Docstoc

An elusive expansion at the FRDA locus

Document Sample
An elusive expansion at the FRDA locus Powered By Docstoc
					                        An elusive expansion at the
                                       FRDA locus




Claire Healey, Andrew Purvis, Mohammed Kiron Kibria, Kara Gaffing, Fiona Coyne & Roger Mountford
Cheshire and Merseyside Regional Molecular Genetics Laboratory, Liverpool Women’s Hospital
                     Presentation Overview
Introduction:
    • Friedreich ataxia:
           Clinical symptoms;
           Molecular pathology


Case 1:
   • Diagnostic referral;
    • CAG repeat expansion testing;
    • Unusual TP-PCR result

Case 2:
    • Diagnostic referral;
    • Premutation plus GAA repeat expansion within the disease-causing size range

Case 3:
    • Carrier testing;
    • GAA repeat expansion undetected using standard analysis
                  Friedreich Ataxia (FRDA)
• Autosomal recessive neurodegenerative disorder;
• Affects the spinal column and cerebellum;
• Slowly progressive ataxia of the gait & limbs;
• Onset: 10 – 15 years of age
• Associated with:
          Muscle weakness;
          Spasticity in the lower limbs;
          Absent lower limb reflexes;

          Dysarthria;
          Scoliosis;
          Pes cavus;
          Bladder dysfunction;
          Loss of position and vibration sense
                                        FRDA
• Additional clinical symptoms:
    • ~ 30 %:
                   Hypertrophic non-obstructive
                    cardiomyopathy

    • ~ 10-25%:
                 Optic atrophy;
                 Deafness;
                 Glucose intolerance
                         or
                 Diabetes mellitus

    • ~ 25%:
                   Atypical presentation:
                        Later age of onset;
                        Retained tendon reflexes;
                                 or
                        Unusually slow disease progression
                          Genetics of FRDA
•   Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia
•   Carrier frequency of ~ 1:100
•   FRDA gene (Frataxin or X25) indentified in 1996:
    1.   Expansion of GAA triplet repeat within intron 1 = 98% mutations

         1                     2               3               4           5a

                     
     aaaaaaaaaaaaaaagaagaag
     aagaagaagaagaaaataaaga

          Normal alleles: 5-33 GAA repeats;
          Alleles > 27 repeats rare;
          Premutation alleles: 34-65 GAA repeats;
          Expanded alleles: > 66 GAA repeats

            Some alleles have interrupted sequences:
             GAAGGA or GAGGAA
                             Genetics of FRDA
•   Incidence of 2-4 per 100,000 – Europe, N. Africa, Middle East & S. Asia
•   Carrier frequency of 1:100
•   FRDA gene (Frataxin or X25) indentified in 1996:
        1.   98% mutations = expansion of GAA triplet repeat within intron 1

             1                    2                3               4                 5a

                                                                                       
    1                                                  106                     165        182

        2.   1-2% FRDA patients – GAA expansion plus inactivating mutation,
             (nonsense, splicing, frameshift or missense)
                Homozygous expansion & compound heterozygous patients:
                 clinically indistinguishable;
                Patients with missense mutations near the carboxy-terminus have atypically
                 mild FRDA;
                No patients have been described with two identified
                 point mutations
                 Molecular Genetic Testing
Detection of GAA repeats:
•   Current testing strategy:
     a)   F-PCR across repeat region with FAM-labelled primers
                 Molecular Genetic Testing
Detection of GAA repeats:
•   Current testing strategy:
     a)   F-PCR across repeat region with FAM-labelled primers




                 n/n (8/29 repeats)




                n/?
                 Molecular Genetic Testing
Detection of GAA repeats:
•   Current testing strategy:
     a)   F-PCR across repeat region with FAM-labelled primers;
     b)   Triplet-prime PCR




          n




          E
                                  Case 1
•   Diagnostic referral;
•   Expansion & point mutation analysis requested:
        Institute of Neurology:
              GAA repeat flanking PCR;
              TP-PCR
•   Clinical details:
          52 year old female;
          No further details avaliable
                    Case 1

F-PCR:




                        8 repeats
         Patient
         1.
              31 rpt control
              2.
                   Expansion control
                   3.
                         Hom & Het normal controls
                         4. & 5.
           Molecular Genetic Testing
Triplet-prime PCR:


                  gaagaagaagaagaagaagaa
            cttcttcttcttcttcttcttcttctt
           Molecular Genetic Testing
Triplet-prime PCR:


              gaagaagaagaagaagaagaa
           cttcttcttcttcttcttcttcttctt
           Molecular Genetic Testing
Triplet-prime PCR:


           gaagaagaagaagaagaagaa
           cttcttcttcttcttcttcttcttctt
Molecular Genetic Testing

gaagaagaagaagaagaagaa
cttcttcttcttcttcttcttcttctt


     gaagaagaagaagaagaagaa

  gaagaagaagaagaagaagaa

gaagaagaagaagaagaagaa
          Case 1

TP-PCR:
                           Case 1

Modified TP-PCR:




                                Primers:
                   FATP-P3-F-FAM
                   FATP-P1-R
                   FATP-P4-F GAA Int + FATP-P4-F GAG Int
                  Case 1

Southern Blot:




      EcoRV
      FA3PEx1




                 Patient   Normal   E/E   n/E
                 1.        2.       3.    4.
                               Case 1

? Clinical Significance:
•   Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures;
                                  Case 1
? Clinical Significance:
•   Long GAA repeats tracts form abnormal ‘sticky’ triplex DNA structures;
•   Inhibit transcription = reduced Frataxin protein
•   Interrupted alleles:
          Triplexes less likely to form;
          Not predicted to inhibit transcription of Frataxin to the same extent as
           pure GAA repeats;
          Shorter in length (equivalent to alleles of 100-300 triplets);
          May be associated with late on-set disease
          (GAGGAA)n & (GAAAGAA)n interruptions may stabilise premutation
           alleles;
          May prevent expansion into abnormal size range
•   Clear guidelines regarding the implications of these interruptions and their
    clinical significance have not been established
                                Case 1

? Clinical Significance:
•   Patient:
          1 normal allele;
          1 interrupted allele;
          No further mutations identified on sequence analysis
•   Unlikely to be affected with FA;
•   ? chance finding unrelated to the patient’s symptoms
•   Further work:
          Sequence interrupted allele
•   Detection of interrupted:
          May be difficult using standard TP-PCR;
          Requires contiguous run of GAA repeats
                                Case 2
•   Diagnostic referral:
          53 year old female:
          Progressive cerebellar degeneration
•   F-PCR analysis identified an allele within the premutation range (~38 rpts);
•   TP-PCR analysis detected the presence of an expansion
                                 Case 2

Southern blot analysis:
•   Confirmed presence of an allele in the premutation size range & an
    expanded allele in the affected size range




         EcoRV
         FA3PEx1




                            Patient Normal E/E   n/E
                            1.     2.     3.     4.
                                  Case 2
? Clinical Significance:
•   Patient:
          1 allele within premutation size range;
          1 allele within affected size range;
          Identified in peripheral lymphocytes
•   Premutation alleles:
          Not thought to affect transcription of the Frataxin gene;
          Not thought to be pathogenic;
          May show somatic instability
•   ? if a significant proportion of such alleles expand into the affected size
    range in appropriate tissues, this may lead to atypical disease;
•   Increases the likelihood of a diagnosis of FA
•   Further work:
          Testing of other tissue types;
          Family studies
                                  Case 3
•   Diagnostic referral:
          10 year old child:
          Progressive ataxia, weakness, deteriorating motor skills, cerebellar
           dysfunction;
          Two GAA repeat expansions
          Mother identified as a carrier using standard testing strategy;

•   Southern blot analysis:       23 Kb -    1         7 8


                                  9.4 Kb -


                    EcoRV         6.5 Kb -
                    FA3PEx1


                                  4.3 Kb -
                                  Case 3
•   Diagnostic referral:
          10 year old child:
          Progressive ataxia, weakness, deteriorating motor skills, cerebellar
           dysfunction;
          Mother identified as a carrier using standard testing strategy;
•   Modified TP-PCR Assay:
          Different locus specific P1-primer;


                                                               No expansion detected
                                   Standard TP-PCR




                                   Modified TP-PCR


           Mother                                                      Father
                                   Case 3
•   DNA sequencing:
         Primers flanking the standard P1 priming site
         30bp deletion:
                Covering the whole of the standard TP-PCR P1 priming site in the patient’s
                 father and the affected child;
                Deletion present on the same allele as the expansion;
                Explains why the expansion in the patient’s father could not be detected
                    Mother
                 using standard TP-PCR

•   Summary:
         Samples harbouring such a deletion would give results consistent with
          homozygosity for the same size normal allele using these assays;
                   Father
         Deletion would not be detected - potentially an expansion could be
          missed
                115 FA referrals with 1 allele in the normal range and no TP-PCR expansion
                 were testedchild presence of this deletion
                    Affected for the                           Break point
                No further deletions were identified in this cohort
                Likely that such a deletion is either very uncommon or private to this family
       Acknowledgements

All within the molecular genetics laboratory

              Andrew Purvis
           Mohammed Kiron Kibria
               Kara Gaffing
               Fiona Coyne
             Roger Mountford
Thank-you for listening

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:16
posted:3/30/2011
language:English
pages:29