Docstoc

Fructose bisphosphate aldolase EC

Document Sample
Fructose bisphosphate aldolase EC Powered By Docstoc
					    GTB 204/3 Molecular Biology Technique

     CLONING SIMULATION PROJECT 2003

Cloning of Human Aldolase B gene : Towards the
       Application in Hereditary Fructose
                Intolerance(HFI)
                    By Group A

  HO YI CHIEW                      71035

  ABD.RASHID B.JUSOH                70931

  SITI FATIHAH ARIFFIN              70965

  MUHAMMAD ZAKI B.ABDUL AZIZ        58971

  EDINUR HISHAM B.ATAN              71034

  SITI SALWA BT.KASSIM              59040

  ABDUL HAIL AHMAD TARMIZZI         71033

                DATE : 25.8.2003

       LECTURER : DR.M.RAVICHANDRAN


                                                 1
TABLE OF CONTENTS

                  TITLE                                        PAGE
    Objectives …………………………………………………………… 3
    Abstract ……………………………………………………………… 4
    Introduction ………………………………………………………….. 6
    STEPS IN CLONING SIMULATION PROJECT
    Step 1 : Hunt for Gene and Get the Gene Sequence …………………… 13
    Step 2 : Open Reading Frame (ORF) Analysis ………………………… 15
    Step 3 : Restriction Enzyme Analysis ………………………………….. 17
    Step 4 : Determination of Amino Acid
            Sequence and Molecular Weight ………………………………. 25
    Step 5 : Compare the Gene Sequence
            with other Similar Gene Sequences
           a) BLAST Analysis(Basic Local Alignment Search Tool) …….. 30
           b) Multiple DNA Sequence Alignment ………………………… 42
    Step 6 : Design primer for
            Polymerase Chain Reaction(PCR) amplification ……………….. 47
    Step 7 : Choosing a suitable vector for cloning …………………………. 50
    Step 8 : Ligation …………………………………………………………. 52
    Step 9 : Transformation …………………………………………………. 54
    Step 10 : Verification of Successful Transformation …………………… 56
    Step 11 : Screening by using
             Hybridization with Radioactive Labeled Probe ………………. 56
    Step 12 : Expression of Recombinant protein……………………………. 57
    Step 13 : Extraction of Protein ………………………………………….. 58
    Step 14 : Purification of Recombinant Protein …………………………. 58
    Step 15 : SDS-PAGE …………………………………………………… 62
    Uses and Commercial Values of the Human Aldolase B Enzymes ……. 65
    Conclusion ……………………………………………………………… 67
    References ……………………………………………………………… 68




                                                                          2
OBJECTIVES


   To understand the concepts of molecular biology technique.
   To understand the application of recombinant DNA technology.
   To understand the functions of the recombinant protein.
   To learn how to design a relevant cloning strategy.
   To apply what we had been taught in the Molecular Biology Technique lectures.
   To practice cooperation and knowledge sharing among group members.
   To gain experiences in cloning strategy which could be useful in our future career.
   To complete the syllabus allocated for GTB 204/3 (Molecular Biology Technique).




                                                                                          3
ABSTRACT
       The human aldolase B gene, which encodes for the human aldolase B enzyme, is our
target gene in this cloning simulation project. We chose to clone this gene because this
isozyme has specialized functions in fructose metabolism and gluconeogenesis. Mutations in
the human aldolase B gene can result in diminished aldolase B activity, causing the autosomal
recessive disease, hereditary fructose intolerance(HFI). HFI patients develop a syndrome of
chronic fructose intoxication characterized by retarded growth, chronic liver disease, and
hepatomegaly. HFI can also lead to hypophosphatemia, increase in serum magnesium,
hyperuricemia and secondary hypoglycemia. By cloning the recombinant protein(human
aldolase B enzyme), we hope that specific drug or cure can be produced through the extensive
study and research of the molecular basis of recombinant aldolase B.
       The procedures we have followed in cloning this gene are: hunting for the human
aldolase B gene and getting the gene sequence from Genbank. Its ORF and the amino acids
sequence encoded by the ORF are then analyzed. Further, we analyzed restriction site it might
have and subsequently, made decision to choose the restriction site or restriction enzyme of
interest. Then we used the BLAST analysis and multiple DNA sequence alignment to check
its similarities with other genes of other organisms.
       Based on the restriction enzyme we have chosen, pETBlue-2 plasmid has been
selected as vector due to its specific properties, which is suitable in cloning the human
aldolase B gene. The properties of pETBlue-2 plasmid will be elaborated in detail in this
report later. BL21 Escherichia coli(E.coli) has been used as the host for replications of
recombinant DNA because it is the most and primary bacteria used in many cloning research.
It allows a simple manipulation on the bacteria.
       The aldolase B gene that we obtained from the Genbank is in mRNA form. We
synthesized the cDNA, using mRNA as template, by using reverse transriptase. Then, we
synthesized the second strand of cDNA by using an enzyme called Klenow Fragment DNA
Polymerase. Then we amplified the aldolase B gene using Polymerase Chain Reaction(PCR)
in which only the coding sequence of the aldolase B gene was amplified. We designed linkers
to the aldolase B gene as the gene only had blunt ends. pETBlue-2 were treated with EcoRI
and HindIII restriction endonuclease and then ligation was performed to get a recombinant
plasmid, which carried the aldolase B gene. The aldolase B gene was inserted into multiple
cloning sites (MCS) of the plasmid. The recombinant plasmid is then transformed into BL21
E.coli host cell by using the Calcium chloride method. Transformants were selected by
culturing them on nutrient agar in the presence of ampicillin. Then, the grown bacterial


                                                                                           4
colonies were selected for screening to determine the bacteria containing the recombinant
plasmid. The method being used here was hybridization with radioactive labeled probe. After
screening, the targeted bacterial colony is amplified by subculturing them on nutrient agar and
treated with IPTG to induce the BL21 E.coli to express the aldolase B gene. It led to the
transcription and translation of the gene. This may cause synthesis of human aldolase B
enzyme(recombinant protein), which leads to protein accumulation in the host cell. By using
Nickel Metal Affinity Chromatography, we managed to purify the recombinant protein in
order to get the human aldolase B enzyme. At the end of the project, we run the purified
recombinant protein in SDS-PAGE to verify the molecular weight of the recombinant protein
to ensure that we have cloned the desired protein.
       We produced the recombinant aldolase B enzyme to study its molecular structure and
do research on it. The final goal is to find a cure for the HFI disease. We also plan to produce
drug from the recombinant protein or inject it directly to the HFI patients who are suffering
from catalytic deficiency in aldolase B enzyme.




                                                                                              5
INTRODUCTION




                           Figure 1 : Structure of Aldolase B Gene


       Hereditary fructose intolerance(HFI) has been recognized as a genetic disorder in
humans since 1956. HFI results from a deficiency of aldolase B activity in the liver, kidney,
and intestine. The disease is inherited as an autosomal recessive trait and most parents of HFI
patients are unaffected and exhibit wild-type aldolase B activities. These repercussions of
fructose ingestion are most dire for the newborn infant whose parents are unaware of the
disorder and may coerce the persistent ingestion of fructose, making weaning during infancy
the period of greatest risk. Undoubtedly some of the many cases of undiagnosed liver failure
in infancy may be due to HFI. Those individuals that survive develop a permanent and
powerful protective aversion to sweet-tasting foods. However, even later in life acute
exposure of HFI subjects to the noxious sugar can lead to liver failure and death.
       Aldolase B is the major aldolase isozyme in the liver and has specialized functions in
fructose metabolism, using fructose 1-phosphate as a substrate, and in gluconeogenesis,
producing fructose 1,6-bisphosphate from the two triose phosphates, glyceraldehyde-3-
phosphate and dihydroxyacetone phosphate. Mutations in the human aldolase B gene that


                                                                                             6
result in diminished aldolase B activity cause the autosomal recessive disease, HFI. The
disease leads to high levels of fructose-1-phosphate(F1P) in the tissues where aldolase B is
expressed, causing several hazardous metabolic effects that can result in liver and kidney
damage. The symptoms of the disorder, abdominal pain, vomiting and hypoglycemia, result
from ingestion of fructose or other sugars that are metabolized through F1P. Growth
retardation, renal tubular dysfunction, liver failure, coma and eventually death may occur if
the disease remains undiagnosed and the patient continues to ingest fructose.
       Aldolase is a ubiquitous glycolytic enzyme that catalyzes the reversible cleavage of
fructose 1,6-bisphosphate to glyceraldehyde 3-phosphate(G3P) and dihydroxyacetone
phosphate(DHAP). The enzyme also catalyzes the cleavage of structurally related sugar
phosphates including fructose-1-phosphate(F1P), an intermediate of fructose metabolism.
Comparative studies of aldolases derived from diverse sources have demonstrated the
presence of two classes of aldolase with different catalytic and molecular properties. Class I
aldolases are found in animals, plants, and green algae while class II aldolases are found in
bacteria, yeasts, and fungi.
       We choose class I aldolase for our cloning simulation project. The class I aldolases of
animals and higher plants have been widely studied. The enzymes are invariably tetrameric
and both amino acid sequence and nucleic acid sequences indicate that they are highly
conserved and derived by divergent evolution from a common ancestral gene.
       Three unique forms of class I aldolase have been detected in various tissues of
vertebrate species including man. These three enzymes, aldolase A(isolated from muscle),
aldolase B(isolated from liver) and aldolase C(isolated from brain) have all been purified to
homogeneity from rabbit tissues and have been extensively characterized. It is clear that these
isozymes are closely related. They have identical molecular weights, form mixed hybrids in
vivo and in vitro and catalyze the same overall reactions. However, it is also clear that each is
a unique protein species. The three forms are immunologically distinct, have different peptide
maps, have distinguishable catalytic activities, have different chromosomal locations, and
different gene sequences.




                                                                                               7
Figure 2 : Normal Fructose Metabolism




                                        8
Figure 3 : Fructose Metabolism in HFI




                                        9
    Pathophysiology of HFI
After fructose ingestion, the inability of aldolase B to cleave fructose-1-phosphate(F1P)
effectively creates a build up of F1P. Inorganic phosphate which is used to regenerate ATP is
sequestered in the accumulating F1P. The inability of aldolase B to cleave F1P leads to the
following pathophysiologies :
1. Hypophasphatemia
   This is a drop in inorganic phosphate(Pi) levels. It is caused by the sequestrating of Pi in
   the high amounts of F1P. This dropping phosphate prevents the enzyme „phosphorylase a‟
   from cleaving glycogen which leads to one of the pathophysiologies : secondary
   hypoglycemia. It is also thought to cause many of the visible symptoms such as
   abdominal pain, though the mechanism is not known.
2. Increase in serum magnesium (Mg)
   ATP is a strong Mg chelator in the blood. So after fructose ingestion the depletion of ATP
   by the useless generation of F1P releases Mg.
3. Hyperuricemia
   Hypophosphatemia and high AMP increase the activity of AMP deaminase. AMP
   deaminase converts AMP into IMP which is then converted to uric acid. This uric acid
   build up is called hyperuricemia.
4. Secondary hypoglycemia
   There are two thoughts to why the body is inhibited from releasing its stores of hepatic
   glucose(glycogen).
   a) glycogenolysis(breakdown of glycogen into glucose) is inhibited by the decreased Pi
      levels.
   b) F1P inhibits phosphogluco-isomerase.


    HFI incidence rate
       The world-wide incidence rate of HFI remains unknown due to the difficulty of HFI
diagnosis. The first report of an incidence rate was from Switzerland, where over a five year
period that included 100,000 births, five cases of HFI were reported. The degree of deviation
in this estimate of 1 in 20,000 births is large and the incidence rate may range from 1 in
10,000 to 1 in 100,000. A more recent study in the UK using DNA testing indicated a more
precise incidence rate of 1 in 22,000 where the range would be between 1 in 12,000 to 1 in
58,000.



                                                                                                  10
       It is likely that the incidence rate varies quite widely among different ethnic groups.
Until easier and more effective methods of diagnosis are available from research involving
different ethnic groups, the incidence rate will remain unclear. There have been numerous
reports of self diagnosis in adulthood, inadvertent deaths to undiagnosed subjects, and
homozygous-heterozygous marriages, all of which indicate that the incidence rate could be
closer to 1 in 10,000. If so, the carrier frequency would be 1 in 50. While the frequency of
HFI in Switzerland is considered by many pediatricians to be higher than other parts of the
world, the statistics outlined above have occurred world-wide and the presumption that HFI is
a rare disorder is clearly premature.


    How is HFI diagnosed?
       The underlying problem in treating HFI, as well as for a more complete
characterization of the population genetics of the disorder, is the difficulty of diagnosis. As
mentioned above, diagnosis of HFI is most critical during the newborn period. The condition
is manifested usually during infancy at weaning, when the child is introduced to fruits and
vegetables, or when feeding is transferred from breast milk to artificial nutrients. Complete
exclusion of fructose results in dramatic recovery, however, early diagnosis is crucial for
prevention of fatalities in the high-risk period of infancy. In many cases preliminary
diagnoses are made simply based on symptoms exhibited by infants when they are weaned to
fructose-containing foods or formula supplements containing fructose. Further standard
clinical work-up may often reveal nonspecific liver dysfunction.
The only definitive way to ascertain if one is suffering from HFI is to have one of two tests:
1) An enzymatic assay to determine aldolase activity. The aldolase is obtained from patient
   liver tissue in an invasive surgical procedure called a liver biopsy.
2) A fructose tolerance test. Fructose is injected intraveniously under controlled conditions
   where acute glucose, fructose, and phosphate levels are monitored.
       However, both tests represent considerable risk, especially in a newborn. In addition,
diagnosis by a fructose tolerance test leads to the same acute symptoms that can be life
threatening. Diagnosis is a challenge, particularly for infants who are suffering the acute
symptoms of the disease and, therefore, are not ideal candidates for either test. Often
diagnosis is not made until adulthood when patients sometimes report symptoms as a "food
allergy". Even in undiagnosed adults HFI remains a problem due to recurrent inadvertent
fructose ingestion. Many deaths have been documented in undiagnosed HFI individuals who



                                                                                                 11
have been challenged unintentionally. These reasons underscore the need for early, reliable,
and non-invasive diagnosis of HFI.
       A newer, non-invasive DNA test is readily becoming more available. While the DNA
test is not diagnostic because negative results do not guarantee that one does not have HFI,
positive results, along with clinical symptoms, are strong indicators of disease. A presumptive
diagnosis can be made.


      Treatment for HFI
       The treatment for HFI is the exclusion of fructose, sucrose, and sorbitol(less than 40
mg/kg per day) from the diet and results in complete alleviation of most symptoms and a
normal life span. Older HFI subjects who adhere to a self-imposed fructose-restricted diet
may continue to live undiagnosed and lead relatively normal lives. Complete exclusion of
fructose is often difficult, however, and many HFI patients develop a syndrome of chronic
fructose intoxication characterized by retarded growth, chronic liver disease, and
hepatomegaly. Furthermore, if not treated properly, these patients suffer episodes of
hypoglycemia, general ill health, and strained relationships with family members due to their
peculiar eating habits. Constant daily risk remains for HFI individuals due to the increasingly
widespread use of these sugars as nutrients and sweeteners.


      Is there a cure?
       HFI is a heritable genetic disease and a cure would involve replacement of the gene or
of the lost aldolase B enzyme activity directly to the liver, kidney, and intestine. Currently,
there are no procedures that can do this, although with more research it is not inconceivable.




                                                                                             12
STEPS IN CLONING SIMULATION PROJECT
STEP 1 : Hunt for Gene and Get the Gene Sequence
       Gene hunting is one of the toughest step in this cloning simulation project. At first, we
decided that each group member find a different gene. After that, we held meeting to discuss
and select the most suitable gene to clone. Several kinds of gene had been found by our group
members. After having discussion, we decided to choose human aldolase B gene for our
cloning project. We visited Genbank website – http://www.ncbi.nlm.nih.gov to get the gene
sequence.
       The Genbank website is maintained by the National Center For Biotechnology
Information(NCBI). NCBI is a national resource center that gathers useful molecular biology
information in the field of biotechnology. It is established in 1988, and it remains active in
conducting research in computational biology, developing powerful software tools for
analyzing genome data, creating public databases, and disseminating biomedical information
for a better understanding of molecular process regarding human health and disease.
       By accessing to the website, the name of gene of interest is submitted to the search
engine by typing the gene name „human aldolase B gene‟. A series of search result are
obtained. By reviewing each result carefully, we decided to choose the gene sequence with
the accession number NM_000035. The definition for this accession is Homo sapiens aldolase
B, fructose-bisphosphate (ALDOB). It has 1654 base pairs in length and its version is
NM_000035.1 GI: 4557306.
       Besides, we knew that the obtained gene sequence is already deprived off the introns
(as these are the non-coding sequence in eukaryotic organism) because the gene is in the form
of mRNA given by gene bank. The gene of interested is located at the locus of chromosome 9.
Coding sequence(CDS) is in the region of base pairs between 126 – 1220. The gene sequence
for ALDOB is show as below:

Homo sapiens aldolase B, fructose-bisphosphate (ALDOB), mRNA.

BASE COUNT :         470 a 420 c 393 g 371 t
ORIGIN
1     aaaaacatga tgagaagtct ataaaaattg tgtgctacca aagatctgtc ttatttggca

61    gctgctgcct cacccacagc ttttgatatc taggaggact cttctctccc aaactacctg

121   tcaccatggc ccaccgattt ccagccctca cccaggagca gaagaaggag ctctcagaaa

181   ttgcccagag cattgttgcc aatggaaagg ggatcctggc tgcagatgaa tctgtaggta



                                                                                             13
241   ccatggggaa ccgcctgcag aggatcaagg tggaaaacac tgaagagaac cgccggcagt

301   tccgagaaat cctcttctct gtggacagtt ccatcaacca gagcatcggg ggtgtgatcc

361   ttttccacga gaccctctac cagaaggaca gccagggaaa gctgttcaga aacatcctca

421   aggaaaaggg gatcgtggtg ggaatcaagt tagaccaagg aggtgctcct cttgcaggaa

481   caaacaaaga aaccaccatt caagggcttg atggcctctc agagcgctgt gctcagtaca

541   agaaagatgg tgttgacttt gggaagtggc gtgctgtgct gaggattgcc gaccagtgtc

601   catccagcct cgctatccag gaaaacgcca acgccctggc tcgctacgcc agcatctgtc

661   agcagaatgg actggtacct attgttgaac cagaggtaat tcctgatgga gaccatgacc

721   tggaacactg ccagtatgtt actgagaagg tcctggctgc tgtctacaag gccctgaatg

781   accatcatgt ttacctggag ggcaccctgc taaagcccaa catggtgact gctggacatg

841   cctgcaccaa gaagtatact ccagaacaag tagctatggc caccgtaaca gctctccacc

901   gtactgttcc tgcagctgtt cctggcatct gctttttgtc tggtggcatg agtgaagagg

961   atgccactct caacctcaat gctatcaacc tttgccctct accaaagccc tggaaactaa

1021 gtttctctta tggacgggcc ctgcaggcag tagcactggc tgcctggggt ggcaaggctg

1081 caaacaagga ggcaacccag gaggctttta tgaagcgggc catggctaac tgccaggcgg

1141 ccaaaggaca gtatgttcac acgggttctt ctggggctgc ttccacccag tcgctcttca

1201 cagcctgcta tacctactag ggtccaatgc ccgccagcct agctccagtg cttctagtag

1261 gagggctgaa agggagcaac ttttcctcca atcctggaaa ttcgacacaa ttagatttga

1321 actcgctgga aatacaacac atgttaaatc ttaagtacaa gggggaaaaa ataaatcagt

1381 tatttgaaac ataaaaatga ataccaagga cctgatcaaa tttcacacag cagtttcctt

1441 gcaacacttt cagctcccca tgctccagaa tacccaccca agaaaataat aggctttaaa

1501 acaatatcgg ctcctcatcc aaagaacaac tgctgattga aacacctcat tagctgagtg

1561 tagagaagtg catcttatga aacagtctta gcagtggtag gttgggaagg agatagctgc

1621 aaccaaaaaa gaaataaata ttctataaac cttc




                                                                          14
STEP 2 : Open Reading Frame (ORF) Analysis
       Open reading frame(ORF) is a DNA sequences that contains series of codons, which
can be translated into protein. ORF must have start codon(ATG) as a starting point of a
peptide and ends with a stop codon(TGA, TAG or TAA) which serves as termination sites of
peptide, while the coding sequence is located between the start codon and stop codon.
       The ORF is a graphical analysis tool, which finds all open reading frames of a
selectable minimum size in users sequence or sequence already in the database. This tool
identifies all open reading frames using the standard or alternative genetic codes.
       This analysis is to make sure that the interested gene region, that is from 126-1220 bp,
can be expressed if the interested gene region is cloned in real life application.
       To     analyze     the   open     reading     frame,    we     used    the     website    –
http://www.ncbi.nlm.nih.gov/gorf/gorf.htm. In ORF finder, we only paste the gene sequence
or type the accession or GI number of NM_000035 and it will analyze the sequence for us.
       The result of ORF is shown as below. From the result, we can see that there are many
ORFs but we are only interested in the +3 frame, which starts from base pair 126 to base pair
1220 with 1095 bp in length, as this is the gene region that we want to clone in this project.
From the +3 ORF sequence, we also know that the +3 frame starts with a start codon(ATG)
and ends with a stop codon(TAG).


OPEN READING FRAME (ORF) FINDER RESULT :




                                                                                                15
Frame                  From                     to     Length
+3                     126                      1220   1095

-1                     35                       345    312
-2                     319                      788    270
+3                     1227                     1394   168
-1                     791                      949    159
-2                     445                      603    159
-1                     1217                     1342   126
-1                     377                      499    123




+3 ORF sequence


                             Length : 364 amino acid

        126 atggcccaccgatttccagccctcacccaggagcagaagaaggag
             M A H R F P A L T Q E Q K K E
        171 ctctcagaaattgcccagagcattgttgccaatggaaaggggatc
             L S E I A Q S I V A N G K G I
        216 ctggctgcagatgaatctgtaggtaccatggggaaccgcctgcag
             L A A D E S V G T M G N R L Q
        261 aggatcaaggtggaaaacactgaagagaaccgccggcagttccga
             R I K V E N T E E N R R Q F R
        306 gaaatcctcttctctgtggacagttccatcaaccagagcatcggg
             E I L F S V D S S I N Q S I G
        351 ggtgtgatccttttccacgagaccctctaccagaaggacagccag
             G V I L F H E T L Y Q K D S Q
        396 ggaaagctgttcagaaacatcctcaaggaaaaggggatcgtggtg
             G K L F R N I L K E K G I V V
        441 ggaatcaagttagaccaaggaggtgctcctcttgcaggaacaaac
             G I K L D Q G G A P L A G T N
        486 aaagaaaccaccattcaagggcttgatggcctctcagagcgctgt
             K E T T I Q G L D G L S E R C
        531 gctcagtacaagaaagatggtgttgactttgggaagtggcgtgct
             A Q Y K K D G V D F G K W R A
        576 gtgctgaggattgccgaccagtgtccatccagcctcgctatccag
             V L R I A D Q C P S S L A I Q
        621 gaaaacgccaacgccctggctcgctacgccagcatctgtcagcag
             E N A N A L A R Y A S I C Q Q
        666 aatggactggtacctattgttgaaccagaggtaattcctgatgga
             N G L V P I V E P E V I P D G


                                                                16
       711 gaccatgacctggaacactgccagtatgttactgagaaggtcctg
            D H D L E H C Q Y V T E K V L
       756 gctgctgtctacaaggccctgaatgaccatcatgtttacctggag
            A A V Y K A L N D H H V Y L E
       801 ggcaccctgctaaagcccaacatggtgactgctggacatgcctgc
            G T L L K P N M V T A G H A C
       846 accaagaagtatactccagaacaagtagctatggccaccgtaaca
            T K K Y T P E Q V A M A T V T
       891 gctctccaccgtactgttcctgcagctgttcctggcatctgcttt
            A L H R T V P A A V P G I C F
       936 ttgtctggtggcatgagtgaagaggatgccactctcaacctcaat
            L S G G M S E E D A T L N L N
       981 gctatcaacctttgccctctaccaaagccctggaaactaagtttc
            A I N L C P L P K P W K L S F
      1026 tcttatggacgggccctgcaggcagtagcactggctgcctggggt
            S Y G R A L Q A V A L A A W G
      1071 ggcaaggctgcaaacaaggaggcaacccaggaggcttttatgaag
            G K A A N K E A T Q E A F M K
      1116 cgggccatggctaactgccaggcggccaaaggacagtatgttcac
            R A M A N C Q A A K G Q Y V H
      1161 acgggttcttctggggctgcttccacccagtcgctcttcacagcc
            T G S S G A A S T Q S L F T A
      1206 tgctatacctactag 1220
            C Y T Y *




STEP 3 : Restriction Enzyme Analysis

       Restriction enzyme is a protein which recognizes specific short nucleotide sequences
and will cut at those sequences to give fragments of DNA. Different restriction enzyme has its
different restriction site. In order to clone a gene, the desired gene and the vector need to be
cut with the same restriction enzyme so that the gene can be inserted into the vector and
proceed to ligation and transformation process.
       In order to analyze the sequence for common restriction enzyme site for aldolase B
gene, we accessed the website - http://www.firstmarket.com/cutter/cut2.html. We just simply
paste the aldolase B gene sequence in the query window and the result is shown as below. The
results show the restriction endonuclease enzymes that cut the sequence and enzymes that do
not cut the sequence. We didn‟t choose any restriction endonuclease enzyme to cut our gene
of interest as different cloning strategy, which will be discussed later, is planned for this




                                                                                             17
cloning procedure. However, we chose two restriction enzymes to cut the vector we had
chosen, that is, EcoRI and HindIII. Both enzymes do not cut the desired gene sequence.


                                       Graphic map

                             XhoII
                             MflI          MspA1I
                             BstYI          PvuII
aaaaacatgatgagaagtctataaaaattgtgtgctaccaaagatctgtcttatttggcagctgctgcctcaccc base pairs
tttttgtactactcttcagatatttttaacacacgatggtttctagacagaataaaccgtcgacgacggagtggg 1 to 75
                             BstX2I          NspBII
                             BglII           AlwNI


                                                 NcoI Bsp19I
                          EarI                   StyI DsaI
        Eco32I            Eam1104I               Eco130I
acagcttttgatatctaggaggactcttctctcccaaactacctgtcaccatggcccaccgatttccagccctca base pairs
tgtcgaaaactatagatcctcctgagaagagagggtttgatggacagtggtaccgggtggctaaaggtcgggagt 76 to 150
        EcoRV             Ksp632I                ErhI BstDSI
                                                 BssT1I
                                                 EcoT14I


                  Eco24I SstI                                     BstI
                  AspHI FriOI                                    BamHI        PstI
EcoNI           Ecl136II BanII                                   BstYI SfcI
cccaggagcagaagaaggagctctcagaaattgcccagagcattgttgccaatggaaaggggatcctggctgcag base pairs
gggtcctcgtcttcttcctcgagagtctttaacgggtctcgtaacaacggttacctttcccctaggaccgacgtc 151 to 225
                EcoICRI SacI                                     BstX2I BstSFI
                   Bbv12I Alw21I                                 MflI
                   Psp124BI BsiHKAI                              XhoII



        Acc65I BssT1I                                 NgoMI
        BanI Eco130I DsaI BstSFI                  Ksp632I NgoAIV
     SfcI Eco64I StyI BstDSI PstI               Eco57I MroNI Cfr1
atgaatctgtaggtaccatggggaaccgcctgcagaggatcaaggtggaaaacactgaagagaaccgccggcagt base pairs
tacttagacatccatggtaccccttggcggacgtctcctagttccaccttttgtgacttctcttggcggccgtca 226 to 300
     BstSFI AccB1I KpnI SfcI                      Eam1104I Bse118
        Asp718I NcoI Bsp19I                     EarI BssAI NaeI
        BshNI ErhI EcoT14I                            BsrFI


           EarI                                                          Eco31I
  0I       Eam1104I                                                   BsiI
tccgagaaatcctcttctctgtggacagttccatcaaccagagcatcgggggtgtgatccttttccacgagaccc base pairs
aggctctttaggagaagagacacctgtcaaggtagttggtctcgtagcccccacactaggaaaaggtgctctggg 301 to 375


                                                                                         18
 I        Ksp632I                                                     BssSI
                                                                        BsaI


tctaccagaaggacagccagggaaagctgttcagaaacatcctcaaggaaaaggggatcgtggtgggaatcaagt base pairs
agatggtcttcctgtcggtccctttcgacaagtctttgtaggagttccttttcccctagcaccacccttagttca 376 to 450


   EcoT14I           BseRI
   StyI          Alw21I
   Eco130I       AspHI
tagaccaaggaggtgctcctcttgcaggaacaaacaaagaaaccaccattcaagggcttgatggcctctcagagc base pairs
atctggttcctccacgaggagaacgtccttgtttgtttctttggtggtaagttcccgaactaccggagagtctcg 451 to 525
   ErhI          Bbv12I
   BssT1I       BsiHKAI
                     EcoNI


 HaeII Alw21I
AfeI      Bbv12I
Aor51HI AspHI                              HincII                    PshAI
gctgtgctcagtacaagaaagatggtgttgactttgggaagtggcgtgctgtgctgaggattgccgaccagtgtc base pairs
cgacacgagtcatgttctttctaccacaactgaaacccttcaccgcacgacacgactcctaacggctggtcacag 526 to 600
Eco47III BsiHKAI                           HindII
 Bsp143II
 BstH2I

                                                                      BshNI
                                                                      Asp718I
                                        BstXI         AlwNI          Eco64I
catccagcctcgctatccaggaaaacgccaacgccctggctcgctacgccagcatctgtcagcagaatggactgg base pairs
gtaggtcggagcgataggtccttttgcggttgcgggaccgagcgatgcggtcgtagacagtcgtcttacctgacc 601 to 675
                                                                      BanI
                                                                      Acc65I
                                                                      AccB1I

                                                Van91I
                                                PflMI                DraII
                                             Eco31I                  PpuMI
tacctattgttgaaccagaggtaattcctgatggagaccatgacctggaacactgccagtatgttactgagaagg base pairs
atggataacaacttggtctccattaaggactacctctggtactggaccttgtgacggtcatacaatgactcttcc 676 to 750
                KpnI                   BsaI AccB7I                EcoO109I
                                            Esp1396I              Psp5II


                                                  BshNI
                                                  Eco64I
                   AccI EcoO109I                GsuI
tcctggctgctgtctacaaggccctgaatgaccatcatgtttacctggagggcaccctgctaaagcccaacatgg base pairs
aggaccgacgacagatgttccgggacttactggtagtacaaatggacctcccgtgggacgatttcgggttgtacc 751 to 825


                                                                                         19
                           DraII               BpmI
                                                BanI
                                                AccB1I

                                               BalI
                                  BpmI         MscI
            NspI BsgI AccI GsuI              EaeI
tgactgctggacatgcctgcaccaagaagtatactccagaacaagtagctatggccaccgtaacagctctccacc base pairs
actgacgacctgtacggacgtggttcttcatatgaggtcttgttcatcgataccggtggcattgtcgagaggtgg 826 to 900
                          Bst1107I          CfrI
                                               MluNI


                        MspA1I
                      PstI                          EarI
                 SfcI PvuII                         Eam1104I
gtactgttcctgcagctgttcctggcatctgctttttgtctggtggcatgagtgaagaggatgccactctcaacc base pairs
catgacaaggacgtcgacaaggaccgtagacgaaaaacagaccaccgtactcacttctcctacggtgagagttgg 901 to 975
                 BstSFI                             Ksp632I
                       NspBII


                                                                    Eco24I Sse8387I
                                                                 EcoO109I BstSFI
                                           BstXI               Bsp120I SfcI SbfI
tcaatgctatcaacctttgccctctaccaaagccctggaaactaagtttctcttatggacgggccctgcaggcag base pairs
agttacgatagttggaaacgggagatggtttcgggacctttgattcaaagagaatacctgcccgggacgtccgtc 976 to 1050
                                                               PspOMI BanII
                                                                 DraII ApaI PstI
                                                                    FriOI BglI

                                                                         NcoI
                                                                         StyI
                                                                         Eco13
tagcactggctgcctggggtggcaaggctgcaaacaaggaggcaacccaggaggcttttatgaagcgggccatgg base pairs
atcgtgaccgacggaccccaccgttccgacgtttgttcctccgttgggtcctccgaaaatacttcgcccggtacc 1051 to 1125
                                                                         ErhI
                                                                         BssT1I
                                                                         EcoT14I

Bsp19I
DsaI                                                                     Ksp632I
0I       EaeI                                                            Eam11
ctaactgccaggcggccaaaggacagtatgttcacacgggttcttctggggctgcttccacccagtcgctcttca base pairs
gattgacggtccgccggtttcctgtcatacaagtgtgcccaagaagaccccgacgaaggtgggtcagcgagaagt 1126 to1200
BstDSI     CfrI                                                           SapI
                                                                          EarI




                                                                                          20
   04I                                GsuI
cagcctgctatacctactagggtccaatgcccgccagcctagctccagtgcttctagtaggagggctgaaaggga base pairs
gtcggacgatatggatgatcccaggttacgggcggtcggatcgaggtcacgaagatcatcctcccgactttccct 1201 to 1275
                                      BpmI
                                                                   NspI
               AcsI                                            BspLU11I
gcaacttttcctccaatcctggaaattcgacacaattagatttgaactcgctggaaatacaacacatgttaaatc base pairs
cgttgaaaaggaggttaggacctttaagctgtgttaatctaaacttgagcgacctttatgttgtgtacaatttag 1276 to 1350
               ApoI                                            AflIII



MspCI                                                        EcoT14I BclI
Bst98I                                                       StyI DraII
BspTI                            MslI                        Eco130I FbaI AcsI
ttaagtacaagggggaaaaaataaatcagttatttgaaacataaaaatgaataccaaggacctgatcaaatttca base pairs
aattcatgttcccccttttttatttagtcaataaactttgtatttttacttatggttcctggactagtttaaagt 1351 to 1425
AflII                                                        ErhI EcoO109I ApoI
Vha464I                                                      BssT1I Psp5II
BfrI                                                           PpuMI Ksp22I



                                                 GsuI                DraI
cacagcagtttccttgcaacactttcagctccccatgctccagaatacccacccaagaaaataataggctttaaa base pairs
gtgtcgtcaaaggaacgttgtgaaagtcgaggggtacgaggtcttatgggtgggttcttttattatccgaaattt 1426 to 1500
                                                 BpmI


              BseRI
acaatatcggctcctcatccaaagaacaactgctgattgaaacacctcattagctgagtgtagagaagtgcatct base pairs
tgttatagccgaggagtaggtttcttgttgacgactaactttgtggagtaatcgactcacatctcttcacgtaga 1501 to 1575


                                                                          SspI
tatgaaacagtcttagcagtggtaggttgggaaggagatagctgcaaccaaaaaagaaataaatattctataaac base pairs
atactttgtcagaatcgtcaccatccaacccttcctctatcgacgttggttttttctttatttataagatatttg 1576 to 1650


cttc base pairs
gaag 1651 to 1654


                                   Table by Enzyme Name

Enzyme      No.          Positions               Recognition
name                     cuts of sites           sequence

Acc65I      2            237 674                  g/gtacc                         More info
AccB1I      3            237 674 801              g/gyrcc                         More info


                                                                                           21
AccB7I      1     719                    ccannnn/ntgg                  More info
AccI        2     763 855                gt/mkac                       More info
AcsI        2     1298 1418              r/aatty                       More info
AfeI        1     525                     agc/gct                      More info
AflII      1      1350                    c/ttaag                       More info
AflIII      1      1339                    a/crygt                      More info
Alw21I      3     172 467 533              gwgcw/c                      More info
AlwNI      2      64 655                  cagnnn/ctg                    More info
Aor51HI     1      525                      agc/gct                      More info
ApaI       1      1040                      gggcc/c                     More info
ApoI       2      1298 1418                 r/aatty                     More info
Asp718I    2       237 674                   g/gtacc                    More info
AspHI      3       172 467 533              gwgcw/c                     More info
BalI       1       879                       tgg/cca                    More info
BamHI      1       211                       g/gatcc                    More info
BanI       3       237 674 801                g/gyrcc                   More info
BanII      2      172 1040                    grgcy/c                   More info
Bbv12I     3      172 467 533                 gwgcw/c                   More info
BclI       1      1413                         t/gatca                  More info
BfrI       1      1350                         c/ttaag                  More info
BglI       1      1044                          gccnnnn/nggc            More info
BglII       1       42                          a/gatct                 More info
BpmI       4       800 864 1248 1468           ctggag                   More info
BsaI        2       374 714                      ggtctc                 More info
Bse118I     1       292                            r/ccggy              More info
BseRI      2        471 1516                      gaggag                More info
BsgI       1        847                             gtgcag              More info
BshNI      3        237 674 801                     g/gyrcc             More info
BsiHKA     3       172 467 533                      gwgcw/c             More info
BsiI        1       371                             ctcgtg              More info
Bsp120I     1       1036                            g/ggccc             More info
Bsp143II    1       527                             rgcgc/y             More info
Bsp19I      3       124 241 1120                     c/catgg            More info
BspLU11      1      1339                             a/catgt            More info
BspTI        1      1350                             c/ttaag            More info
BsrFI        1      292                              r/ccggy            More info
BssAI        1      292                              r/ccggy            More info
BssSI         1      371                             ctcgtg             More info
BssT1I       5       124 241 455 1120 1404           c/cwwgg             More info
Bst1107I     1       856                              gta/tac           More info
Bst98I       1       1350                             c/ttaag           More info
BstDSI       3       124 241 1120                     c/crygg           More info
BstH2I       1        527                             rgcgc/y           More info
BstI         1        211                            g/gatcc            More info
BstSFI       5       220 232 255 910 1041            c/tryag            More info
BstX2I       2        42 211                           r/gatcy          More info
BstXI        2        635 1009                         ccannnnn/ntgg    More info
BstYI        2        42 211                            r/gatcy         More info
Cfr10I       1        292                               r/ccggy         More info
CfrI         2        877 1138                          y/ggccr         More info


                                                                               22
DraI     1        1497                         ttt/aaa     More info
DraII    4       749 770 1037 1408              rg/gnccy   More info
DsaI     3        124 241 1120                 c/crygg     More info
EaeI      2       877 1138                     y/ggccr     More info
Eam1104I 5       104 287 317 959 1199     ctcttc           More info
EarI      5      104 287 317 959 1199     ctcttc           More info
Ecl136II  1      170                      gag/ctc          More info
Eco130I   5      124 241 455 1120 1404    c/cwwgg           More info
Eco24I    2      172 1040                 grgcy/c          More info
Eco31I    2      374 714                  ggtctc           More info
Eco32I    1      87                       gat/atc          More info
Eco47III 1       525                      agc/gct          More info
Eco57I    1      285                      ctgaag            More info
Eco64I    3      237 674 801              g/gyrcc          More info
EcoICRI  1       170                      gag/ctc          More info
EcoNI     2      150 472                  cctnn/nnnagg      More info
EcoO109I 4       749 770 1037 1408        rg/gnccy         More info
EcoRV     1       87                      gat/atc          More info
EcoT14I  5       124 241 455 1120 1404     c/cwwgg         More info
ErhI     5       124 241 455 1120 1404     c/cwwgg         More info
Esp1396I 1       719                       ccannnn/ntgg     More info
FbaI       1     1413                      t/gatca          More info
FriOI     2      172 1040                 grgcy/c           More info
GsuI      4       800 864 1248 1468       ctggag           More info
HaeII      1      527                      rgcgc/y         More info
HincII      1     554                      gty/rac         More info
HindII     1      554                      gty/rac         More info
KpnI       2       241 678                  ggtac/c        More info
Ksp22I      1      1413                     t/gatca        More info
Ksp632I     5      104 287 317 959 1199     ctcttc         More info
MflI        2      42 211                  r/gatcy         More info
MluNI       1       879                     tgg/cca        More info
MroNI       1       292                     g/ccggc        More info
MscI        1       879                     tgg/cca        More info
MslI         1      1394                   caynn/nnrtg     More info
MspA1I       2       61 915                cmg/ckg         More info
MspCI       1        1350                  c/ttaag         More info
NaeI         1      294                     gcc/ggc        More info
NcoI         3      124 241 1120            c/catgg        More info
NgoAIV       1       292                    g/ccggc        More info
NgoMI        1      292                     g/ccggc        More info
NspBII       2      61 915                  cmg/ckg        More info
NspI         2      840 1343                rcatg/y         More info
PflMI        1       719                   ccannnn/ntgg    More info
PpuMI        2       749 1408               rg/gwccy        More info
PshAI        1       595                    gacnn/nngtc    More info
Psp124BI     1      172                      gagct/c       More info
Psp5II       2      749 1408                 rg/gwccy      More info
PspOMI       1      1036                     g/ggccc        More info
PstI        4        224 259 914 1045        ctgca/g       More info


                                                                  23
PvuII          2              61 915                         cag/ctg            More info
SacI            1             172                           gagct/c             More info
SapI           1              1199                          gctcttc             More info
SbfI           1               1045                         cctgca/gg           More info
SfcI           5            220 232 255 910 1041           c/tryag              More info
Sse8387I       1            1045                           cctgca/gg            More info
SspI           1            1639                           aat/att              More info
SstI           1            172                             gagct/c             More info
StyI           5             124 241 455 1120 1404          c/cwwgg             More info
Van91I          1            719                           ccannnn/ntgg         More info
Vha464I         1            1350                          c/ttaag              More info
XhoII           2            42 211                        r/gatcy              More info



The following endonucleases were selected but don't cut this sequence:

AatI, AatII, Acc113I, Acc16I, AccBSI, AccIII, AclNI, AcyI, AgeI, AhdI,
Alw44I, Ama87I, AocI, ApaLI, AscI, AseI, AsnI, Asp700I, AspEI, AspI, AtsI,
AvaI, AviII, AvrII, BanIII, BbeI, BbiII, BbrPI, BbsI, BbuI, Bbv16II, BcgI,
BcoI, BlnI, BlpI, BpiI, Bpu1102I, Bpu14I, BpuAI, Bsa29I, BsaAI, BsaBI,
BsaHI, BsaMI, BsaOI, BsaWI, BscI, Bse21I, Bse8I, BseAI, BseCI, BsePI, Bsh1285I,
Bsh1365I, BsiEI, BsiMI, BsiWI, BsmBI, BsmI, BsoBI, Bsp106I, Bsp119I, Bsp13I,
Bsp1407I, Bsp1720I, Bsp68I, BspCI, BspDI, BspEI, BspHI, BspMI, BspXI, BsrBI,
BsrBRI, BsrDI, BsrGI, BssHII, BstBI, BstD102I, BstEII, BstMCI, BstPI, BstSNI,
BstZI, Bsu15I, Bsu36I, CciNI, CelII, Cfr42I, Cfr9I, ClaI, CpoI, Csp45I,
CspI, CvnI, DraIII, DrdI, EagI, Eam1105I, EclHKI, EclXI, Eco105I, Eco147I,
Eco255I, Eco52I, Eco72I, Eco81I, Eco88I, Eco91I, EcoO65I, EcoRI, EcoT22I,
EheI, Esp3I, FauNDI, FseI, FspI, Hin1I, HindIII, HpaI, Hsp92I, KasI, Kpn2I,
KspI, LspI, MamI, MfeI, MluI, Mph1103I, MroI, Msp17I, MunI, Mva1269I, NarI,
NdeI, NheI, NotI, NruI, NsiI, NspV, PacI, PaeI, PaeR7I, Pfl23II, PinAI,
Ple19I, PmaCI, Pme55I, PmeI, PmlI, Ppu10I, PshBI, Psp1406I, PspAI, PspALI,
PspEI, PspLI, PstNHI, PvuI, RcaI, RsrII, SacII, SalI, ScaI, SexAI, SfiI,
Sfr274I, Sfr303I, SfuI, SgfI, SgrAI, SmaI, SmiI, SnaBI, SpeI, SphI, SplI,
SrfI, SseBI, SspBI, SstII, StuI, SunI, SwaI, Tth111I, VneI, VspI, XbaI,
XcmI, XhoI, XmaI, XmaIII, XmnI, Zsp2I




                                                                                      24
STEP 4 : Determining Of Amino Acid Sequence and Molecular Weight


       By using BioEdit software, the amino acid sequence of aldolase B gene can be
determined and the results are:


       >Homo sapiens aldolase B, fructose-bisphosphate (ALDOB), mRNA.

1     aaa aac atg atg aga agt cta taa aaa ttg tgt gct acc aaa gat        45
1      K   N   M   M   R   S   L   *   K   L   C   A   T   K   D         15

46    ctg tct tat ttg gca gct gct gcc tca ccc aca gct ttt gat atc        90
16     L   S   Y   L   A   A   A   A   S   P   T   A   F   D   I         30

91    tag gag gac tct tct ctc cca aac tac ctg tca cca tgg ccc acc        135
31     *   E   D   S   S   L   P   N   Y   L   S   P   W   P   T         45

136   gat ttc cag ccc tca ccc agg agc aga aga agg agc tct cag aaa        180
46     D   F   Q   P   S   P   R   S   R   R   R   S   S   Q   K         60

181   ttg ccc aga gca ttg ttg cca atg gaa agg gga tcc tgg ctg cag        225
61     L   P   R   A   L   L   P   M   E   R   G   S   W   L   Q         75

226   atg aat ctg tag gta cca tgg gga acc gcc tgc aga gga tca agg        270
76     M   N   L   *   V   P   W   G   T   A   C   R   G   S   R         90

271   tgg aaa aca ctg aag aga acc gcc ggc agt tcc gag aaa tcc tct        315
91     W   K   T   L   K   R   T   A   G   S   S   E   K   S   S         105

316   tct ctg tgg aca gtt cca tca acc aga gca tcg ggg gtg tga tcc        360
106    S   L   W   T   V   P   S   T   R   A   S   G   V   *   S         120

361   ttt tcc acg aga ccc tct acc aga agg aca gcc agg gaa agc tgt        405
121    F   S   T   R   P   S   T   R   R   T   A   R   E   S   C         135

406   tca gaa aca tcc tca agg aaa agg gga tcg tgg tgg gaa tca agt        450
136    S   E   T   S   S   R   K   R   G   S   W   W   E   S   S         150

451   tag acc aag gag gtg ctc ctc ttg cag gaa caa aca aag aaa cca        495
151    *   T   K   E   V   L   L   L   Q   E   Q   T   K   K   P         165

496   cca ttc aag ggc ttg atg gcc tct cag agc gct gtg ctc agt aca        540
166    P   F   K   G   L   M   A   S   Q   S   A   V   L   S   T         180

541   aga aag atg gtg ttg act ttg gga agt ggc gtg ctg tgc tga gga        585
181    R   K   M   V   L   T   L   G   S   G   V   L   C   *   G         195

586   ttg ccg acc agt gtc cat cca gcc tcg cta tcc agg aaa acg cca        630
196    L   P   T   S   V   H   P   A   S   L   S   R   K   T   P         210

631   acg ccc tgg ctc gct acg cca gca tct gtc agc aga atg gac tgg        675
211    T   P   W   L   A   T   P   A   S   V   S   R   M   D   W         225




                                                                                25
676   tac cta ttg ttg aac cag agg taa ttc ctg atg gag acc atg acc   720
226    Y   L   L   L   N   Q   R   *   F   L   M   E   T   M   T    240

721   tgg aac act gcc agt atg tta ctg aga agg tcc tgg ctg ctg tct   765
241    W   N   T   A   S   M   L   L   R   R   S   W   L   L   S    255

766   aca agg ccc tga atg acc atc atg ttt acc tgg agg gca ccc tgc   810
256    T   R   P   *   M   T   I   M   F   T   W   R   A   P   C    270

811   taa agc cca aca tgg tga ctg ctg gac atg cct gca cca aga agt   855
271    *   S   P   T   W   *   L   L   D   M   P   A   P   R   S    285

856   ata ctc cag aac aag tag cta tgg cca ccg taa cag ctc tcc acc   900
286    I   L   Q   N   K   *   L   W   P   P   *   Q   L   S   T    300

901   gta ctg ttc ctg cag ctg ttc ctg gca tct gct ttt tgt ctg gtg   945
301    V   L   F   L   Q   L   F   L   A   S   A   F   C   L   V    315

946   gca tga gtg aag agg atg cca ctc tca acc tca atg cta tca acc   990
316    A   *   V   K   R   M   P   L   S   T   S   M   L   S   T    330

991   ttt gcc ctc tac caa agc cct gga aac taa gtt tct ctt atg gac   1035
331    F   A   L   Y   Q   S   P   G   N   *   V   S   L   M   D    345

1036 ggg ccc tgc agg cag tag cac tgg ctg cct ggg gtg gca agg ctg    1080
346   G   P   C   R   Q   *   H   W   L   P   G   V   A   R   L     360

1081 caa aca agg agg caa ccc agg agg ctt tta tga agc ggg cca tgg    1125
361   Q   T   R   R   Q   P   R   R   L   L   *   S   G   P   W     375

1126 cta act gcc agg cgg cca aag gac agt atg ttc aca cgg gtt ctt    1170
376   L   T   A   R   R   P   K   D   S   M   F   T   R   V   L     390

1171 ctg ggg ctg ctt cca ccc agt cgc tct tca cag cct gct ata cct    1215
391   L   G   L   L   P   P   S   R   S   S   Q   P   A   I   P     405

1216 act agg gtc caa tgc ccg cca gcc tag ctc cag tgc ttc tag tag    1260
406   T   R   V   Q   C   P   P   A   *   L   Q   C   F   *   *     420

1261 gag ggc tga aag gga gca act ttt cct cca atc ctg gaa att cga    1305
421   E   G   *   K   G   A   T   F   P   P   I   L   E   I   R     435

1306 cac aat tag att tga act cgc tgg aaa tac aac aca tgt taa atc    1350
436   H   N   *   I   *   T   R   W   K   Y   N   T   C   *   I     450

1351 tta agt aca agg ggg aaa aaa taa atc agt tat ttg aaa cat aaa    1395
451   L   S   T   R   G   K   K   *   I   S   Y   L   K   H   K     465


1396 aat gaa tac caa gga cct gat caa att tca cac agc agt ttc ctt    1440
466   N   E   Y   Q   G   P   D   Q   I   S   H   S   S   F   L     480

1441 gca aca ctt tca gct ccc cat gct cca gaa tac cca ccc aag aaa    1485
481   A   T   L   S   A   P   H   A   P   E   Y   P   P   K   K     495

1486 ata ata ggc ttt aaa aca ata tcg gct cct cat cca aag aac aac    1530
496   I   I   G   F   K   T   I   S   A   P   H   P   K   N   N     510

1531 tgc tga ttg aaa cac ctc att agc tga gtg tag aga agt gca tct    1575
511   C   *   L   K   H   L   I   S   *   V   *   R   S   A   S     525




                                                                           26
1576 tat gaa aca gtc tta gca gtg gta ggt tgg gaa gga gat agc tgc                    1620
526   Y   E   T   V   L   A   V   V   G   W   E   G   D   S   C                     540

1621 aac caa aaa aga aat aaa tat tct ata aac ctt                1653
541   N   Q   K   R   N   K   Y   S   I   N   L
Each codon is read as left nucleotide, top nucleotide, and right nucleotide.
Each entry is organized as follows:
- The number of occurrences of the codon in the sequence.
- Preference of that codon in organism represented by the codon table (as a fraction of all
  codons coding for the same amino acid).
- Three-letter code for the amino acid coded for according to the codon table.
   |A     C     G     T     |
-----------------------------
 A |19    16    15    6     |A
   |0.76 0.12 0.04 0.07 |
   |Lys   Thr   Arg   Ile   |
-----------------------------
 A |11    15    11    5     |C
   |0.61 0.43 0.27 0.46 |
   |Asn   Thr   Ser   Ile   |
-----------------------------
 A |11    4     23    17    |G
   |0.24 0.23 0.03 1        |
   |Lys   Thr   Arg   Met   |
-----------------------------
 A |4     6     14    4     |T
   |0.39 0.21 0.13 0.47 |
   |Asn   Thr   Ser   Ile   |
-----------------------------
 C |8     22    1     6     |A
   |0.31 0.2    0.05 0.03 |
   |Gln   Pro   Arg   Leu   |
-----------------------------
 C |4     14    2     11    |C
   |0.48 0.1    0.37 0.1    |
   |His   Pro   Arg   Leu   |
-----------------------------
 C |12    3     2     23    |G
   |0.69 0.55 0.08 0.55 |
   |Gln   Pro   Arg   Leu   |
-----------------------------
 C |4     8     0     7     |T
   |0.52 0.16 0.42 0.1      |
   |His   Pro   Arg   Leu   |
-----------------------------
 G |10    13    10    3     |A
   |0.7   0.22 0.09 0.17 |
   |Glu   Ala   Gly   Val   |
-----------------------------
 G |5     10    5     4     |C
   |0.41 0.25 0.4     0.2   |
   |Asp   Ala   Gly   Val   |



                                                                                              27
-----------------------------
 G |5     0     6     10    |G
   |0.3   0.34 0.13 0.34 |
   |Glu   Ala   Gly   Val   |
-----------------------------
 G |5     11    1     3     |T
   |0.59 0.19 0.38 0.29 |
   |Asp   Ala   Gly   Val   |
-----------------------------
 T |7     14    10    4     |A
   |0.62 0.12 0.3     0.11 |
   |End   Ser   End   Leu   |
-----------------------------
 T |6     9     8     8     |C
   |0.47 0.17 0.57 0.49 |
   |Tyr   Ser   Cys   Phe   |
-----------------------------
 T |10    4     18    14    |G
   |0.09 0.13 1       0.11 |
   |End   Ser   Trp   Leu   |
-----------------------------
 T |4     15    4     7     |T
   |0.53 0.19 0.43 0.51 |
   |Tyr   Ser   Cys   Phe   |
-----------------------------



DNA molecule: Homo sapiens aldolase B, fructose-bisphosphate (ALDOB), mRNA.
Length = 1654 base pairs
Molecular Weight = 504410 Daltons, single stranded
Molecular Weight = 1005265 Daltons, double stranded
G+C content = 49,15%
A+T content = 50,85%


Nucleotide Number Mol%
  A          470     28,42
  C          420     25,39
  G          393     23,76
  T          371       22,43




                                                                              28
Molecular weight of +3 frame ORF of aldolase B gene:
              = 1095 x 110 Dalton
                 3
             = 40150 Dalton
             = 40.15 kDa
             = approximately 40 kDa.




                                                       29
STEP 5 : Compare the Gene Sequence With Other Similar Gene Sequences
a) BLAST Analysis (Basic Local Alignment Search Tool)


       BLAST is a program designed for comparison of the protein or gene of interest with
all the available sequence databases that share the similarity. It uses a heuristic algorithm
which seeks local as opposed to global alignments, therefore it is able to detect relationships
among sequences which share the isolated regions of similarity. As this program is designed
for speed and sensitivity to distant sequence relationship, it provides the users a quick
reference that the sequence of interest is affirmed. This is important to eliminate any possible
background hits.
       Dedicated remote servers, such as the one at the NCBI, typically perform BLAST
analyses. By visiting the NCBI website http://www.ncbi.nlm.nih.gov and link to the /BLAST
pages, the aldolase B gene sequence is paste into the query window via FASTA format. A
request ID is given as: 1061582061-9566-1457996. Within several minutes, the BLAST result
is readily available as below.
       The score of each alignment is indicated by one of five different colors, which divides
the range of scores into five groups. Each of the alignment represents an organism. Expected
value(E) shows the degree of similarity. When the E value is zero, means the compared gene
sequences is 100% identical to each other.




                                                                                             30
                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|4557306|ref|NM_000035.1| Homo sapiens aldolase B, fructo...   3279   0.0
gi|28616|emb|X02747.1|HSALDOBR Human mRNA for aldolase B         3209   0.0
gi|28419|emb|X01098.1|HSADOLB Human mRNA for aldolase B (EC...   2966   0.0
gi|178352|gb|K01177.1|HUMALDB Human aldolase B mRNA, comple...   2956   0.0
gi|20809494|gb|BC029399.1| Homo sapiens, Similar to aldolas...   1925   0.0
gi|443800|emb|Z29372.1|OAMRALDB O.aries mRNA for aldolase B      1443   0.0
gi|23271468|gb|BC024056.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|23274026|gb|BC036132.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|23273591|gb|BC036133.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|23243324|gb|BC036130.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|21707959|gb|BC034169.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|20072354|gb|BC026577.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|21706880|gb|BC034171.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|18381049|gb|BC022113.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|16741178|gb|BC016435.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|21314987|gb|BC030725.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|21314985|gb|BC030724.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|21706770|gb|BC034172.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|18848232|gb|BC024112.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|23271464|gb|BC036131.1| Mus musculus aldolase 2, B isofo...   1354   0.0
gi|31981737|ref|NM_144903.2| Mus musculus aldolase 2, B iso...   1354   0.0
gi|21707668|gb|BC034173.1| Mus musculus aldolase 2, B isofo...   1346   0.0
gi|27714456|ref|XM_216395.1| Rattus norvegicus similar to a...   1275   0.0



                                                                                31
gi|27476058|ref|NM_012496.1| Rattus norvegicus aldolase B (...   1211   0.0
gi|202839|gb|M10149.1|RATALDBC Rat liver aldolase B mRNA, c...   1211   0.0
gi|10439268|dbj|AK026411.1| Homo sapiens cDNA: FLJ22758 fis...   1189   0.0
gi|28611|emb|X00270.1|HSALDO Human human aldolase B messeng...   1067   0.0
gi|17977710|emb|AL353621.19| Human DNA sequence from clone ...   1021   0.0
gi|8810486|gb|AC002469.8| Homo sapiens Chromosome 9p22 Cosm...   1013   0.0
gi|178355|gb|M15656.1|HUMALDB2 Human aldolase B (ALDOB) gen...   1013   0.0
gi|219451|dbj|D00183.1|D00175S9 Homo sapiens gene for aldol...    997   0.0
gi|23241976|gb|BC036139.1| Mus musculus aldolase 2, B isofo...    888   0.0
gi|55636|emb|V01223.1|RNALDO Rat mRNA encoding aldolase (fr...    555   e-155
gi|23243437|gb|BC036142.1| Mus musculus aldolase 2, B isofo...    521   e-144
gi|219445|dbj|D00177.1|D00175S3 Homo sapiens gene for aldol...    426   e-116
gi|178354|gb|M15657.1|HUMALDB1 Human aldolase B (ALDOB) gen...    418   e-113
gi|219450|dbj|D00182.1|D00175S8 Homo sapiens gene for aldol...    363   6e-97
gi|219449|dbj|D00181.1|D00175S7 Homo sapiens gene for aldol...    353   6e-94
gi|219447|dbj|D00179.1|D00175S5 Homo sapiens gene for aldol...    315   1e-82
gi|1816641|gb|U85645.1|OCU85645 Oryctolagus cuniculus fruct...    299   8e-78
gi|219444|dbj|D00176.1|D00175S2 Homo sapiens gene for aldol...    246   1e-61
gi|15723265|gb|AF403565.1|AF403565S1 Mus musculus fructose-...    244   4e-61
gi|33186784|emb|AL772310.27| Mouse DNA sequence from clone ...    244   4e-61
gi|55657|emb|X02285.1|RNALOBG3 R.norvegicus gene encoding a...    236   1e-58
gi|15723267|gb|AF403567.1|AF403565S3 Mus musculus fructose-...    234   4e-58
gi|28615|emb|X02748.1|HSALDOBG Human DNA for aldolase B tra...    228   2e-56
gi|219443|dbj|D00175.1|D00175S1 Homo sapiens gene for aldol...    228   2e-56
gi|55664|emb|X02289.1|RNALOBG7 R.norvegicus gene encoding a...    222   1e-54
gi|15723266|gb|AF403566.1|AF403565S2 Mus musculus fructose-...    204   4e-49
gi|55661|emb|X02287.1|RNALOBG5 R.norvegicus gene encoding a...    204   4e-49
gi|14198248|gb|BC008184.1| Mus musculus, aldolase 3, C isof...    178   2e-41
gi|13435923|gb|BC004802.1| Mus musculus, aldolase 3, C isof...    178   2e-41
gi|11231094|dbj|AB051116.1| Macaca fascicularis brain cDNA,...    178   2e-41
gi|219448|dbj|D00180.1|D00175S6 Homo sapiens gene for aldol...    174   3e-40
gi|55666|emb|X02290.1|RNALOBG8 R.norvegicus gene encoding a...    172   1e-39
gi|30584678|gb|BT007920.1| Synthetic construct Homo sapiens...    170   5e-39
gi|30582850|gb|BT007006.1| Homo sapiens aldolase C, fructos...    170   5e-39
gi|4885062|ref|NM_005165.1| Homo sapiens aldolase C, fructo...    170   5e-39
gi|13177653 Unknown                                               170   5e-39
gi|3005697|gb|AF054987.1|AF054987 Homo sapiens clone 23831 ...    170   5e-39
gi|28510581|ref|XM_126120.4| Mus musculus aldolase 3, C iso...    163   1e-36
gi|12836757|dbj|AK005077.1| Mus musculus adult male cerebel...    163   1e-36
gi|26333164|dbj|AK039267.1| Mus musculus adult male spinal ...    163   1e-36
gi|619372|gb|S72537.1|S72537 zebrin II [mice, C57BL/6J inbr...    163   1e-36
gi|1143276|gb|U36777.1|CAU36777 Carassius auratus aldolase ...    149   2e-32
gi|13195056|gb|AY015236.1| Mus saxicola isolate M16-3 aldol...    149   2e-32
gi|13195064|gb|AY015244.1| Mus pahari isolate M15-8 aldolas...    141   4e-30
gi|49918|emb|X03796.1|MMALDCR5 Mouse mRNA 5'-region for ald...    139   2e-29
gi|202836|gb|M14420.1|RATALDA2 Rat aldolase A mRNA, complet...    139   2e-29
gi|55655|emb|X02284.1|RNALOBG2 R.norvegicus gene encoding a...    135   3e-28
gi|13195084|gb|AY015264.1| Mus spicilegus isolate M32-3 ald...    133   1e-27
gi|29747887|gb|BC050896.1| Mus musculus aldolase 1, A isofo...    131   4e-27
gi|27695277|gb|BC043026.1| Mus musculus aldolase 1, A isofo...    131   4e-27
gi|49916|emb|X03797.1|MMALDAR1 Mouse mRNA fragment for aldo...    131   4e-27
gi|49914|emb|Y00516.1|MMALDA Mouse mRNA for aldolase A            131   4e-27
gi|12847228|dbj|AK011238.1| Mus musculus 10 days embryo who...    131   4e-27
gi|6978486|ref|NM_012495.1| Rattus norvegicus aldolase A (A...    131   4e-27
gi|202834|gb|M12919.1|RATALDA Rat aldolase A mRNA, complete...    131   4e-27
gi|31982505|ref|NM_007438.2| Mus musculus aldolase 1, A iso...    131   4e-27
gi|6978488|ref|NM_012497.1| Rattus norvegicus aldolase C, f...    129   2e-26
gi|55634|emb|X06984.1|RNALDCR1 Rat brain mRNA for aldolase ...    129   2e-26
gi|30985109|gb|AC107633.11| Mus musculus, clone RP23-7P3, c...    127   7e-26
gi|13385219|ref|NM_025754.1| Mus musculus RIKEN cDNA 493342...    127   7e-26
gi|13195068|gb|AY015248.1| Mus musculus isolate M10-16 aldo...    127   7e-26
gi|12855909|dbj|AK016920.1| Mus musculus adult male testis ...    127   7e-26
gi|12839520|dbj|AK006425.1| Mus musculus adult male testis ...    127   7e-26
gi|587523|emb|X82278.1|SAFBPAL S.aurata mRNA for fructose-1...    125   3e-25
gi|13195083|gb|AY015263.1| Mus spicilegus isolate M32-7 ald...    125   3e-25
gi|13195070|gb|AY015250.1| Mus musculus domesticus isolate ...    125   3e-25
gi|55663|emb|X02288.1|RNALOBG6 R.norvegicus gene encoding a...    121   4e-24
gi|211128|gb|M10946.1|CHKALDB Chicken aldolase B gene, comp...    121   4e-24



                                                                                32
gi|28302292|gb|BC046673.1| Xenopus laevis, Similar to aldol...             119   2e-23
gi|13195048|gb|AY015228.1| Mus musculus isolate M13-4 aldol...             119   2e-23
gi|1944024|dbj|AB002267.1| Xenopus laevis mRNA for aldolase...             119   2e-23
gi|12832632|dbj|AK002561.1| Mus musculus adult male kidney ...             117   6e-23
gi|27882068|gb|BC044379.1| Danio rerio, Similar to aldolase...             115   3e-22
gi|22671687|gb|AF533645.1| Danio rerio aldolase A mRNA, com...             115   3e-22
gi|13195059|gb|AY015239.1| Mus pahari isolate M15-10 aldola...             115   3e-22
gi|28600|emb|X07292.1|HSALDCG Homo sapiens gene for fructos...             115   3e-22
gi|3810672|gb|AC005726.1|AC005726 Homo sapiens chromosome 1...             115   3e-22



These are some of the definitions and scores with associated alignments:


                                        Alignments


>gi|4557306|ref|NM_000035.1|     Homo sapiens        aldolase    B,   fructose-bisphosphate
(ALDOB), mRNA. Length = 1654
 Score = 3279 bits (1654), Expect = 0.0
 Identities = 1654/1654 (100%)
 Strand = Plus / Plus

Query: 1     aaaaacatgatgagaagtctataaaaattgtgtgctaccaaagatctgtcttatttggca 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1     aaaaacatgatgagaagtctataaaaattgtgtgctaccaaagatctgtcttatttggca 60


Query: 61    gctgctgcctcacccacagcttttgatatctaggaggactcttctctcccaaactacctg 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61    gctgctgcctcacccacagcttttgatatctaggaggactcttctctcccaaactacctg 120


Query: 121   tcaccatggcccaccgatttccagccctcacccaggagcagaagaaggagctctcagaaa 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121   tcaccatggcccaccgatttccagccctcacccaggagcagaagaaggagctctcagaaa 180


Query: 181   ttgcccagagcattgttgccaatggaaaggggatcctggctgcagatgaatctgtaggta 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181   ttgcccagagcattgttgccaatggaaaggggatcctggctgcagatgaatctgtaggta 240


Query: 241   ccatggggaaccgcctgcagaggatcaaggtggaaaacactgaagagaaccgccggcagt 300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241   ccatggggaaccgcctgcagaggatcaaggtggaaaacactgaagagaaccgccggcagt 300


Query: 301   tccgagaaatcctcttctctgtggacagttccatcaaccagagcatcgggggtgtgatcc 360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301   tccgagaaatcctcttctctgtggacagttccatcaaccagagcatcgggggtgtgatcc 360


Query: 361   ttttccacgagaccctctaccagaaggacagccagggaaagctgttcagaaacatcctca 420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361   ttttccacgagaccctctaccagaaggacagccagggaaagctgttcagaaacatcctca 420


Query: 421   aggaaaaggggatcgtggtgggaatcaagttagaccaaggaggtgctcctcttgcaggaa 480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421   aggaaaaggggatcgtggtgggaatcaagttagaccaaggaggtgctcctcttgcaggaa 480


Query: 481   caaacaaagaaaccaccattcaagggcttgatggcctctcagagcgctgtgctcagtaca 540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 481   caaacaaagaaaccaccattcaagggcttgatggcctctcagagcgctgtgctcagtaca 540




                                                                                         33
Query: 541   agaaagatggtgttgactttgggaagtggcgtgctgtgctgaggattgccgaccagtgtc 600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541   agaaagatggtgttgactttgggaagtggcgtgctgtgctgaggattgccgaccagtgtc 600


Query: 601   catccagcctcgctatccaggaaaacgccaacgccctggctcgctacgccagcatctgtc 660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 601   catccagcctcgctatccaggaaaacgccaacgccctggctcgctacgccagcatctgtc 660


Query: 661   agcagaatggactggtacctattgttgaaccagaggtaattcctgatggagaccatgacc 720
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 661   agcagaatggactggtacctattgttgaaccagaggtaattcctgatggagaccatgacc 720


Query: 721   tggaacactgccagtatgttactgagaaggtcctggctgctgtctacaaggccctgaatg 780
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 721   tggaacactgccagtatgttactgagaaggtcctggctgctgtctacaaggccctgaatg 780


Query: 781   accatcatgtttacctggagggcaccctgctaaagcccaacatggtgactgctggacatg 840
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 781   accatcatgtttacctggagggcaccctgctaaagcccaacatggtgactgctggacatg 840


Query: 841   cctgcaccaagaagtatactccagaacaagtagctatggccaccgtaacagctctccacc 900
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 841   cctgcaccaagaagtatactccagaacaagtagctatggccaccgtaacagctctccacc 900


Query: 901   gtactgttcctgcagctgttcctggcatctgctttttgtctggtggcatgagtgaagagg 960
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 901   gtactgttcctgcagctgttcctggcatctgctttttgtctggtggcatgagtgaagagg 960


Query: 961   atgccactctcaacctcaatgctatcaacctttgccctctaccaaagccctggaaactaa 1020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 961   atgccactctcaacctcaatgctatcaacctttgccctctaccaaagccctggaaactaa 1020


Query: 1021 gtttctcttatggacgggccctgcaggcagtagcactggctgcctggggtggcaaggctg 1080
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1021 gtttctcttatggacgggccctgcaggcagtagcactggctgcctggggtggcaaggctg 1080


Query: 1081 caaacaaggaggcaacccaggaggcttttatgaagcgggccatggctaactgccaggcgg 1140
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1081 caaacaaggaggcaacccaggaggcttttatgaagcgggccatggctaactgccaggcgg 1140


Query: 1141 ccaaaggacagtatgttcacacgggttcttctggggctgcttccacccagtcgctcttca 1200
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1141 ccaaaggacagtatgttcacacgggttcttctggggctgcttccacccagtcgctcttca 1200


Query: 1201 cagcctgctatacctactagggtccaatgcccgccagcctagctccagtgcttctagtag 1260
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1201 cagcctgctatacctactagggtccaatgcccgccagcctagctccagtgcttctagtag 1260


Query: 1261 gagggctgaaagggagcaacttttcctccaatcctggaaattcgacacaattagatttga 1320
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1261 gagggctgaaagggagcaacttttcctccaatcctggaaattcgacacaattagatttga 1320


Query: 1321 actcgctggaaatacaacacatgttaaatcttaagtacaagggggaaaaaataaatcagt 1380
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



                                                                                 34
Sbjct: 1321 actcgctggaaatacaacacatgttaaatcttaagtacaagggggaaaaaataaatcagt 1380


Query: 1381 tatttgaaacataaaaatgaataccaaggacctgatcaaatttcacacagcagtttcctt 1440
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1381 tatttgaaacataaaaatgaataccaaggacctgatcaaatttcacacagcagtttcctt 1440


Query: 1441 gcaacactttcagctccccatgctccagaatacccacccaagaaaataataggctttaaa 1500
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1441 gcaacactttcagctccccatgctccagaatacccacccaagaaaataataggctttaaa 1500


Query: 1501 acaatatcggctcctcatccaaagaacaactgctgattgaaacacctcattagctgagtg 1560
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1501 acaatatcggctcctcatccaaagaacaactgctgattgaaacacctcattagctgagtg 1560


Query: 1561 tagagaagtgcatcttatgaaacagtcttagcagtggtaggttgggaaggagatagctgc 1620
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1561 tagagaagtgcatcttatgaaacagtcttagcagtggtaggttgggaaggagatagctgc 1620


Query: 1621 aaccaaaaaagaaataaatattctataaaccttc 1654
            ||||||||||||||||||||||||||||||||||
Sbjct: 1621 aaccaaaaaagaaataaatattctataaaccttc 1654


>gi|443800|emb|Z29372.1|OAMRALDB   O.aries mRNA for aldolase B
 Length = 1649
 Score = 1443 bits (728), Expect = 0.0
 Identities = 1057/1163 (90%), Gaps = 4/1163 (0%)
 Strand = Plus / Plus


Query: 61    gctgctgcctcacccacagcttttgata--tctaggaggactcttctctcccaaactacc 118
             |||||||||||| ||||||||| ||||| |||| ||| ||||| ||||| |||||||||
Sbjct: 1     gctgctgcctcatccacagcttctgatagatctaagagaactctcctctctcaaactacc 60


Query: 119   tgtcaccatggcccaccgatttccagccctcacccaggagcagaagaaggagctctcaga 178
             ||| ||||||||||||| ||||||||||||||     || |||||||||| ||||||||
Sbjct: 61    tgtgaccatggcccaccagtttccagccctcacttcagaacagaagaaggcactctcaga 120


Query: 179   aattgcccagagcattgttgccaatggaaaggggatcctggctgcagatgaatctgtagg 238
             || |||||   |||||||||||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 121   aactgcccgacgcattgttgccaatgggaaggggatcctggctgcagatgagtctgtagg 180


Query: 239   taccatggggaaccgcctgcagaggatcaaggtggaaaacactgaagagaaccgccggca 298
              || ||||| ||||||||||| |||||||||||||| ||||| |||||||||||||||||
Sbjct: 181   cacgatgggaaaccgcctgcaaaggatcaaggtggagaacacggaagagaaccgccggca 240


Query: 299   gttccgagaaatcctcttctctgtggacagttccatcaaccagagcatcgggggtgtgat 358
             |||||| || |||| ||| |||||||||| ||| ||| |||||||||||||||||||||
Sbjct: 241   gttccgcgagctcctgttcactgtggacagctccgtcagccagagcatcgggggtgtgat 300


Query: 359   ccttttccacgagaccctctaccagaaggacagccagggaaagctgttcagaaacatcct 418
             ||| ||||| |||||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 301   cctcttccatgagaccctctaccagaaggatggccagggaaagctgttcagagacatcct 360


Query: 419   caaggaaaaggggatcgtggtgggaatcaagttagaccaaggaggtgctcctcttgcagg 478
             ||||||||| |||||||||||||||||||||||||| ||||||| |||||| ||||||||
Sbjct: 361   caaggaaaaagggatcgtggtgggaatcaagttagatcaaggagttgctccgcttgcagg 420



                                                                                35
Query: 479   aacaaacaaagaaaccaccattcaagggcttgatggcctctcagagcgctgtgctcagta 538
             ||||||||||||||||||| ||||||||||||||||||| || || ||||||||||||||
Sbjct: 421   aacaaacaaagaaaccaccgttcaagggcttgatggcctttctgaacgctgtgctcagta 480


Query: 539   caagaaagatggtgttgactttgggaagtggcgtgctgtgctgaggattgccgaccagtg 598
              ||||||||||||| ||||||||||||||||||||||||||||| ||||| | |||||||
Sbjct: 481   taagaaagatggtgctgactttgggaagtggcgtgctgtgctgaagattgacaaccagtg 540


Query: 599   tccatccagcctcgctatccaggaaaacgccaacgccctggctcgctacgccagcatctg 658
             |||||||   || ||||||||||||||||||||| |||| || ||||| ||||||||||
Sbjct: 541   tccatcccatcttgctatccaggaaaacgccaacaccctcgcccgctatgccagcatcta 600


Query: 659   tcagcagaatggactggtacctattgttgaaccagaggtaattcctgatggagaccatga 718
             |||||||||||| || ||||| ||||||||||||||||||||||| |||||   ||||||
Sbjct: 601   tcagcagaatggtcttgtacccattgttgaaccagaggtaattcccgatggcagccatga 660


Query: 719   cctggaacactgccagtatgttactgagaaggtcctggctgctgtctacaaggccctgaa 778
             | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 661   catggaacactgccagtatgttactgagaaggtcctggctgctgtatacaaggccctgaa 720


Query: 779   tgaccatcatgtttacctggagggcaccctgctaaagcccaacatggtgactgctggaca 838
             ||||||||| |||||| |||||||||| ||| | ||||||||||||||||||||||||||
Sbjct: 721   tgaccatcacgtttacttggagggcactctgttgaagcccaacatggtgactgctggaca 780


Query: 839   tgcctgcaccaagaagtatactccagaacaagtagctatggccaccgtaacagctctcca 898
             ||||||||||||||||||||||||||| || || || |||||||| || |||||||||||
Sbjct: 781   tgcctgcaccaagaagtatactccagagcaggtggcaatggccacggttacagctctcca 840


Query: 899   ccgtactgttcctgcagctgttcctggcatctgctttttgtctggtggcatgagtgaaga 958
             |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 841   ccgtaccgttcctgcagctgtgcctggcatctgctttttgtctggtggcatgagtgaaga 900


Query: 959   ggatgccactctcaacctcaatgctatcaacctttgccctctaccaaagccctggaaact 1018
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 901   ggatgctactctcaacctcaatgctatcaacctttgccctctaccaaagccctggaaact 960


Query: 1019 aagtttctcttatggacgggccctgcagg-cagtagcactggctgcctggggtggcaagg 1077
            |||||||||||| ||||| |||||||||| |||| ||||||||||| |||||||||||||
Sbjct: 961 aagtttctcttacggacgagccctgcaggccagt-gcactggctgcatggggtggcaagg 1019


Query: 1078 ctgcaaacaaggaggcaacccaggaggcttttatgaagcgggccatggctaactgccagg 1137
            ||| ||||||| |||||||||||||||| ||||||||||||||| |||||||| ||||||
Sbjct: 1020 ctgaaaacaagaaggcaacccaggaggcctttatgaagcgggccttggctaacagccagg 1079


Query: 1138 cggccaaaggacagtatgttcacacgggttcttctggggctgcttccacccagtcgctct 1197
            | |||||||||||||||||||||| ||| |||||||   |||||||||||||||||||||
Sbjct: 1080 cagccaaaggacagtatgttcacatgggctcttctgactctgcttccacccagtcgctct 1139


Query: 1198 tcacagcctgctatacctactag 1220
            |||| ||| ||||||||||||||
Sbjct: 1140 tcactgccagctatacctactag 1162


 Score = 87.7 bits (44), Expect = 6e-14
 Identities = 68/76 (89%)
 Strand = Plus / Plus



                                                                                 36
Query: 1556 gagtgtagagaagtgcatcttatgaaacagtcttagcagtggtaggttgggaaggagata 1615
            ||||| ||||||| |||||||| || ||||||||||||||||||||| |||||||| |
Sbjct: 1499 gagtgcagagaagctcatcttattaagcagtcttagcagtggtaggttatgaaggagaca 1558


Query: 1616 gctgcaaccaaaaaag 1631
            ||||||||||||||||
Sbjct: 1559 gctgcaaccaaaaaag 1574



>gi|23271468|gb|BC024056.1|   Mus musculus aldolase 2, B isoform, mRNA(cDNA clone
MGC:36391
 IMAGE:5100067), complete cds
 Length = 1971
 Score = 1354 bits (683), Expect = 0.0
 Identities = 1000/1103 (90%), Gaps = 2/1103 (0%)
 Strand = Plus / Plus


Query: 115   tacctgtcaccatggcccaccgatttccagccctcacccaggagcagaagaaggagctct 174
             ||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||
Sbjct: 56    tacctgtcatcatggctcaccgatttccagccctcaccccagagcagaagaaggagctct 115


Query: 175   cagaaattgcccagagcattgttgccaatggaaaggggatcctggctgcagatgaatctg 234
             | |||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 116   ctgaaattgcccagcgcattgttgccaatgggaagggcatcctggctgcagatgaatctg 175


Query: 235   taggtaccatggggaaccgcctgcagaggatcaaggtggaaaacactgaagagaaccgcc 294
             | ||||||||||| ||||||||||| ||||| |||||||| ||||| |||||||||||
Sbjct: 176   tgggtaccatgggaaaccgcctgcaaaggataaaggtggagaacaccgaagagaaccgaa 235


Query: 295   ggcagttccgagaaatcctcttctctgtggacagttccatcaaccagagcatcgggggtg 354
             |||||||||||||| |||||||   |||||||| |||||| | |||||||||||| || |
Sbjct: 236   ggcagttccgagaactcctctttagtgtggacaattccattagccagagcatcggcggag 295


Query: 355   tgatccttttccacgagaccctctaccagaaggacagccagggaaagctgttcagaaaca 414
             |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 296   tgatccttttccacgagaccctctaccagaaggacagccagggaaatctgttcagaaacg 355


Query: 415   tcctcaaggaaaaggggatcgtggtgggaatcaagttagaccaaggaggtgctcctcttg 474
             | |||||||| ||||| || |||||||| |||||||| |||||||||||||| || ||||
Sbjct: 356   ttctcaaggagaagggaattgtggtgggcatcaagttggaccaaggaggtgccccgcttg 415


Query: 475   caggaacaaacaaagaaaccaccattcaagggcttgatggcctctcagagcgctgtgctc 534
             ||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 416   caggaacaaacaaggaaaccaccattcaagggcttgatggcctctctgaacgctgtgctc 475


Query: 535   agtacaagaaagatggtgttgactttgggaagtggcgtgctgtgctgaggattgccgacc 594
             |||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||
Sbjct: 476   agtacaagaaagatggagttgactttgggaagtggcgtgctgtgttgaggattgctgacc 535


Query: 595   agtgtccatccagcctcgctatccaggaaaacgccaacgccctggctcgctacgccagca 654
             ||||||| |||||||| |||||||| ||||| ||||| || ||||||||||| |||||||
Sbjct: 536   agtgtccttccagccttgctatccaagaaaatgccaatgctctggctcgctatgccagca 595


Query: 655   tctgtcagcagaatggactggtacctattgttgaaccagaggtaattcctgatggagacc 714
             |||||||||||||||| ||||| ||||||||||| |||||||| ||||||| |||||||
Sbjct: 596   tctgtcagcagaatgggctggtccctattgttgagccagaggtgcttcctgacggagacc 655



                                                                                37
Query: 715   atgacctggaacactgccagtatgttactgagaaggtcctggctgctgtctacaaggccc 774
             |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
Sbjct: 656   atgacctggagcactgccagtatgtttctgagaaggtcctggctgctgtctacaaggctc 715


Query: 775   tgaatgaccatcatgtttacctggagggcaccctgctaaagcccaacatggtgactgctg 834
             | ||||| |||||||||||||| || |||||| |||||||||| ||||||||||||||||
Sbjct: 716   tcaatgatcatcatgtttacctagaaggcaccttgctaaagccaaacatggtgactgctg 775


Query: 835   gacatgcctgcaccaagaagtatactccagaacaagtagctatggccaccgtaacagctc 894
             ||||||||||||| ||||||||||| ||||| || || ||||||||||| || |||||||
Sbjct: 776   gacatgcctgcacgaagaagtatacaccagagcaggtggctatggccactgtcacagctc 835


Query: 895   tccaccgtactgttcctgcagctgttcctggcatctgctttttgtctggtggcatgagtg 954
             ||||| | ||||||||||||||||||||||| ||||||||||||||||| || |||||||
Sbjct: 836   tccacagaactgttcctgcagctgttcctggtatctgctttttgtctggaggtatgagtg 895


Query: 955   aagaggatgccactctcaacctcaatgctatcaacctttgccctctaccaaagccctgga 1014
             | |||||||| || || ||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 896   aggaggatgctacacttaacctcaatgctatcaaccgttgccctctaccaaggccctgga 955


Query: 1015 aactaagtttctcttatggacgggccctgcagg-cagtagcactggctgcctggggtggc 1073
            ||||||| || || |||||| | ||||| |||| |||| ||| |||||||||||||||||
Sbjct: 956 aactaagcttttcatatggaagagccctccaggccagt-gcattggctgcctggggtggc 1014


Query: 1074 aaggctgcaaacaaggaggcaacccaggaggcttttatgaagcgggccatggctaactgc 1133
            ||||||||||||||| ||||||||||||| ||||| ||||||||||| ||||||||||||
Sbjct: 1015 aaggctgcaaacaagaaggcaacccaggaagctttcatgaagcgggctatggctaactgc 1074


Query: 1134 caggcggccaaaggacagtatgttcacacgggttcttctggggctgcttccacccagtcg 1193
            ||||||||| |||||||||| |||||||| || ||||| || |||||| |||||||||||
Sbjct: 1075 caggcggcccaaggacagtacgttcacacaggctcttcaggtgctgctgccacccagtcg 1134


Query: 1194 ctcttcacagcctgctataccta 1216
            ||||||||||||| ||| |||||
Sbjct: 1135 ctcttcacagcctcctacaccta 1157



>gi|27476058|ref|NM_012496.1| Rattus norvegicus aldolase B (Aldob), mRNA
 Length = 1547
 Score = 1211 bits (611), Expect = 0.0
 Identities = 985/1107 (88%), Gaps = 2/1107 (0%)
 Strand = Plus / Plus


Query: 115   tacctgtcaccatggcccaccgatttccagccctcacccaggagcagaagaaggagctct 174
             ||||||||| |||||| |||||||||||||||||||||   |||||||||||||||||||
Sbjct: 58    tacctgtcatcatggctcaccgatttccagccctcacctcagagcagaagaaggagctct 117


Query: 175   cagaaattgcccagagcattgttgccaatggaaaggggatcctggctgcagatgaatctg 234
             | || ||||| ||| |||||||||||||||| ||||| ||| ||||||||||||| ||||
Sbjct: 118   ccgagattgcgcagcgcattgttgccaatgggaagggtatcttggctgcagatgagtctg 177


Query: 235   taggtaccatggggaaccgcctgcagaggatcaaggtggaaaacactgaagagaaccgcc 294
             | || |||||||| |||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 178   tgggcaccatgggaaaccgcctacagaggataaaggtggaaaacactgaagagaaccgaa 237




                                                                                 38
Query: 295   ggcagttccgagaaatcctcttctctgtggacagttccatcaaccagagcatcgggggtg 354
             ||||||||||||| |||||||    |||||||| ||| |||| |||||||||||| || |
Sbjct: 238   ggcagttccgagagctcctctttagtgtggacaattctatcagccagagcatcggcggag 297


Query: 355   tgatccttttccacgagaccctctaccagaaggacagccagggaaagctgttcagaaaca 414
             ||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||
Sbjct: 298   tgatccttttccatgagacgctctaccagaaggatagccagggaaagctgttcagaaaca 357


Query: 415   tcctcaaggaaaaggggatcgtggtgggaatcaagttagaccaaggaggtgctcctcttg 474
             | |||||||| ||||| || |||||||| |||||| | |||||||||||||| || ||||
Sbjct: 358   ttctcaaggagaagggaattgtggtgggcatcaagctggaccaaggaggtgccccgcttg 417


Query: 475   caggaacaaacaaagaaaccaccattcaagggcttgatggcctctcagagcgctgtgctc 534
             ||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 418   caggaacaaacaaagaaaccaccattcaagggcttgacggcctctccgaacgctgtgctc 477


Query: 535   agtacaagaaagatggtgttgactttgggaagtggcgtgctgtgctgaggattgccgacc 594
             ||||||||||||| || || |||||||||||||||||||||||||||||||| | ||||
Sbjct: 478   agtacaagaaagacggagtcgactttgggaagtggcgtgctgtgctgaggatctcggacc 537


Query: 595   agtgtccatccagcctcgctatccaggaaaacgccaacgccctggctcgctacgccagca 654
             |||| || |||||||| |||||||| |||||||||||||| |||||||||||||||||||
Sbjct: 538   agtgcccttccagccttgctatccaagaaaacgccaacgctctggctcgctacgccagca 597


Query: 655   tctgtcagcagaatggactggtacctattgttgaaccagaggtaattcctgatggagacc 714
             |||| ||||||||||| ||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 598   tctgccagcagaatgggctggtacctattgttgagccagaggttcttcctgatggagacc 657


Query: 715   atgacctggaacactgccagtatgttactgagaaggtcctggctgctgtctacaaggccc 774
             ||||||| || ||||||||||||||| ||||||||||| ||||||||||||||||||| |
Sbjct: 658   atgacctagagcactgccagtatgtttctgagaaggtcttggctgctgtctacaaggctc 717


Query: 775   tgaatgaccatcatgtttacctggagggcaccctgctaaagcccaacatggtgactgctg 834
             | ||||| |||||||||||||| |||||||||||||||||||| |||||| |||||||||
Sbjct: 718   tcaatgatcatcatgtttaccttgagggcaccctgctaaagccaaacatgctgactgctg 777


Query: 835   gacatgcctgcaccaagaagtatactccagaacaagtagctatggccaccgtaacagctc 894
             |||||||||||||||||||||| || || || ||||| |||||||||||||| || ||||
Sbjct: 778   gacatgcctgcaccaagaagtacacacctgagcaagtggctatggccaccgtcacggctc 837


Query: 895   tccaccgtactgttcctgcagctgttcctggcatctgctttttgtctggtggcatgagtg 954
             ||||| | ||||||||||||||||| ||| | ||||||||||||||||| ||||||||||
Sbjct: 838   tccacagaactgttcctgcagctgtgcctagtatctgctttttgtctggaggcatgagtg 897


Query: 955   aagaggatgccactctcaacctcaatgctatcaacctttgccctctaccaaagccctgga 1014
             | |||||||| || || ||||||||||||||| ||| |||||||||||| | ||||||||
Sbjct: 898   aggaggatgctacacttaacctcaatgctatctaccgttgccctctacctaggccctgga 957


Query: 1015 aactaagtttctcttatggacgggccctgcagg-cagtagcactggctgcctggggtggc 1073
            ||||||| || || || || | ||||| |||| |||| ||| ||||||| ||||| |||
Sbjct: 958 aactaagcttttcatacggcagagccctccaggccagt-gcattggctgcttggggcggc 1016


Query: 1074 aaggctgcaaacaaggaggcaacccaggaggcttttatgaagcgggccatggctaactgc 1133
            ||||||||||||||| ||||||||||||| ||||| ||||||||||| |||| |||||
Sbjct: 1017 aaggctgcaaacaagaaggcaacccaggaagctttcatgaagcgggctgtggccaactgt 1076



                                                                                 39
Query: 1134 caggcggccaaaggacagtatgttcacacgggttcttctggggctgcttccacccagtcg 1193
            ||||| ||| |||||||||||||||||||||| || || || ||||||||||| |||||
Sbjct: 1077 caggcagcccaaggacagtatgttcacacgggctcgtcaggcgctgcttccacgcagtca 1136


Query: 1194 ctcttcacagcctgctatacctactag 1220
            ||||||||||||| ||| |||||||||
Sbjct: 1137 ctcttcacagcctcctacacctactag 1163



>gi|202839|gb|M10149.1|RATALDBC Rat liver aldolase B mRNA, complete cds
 Length = 1547
 Score = 1211 bits (611), Expect = 0.0
 Identities = 985/1107 (88%), Gaps = 2/1107 (0%)
 Strand = Plus / Plus


Query: 115   tacctgtcaccatggcccaccgatttccagccctcacccaggagcagaagaaggagctct 174
             ||||||||| |||||| |||||||||||||||||||||   |||||||||||||||||||
Sbjct: 58    tacctgtcatcatggctcaccgatttccagccctcacctcagagcagaagaaggagctct 117


Query: 175   cagaaattgcccagagcattgttgccaatggaaaggggatcctggctgcagatgaatctg 234
             | || ||||| ||| |||||||||||||||| ||||| ||| ||||||||||||| ||||
Sbjct: 118   ccgagattgcgcagcgcattgttgccaatgggaagggtatcttggctgcagatgagtctg 177


Query: 235   taggtaccatggggaaccgcctgcagaggatcaaggtggaaaacactgaagagaaccgcc 294
             | || |||||||| |||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 178   tgggcaccatgggaaaccgcctacagaggataaaggtggaaaacactgaagagaaccgaa 237


Query: 295   ggcagttccgagaaatcctcttctctgtggacagttccatcaaccagagcatcgggggtg 354
             ||||||||||||| |||||||    |||||||| ||| |||| |||||||||||| || |
Sbjct: 238   ggcagttccgagagctcctctttagtgtggacaattctatcagccagagcatcggcggag 297


Query: 355   tgatccttttccacgagaccctctaccagaaggacagccagggaaagctgttcagaaaca 414
             ||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||
Sbjct: 298   tgatccttttccatgagacgctctaccagaaggatagccagggaaagctgttcagaaaca 357


Query: 415   tcctcaaggaaaaggggatcgtggtgggaatcaagttagaccaaggaggtgctcctcttg 474
             | |||||||| ||||| || |||||||| |||||| | |||||||||||||| || ||||
Sbjct: 358   ttctcaaggagaagggaattgtggtgggcatcaagctggaccaaggaggtgccccgcttg 417


Query: 475   caggaacaaacaaagaaaccaccattcaagggcttgatggcctctcagagcgctgtgctc 534
             ||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 418   caggaacaaacaaagaaaccaccattcaagggcttgacggcctctccgaacgctgtgctc 477


Query: 535   agtacaagaaagatggtgttgactttgggaagtggcgtgctgtgctgaggattgccgacc 594
             ||||||||||||| || || |||||||||||||||||||||||||||||||| | ||||
Sbjct: 478   agtacaagaaagacggagtcgactttgggaagtggcgtgctgtgctgaggatctcggacc 537


Query: 595   agtgtccatccagcctcgctatccaggaaaacgccaacgccctggctcgctacgccagca 654
             |||| || |||||||| |||||||| |||||||||||||| |||||||||||||||||||
Sbjct: 538   agtgcccttccagccttgctatccaagaaaacgccaacgctctggctcgctacgccagca 597


Query: 655   tctgtcagcagaatggactggtacctattgttgaaccagaggtaattcctgatggagacc 714
             |||| ||||||||||| ||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 598   tctgccagcagaatgggctggtacctattgttgagccagaggttcttcctgatggagacc 657




                                                                                40
Query: 715   atgacctggaacactgccagtatgttactgagaaggtcctggctgctgtctacaaggccc 774
             ||||||| || ||||||||||||||| ||||||||||| ||||||||||||||||||| |
Sbjct: 658   atgacctagagcactgccagtatgtttctgagaaggtcttggctgctgtctacaaggctc 717


Query: 775   tgaatgaccatcatgtttacctggagggcaccctgctaaagcccaacatggtgactgctg 834
             | ||||| |||||||||||||| |||||||||||||||||||| |||||| |||||||||
Sbjct: 718   tcaatgatcatcatgtttaccttgagggcaccctgctaaagccaaacatgctgactgctg 777


Query: 835   gacatgcctgcaccaagaagtatactccagaacaagtagctatggccaccgtaacagctc 894
             |||||||||||||||||||||| || || || ||||| |||||||||||||| || ||||
Sbjct: 778   gacatgcctgcaccaagaagtacacacctgagcaagtggctatggccaccgtcacggctc 837


Query: 895   tccaccgtactgttcctgcagctgttcctggcatctgctttttgtctggtggcatgagtg 954
             ||||| | ||||||||||||||||| ||| | ||||||||||||||||| ||||||||||
Sbjct: 838   tccacagaactgttcctgcagctgtgcctagtatctgctttttgtctggaggcatgagtg 897


Query: 955   aagaggatgccactctcaacctcaatgctatcaacctttgccctctaccaaagccctgga 1014
             | |||||||| || || ||||||||||||||| ||| |||||||||||| | ||||||||
Sbjct: 898   aggaggatgctacacttaacctcaatgctatctaccgttgccctctacctaggccctgga 957


Query: 1015 aactaagtttctcttatggacgggccctgcagg-cagtagcactggctgcctggggtggc 1073
            ||||||| || || || || | ||||| |||| |||| ||| ||||||| ||||| |||
Sbjct: 958 aactaagcttttcatacggcagagccctccaggccagt-gcattggctgcttggggcggc 1016


Query: 1074 aaggctgcaaacaaggaggcaacccaggaggcttttatgaagcgggccatggctaactgc 1133
            ||||||||||||||| ||||||||||||| ||||| ||||||||||| |||| |||||
Sbjct: 1017 aaggctgcaaacaagaaggcaacccaggaagctttcatgaagcgggctgtggccaactgt 1076


Query: 1134 caggcggccaaaggacagtatgttcacacgggttcttctggggctgcttccacccagtcg 1193
            ||||| ||| |||||||||||||||||||||| || || || ||||||||||| |||||
Sbjct: 1077 caggcagcccaaggacagtatgttcacacgggctcgtcaggcgctgcttccacgcagtca 1136


Query: 1194 ctcttcacagcctgctatacctactag 1220
            ||||||||||||| ||| |||||||||
Sbjct: 1137 ctcttcacagcctcctacacctactag 1163



Comments :
The four examples above were compared to the human aldolase B gene according to the E
value. The first alignment is the homo sapiens aldolase B gene that is readily available in the
Genbank data base. Therefore, it has 100% similarities in gene sequence with the human
aldolase B gene sequence that we paste in the query window during BLAST analysis. Both
O.aries and Mus musculus aldolase 2 bear 90% similarities in gene sequence to the human
aldolase B gene. Both Rattus norvegicus aldolase B(Aldob) and rat liver aldolase B bear 88%
similarities in gene sequence to the human aldolase B gene.




                                                                                            41
b) Multiple DNA Sequence Alignment


          While BLAST analysis is able to compare the aldolas B gene with other similar genes
singly, the multiple DNA sequence alignment is capable of comparing aldolase B gene with
several     other   genes   simultaneously.   By   using   the   CLUSTALW       program    at
http://www2.ebi.ac.uk/clustalw/, the gene sequence of aldolase B gene is again sent to query
in a FASTA format. Then, several genes sequence to be compared with aldolase B gene are
selected from the BLAST result. At least four gene sequences have to be selected to ensure
the multiple sequence alignment can be done. From the BLAST result, four different gene
sequences(O.aries aldolase B, Mus musculus aldolase B, Rattus norvegicus aldolase B and rat
liver aldolase B) are selected to compare with homo sapiens aldolase B for similarity. The
result is as below:

CLUSTAL W (1.82) Multiple Sequence Alignments

Sequence format is Pearson
Sequence 1: Homo            1654 bp
Sequence 2: O.aries         1649 bp
Sequence 3: Mus             1971 bp
Sequence 4: Rattus          1547 bp
Sequence 5: Rat             1547 bp
Start of Pairwise alignments
Aligning...
Sequences (1:2) Aligned. Score: 83
Sequences (1:3) Aligned. Score: 78
Sequences (1:4) Aligned. Score: 82
Sequences (1:5) Aligned. Score: 82
Sequences (2:3) Aligned. Score: 76
Sequences (2:4) Aligned. Score: 79
Sequences (2:5) Aligned. Score: 79
Sequences (3:4) Aligned. Score: 89
Sequences (3:5) Aligned. Score: 89
Sequences (4:5) Aligned. Score: 100
Guide tree         file created:    [/ebi/extserv/old-work/clustalw-20030822-
21202970.dnd]
Start of Multiple Alignment
There are 4 groups
Aligning...
Group 1: Sequences:    2      Score:29393
Group 2: Sequences:    3      Score:26250
Group 3: Sequences:    2      Score:27119
Group 4: Sequences:    5      Score:24356
Alignment Score 92450
CLUSTAL-Alignment file created      [/ebi/extserv/old-work/clustalw-20030822-
21202970.aln]




                                                                                          42
CLUSTAL W (1.82) multiple sequence alignment


Rattus         --------------------------------------------------------GACG   4
Rat            --------------------------------------------------------GACG   4
Mus            ---------------------------------------------------------GCG   3
Homo           AAAAACATGATGAGAAGTCTATAAAAATTGTGTGCTACCAAAGATCTGTCTTATTTGGCA   60
O.aries        ------------------------------------------------------------


Rattus         GCTGCCACCTCA--CACAGCTTCTGATA--CCTTGGAGCACTCTTCTCCCTTGGCTGTAC   60
Rat            GCTGCCACCTCA--CACAGCTTCTGATA--CCTTGGAGCACTCTTCTCCCTTGGCTGTAC   60
Mus            GCTGCCACCTCA--CACAGCTTCTGATA--CCTTGGAGGACTCTTC-CCCTTTGCTGTAC   58
Homo           GCTGCTGCCTCACCCACAGCTTTTGATA--TCTAGGAGGACTCTTCTCTCCCAAAC-TAC   117
O.aries        GCTGCTGCCTCATCCACAGCTTCTGATAGATCTAAGAGAACTCTCCTCTCTCAAAC-TAC   59
               ***** ***** ******** *****     ** *** ***** * * *        ***


Rattus         CTGTCATCATGGCTCACCGATTTCCAGCCCTCACCTCAGAGCAGAAGAAGGAGCTCTCCG   120
Rat            CTGTCATCATGGCTCACCGATTTCCAGCCCTCACCTCAGAGCAGAAGAAGGAGCTCTCCG   120
Mus            CTGTCATCATGGCTCACCGATTTCCAGCCCTCACCCCAGAGCAGAAGAAGGAGCTCTCTG   118
Homo           CTGTCACCATGGCCCACCGATTTCCAGCCCTCACCCAGGAGCAGAAGAAGGAGCTCTCAG   177
O.aries        CTGTGACCATGGCCCACCAGTTTCCAGCCCTCACTTCAGAACAGAAGAAGGCACTCTCAG   119
               **** * ****** **** **************     ** ********** ***** *


Rattus         AGATTGCGCAGCGCATTGTTGCCAATGGGAAGGGTATCTTGGCTGCAGATGAGTCTGTGG   180
Rat            AGATTGCGCAGCGCATTGTTGCCAATGGGAAGGGTATCTTGGCTGCAGATGAGTCTGTGG   180
Mus            AAATTGCCCAGCGCATTGTTGCCAATGGGAAGGGCATCCTGGCTGCAGATGAATCTGTGG   178
Homo           AAATTGCCCAGAGCATTGTTGCCAATGGAAAGGGGATCCTGGCTGCAGATGAATCTGTAG   237
O.aries        AAACTGCCCGACGCATTGTTGCCAATGGGAAGGGGATCCTGGCTGCAGATGAGTCTGTAG   179
               * * *** *   **************** ***** *** ************* ***** *

Rattus         GCACCATGGGAAACCGCCTACAGAGGATAAAGGTGGAAAACACTGAAGAGAACCGAAGGC   240
Rat            GCACCATGGGAAACCGCCTACAGAGGATAAAGGTGGAAAACACTGAAGAGAACCGAAGGC   240
Mus            GTACCATGGGAAACCGCCTGCAAAGGATAAAGGTGGAGAACACCGAAGAGAACCGAAGGC   238
Homo           GTACCATGGGGAACCGCCTGCAGAGGATCAAGGTGGAAAACACTGAAGAGAACCGCCGGC   297
O.aries        GCACGATGGGAAACCGCCTGCAAAGGATCAAGGTGGAGAACACGGAAGAGAACCGCCGGC   239
               * ** ***** ******** ** ***** ******** ***** *********** ***

Rattus         AGTTCCGAGAGCTCCTCTTTAGTGTGGACAATTCTATCAGCCAGAGCATCGGCGGAGTGA   300
Rat            AGTTCCGAGAGCTCCTCTTTAGTGTGGACAATTCTATCAGCCAGAGCATCGGCGGAGTGA   300
Mus            AGTTCCGAGAACTCCTCTTTAGTGTGGACAATTCCATTAGCCAGAGCATCGGCGGAGTGA   298
Homo           AGTTCCGAGAAATCCTCTTCTCTGTGGACAGTTCCATCAACCAGAGCATCGGGGGTGTGA   357
O.aries        AGTTCCGCGAGCTCCTGTTCACTGTGGACAGCTCCGTCAGCCAGAGCATCGGGGGTGTGA   299
               ******* ** **** **    ******** ** * * ************ ** ****

Rattus         TCCTTTTCCATGAGACGCTCTACCAGAAGGATAGCCAGGGAAAGCTGTTCAGAAACATTC   360
Rat            TCCTTTTCCATGAGACGCTCTACCAGAAGGATAGCCAGGGAAAGCTGTTCAGAAACATTC   360
Mus            TCCTTTTCCACGAGACCCTCTACCAGAAGGACAGCCAGGGAAATCTGTTCAGAAACGTTC   358
Homo           TCCTTTTCCACGAGACCCTCTACCAGAAGGACAGCCAGGGAAAGCTGTTCAGAAACATCC   417
O.aries        TCCTCTTCCATGAGACCCTCTACCAGAAGGATGGCCAGGGAAAGCTGTTCAGAGACATCC   359
               **** ***** ***** ************** ********** ********* ** * *

Rattus         TCAAGGAGAAGGGAATTGTGGTGGGCATCAAGCTGGACCAAGGAGGTGCCCCGCTTGCAG   420
Rat            TCAAGGAGAAGGGAATTGTGGTGGGCATCAAGCTGGACCAAGGAGGTGCCCCGCTTGCAG   420
Mus            TCAAGGAGAAGGGAATTGTGGTGGGCATCAAGTTGGACCAAGGAGGTGCCCCGCTTGCAG   418
Homo           TCAAGGAAAAGGGGATCGTGGTGGGAATCAAGTTAGACCAAGGAGGTGCTCCTCTTGCAG   477
O.aries        TCAAGGAAAAAGGGATCGTGGTGGGAATCAAGTTAGATCAAGGAGTTGCTCCGCTTGCAG   419
               ******* ** ** ** ******** ****** * ** ******* *** ** *******

Rattus         GAACAAACAAAGAAACCACCATTCAAGGGCTTGACGGCCTCTCCGAACGCTGTGCTCAGT   480
Rat            GAACAAACAAAGAAACCACCATTCAAGGGCTTGACGGCCTCTCCGAACGCTGTGCTCAGT   480
Mus            GAACAAACAAGGAAACCACCATTCAAGGGCTTGATGGCCTCTCTGAACGCTGTGCTCAGT   478
Homo           GAACAAACAAAGAAACCACCATTCAAGGGCTTGATGGCCTCTCAGAGCGCTGTGCTCAGT   537
O.aries        GAACAAACAAAGAAACCACCGTTCAAGGGCTTGATGGCCTTTCTGAACGCTGTGCTCAGT   479
               ********** ********* ************* ***** ** ** *************




                                                                                    43
Rattus    ACAAGAAAGACGGAGTCGACTTTGGGAAGTGGCGTGCTGTGCTGAGGATCTCGGACCAGT   540
Rat       ACAAGAAAGACGGAGTCGACTTTGGGAAGTGGCGTGCTGTGCTGAGGATCTCGGACCAGT   540
Mus       ACAAGAAAGATGGAGTTGACTTTGGGAAGTGGCGTGCTGTGTTGAGGATTGCTGACCAGT   538
Homo      ACAAGAAAGATGGTGTTGACTTTGGGAAGTGGCGTGCTGTGCTGAGGATTGCCGACCAGT   597
O.aries   ATAAGAAAGATGGTGCTGACTTTGGGAAGTGGCGTGCTGTGCTGAAGATTGACAACCAGT   539
          * ******** ** * ************************ *** ***      ******

Rattus    GCCCTTCCAGCCTTGCTATCCAAGAAAACGCCAACGCTCTGGCTCGCTACGCCAGCATCT   600
Rat       GCCCTTCCAGCCTTGCTATCCAAGAAAACGCCAACGCTCTGGCTCGCTACGCCAGCATCT   600
Mus       GTCCTTCCAGCCTTGCTATCCAAGAAAATGCCAATGCTCTGGCTCGCTATGCCAGCATCT   598
Homo      GTCCATCCAGCCTCGCTATCCAGGAAAACGCCAACGCCCTGGCTCGCTACGCCAGCATCT   657
O.aries   GTCCATCCCATCTTGCTATCCAGGAAAACGCCAACACCCTCGCCCGCTATGCCAGCATCT   599
          * ** ***   ** ******** ***** ***** * ** ** ***** **********

Rattus    GCCAGCAGAATGGGCTGGTACCTATTGTTGAGCCAGAGGTTCTTCCTGATGGAGACCATG   660
Rat       GCCAGCAGAATGGGCTGGTACCTATTGTTGAGCCAGAGGTTCTTCCTGATGGAGACCATG   660
Mus       GTCAGCAGAATGGGCTGGTCCCTATTGTTGAGCCAGAGGTGCTTCCTGACGGAGACCATG   658
Homo      GTCAGCAGAATGGACTGGTACCTATTGTTGAACCAGAGGTAATTCCTGATGGAGACCATG   717
O.aries   ATCAGCAGAATGGTCTTGTACCCATTGTTGAACCAGAGGTAATTCCCGATGGCAGCCATG   659
            *********** ** ** ** ******** ******** **** ** **    *****

Rattus    ACCTAGAGCACTGCCAGTATGTTTCTGAGAAGGTCTTGGCTGCTGTCTACAAGGCTCTCA   720
Rat       ACCTAGAGCACTGCCAGTATGTTTCTGAGAAGGTCTTGGCTGCTGTCTACAAGGCTCTCA   720
Mus       ACCTGGAGCACTGCCAGTATGTTTCTGAGAAGGTCCTGGCTGCTGTCTACAAGGCTCTCA   718
Homo      ACCTGGAACACTGCCAGTATGTTACTGAGAAGGTCCTGGCTGCTGTCTACAAGGCCCTGA   777
O.aries   ACATGGAACACTGCCAGTATGTTACTGAGAAGGTCCTGGCTGCTGTATACAAGGCCCTGA   719
          ** * ** *************** *********** ********** ******** ** *

Rattus    ATGATCATCATGTTTACCTTGAGGGCACCCTGCTAAAGCCAAACATGCTGACTGCTGGAC   780
Rat       ATGATCATCATGTTTACCTTGAGGGCACCCTGCTAAAGCCAAACATGCTGACTGCTGGAC   780
Mus       ATGATCATCATGTTTACCTAGAAGGCACCTTGCTAAAGCCAAACATGGTGACTGCTGGAC   778
Homo      ATGACCATCATGTTTACCTGGAGGGCACCCTGCTAAAGCCCAACATGGTGACTGCTGGAC   837
O.aries   ATGACCATCACGTTTACTTGGAGGGCACTCTGTTGAAGCCCAACATGGTGACTGCTGGAC   779
          **** ***** ****** * ** ***** ** * ***** ****** ************

Rattus    ATGCCTGCACCAAGAAGTACACACCTGAGCAAGTGGCTATGGCCACCGTCACGGCTCTCC   840
Rat       ATGCCTGCACCAAGAAGTACACACCTGAGCAAGTGGCTATGGCCACCGTCACGGCTCTCC   840
Mus       ATGCCTGCACGAAGAAGTATACACCAGAGCAGGTGGCTATGGCCACTGTCACAGCTCTCC   838
Homo      ATGCCTGCACCAAGAAGTATACTCCAGAACAAGTAGCTATGGCCACCGTAACAGCTCTCC   897
O.aries   ATGCCTGCACCAAGAAGTATACTCCAGAGCAGGTGGCAATGGCCACGGTTACAGCTCTCC   839
          ********** ******** ** ** ** ** ** ** ******** ** ** *******

Rattus    ACAGAACTGTTCCTGCAGCTGTGCCTAGTATCTGCTTTTTGTCTGGAGGCATGAGTGAGG   900
Rat       ACAGAACTGTTCCTGCAGCTGTGCCTAGTATCTGCTTTTTGTCTGGAGGCATGAGTGAGG   900
Mus       ACAGAACTGTTCCTGCAGCTGTTCCTGGTATCTGCTTTTTGTCTGGAGGTATGAGTGAGG   898
Homo      ACCGTACTGTTCCTGCAGCTGTTCCTGGCATCTGCTTTTTGTCTGGTGGCATGAGTGAAG   957
O.aries   ACCGTACCGTTCCTGCAGCTGTGCCTGGCATCTGCTTTTTGTCTGGTGGCATGAGTGAAG   899
          ** * ** ************** *** * ***************** ** ******** *

Rattus    AGGATGCTACACTTAACCTCAATGCTATCTACCGTTGCCCTCTACCTAGGCCCTGGAAAC   960
Rat       AGGATGCTACACTTAACCTCAATGCTATCTACCGTTGCCCTCTACCTAGGCCCTGGAAAC   960
Mus       AGGATGCTACACTTAACCTCAATGCTATCAACCGTTGCCCTCTACCAAGGCCCTGGAAAC   958
Homo      AGGATGCCACTCTCAACCTCAATGCTATCAACCTTTGCCCTCTACCAAAGCCCTGGAAAC   1017
O.aries   AGGATGCTACTCTCAACCTCAATGCTATCAACCTTTGCCCTCTACCAAAGCCCTGGAAAC   959
          ******* ** ** *************** *** ************ * ***********

Rattus    TAAGCTTTTCATACGGCAGAGCCCTCCAGGCCAGTGCATTGGCTGCTTGGGGCGGCAAGG   1020
Rat       TAAGCTTTTCATACGGCAGAGCCCTCCAGGCCAGTGCATTGGCTGCTTGGGGCGGCAAGG   1020
Mus       TAAGCTTTTCATATGGAAGAGCCCTCCAGGCCAGTGCATTGGCTGCCTGGGGTGGCAAGG   1018
Homo      TAAGTTTCTCTTATGGACGGGCCCTGCAGGCAGTAGCACTGGCTGCCTGGGGTGGCAAGG   1077
O.aries   TAAGTTTCTCTTACGGACGAGCCCTGCAGGCCAGTGCACTGGCTGCATGGGGTGGCAAGG   1019
          **** ** ** ** ** * ***** *****     *** ******* ***** *******

Rattus    CTGCAAACAAGAAGGCAACCCAGGAAGCTTTCATGAAGCGGGCTGTGGCCAACTGTCAGG   1080
Rat       CTGCAAACAAGAAGGCAACCCAGGAAGCTTTCATGAAGCGGGCTGTGGCCAACTGTCAGG   1080
Mus       CTGCAAACAAGAAGGCAACCCAGGAAGCTTTCATGAAGCGGGCTATGGCTAACTGCCAGG   1078
Homo      CTGCAAACAAGGAGGCAACCCAGGAGGCTTTTATGAAGCGGGCCATGGCTAACTGCCAGG   1137
O.aries   CTGAAAACAAGAAGGCAACCCAGGAGGCCTTTATGAAGCGGGCCTTGGCTAACAGCCAGG   1079



                                                                                44
          *** ******* ************* ** ** ***********   **** *** * ****

Rattus    CAGCCCAAGGACAGTATGTTCACACGGGCTCGTCAGGCGCTGCTTCCACGCAGTCACTCT    1140
Rat       CAGCCCAAGGACAGTATGTTCACACGGGCTCGTCAGGCGCTGCTTCCACGCAGTCACTCT    1140
Mus       CGGCCCAAGGACAGTACGTTCACACAGGCTCTTCAGGTGCTGCTGCCACCCAGTCGCTCT    1138
Homo      CGGCCAAAGGACAGTATGTTCACACGGGTTCTTCTGGGGCTGCTTCCACCCAGTCGCTCT    1197
O.aries   CAGCCAAAGGACAGTATGTTCACATGGGCTCTTCTGACTCTGCTTCCACCCAGTCGCTCT    1139
          * *** ********** ******* ** ** ** *    ***** **** ***** ****


Rattus    TCACAGCCTCCTACACCTACTAGATACCGTCACCTACCAGCCAG-CTCCAGTTGTCCTAA    1199
Rat       TCACAGCCTCCTACACCTACTAGATACCGTCACCTACCAGCCAG-CTCCAGTTGTCCTAA    1199
Mus       TCACAGCCTCCTACACCTATTAGATACTGTCACC-ACCAGCCAGGCTCCAGTTCTCCTAA    1197
Homo      TCACAGCCTGCTATACCTACTAGGGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTT-C--    1254
O.aries   TCACTGCCAGCTATACCTACTAGAACCCGAGGCTGACCAGCTTGGCTCTGGCGCTC-TAG    1198
          **** *** *** ***** ***    *     *   *****    *** *    *

Rattus    ATATTTTGGTTGGAGACCTCAAAGG----------C-TTCAGTCAGCCCTG-AAATTAGA    1247
Rat       ATATTTTGGTTGGAGACCTCAAAGG----------C-TTCAGTCAGCCCTG-AAATTAGA    1247
Mus       ATATTTTGG----AGACCTGAATGG----------C-T-CAGTCAACCCTGGAAATTAGA    1241
Homo      ------TAGTAGGAGGGCTGAAAGGGAGCAAC---TTTTCCTCCAATCCTGGAAATTCGA    1305
O.aries   GTGTCTTGGTAGGAGGGCTGAAAAGAAACAACGACTTTTCGACTGACCCTGGAAATTAGA    1258
                * *    ** ** ** *              * *       **** ***** **


Rattus    TCACATCTGATTG--AACTTTTGAAAACACCACATAC-TG--------------------    1284
Rat       TCACATCTGATTG--AACTTTTGAAAACACCACATAC-TG--------------------    1284
Mus       TAACATTTGATTG--AACTTCTGAAAACACAACACATGTGAATCATAAACACAAGAGAAA    1299
Homo      CACAATTAGATTTGAACTCGCTGGAAATACAACACATGTTAAAT-CTTAAGTACAAGGGG    1364
O.aries   TGAAATTAGGTTGCAAACTGCTGGAAACACAACACATGTTAATTTCTTAGACACAAGTGG    1318
              ** * **    *     ** *** ** *** * *

Rattus    ---CGAA----TCAGCTGTT---------------GAAGTGCGGAGTATGA--GCACGTC    1320
Rat       ---CGAA----TCAGCTGTT---------------GAAGTGCGGAGTATGA--GCACGTC    1320
Mus       AGCCAAA----TCAGCT-TT---------------GAAACCCA-AGAATGA--GCATGTC    1336
Homo      GAAAAAATAAATCAGTTATTTGAAACATAAAAATGAATACCAAGGACCTGATCAAATTTC    1424
O.aries   AAAAAAA----TCAGTTATG-GAAACATAAATCTGAATATCAGGGATCTGATGAAATCTC    1373
               **    **** * *                 *           ***    * **

Rattus    ACCCAGTAGTCTCC---GAACACCTCCAGTTCCCCGTGTTCCAGAACATCCATCCAAGAG    1377
Rat       ACCCAGTAGTCTCC---GAACACCTCCAGTTCCCCGTGTTCCAGAACATCCATCCAAGAG    1377
Mus       ACCCAATAGTCTCT---CAACACTTCCAGTTCCCTATGTTCCAGAACATTCATCCAAGAA    1393
Homo      ACACAGCAGTTTCCTTGCAACACTTTCAGCTCCCCATGCTCCAGAATACCCACCCAAGAA    1484
O.aries   ACCCAATGGTTTCCTTACAACGCTTCTAGCTCCCCACACCCCAAAGTATCTATCTAAGAA    1433
          ** **   ** **     *** * * ** ****       *** * *    * * ****

Rattus    AAGGAACGGGCTTTACATGGAAGGTCAGTCTTCCATGCATACAGCCACTACTGAGCAAAG    1437
Rat       AAGGAACGGGCTTTACATGGAAGGTCAGTCTTCCATGCATACAGCCACTACTGAGCAAAG    1437
Mus       AAG-AACAGGC----------------------------------CACGACTGAGAAAAG    1418
Homo      AAT-AATAGGCTTTA-AAACAATATCGGCTCCTCATCCAAAGAACAACTGCTGATTGAAA    1542
O.aries   AAG-AACAGACTTTA-AAACAGAACCAGCTCTCCATCCAGA------TCACCAAATGAAA    1485
          ** ** * *                                         * *    **


Rattus    CAGCTCGGAAGGGAAGGA-GGAGAAGGGCATTTTAACAAACATACTTACCGGGGGTTGGT    1496
Rat       CAGCTCGGAAGGGAAGGA-GGAGAAGGGCATTTTAACAAACATACTTACCGGGGGTTGGT    1496
Mus       CAACTCAGAAGCAGAGGATGGAGAAGGGCATTTTAATAAACATAGTTACCAGGGGTTGGT    1478
Homo      CACCTCATTAGCTGAGTGTAGAGAAGTGCATCTTATGAAACAGTCTTAGCAGTGGTAGGT    1602
O.aries   TACCTCCCAAGCCGAGTGCAGAGAAGCTCATCTTATTAAGCAGTCTTAGCAGTGGTAGGT    1545
           * ***   **   **    ****** *** *** ** **     *** * * *** ***

Rattus    TAGAGAAGAGGCA-CAGCAGCAGAAAAAG-AAATAAAAAGT-CTATGAACCTTC------    1547
Rat       TAGAGAAGAGGCA-CAGCAGCAGAAAAAG-AAATAAAAAGT-CTATGAACCTTC------    1547
Mus       TATAGAAGAGGCA-CAGCAACAGAAAAAG-AAATAAAACGT-GTATGAACCTTCCGTTGG    1535
Homo      TGGGAAGGAGATAGCTGCAACCAAAAAAG-AAATAAA-TATTCTATAAACCTTC------    1654
O.aries   TATGAAGGAGACAGCTGCAACCAAAAAAGGAAATAAAGTGTTCTACAAACCTTTAGTTCC    1605
          *    * *** * * *** * ****** *******     * ** ******




                                                                                 45
Rattus            ------------------------------------------------------------
Rat               ------------------------------------------------------------
Mus               TACAGTTTCACTTTCCTGCTCTTGTTGAGGGATCCTGCATTTCATTGTCTTTGCCTATAC 1595
Homo              ------------------------------------------------------------
O.aries           AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA---------------- 1649


Rattus            ------------------------------------------------------------
Rat               ------------------------------------------------------------
Mus               CAGATACAACCCCAATAGTCAGGATCCTCAGCCCCAGATGCTCACTACAGTCAAGTGGCT 1655
Homo              ------------------------------------------------------------
O.aries           ------------------------------------------------------------


Rattus            ------------------------------------------------------------
Rat               ------------------------------------------------------------
Mus               GATGGCTCCCTTTAGCTGAATTACACTAGAAACTCTACCAGATTAAATAAGAGTTCTTTT 1715
Homo              ------------------------------------------------------------
O.aries           ------------------------------------------------------------

Rattus            ------------------------------------------------------------
Rat               ------------------------------------------------------------
Mus               GGGGCTTCCTATATGCAGTCATACTTGAGAACAGTCAGTCTAGACTTCTAGCTTGAGAAT 1775
Homo              ------------------------------------------------------------
O.aries           ------------------------------------------------------------


Rattus            ------------------------------------------------------------
Rat               ------------------------------------------------------------
Mus               ATTTGAGAATACTAAGCTGCAACAGAGACTCATCTCTTCCAAGCTATGGAGTGTAGAGAA 1835
Homo              ------------------------------------------------------------
O.aries           ------------------------------------------------------------


Rattus            ------------------------------------------------------------
Rat               ------------------------------------------------------------
Mus               TGAGTTGATAAACCTGACTTGGCATACTCCTCTCCAGGAATCCAGGTTTTGTGACACAGA 1895
Homo              ------------------------------------------------------------
O.aries           ------------------------------------------------------------

Rattus            ------------------------------------------------------------
Rat               ------------------------------------------------------------
Mus               ACTACATTTTCCTCTCAAAGTCAAGCTGGTCCCCCAGCTGTGCAATAAACAATCGTTGAA 1955
Homo              ------------------------------------------------------------
O.aries           ------------------------------------------------------------

Rattus            ----------------
Rat               ----------------
Mus               TAAAAAAAAAAAAAAA 1971
Homo              ----------------
O.aries           ----------------



       Here, all the gene sequences are aligned and compared simultaneously. Note that
below the sequences alignment, an asterisk (*) is indicated at each base pair. It means that all
four subject genes have total similarity with aldolase B gene. On the contrary, at the site
where no asterisk is found, it indicates that one or more of these bases are different. Hence,
multiple DNA sequence alignment has the advantage of comparing these differences
simultaneously. Below is the tree view among the genes being compared with aldolase B
gene, it shows the distance of every compared gene with the ancestor gene.



                                                                                             46
                                                                       Homo sapiens


                                                                           O.aries



                                                                       Mus musculus


                                                                      Rattus novergicus


                                                                          Rat liver




STEP 6: Design primer for Polymerase Chain Reaction(PCR) amplification
        We obtained a liver biopsy tissue from a patient after obtaining his conscent. This
biopsy was done for other medical reason. RNA was extracted from the liver biopsy and using
oligo dT primer, cDNA was synthesized using reverse transcriptase. We used the enzyme
Klenow Fragment DNA polymerase to synthesize the second strand complementary to the
first strand in order to produce a double-stranded cDNA for the following step : PCR
amplification.
        The PCR is a method for oligonucleotide primer directed enzymatic amplification of a
specific DNA sequence of interest. This technique is capable of amplifying a sequence 105 to
106-fold from nanogram amounts of template DNA within a large background of irrelevant
sequences(e.g. from total genomic DNA). Therefore, basically PCR is DNA replication taking
place in a test tube.
        At first, we need to design primers for the PCR amplification. Primer is a short nucleic
acid containing free 3‟ hydroxyl group that forms base pairs with a complementary template
strand and functions as the starting point for additional of nucleotides to copy the template.
For PCR amplification, two primers are needed, the forward primer and the reverse primer.
The forward primer will bind to the second strand of the template DNA while the reverse
primer will bind to the first strand of template DNA. The 3‟OH terminal of the primer must be
complementary to the template DNA because the extension of newly form DNA is begins
from this point.


                                                                                             47
          Here, we designed the primer manually. The forward and reverse primers are shown as
below :


Forward primer: 5‟ atg gcc cac cga ttt cca gc 3‟
Reverse primer: 5‟ cta gta ggt ata gca ggc tg 3‟


          After that, the forward and the reverse primer were prolonged to create the restriction
sites of EcoRI(gaattc) and HindIII(aagctt) at the defined DNA fragment. We chose both
enzymes as they do not cut our gene of interest. We added the 6-cut base sequence, atcgaattc
(EcoRI) at the 5' end of the forward primer and aagcttatc (HindIII) at the 5' end of the reverse
primer. The atc bases served as extra sequences to stabilize the binding of the restriction
enzymes, EcoRI and HindIII, during cleavage activity. We did this because it is a common
method for efficient directional cloning. By introducing additional restriction sites at 5' end of
the primers, modification of the PCR primers can eventually improve cloning efficiency and
facilitate directional cloning of the PCR products.
          In order to run the PCR, several components are required. The components of PCR are
listed below.
    Taq DNA polymerase
    Primers
    Template DNA
    KCl 50mM
    MgCl2 1.5mM
    Tris 10 mM at pH 8.3
    dNTPs 0.2 mM each dNTP (dATP, dCTP, dGTP, dTTP)
    Optional:BSA, DMSO, Formamide
The PCR procedure involves three steps to complete a cycle and it takes 25 to 35 cycles to
complete an amplification process. It rarely runs more than 40 cycles. More cycles mean a
greater yield of product. However, with increasing number of cycles the greater the
probability of generating various artifacts(mispriming products). The three steps of PCR are
as below :


(I) Template denaturation
          Heating up to 95-970C for about 15-30 seconds denatures the template DNA
containing the sequence that is to be amplified.


                                                                                               48
(II) Primer annealing
       The denatured DNA is annealed to the excess of synthetic oligonucleotide primers by
incubating them together for 30 seconds. The ideal annealing temperature depends on the base
composition of the primers and can be calculated by the formula below :


       Tm = (A+T)2 + (G+C)4


                   Forward primer = (4+4)2 + (4+8)4
                                      = 64ºC
                      Annealing temperature = 640C – 20C = 620C


                   Reverse primer = (5+5)2 + (7+3)4
                                     = 60 ºC
                     Annealing temperature = 60ºC – 20C = 580C
By comparing the annealing temperatures of the forward and reverse primers, we chose the
lowest annealing temperature for our PCR procedure, that is, 58ºC.


GC content(%) :         Forward primer = 12/20 x 100% = 60%
                        Reverse primer = 10/20 x 100% = 50%


(III) Primer extension
       DNA Polymerase is used to replicate the DNA segments between the sites
complementary to the oligonucleotide primers. The primer provides the free 3‟-OH required
for covalent extension, and the denatured genomic DNA provides the required template
function. Polymerization is usually carried out at 70-72ºC for 15 minutes. The procedure is
repeated many times until the desired level of amplification is achieved. Amplification occurs
exponentially.


By the end of PCR, a large amount of PCR product(ALDOB gene) will be obtained and used
in the next cloning procedure.




                                                                                           49
                                  Figure 4 : Summary of PCR




STEP 7 : Choosing a suitable vector for cloning


       In order to clone a gene, a vector is needed as an agent to carry a DNA into a host cell
or organism. After searching through the Novagen catalogs, we decided to choose pETBlue-2,
which is an expression vector, as the vector in this cloning simulation project. Expression
vector is important for the expression of the recombinant protein.
       The reasons for us choosing pETBlue-2 are because of some special characteristics
displayed by pETBlue-2 :
    The presence of EcoRI and HindIII enzyme cleavage sites in the multiple cloning
       sequence(MCS) of the vector. Both enzymes will be used to cut pETBlue-2 later.
    MCS is situated downstream of T7 promoter, which promotes high level protein
       expression in BL21 E.coli host cells. T7 promoter also serves as the binding site for
       forward promoter for PCR screening purpose.
    The presence of His Tag sequences and HSV Tag at the C-terminal to simplify and
       facilitate rapid protein purification and detection.
    Enterokinase cleavage site for efficient removal of the fusion tag.
    Ampicillin resistance marker for screening.
    The high copy number pUC origin of replication increases plasmid yields relative to
       the vector and provides an advantage for sequencing and mutagenesis.


                                                                                            50
    f1 origin of replication(allows single-stranded vector to be produced when co-infected
       with M13 helper phage).




                         Figure 5 : Plasmid map of pETBlue-2 vector.



       pETBlue-2 was digested by the restriction enzymes EcoRI and HindIII at their
respective cleavage sites located in the vector. After treated with both enzymes, sticky ends
were produced at both ends of the cleavage sites. This ensures directional cloning of the
desired gene when the aldolase B gene, which contains EcoRI and HindIII restriction sites at
both 5‟ and 3‟ ends, is inserted and ligated with the vector.




                                                                                          51
STEP 8 : Ligation
       Ligation is the process where a DNA fragment, with blunt or sticky end, is inserted
into an appropriate plasmid. More specifically, DNA ligation involves creating a
phosphodiester bond between the 3' hydroxyl of one nucleotide and the 5' phosphate of
another. Sticky ends can only join with “compatible sticky ends” whereas blunt ends can join
with any blunt ends(but not with sticky ends). Ligation of complementary sticky ends is much
more efficient compared to the ligation of two blunt ends. This is because compatible sticky
ends can base pair with one another by hydrogen bonding, forming a relatively stable
structure for the enzyme to work on.
       Before ligation taken place, pETBlue-2 vector was treated with shrimp alkaline
phosphatase(SAP) to prevent self-ligation of the vector. We used T4 DNA ligase to ligate the
ALDOB gene into the restricted pETBlue-2 vector. T4 DNA ligase is greatly enhanced if the
DNA ligase contains RNA ligase. The energy source for this ligase reaction is ATP plus
Mg2+. The double-stranded DNA segments to be joined must be present in fairly high
concentration and must have 5‟-P and 3‟-OH groups. The figure below shows how the
ALDOB gene is ligated into the restricted pETBlue-2 plasmid.




                       Figure 6 : pETBlue-2 with ALDOB gene insert




                                                                                         52
5’T           A 3’

      3’ A           T 5’

 ALDOB Gene
                                                        pETBlue-2
                                                  treated with shrimp
                                                alkaline phosphatase




                            T4 DNA Ligase




                                           Recombinant plasmid




                       Figure 7 : Ligation process




                                                                        53
STEP 9 : Transformation into BL21 E.coli host
       BL21 E.coli is selected as the host cells in this cloning project. Bacteria are capable of
plasmid uptake through the process of bacterial transformation. This is a process by which
extra-cellular DNA, usually plasmids isolated from cells, is taken in by a bacterial cell. Once
obtained, the plasmid genes may then be expressed by the host cell. In order for
transformation to occur, the cells must be in a particular physiological state known as
„competence‟.
       In order to introduce the recombinant plasmid into the BL21 E. coli cells, we made the
host cells become competent by treatment with calcium chloride in the early log phase of
growth. This is called calcium chloride method. The bacterial cell membrane is permeable to
chloride ions, but is non-permeable to calcium ions. As the chloride ions enter the cell, water
molecules accompany the charged particle. This influx of water causes the cells to swell and
is necessary for the uptake of DNA. The calcium chloride treatment is followed by heat.
When E. coli are subjected to 420C heat, a set of genes are expressed which aid the bacteria in
surviving at such temperatures. This set of genes are called the heat shock genes. The heat
shock step is necessary for the uptake of DNA. At temperatures above 420C, the bacteria's
ability to uptake DNA becomes reduced, and at extreme temperatures the bacteria will die.


Calcium chloride method
    Competent BL21 E.coli cells can be prepared by suspending the cells in CaCl2 and
     incubate on ice for 2 hours. Some of the cells will become competent.
    Smaller plasmid transforms more efficiently than the larger plasmid.




                                                                                              54
                        Figure 8 : Calcium Chloride method




                                             Chromosomal DNA
Chromosomal DNA

                        Treat with calcium chloride



     uncompetent BL21 E.Coli                     competent BL21 E.Coli




                                                              Recombinant plasmid
                                                              with ALDOB gene




                       Figure 9 : Summary of transformation




                                                                                    55
STEP 10 : Verification of successful Transformation
       This step is done to determine whether the BL21 E.coli had successfully uptake the
recombinant plasmid into the cells. Fist, we cultured the BL21 E.coli on LB ampicillin agar
plate and incubate for 16-18 hours at 370C to check for the growth and the
presence of colonies. If colonies are present it show that transformation is successful done and
should be conform using screening method.
       The principle of the step is that E.coli is sensitive to ampicillin in nature and will not
grow on ampicillin plate. However, those bacterial colonies observed on the plate conferred
antibiotic resistance because they had taken up the recombinant plasmid. The transformed
E.coli cells are protected by the ampicillin-resistance gene(AMP R) on the pETBlue-2
plasmid, which can express the enzyme, b-lactamase, to inactivate the antibiotic ampicillin.
This method allows us to select the transformants for screening method.




STEP 11 : Screening by using hybridization with radioactive labeled probe




                 Figure 10 : Hybridization with radioactive labeled probe


       Hybridization with radioactive labeled probe method was chosen for screening to
detect the present of ALDOB gene in BL21 E.coli host . Firstly, master plate colonies of
BL21 E.coli that contain cloned segment of ALDOB gene are transferred from the culture
medium onto a filter paper, nitrocellulose filter was used here, by gently pressing the filter
onto the surface. A part of each colony remains on the agar medium. The filter is treated with
sodium hydroxide(NaOH), which simultaneously breaks open the cells and denatures the



                                                                                              56
duplex DNA into single strands. The filter is then saturated with radioactive labeled probe
complementary in base sequence to the ALDOB gene, and the DNA strands are allowed to
form duplex molecules again(renatured). After washing to remove unbound probe, the
positions of the bound probe identify the desired colony. Detection of the desired colony can
be done by exposing the nitrocellulose filter under the X-ray to detect the presence of
radioactivity on the membrane. Only segments that contain DNA sequences complementary
to the radioactive DNA probe will yield radioactive spots on the autoradiograph. The
locations of the radioactive spots are used to identify colonies that contain the desired
sequence on the original replicated plates. These colonies are used to purify many ALDOB
genes for further usage.




STEP 12 : Expression of recombinant protein


       As the plasmid vector propagates in the dividing host cell, the foreign DNA is
replicated and amplified as well. Virtually unlimited quantities of the recombinant molecule
can be produced in this manner, which allow for physical characterization or manipulation of
the inserted foreign DNA fragment for further usage.
       In this step, the isolated recombinant BL21 E.coli was then grown up on the nutrient
agar plate. In this stage, we treated the bacteria with IPTG (Isopropylthiogalactoside). The
IPTG acts as an inducers to initiate the transcription and translation of the ALDOB gene into
the aldolase B enzymes and leads to an accumulation of large quantities of enzymes within
the host cell before we harvest them.
       The principle behind this method is using the regulated promoter to express a foreign
protein in BL21 E.coli. The pETBlue-2 vector contains E.coli promoter under the control of
the lac repressor and operator. The foreign DNA is inserted into the restriction site between
the T7 promoter and a transcriptional terminator. When transcription is initiated at the T7
promoter, it will produce mRNA that can be translated into protein. The plasmid is
transformed into an E.coli strain that overexpresses the lac repressor. This keeps transcription
of foreign DNA tightly repressed in case the foreign protein is toxic to the cells. Once a large
enough amount of the E.coli culture has been grown, IPTG is added to inactivate the
repressor. Now the foreign mRNA is transcripted efficiently and translated into protein.




                                                                                             57
STEP 13 : Extraction of protein
       The previous step had provided us the unlimited amount of E.coli containing abundant
human aldolase B enzymes within their periplasm. After the protein expression of the host
cells, we need to extract the protein that we want from the host cells. Therefore, we need to
lyse the host cells to release the „contents‟ in the host cells to the surrounding environment. In
order to do this, we have used the sonication method to lyse the bacterial cells which have the
recombinant protein.


STEP 14 : Purification of recombinant protein
       In this step, we aim to get a large quantities of the wanted recombinant protein, human
aldolase B enzyme, in the purified form without the mixture of bacterial protein and other
substances.
       In order to purify the protein extracted from the bacterial cells, we have adopted the
Nickel Metal Affinity Chromatography as pETBlue-2 plasmid contains His Tag sequence(6
consecutive histidine residues) in its multiple cloning site. The principle behind this method is
due to pETBlue-2 plasmid properties. pETBlue-2 is an oligo-histidine expression vector,
which has a short sequence in the multiple cloning site that encodes a stretch of six histidines.
Thus, the protein(human aldolase B enzyme) expressed in such vector will be a fusion protein
with six histidines at its amino end. Oligo-histidine regions like this have a high affinity for
metals like nickel, so we can purify proteins that have such region using Nickel Metal
Affinity Chromatography. After the bacteria have made the fusion protein, we simply lyse
them, add the crude bacterial extract to a nickel affinity column and harvested essentially pure
fusion protein in only one step. This is possible because very few natural protein have oligo-
histidine region, the fusion protein is essentially the only one that binds to the column.
       After getting the recombinant protein from the host cells by sonication method, we
pass the recombinant protein with His Tag sequence through a Nickel affinity column. The
His Tag sequence will bind to divalent cations(Ni2+) immobilized on nitriloacetic acid(NTA)
resins. After that, we wash the unbound proteins or proteins without the His Tag with buffer.
After unbound proteins and proteins without His Tag are washed away, the target protein is
recovered by elution with either imidazole or slight reduction in pH. After the elution step, the
His Tag protein is treated with specific protease to cleave off the His Tag. Here, we use
enterokinase to cleave off the His Tag. Finally, we pass the cleaved protein through the Nickel
affinity column once again to get the recombinant protein freed of His Tag peptide.



                                                                                               58
       This method enables proteins to be purified under gentle and non-denaturing
conditions. The purification is based on the affinity between the neighbouring histidines of the
His Tag sequence and an immobilized metal ion(Ni2+). The metal is held by chelation with
reactive groups covalently attached to a solid support. The most commonly used chelators
include nitriloacetic acid(NTA) and iminodiacetic acid(IDA), which have four and three sites
available for interaction with metal ions, respectively. The two chemistries confer different
properties to the affinity support and conditions used for binding, washing and elution of
target proteins for both native and denaturing conditions. In this cloning simulation project,
we use NTA as the chelator as the additional chelation site available with NTA minimizes
leaching of the metal during the purification. However, IDA supports can be recycled many
times with no loss in performance. For both types of support the conditions can be modified
to optimize the purification of individual target proteins expressed in specific systems. Most
often, the imidazole concentrations of the wash and elution buffers under native conditions
are adjusted to minimize co-purification of non-specifically bound proteins.
       For an optimum binding of the protein to the immobilized metal complex, the buffer
system can be of influence. For example, Tris-containing buffer reduces the binding affinity
and should therefore only be used if the proteins have very strong interactions with the
affinity matrix. The presence of substances which also bind to the metal ions can prevent
binding of the target protein. For example, high imidazole concentrations strongly influence
the protein binding characteristics of the column. At the same time the decrease of the pH
value of the equilibration buffer can also result in adsorption of less protein from a complex
mixture.
       The diagram below shows the purification of recombinant protein by using Nickel
Metal Affinity Chromatography.




                                                                                             59
Figure 11 : Summary of Immobilized Metal Affinity Chromatography(IMAC)




                                                                         60
61
Figure 12 : 2 adjacent histidine residues in a protein interacting with a Nickel ion that is
chelated by Nitrilotriacetic acid (NTA), and covalently linked to a solid support by an 9-bond
tether.




STEP 15 : SDS-PAGE
       This is the last step of our cloning simulation project. After the purification of
recombinant protein, we need to run the purified protein in SDS-PAGE in order to verify that
the purified protein we obtained from the previous step is actually the protein that we wanted
to clone, that is, human aldolase B enzyme. Although several methods are available for
determining purity, the easiest to apply and the best method is Polyacrylamide Gel
Electrophoresis(PAGE).
       PAGE is usually used for proteins. In PAGE, we make a polyacrylamide gel from a
mixture of acrylamide and a bis-acrylamide cross linker. Proteins are loaded onto the gel and
move through the gel under the influence of an electric field. All things being equal, the



                                                                                           62
protein will move according to its charge density, but in actual fact in most PAGE techniques,
it is the size of the pores in the gel that have to more profound effect on the rate of protein
migration.
       In native PAGE, we just add protein directly to the gel and run it. Native PAGE is
non-denaturing so we can test for protein activity afterwards, but it doesn't tell you much
more than how pure your protein sample is. Proteins move in a complex way depending on
their charge density and the size of the gel pores.
       In SDS-PAGE, we denature proteins in such a way as to make them migrate in a
predictable fashion. SDS-PAGE is a denaturing technique. The SDS-PAGE system has
excellent resolution due to the use of stacking gel(acidic pH) and separating gel(basic pH).
Firstly, proteins are unravelled by boiling, then any disulfide bonds are broken with beta-
mercaptoethanol. This is a reducing agent that will break the disulfide bonds and destroy the
quarternary structure of proteins and separate them into subunits. It will ensure maximum
reaction with SDS. Hence what we add to the gel will be subunits and not the original
protein. We then add the negatively charged detergent sodium dodecyl sulfate(SDS), which
linearises the protein chains and coats the protein with negative charge. This swamps the
natural charge on the protein, so all proteins will have the same charge density. Since SDS-
coated proteins have a constant charge, they will migrate with the same mobility in stacking
gel(3%) but will begin to separate via molecular weight due to the sieving effect of the
separating gel(7.5%-15%). Consequently, when we load the proteins, they will move
according to how easily they can navigate through the pores in the gel alone. Protein are thus
separated on the basis of size by the sieving effect of the polyacrylamide gel matrix. Finally,
proteins separated by PAGE can be visualized using staining method with Coomassie
Brilliant blue R250. The gels are then destained to observe the protein band.
       At the end of the SDS-PAGE procedure, an estimate of the molecular weight of the
recombinant protein can be done by comparing against the electrophoretic mobility of the
known molecular markers. There should be only one band on the gel indicating molecular
weight 40kDa approximately, which is compatible to the molecular weight of the recombinant
protein that we cloned.




                                                                                            63
Figure 13 : The setup of SDS-PAGE apparatus and concept of using electric charge to
            drive protein separation.




                Figure 14 : Example showing results of SDS-PAGE.




                                                                                      64
USES AND COMMERCIAL VALUES OF THE HUMAN ALDOLASE B ENZYME


       The product that we yield from this cloning simulation project is the human aldolase B
enzyme. This isozyme has specialized functions in fructose metabolism and gluconeogenesis.
Mutations in the human aldolase B gene that result in diminished aldolase B activity cause the
autosomal recessive disease, hereditary fructose intolerance(HFI). HFI leads to high levels of
fructose-1-phosphate(F1P) in the tissues where aldolase B is expressed causing several
hazardous metabolic effects that can result in liver and kidney damage. The symptoms of the
disorder, abdominal pain, vomiting and hypoglycemia, result from ingestion of fructose or
other sugars that are metabolized through F1P. This disease poses the greatest risk to the
patient during infancy at the time of weaning when it may be fatal. Growth retardation, renal
tubular dysfunction, liver failure, coma and eventually death may occur if the disease remains
undiagnosed and the patient continues to ingest fructose.
       Unfortunately, the crystallographic structure of human aldolase B is still unknown.
Moreover, the structure of aldolase B is still unavailable, making scientists still uncertain
what the effect of this, or any other, mutation would have on the structure or activity of
aldolase B. The mechanisms of control of Aldolase B expression is also not known. Another
surprising fact is that HFI patients do not have difficulty maintaining their blood-glucose
levels(in absence of fructose). This is surprising given that, by definition, they suffer from a
catalytic deficency(less than normal enzyme activity) in what is thought to be a key glucose
synthesizing enzyme (aldolase B). Two hypotheses have been proposed to explain this
enigma: (1) residual activity in mutant aldolase B or (2) expression of the other aldolase
isozymes. Both hypotheses are still uncertain. The biochemical effect of the common
mutations(all missense), which are found in at least one allele in over 95% of HFI patients,
remains unclear.
       Therefore, we clone the human aldolase B enzyme in large quantities in order to have
an extensive study and thorough research to solve the problems above. The research is
directed toward understanding the molecular basis of HFI, as well as its causes, distribution,
and biochemical and physiological effects. Understanding these genetic issues will offer the
physician and genetic counselor better tools for diagnosis and counseling of families with this
potentially disastrous disease. These studies will directly test hypotheses that may explain the
normal gluconeogenesis that HFI patients exhibit in the absence of fructose, and therefore,
may lead to a better understanding of glucose homeostasis in humans. We can also multiply



                                                                                             65
and specify the enzymatic function of aldolase B by modifying its molecular structure. The
specific aims of the research are:
1) the identification of mutations in the DNA from individuals with HFI.
2) the determination of the biochemical roots of this disorder by examination of both
   the normal enzyme, aldolase B, and the enzymes produced from HFI alleles
   containing missense mutations.
3) structural and functional analyses will determine if the HFI enzymes have any
   residual activity.
4) the enzymology of normal aldolase B will be examined by measurement of the
   levels of several covalent reaction intermediates by chemical trapping and the rates
  of their formation and interconversion by rapid quenching during single turnover
  experiments. Lastly, stable HFI enzymes will be examined in similar experiments
  to assess the nature of the biochemical defects that causes HFI.
Hopefully, by the end of the research, the scientists are able to find a cure for HFI disease as
there is no cure for HFI at the moment.
        Among the most important applications of genetic engineering is the production of
large quantities of particular proteins that are otherwise difficult to obtain(for example,
proteins that are present in only a few molecules per cell or that are produced in only a small
number of cells or only in human cells). The method is simple in principle. Just as what we
have done in this cloning simulation project, a DNA sequence coding for the desired protein
is cloned in a vector adjacent to an appropriate regulatory sequence. This step is usually done
with cDNA because it has all the coding sequence spliced together in the right order. Using a
vector with a high copy number ensures that many copies of the coding sequence will be
present in each bacterial cell, which can result in synthesis of the gene product at
concentrations ranging from 1-5% of the total cellular protein. This is exactly what our group
wanted to do, that is, to produce the normal aldolase B enzyme in abundant amount in order
to produce relevant drug for the HFI patients. The normal aldolase B can also be introduced to
HFI patients who suffer from catalytic deficiency of aldolase B, in which the method of
administrating the aldolase B protein into the patients is through direct injection. However,
further investigation is still needed to find the most suitable way of introducing it. This may
not be the cure for HFI but hopefully it can ease and minimize the suffering faced by HFI
patients.
        In practice, the production of large quantities of a protein in bacterial cells is
straightforward, but there are often problems that must be overcome, because in the bacterial


                                                                                             66
cell, which is a prokaryote, the eukaryotic protein may be unstable, may not fold properly, or
may fail to undergo necessary chemical modification.


CONCLUSION
        After completing the cloning simulation project, we found out that we had a better
understanding about the concept and principle of molecular biology techniques. We had also
gained precious knowledge and experiences regarding the procedures of molecular cloning,
from searching for gene of interest to draw the cloning strategy and also the functions and
potential of the protein(human aldolase B enzyme) we cloned. Meanwhile, we had also
upgraded our knowledge and open our mind to the genetic engineering field. Through this
project, we had also learnt a lot of things regarding the HFI disease, such as its causes,
symptoms and bad effects.
        At first we thought that cloning a gene is not a tough job but as we were exposed
deeper into the cloning procedures, we found that cloning a gene can be very challenging,
especially when we wanted to choose the appropriate gene to clone and the suitable vector,
which is something extra from lectures been taught to us. In addition, we had also learnt how
to design a good cloning strategy to clone the desired gene. This could be very helpful to us if
we were to involve in the genetic engineering field in the future. Besides, we found that the
advanced development of computerized biotechnology has really simplified the job in
molecular cloning or recombinant DNA technology. Information about genetic technique is
available and accessible through internet or can be completed by using certain software
programmes. Although the cloning simulation project is just a theoretical project, but we had
improved our understanding about molecular biology techniques.




                                                                                             67
REFERENCES


1. Daniel L. Hartl, Elizabeth W. Jones, 1999. Essential Genetics, 2nd edition. Pg. 351-
   354, 363. Jones and Bartlett Publisher.
2. GTB 204 Molecular Biology Technique : Lecture Notes.
3. http://www.ncbi.nlm.nih.gov
4. http://www3.ncbi.nlm.nih.gov/htbin-post/Omim/dispmim?229600
5. www.novagen.com
6. www.bu.edu/aldolase/HFI/index.html
7. http://www5.amershambiosciences.com/Aptrix/upp01077.nsf/Content/Homepage
8. www.jrhbio.com
9. http://uk.vwr.com/app/Home
10. http://www1.qiagen.com
11. http://wheat.pw.usda.gov/~lazo/methods/goldberg/toc.html
12. http://www.steve.gb.com
13. Novagen 2000 Catalog : Molecular Tools for Life Science Research




                                                                                          68