC predisposition – Update of
              ICG-HNPCC/InSiGHT mutation database. Dis Markers, 20: 269-276.




                                                  78
Peters AC, Young LC, Maeda T, Tron VA, and Andrew SE (2003). Mammalian DNA mismatch
              repair protects cells from UVB-induced DNA damage by facilitating apoptosis and
              p53 activation. DNA Repair, 2: 427-435.
Potter JD (1999). Colorectal cancer: molecules and populations. J Natl Cancer Inst, 91: 916-932.
Prolla TA, Baker SM, Harris AC, Tsao JL, Yao X, Bronner CE, Zheng B, Gordon M, Jeneker J,
              Arnheim N, Shibata D, Bradley A, and Liskay RM (1998). Tumour susceptibility and
              spontaneous mutation in mice deficient in Mlh1, Pms1 and Pms2 DNA mismatch
              repair. Nat Genet, 18: 276–279.
Reitmair AH, Schmits R, Ewel A, Bapat B, Redston M, Mitri A, Waterhouse P, Mittrücker HW,
              Wakeham A, Liu B, Thomason A, Griesser H, Gallinger S, Ballhausen WG, Fishel R,
              and Mak TW (1995). MSH2 deficient mice are viable and susceptible to lymphoid
              tumours. Nat Genet, 11: 64–70.
Ricciardone MD, Ozcelik T, Cevher B, Ozdag H, Tuncer M, Gurgey A, Uzunalimoglu O,
              Cetinkaya H, Tanyeli A, Erken E, and Ozturk M (1999). Human MLH1 deficiency
              predisposes to hematological malignancy and neurofibromatosis type 1. Cancer Res,
              59: 290-293.
Rodriguez-Bigas MA, Boland CR, Hamilton SR, Henson DE, Jass JR, Khan PM, Lynch H, Perucho
              M, Smyrk T, Sobin L, and Srivastava S (1997). Workshop on Hereditary
              Nonpolyposis Colorectal Cancer Syndrome: meeting highlights and Bethesda
              guidelines. J Natl Cancer Inst, 89: 1758-1762.
Räschle M, Marra G, Nyström-Lahti M, Schär P, and Jiricny J (1999). Identification of hMutLβ, a
              heterodimer of hMLH1 and hPMS1. J Biol Chem, 274: 32368-32375.
Räschle M, Dufner P, Marra G, and Jiricny J (2002). Mutations within the hMLH1 and hPMS2
              subunits of the human MutLalpha mismatch repair factor affect its ATPase activity,
              but not its ability to interact with hMutSalpha. J Biol Chem, 277: 21810-21820
Salovaara R, Loukola A, Kristo P, Kääriäinen H, Ahtola H, Eskelinen M, Härkonen N, Julkunen R,
              Kangas E, Ojala S, Tulikoura J, Valkamo E, Järvinen H, Mecklin JP, Aaltonen LA,
              and de la Chapelle A (2000). Population-based molecular detection of hereditary
              nonpolyposis colorectal cancer. J Clin Oncol, 18: 2193-2200.
Shcherbakova PV and Kunkel TA (1999). Mutator phenotypes conferred by MLH1 overexpression
               and by heterozygosity for mlh1 mutations. Mol Cell Biol. 19: 3177-3183.
Schmutte C, Sadoff MM, Shim KS, Acharya S, and Fishel R (2001). The interaction of DNA
               mismatch repair proteins with human exonuclease I. J Biol Chem, 276: 33011-33018.
Schofield MJ and Hsieh P (2004). DNA mismatch repair: molecular mechanisms and biological
              function. Annu Rev Microbiol, 57: 579-608.
Shimodaira H, Filosi N, Shibata H, Suzuki T, Radice P, Kanamaru R, Friend SH, Kolodner RD, and
              Ishioka C (1998). Functional analysis of human MLH1 mutations in Saccharomyces
              cerevisiae. Nat Genet, 19: 384-389.
Shimodaira H, Yoshioka-Yamashita A, Kolodner RD, and Wang JY (2003). Interaction of
              mismatch repair protein PMS2 and the p53-related transcription factor p73 in
              apoptosis response to cisplatin. Proc Natl Acad Sci USA, 100: 2420-2425.
Thomas DC, Roberts JD, and Kunkel TA (1991). Heteroduplex repair in extracts of human HeLa
               cells. J Biol Chem, 266: 3744-3751.
Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: Improving the sensitivity of
               progressive multiple sequence alignment through sequence weighting,
               position-specific gap penalties and weight matrix choice. Nucl Acid Res, 22:
               4673-4680.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, and Higgins DG (1997). The ClustalX
              windows interface: flexible strategies for multiple sequence alignment aided by quality
              analysis tools. Nucl Acids Res, 25: 4876-4882.
Tinschert S, Naumann I, Stegmann E, Buske A, Kaufmann D, Thiel G, and Jenne DE (2000).
               Segmental neurofibromatosis is caused by somatic mutation of the neurofibromatosis




                                                 79
               type 1 (NF1) gene. Eur J Hum Genet, 8: 455–459.
Tippin B, Pham P, and Goodman MF (2004). Error-prone replication for better or worse. Trends in
              microbiol, 12: 288-295.
Tomkinson AE, Mackey ZB, Brueckl WM, Limmert T, Brabletz T, Guenther K, Jung A, Hermann
              K, Wiest GH, Kirchner T, Hohenberger W, Hahn EG, and Wein A (1998). Structure
              and function of mammalian DNA ligases. Mutat Res, 407: 1-9.
Tran PT and Liskay RM (2000). Functional studies on the candidate ATPase domains of
               Saccharomyces cerevisiae MutLalpha. Mol Cell Biol, 20: 6390-6398.
Tran PT, Simon JA, and Liskay RM (2001). Interactions of Exo1p with components of
               MutLalpha in Saccharomyces cerevisiae. Proc Natl Acad Sci USA, 98: 9760-9765.
Trimbath JD, Petersen GM, Erdman SH, Ferre M, Luce MC, and Giardiello FM (2001).
              Cáfe-au-lait spots and early onset colorectal neoplasia: a variant of HNPCC? Fam
              Cancer, 1: 101-105.
Trojan J, Zeuzem S, Randolph A, Hemmerle C, Brieger A, Raedle J, Plotz G, Jiricny J, and
              Marra G (2002). Functional analysis of hMLH1 variants and HNPCC-related
              mutations using a human expression system. Gastroenterology, 122: 211-219.
Tucker T and Friedman JM. Pathogenesis of hereditary tumors: beyond the “two-hit” hypothesis.
              Clin Genet, 62: 345-357.
Umar A, Buermeyer AB, Simon JA, Thomas DC, Clark AB, Liskay RM, and Kunkel TA (1996).
              Requirement for PCNA in DNA mismatch repair at a step preceding DNA resynthesis.
              Cell, 87: 65-73.
Umar A, Boland CR, Terdiman JP, Syngal S, de la Chapelle A, Ruschoff J, Fishel R, Lindor NM,
              Burgart LJ, Hamelin R, Hamilton SR, Hiatt RA, Jass J, Lindblom A, Lynch HT,
              Peltomäki P, Ramsey SD, Rodriguez-Bigas MA, Vasen HF, Hawk ET, Barrett JC,
              Freedman AN, and Srivastava S (2004). Revised Bethesda Guidelines for hereditary
              nonpolyposis colorectal cancer (Lynch syndrome) and microsatellite instability. J Natl
              Cancer Inst, 96: 261-268.
Vasen HF, Mecklin JP, Khan PM, and Lynch HT (1991). The International Collaborative Group on
              Hereditary Non-Polyposis Colorectal Cancer (ICG-HNPCC). Dis Colon Rectum,
              34: 424-425.
Vasen HF, Wijnen JT, Menko FH, Kleibeuker JH, Taal BG, Griffioen G, Nagengast FM,
              Meijers-Heijboer EH, Bertario L, Varesco L, Bisgaard ML, Mohr J, Fodde R, and
              Khan PM (1996). Cancer risk in families with hereditary nonpolyposis colorectal
              cancer diagnosed by mutation analysis. Gastroenterology, 110:1020-1027.
Vasen HF, Watson P, Mecklin JP, and Lynch HT (1999). New clinical criteria for hereditary
              nonpolyposis colorectal cancer (HNPCC, Lynch syndrome) proposed by the
              International Collaborative group on HNPCC. Gastroenterology, 116: 1453-1456.
Vasen HF, Stormorken A, Menko FH, Nagengast FM, Kleibeuker JH, Griffioen G, Taal BG, Moller
              P, and Wijnen JT (2001). MSH2 mutation carriers are at higher risk of cancer than
              MLH1 mutation carriers: a study of hereditary nonpolyposis colorectal cancer families.
              J Clin Oncol, 19: 4074-4080.
Vilkki S, Tsao JL, Loukola A, Pöyhönen M, Vierimaa O, Herva R, Aaltonen LA, and Shibata D
               (2001). Extensive somatic microsatellite mutations in normal human tissue. Cancer
               Res, 61: 4541-4544.
Vogelstein B and Kinzler KW (1993). The multistep nature of cancer. Trends Genet, 9: 138.
Wagner A, Barrows A, Wijnen JT, van der Klift H, Franken PF, Verkuijlen P, Nakagawa H,
               Geugien M, Jaghmohan-Changur S, Breukel C, Meijers-Heijboer H, Morreau H, van
               Puijenbroek M, Burn J, Coronel S, Kinarski Y, Okimoto R, Watson P, Lynch JF, de la
               Chapelle A, Lynch HT, and Fodde R (2003). Molecular analysis of hereditary
               nonpolyposis colorectal cancer in the United States: high mutation detection rate
               among clinically selected families and characterization of an American founder
               genomic deletion of the MSH2 gene. Am J Hum Genet, 72:1088-1100.
Wahlberg SS, Schmeits J, Thomas G, Loda M, Garber J, Syngal S; Kolodner RD, and Fox E




                                                 80
               (2002). Evaluation of microsatellite instability and immunohistochemistry for the
               prediction of germ-line MSH2 and MLH1 mutations in hereditary nonpolyposis colon
               cancer families. Cancer Res, 62: 3485-3492.
Wang Q, Lasset C, Desseigne F, Frappaz D, Bergeron C, Navarro C, Ruano E, and Puisieux A
               (1999). Neurofibromatosis and early onset of cancers in hMLH1-deficient children.
               Cancer Res, 59: 294-297.
Wang Y, Friedl W, Sengteller M, Jungck M, Filges I, Propping P, and Mangold E (2002). A
               modified multiplex PCR assay for detection of large deletions in MSH2 and MLH1.
               Hum Mutat, 19: 279-286.
Wang Q, Montmain G, Ruano E, Upadhyaya M, Dudley S, Liskay RM, Thibodeau SN, and
               Puisieux A (2003). Neurofibromatosis type 1 gene as a mutational target in a
               mismatch repair-deficient cell type. Hum Genet, 112: 117-123.
Wei K, Kucherlapati R, and Edelmann W (2002). Mouse models for human DNA mismatch-repair
               gene defects. Trends Mol Med, 8: 346-353.
Whiteside D, McLeod R, Graham G, Steckley JL, Booth K, Somerville MJ, and Andrew SE (2002).
               A homozygous germ-line mutation in the human MSH2 gene predisposes to
               hematological malignancy and multiple cafe-au-lait spots. Cancer Res, 62: 359-362.
Wilmink AB (1997). Overview of the epidemiology of colorectal cancer. Dis Colon Rectum,
               40: 483-493.
Wilson T, Guerrette S, and Fishel R (1999). Dissociation of mismatch recognition and ATPase
              activity by hMSH2-hMSH3. J Biol Chem, 274: 21659-21664.
Wu Y, Berends MJW, Sijmons RH, Mensink RGJ, Verlind E, Kooi KA, van der Sluis T, Kempinga
              C, van der Zee AGJ, Hollema H, Buys CHCM, Kleibeuker JH, and Hofstra RMW
              (2001). A role for MLH3 in hereditary nonpolyposis colorectal cancer. Nature Genet,
              29: 137-138.
Wu X, Platt JL, and Cascalho M (2003). Dimerization of MLH1 and PMS2 limits nuclear
               localization of MutLalpha. Mol Cell Biol, 23: 3320-3328.




                                               81
APPENDICES



Table A.1. Experimental conditions for site-directed mutagenesis using pFastBac1-MLH1
plasmid as a template.
           1st PCR                                                  2nd PCR
                                                               1
 MLH                                                   Size   T     Oligos    Size   T2    Cloning
                                                       (bp)   (°C             (bp)   (°C    sites
 1         Oligos for fragments A and B (5’→3’)                     (5’→3’
 variant                                                        )   )                  )
 MLH1-     fA: CGCATTATTCATACCGTCCC                    178    45      fA      571    45    BamHI
 P28L      rA: GATAGCATTAGCTAGCCGCTGGATAAC                            rB                    PvuII
           fB: GTTATCCAGCGGCTAGCTAATGCTATC             431    45
           rB: TTCTCCTCGTGGCTATGTTG
 MLH1-     fA: fA-P28L                                 182    50      fA      571    50    BamHI
 A29S      rA: CTTTGATAGCATTAGATGGCCGCTGG                             rB                    PvuII
           fB: CCAGCGGCCATCTAATGCTATCAAAG              426    50
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 229    50      fA      568    45    BamHI
 TSI45-    rA: CACTTGAAAACAGGATTTTGCATC                               rB                    PvuII
 47CF      fB: GATGCAAAATCCTGTTTTCAAGTG                370    50
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 283    50      fA      571    50    BamHI
 D63E      rA: CCCGGTGCCATTTTCTTGGATCTG                               rB                    PvuII
           fB: CAGATCCAAGAAAATGGCACCGGG                313    50
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 294    45      fA      571    45    BamHI
 G67R      rA: CTTCTTTCCTGATCCTGGTGCCATTGTC                           rB                    PvuII
           fB: GACAATGGCACCAGGATCAGGAAAGAAG            304    45
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 308    60      fA      568    60    BamHI
 E71del    rA: CAATATCCAGATCTTTCCTGATCC                               rB                    PvuII
           fB: GGATCAGGAAAGATCTGGATATTG                290    60
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 327    45      fA      571    45    BamHI
 C77R      rA: GTAGTGAACCTTTCACGTACAATATCCAG                          rB                    PvuII
           fB: CTGGATATTGTACGTGAAAGGTTCACTAC           273    45
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 336    45      fA      571    45    BamHI
 F80V      rA: GTTTACTAGTAGTGACCCTTTCACATAC                           rB                    PvuII
           fB: GTATGTGAAAGGGTCACTACTAGTAAAC            265    45
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 343    45      fA      571    45    BamHI
 K84E      rA: GGACTGCAGTTCACTAGTAGTGAAC                              rB                    PvuII
           fB: GTTCACTACTAGTGAACTGCAGTCC               254    45
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 376    57      fA      571    57    BamHI
 S93G      rA: GCCATAGGTAGAAATACCGGCTAAATCCTC                         rB                    PvuII
           AAAGG                                       230    57
           fB: CCTTTGAGGATTTAGCCGGTATTTCTACC
           TATGGC
           rB: rB-P28L
 MLH1-     fA: fA-P28L                                 416    45      fA      571    45    BamHI
 I107R     rA: GAGCCACATGGCTTCTGCTGGCCAAAGCC                          rB                    PvuII
           fB: GGCTTTGGCCAGCAGAAGCCATGTGGCTC           184    45
           rB: rB-P28L
 MLH1-     fA: CTACCTATGGCTTTCG                        195    45      fA      927    45     PvuII
 L155R     rA: CTATGTTGTAAAAACGGTCCTCCACCG                            rB                    NsiI
           fB: CGGTGGAGGACCGTTTTTACAACATAG             759    45
           rB: GGGGTTTGCTCAGAGGCTGC




                                                  82
MLH1-     fA: fA-L155R                          281    50   fA   927    45   PvuII
V185G     rA: CTGCATTGTGTCCTGAATACCTGC                      rB               NsiI
          fB: GCAGGTATTCAGGACACAATGCAG          669    50
          rB: rB-L155R
MLH1-     fA: fA-L155R                          367    50   fA   927    45   PvuII
V213M     rA: GCGAATATTGTCCATGGTTGAGGC                      rB               NsiI
          fB: GCCTCAACCATGGACAATATTCGC          583    50
          rB: rB-L155R
MLH1-     fA: fA-L155R                          383    45   fA   927    45   PvuII
I219V     rA: CATTTCCAAAGACGGAGCGAATATTG                    rB               NsiI
          fB: CAATATTCGCTCCGTCTTTGGAAATG        569    45
          rB: rB-L155R
MLH1-     fA: fA-L155R                          470    45   fA   927    45   PvuII
S247P     rA: GTAGTTTGCATTGGGTATGTAACCATTC                  rB               NsiI
          fB: GAATGGTTACATACCCAATGCAAACTAC      485    45
          rB: rB-L155R
MLH1-     fA: fA-L155R                          716    45   fA   927    45   PvuII
H329P     rA: CTTGCTCTCGATGGGCTGCTGCACCCG                   rB               NsiI
          fB: CGGGTGCAGCAGCCCATCGAGAGCAAG       238    45
          rB: rB-L155R
MLH1-     fA: fA-L155R                          719    45   fA   924    45   PvuII
I330del   rA: GGAGCTTGCTCTCGTGCTGCTGCAC                     rB               NsiI
          fB: GTGCAGCAGCACGAGAGCAAGCTCC         235    45
          rB: rB-L155R
MLH1-     fA: CGGGTGCAGCACATCG                  366    45   fA   1618   45   NsiI
K443Q     rA: GCTCTGATTTTGGGCAGCCACTTC                      rB               NotI
          fB: GAAGTGGCTGCCCAAAATCAGAGC          1279   45
          rB: CTGATTATGATCCTCTAGTAC
MLH1-     fA: fA-K443Q                          690    45   fA   1618   45   NsiI
L550P     rA: CTTGGTGGTGTTGGGAAGGTATAACTTG                  rB               NotI
          fB: CAAGTTATACCTTCCCAACACCACCAAG      959    45
          rB: rB-K443Q
MLH1-     fA: fA-K443Q                          808    45   fA   1618   45   NsiI
A589D     rA: CTGGACTATCTAAGTCAAGCATGGCAAG                  rB               NotI
          fB: CTTGCCATGCTTGACTTAGATAGTCCAG      841    45
          rB: rB-K443Q
MLH1-     fA: fA-K443Q                          876    60   fA   1615   60   NsiI
V612de    rA: CTTCAGAAACTCAATGTATTCAGC                      rB               NotI
l         fB: GCTGAATACATTGAGTTTCTGAAG          772    60
          rB: rB-K443Q
MLH1-     fA: fA-K443Q                          893    45   fA   1615   65   NsiI
K616de    rA: GCAAGCATCTCAGCCTTCTTCAGAAACTC                 rB               NotI
l         fB: GAGTTTCTGAAGAAGGCTGAGATGCTTGC     751    65
          rB: rB-K443Q
MLH1-     fA: fA-K443Q                          896    45   fA   1618   45   NsiI
K618A     rA:                                               rB               NotI
          GCAAGCATCTCAGCCGCCTTCTTCAGAAACTC      754    45
          fB:
          GAGTTTCTGAAGAAGGCGGCTGAGATGCTTGC
          rB: rB-K443Q
MLH1-     fA: fA-K443Q                          896    45   fA   1618   45   NsiI
K618T     rA:                                               rB               NotI
          GCAAGCATCTCAGCCGTCTTCTTCAGAAACTC      754    45
          fB: GAGTTTCTGAAGAAGACGCTGAGATGCTTGC
          rB: rB-K443Q
MLH1-     fA: fA-K443Q                          937    45   fA   1525   45   NsiI
Del633-   rA: CGTCCCAATTCACCTCATCAATTTCC                    rB               NotI
663       fB: GGAAATTGATGAGGTGAATTGGGACG        614    45
          rB: rB-K443Q
MLH1-     fA: fA-K443Q                          979    45   fA   1618   45   NsiI
Y646C     rA: CCAAAGGGGGCACACAGTTGTCAATC                    rB               NotI
          fB: GATTGACAACTGTGTGCCCCCTTTGG        669    45
          rB: rB-K443Q




                                           83
    MLH1-     fA: fA-K443Q                                         985     45        fA     1618       45        NsiI
    P648L     rA: GTCCCTCCAAAGGGAGCACATAGTTGTC                                       rB                          NotI
              fB: GACAACTATGTGCTCCCTTTGGAGGGAC                     664     45
              rB: rB-K443Q
    MLH1-     fA: fA-K443Q                                         985     45        fA     1618       45        NsiI
    P648S     rA: CCAAAGGGGACACATAGTTGTC                                             rB                          NotI
              fB: GACAACTATGTGTCCCCTTTGG                           664     45
              rB: rB-K443Q
    MLH1-     fA: fA-K443Q                                         1000    45        fA     1618       45        NsiI
    P654L     rA: GAATGAAGATAAGCAGTCCCTCCAAAGG                                       rB                          NotI
              fB: CCTTTGGAGGGACTGCTTATCTTCATTC                     648     45
              rB: rB-K443Q
    MLH1-     fA: fA-K443Q                                         1018    45        fA     1618       60        NsiI
    R659P     rA:                                                                    rB                          NotI
              CCTCAGTGGCTAGTGGAAGAATGAAGATAGGC                     632     45
              fB: GCCTATCTTCATTCTTCCACTAGCCACTGAGG
              rB: rB-K443Q
    MLH1-     fA: fA-K443Q                                         1015    60        fA     1618       60        NsiI
    R659Q     rA: CAGTGGCTAGTTGAAGAATGAAGATAG                                        rB                          NotI
              fB: CTATCTTCATTCTTCAACTAGCCACTG                      634     60
              rB: rB-K443Q
    MLH1-     fA: fA-K443Q                                         1082    60        fA     1618       60        NsiI
    A681T     rA: GAATAGAACATAGTGCATTCTTTAC                                          rB                          NotI
              fB: GTAAAGAATGCACTATGTTCTATTC                        564     60
              rB: rB-K443Q
    MLH1-     fA: fA-K443Q                                         1188    45        fA     1618       45        NsiI
    V716M     rA: GACAATGTGTTCCATAGTCCACTTCCAG                                       rB                          NotI
              fB: CTGGAAGTGGACTATGGAACACATTGTC                     461     45
              rB: rB-K443Q
1
    annealing temperature in 1st PCR; 2 annealing temperature in 2nd PCR



Table A.2. Characteristics of different plasmids used in the present study.
                                                                          Cloning sites Selection        Original
      Plasmid       Purpose of use        Reference       Insert            of insert   in E.coli        plasmid
     pFast-Bac1-     Generation of        Prof. Josef     MLH1            BamHI + NotI ampicillin       pFastBac1
       MLH1        baculoviruses for       Jiricny,                                                    (Invitrogen)
                 protein expression in   University of
                       Sf9 cells            Zürich
     pFast-Bac1-     Generation of        Prof. Josef     PMS2            BamHI + XbaI ampicillin       pFastBac1
       PMS2        baculoviruses for       Jiricny,                                                    (Invitrogen)
                 protein expression in   University of
                       Sf9 cells            Zürich
     pEGFP-N1 Protein expression in        Clontech       EGFP            BamHI + NotI kanamycin            ..
                         293T
                     human cells
     pMLH1-N1 Protein expression in      Present study    MLH1            BamHI + NotI kanamycin pEGFP-N1
                         293T                                                                    (Clontech)
                     human cells
     pPMS2-N1 Protein expression in      Present study    PMS2            BamHI + NotI kanamycin pEGFP-N1
                         293T                                                                    (Clontech)
                     human cells
    pMLH1-EGFP Protein expression in     Present study    MLH1-     NheI + SacI kanamycin pEGFP-N1
                         293T                          EGFP fusion   (MLH1)               (Clontech)
                     human cells                            gene
    pPMS2-EGFP Protein expression in     Present study PMS2-EGFP BamHI + AgeI kanamycin pEGFP-N1
                         293T                           fusion gene  (PMS2)               (Clontech)
                     human cells
       pGEM      Preparation of DNA        Promega            ..                ..        ampicillin        ..
                     heteroduplex




                                                         84
Table A.3. Cell lines used in the present study.
 Cell                                                                                 Used in original
 line             Specification            Special characters       Reference           publication
 Sf9     insect (Spodoptera frugiperda              ..              Invitrogen              I-IV
                 9) ovarian cells
 293T    human embryonic kidney cells     loss of MLH1 protein   Trojan et al. 2001        II-IV
 TK6       human lymphoblastoid cells               ..                ATCC                  I-IV
 HCT116 human colon carcinoma cells       loss of MLH1 protein        ATCC                  I-IV
ATCC, American Type Culture Collection.




                                                 85

								
To top