UNCONTROLLED by gjjur4356

VIEWS: 95 PAGES: 27

									 Charlottetown Laboratory               SOP-CL-DIA-DIA-074-02                        Page 1 of 26

 Section:        Diagnostics

 Title:          Procedure for the total extraction of DNA from potato stem and tuber
                 tissues, geranium stems and tomato stems using the KingFisher mL® and
                 KingFisher® 96 magnetic particle processors for the detection of Ralstonia
                 solanacearum race 3 biovar 2 using Real Time Taq Man PCR and the
                 CEPHEID® unit

1.        Purpose:

          1.1    To describe the procedure used for total extraction of DNA from potato stems and
                 tuber tissues using the KingFisher® mL and KingFisher® 96 magnetic particle
                 processors.

          1.2    Describe the procedure for the performance of Real time Taq Man PCR using the
                 Smart Cycler (CEPHEID®)

2.        References

          2.1    Weller, SA, Elphinstone, J.G. Smith, N.C. Boonham, N., and Stead, D.E. 2000,
                 Detection of Ralstonia solanacearum strains with a quantitative, multiplex, real-


 UNCONTROLLED
          2.2
                 time, fluorogenic PCR Taqman assay. AJ. Appl. Environ.Microbiol.66:2853-2858.

                The Thermo Labsystems, KingFisher® mL and KingFisher® 96 (magnetic particle
                 processor) manuals.

          2.3    Protocol for the Detection of Clavibacter michiganensis subsp. sepedonicus,
                 the bacterial ring rot pathogen in potato, current version.

          2.4    SOP CL-DIA-DIA-002, “Bacterial Ring Rot Composite Extraction”

          2.5    SOP CL-DIA-DIA-040, “Bacterial Ring Rot Individual Potato Stem/ Tuber
                 Extraction”

          2.6    Operator Manual for the Cepheid Smart Cycler and Instruction Sheet prepared by
                 CL Appendix 4.0

          2.7    SOP CL-DIA-EQP-013, “pH Meter”

          2.8    SOP CL-MSP-043, “Design and use of the Molecular Laboratories at CL”.

          2.9    SOP CL-DIA-DIA-067, “Procedure for the total extraction of DNA from potato
                 stem and tuber tissues using the KingFisher ml and KingFisher 96 magnetic
                 particle processors for the detection of Bacterial Ring Rot (Clavibacter
 Charlottetown Laboratory            SOP CL-DIA-DIA-074-02                            Page 2 of 26

             michiganensis subsp. sepedonicus) using Real Time TaqMan PCR and the
             CEPHEID unit.

3.    Responsibility:

      3.1    It is the responsibility of the Group Leader to ensure that the laboratory technician
             is properly trained in this procedure.

      3.2    The laboratory technician is responsible to follow this SOP.

      3.3    The laboratory technician is responsible for informing the Group Leader of any
             problems that occur during this procedure.

4.    Definitions:

      4.1    MSDS                   Material Safety Data Sheets

      4.2    SOP                    Standard Operation Procedure

      4.3    Cycle Threshold        The first cycle in which there is a significant increase in the
                                    fluorescence above the back ground or specific threshold .


 UNCONTROLLED
5.
      4.4    Template

      Equipment and Supplies:
                                    Extracted DNA



      The Equipment and supplies listed are those which have not been mentioned in the BRR
      Protocol (2.3) , SOPs CL-DIA-DIA-002 (2.4) and CL-DIA-DIA-040 (2.5)

      5.1    Primers, TaqMan probe and rection control for detection Ralstonia solancearum
             race 3 biovar 2.

             5.1.1   Forward Primer (B2-1-F) 5' TGGCGCACTGCACTCAAC 3' (Refer to 2.1)
                     HPLC purified.

             5.1.2   Reverse Primer (B2-11-R) 5' AATCACATGCAATTCGCCTACG (Refer
                     to 2.1).

             5.1.3   TaqMan Probe (B2-P) 5' Cy5 - TTCAAGCCGAACACCTGCTGCAAG -
                     IWBQ 3' (Refer to 2.1).

             5.1.4   Reaction control (pRB2C2) 100 x stock (400 copies/µl) in 0.1 x TE. Obtain
                     from TD.
Charlottetown Laboratory           SOP CL-DIA-DIA-074-02                          Page 3 of 26

     5.2    Autoclave: capable of sterilizing at 121°C, any brand.

     5.3    Heat block: capable of maintaining a temperature of 50 - 60°C

     5.4    Incubator or oven :capable of maintaining a temperature of 50 - 60°C (used when
            large number of samples are extracted).

     5.5    Water purification system: to provide Type 1 quality water, 18 Megaohm pyrogen
            free, e.g. Milli-Q.

     5.6    Micro Centrifuge tubes: 1.5-1.7ml DNAse/RNAse free (or autoclaved) any brand

     5.7    Absolute Alcohol (Ethanol 100%).

     5.8    Skim milk powder, any brand

     5.9    Ethylene-diamine-tetra-acetic Acid (EDTA), (C10H12N2O8Na2) Disodium
            Dihydrate, A.C.S., DNase/RNase free, F.W. 372.24.

     5.10   Proteinase K, purchased from Sigma (catalog # P-2308) or equivalent



UNCONTROLLED
     5.11


     5.12
            Sodium dodecyl sulfate (SDS), (CH3(CH2)11OSO3Na), A.C.S. , DNase/RNase free,
            F.W. 288.4.

            Tris (hydroxymethyl)aminomethane, (C4H11NO3), DNase/RNase free, A.C.S., F.W.
            121.1.

     5.13   Ralstonia solanacearum race 3 biovar 2 Negative Control

     5.14   Ralstonia solanacearum race 3 biovar 2 Positive Control extract of pure culture.

     5.15   CEPHEID® Smart Cycler

     5.16   Polypropylene Smart Cycler reaction tubes ( 25 µl ) purchased from Fisher Cat #
            114005

     5.17   Smart cycler tube racks purchased from Fisher Cat # 114008

     5.18   Commercially purchased DNase/RNase free Water.

     5.19   KingFisher® mL or KingFisher® 96 magnetic particle processor.


     5.20   KingFisher® mL Tube strips and Tip Combs purchased as a combo pack from
Charlottetown Laboratory           SOP CL-DIA-DIA-074-02                       Page 4 of 26

            VWR cat # CA53500-050.

     5.21   KingFisher® 96 Deep Well Tip Combs (VWR cat #83007-594) and 96 well plates
            (VWR cat #83007-599).

     5.22   Promega, Magnesil KF Genomic System Kit or its individual components

     5.23   SYBR Jumpstart Taq Ready Mix from Sigma Cat # 54438.

     5.24   5N HCL ( Hydrochloric Acid )

     5.25   NaOH Pellets ( Sodium hydroxide ) ACS. F.W. 40

     5.26   5N NaOH ( Sodium hydroxide ) ACS. F.W. 40

     5.27   MO-BIO Ultra Clean DNA Isolation Kit Cat #13000.          .

     5.28   4% Egel® purchased through Invitrogen and used according to manufacturer’s
            directions or equivalent (Appendix 9.0).

     5.29   Sodium Azide NaN3 FW 65.01 Sigma S2002 or equivalent.


UNCONTROLLED
     5.30   Dimethyl Sulphoxide (DMSO) C2H6OS FW 78.13 Sigma Cat # 02650 or
            equivalent

     5.31   10% SDS purchased through Invitrogen (cat #15553-035) or equivalent.

     5.32   0.5M EDTA purchased through Invitrogen (cat #15575-038) or equivalent.

     5.33   Ultra Pure 1M Tris-HCL pH 8.0 purchased through Invitrogen (cat #15568-025)

     5.34   Boric Acid (for electrophoresis) (H3 BO3) F.W. 61.83 available through Sigma Cat
            # B7901 or equivalent.

     5.35   pH meter, operational range 0.00 to 14.00 ± 0.01 pH.

     5.36   Bromophenol blue (sodium salt) available through EM Science Cat # BX-1410-7
            or equivalent.

     5.37   Xylene Cyanole FF F.W. 538.6 available through Sigma Cat # X-4126 or
            equivalent.

     5.38   Gycerol F. W. 92.09 available through any supplier.
Charlottetown Laboratory              SOP CL-DIA-DIA-074-02                         Page 5 of 26

     5.39     NuSieve® 3.1 Agarose available through VWR Cat # 12001-726 or equivalent.

     5.40     Ethidium Bromide (10 mg/ml) available through Invitrogen Cat #155-85-011.

     5.41     Kodak BIO Max QS710 Horizontal Gel Electrophoresis system or equivalent.

     5.42     Bio-Rad Power Pak 200 or equivalent.

     5.43     Image or Gel Documentation System, any brand.

     5.44     Microwave, any brand.

     5.45     Glass and plasticware, various sizes and styles.

     5.46     Pipettes, any brand, calibrated to manufacturer’s specifications
                      0.5 - 10.0 ul single channel pipettor and filtered tips
                      10.0 - 100.0 ul single channel pipettor and filtered tips
                      100.0 - 1000.0 ul single channel pipettor and filtered tips

     5.47     Molecular Weight Ladder purchased through New England Biolabs cat #N3236S.

6

    UNCONTROLLED
     Safety

     6.1      MSDS must be examined before handling the chemicals required in this procedure.

7     Policy:

     7.1      All buffers and the Type 1 water used must be sterilized according to the validation
              chart posted in M2-08 (wash-up). For example, 1 litre of water may be autoclaved
              in a 2L reagent bottle for 25 minutes at 121°C in a liquid cycle.

     7.2      Technicians must wear gloves while preparing solutions /buffers and performing
              the procedures described in this SOP.

     7.3      The bench or work area and utensils must be sprayed and wiped down with 70%
              ethanol (8.1.6).

     7.4      All tips and tubes noted in this SOP must be autoclaved according to the validation
              chart posted in M2-08 or purchased sterile DNase\RNase free.


     7.5      A negative control representing tissue type of the sample must be included in all
              Real Time PCR Runs, extracted and amplified at the same time as samples.
 Charlottetown Laboratory            SOP CL-DIA-DIA-074-02                           Page 6 of 26

      7.6    A positive control must be included in all Real Time PCR Runs, extracted and
             amplified at the same time as samples.

      7.7    A water control must be included with all Real Time PCR runs, extracted and
             amplified at the same time as samples.

      7.8    A quality control check (Appendix 7.0 ) will be done on all commercially prepared
             buffers and reagents before they are put into use to ensure that they comply with
             the criteria described for Ralstonia (10.0).

      7.9    If the sample is considered a first find in a geographical area, Isolation Bioassay
             and Re-Isolation of the organism must be performed.

8.    Instructions

      8.1    Preparation of Reagents

             8.1.1   1M Tris-HCL pH 8.0 (Stock Solution)

        1M Tris-HCL pH 8.0 may be prepared as follows or bought as a 1M solution
        (5.33). If commercial buffers are used they must comply with section 7.8.

 UNCONTROLLED        8.1.1.1        Dissolve 12.11g of Tris (5.12) in 70 ml of Type 1 water.

                     8.1.1.2        Ensure that the pH metre has been calibrated that day, if not,
                                    please consult SOP CL-DIA-EQP-013 (2.7) and perform a
                                    two-point calibration. Adjust pH to 8.0±0.1 using 5N
                                    HCL.(5.24)

                     8.1.1.3        Adjust volume to 100mls with Type 1water.

                     8.1.1.4        Autoclave according to Section 7.1.

                     8.1.1.5        Label and store at room temperature for a maximum of 90
                                    days.

             8.1.2   0.5M EDTA, pH 8.0 (Stock Solution)

        0.5M EDTA may be prepared as follows or bought as a 0.5M solution (5.32). If
        commercial buffers are used they must comply with section 7.8.
Charlottetown Laboratory            SOP CL-DIA-DIA-074-02                          Page 7 of 26

                    8.1.2.1        Dissolve 93.05g of EDTA (5.9 ) into 300mls of Type 1
                                   water. Stir vigorously on a magnetic stirrer.

                    8.1.2.2        Ensure that the pH metre has been calibrated that day, if not,
                                   consult SOP CL-DIA-EQP-013 (2.7 ) and perform a two-
                                   point calibration.
                                   Adjust pH to 7.0 with approximately 10g of NaOH pellets
                                   (5.25) then finely adjust to pH 8.0±0.5 with 5N NaOH
                                   (5.26).

                    EDTA will not completely dissolve until the pH of the solution
                    reaches at least 7.0.

                    8.1.2.3        Adjust volume to 500mls with Type 1 water.

                    8.1.2.4        Autoclave according to Section 7.1.

                    8.1.2.5        Label and store at room temperature for 90 days.

            8.1.3   10 % SDS (Stock Solution)



UNCONTROLLED
        10% SDS may be prepared as follows or bought as a 10% solution (5.31). If
        commercial buffers are used they must comply with section 7.8.

                    8.1.3.1        Using autoclaved glassware, plastic ware and utensils,
                                   dissolve 10g of SDS (5.11 ) in 85mls of autoclaved Type 1
                                   water. Heat to 68°C to assist dissolution.

                     A mask must be worn when weighing SDS.

                    8.1.3.2        Adjust the volume to 100mls with autoclaved Type 1 water.

                    8.1.3.3        Label and store at room temperature for a maximum of 90
                                   days.

            8.1.4   Proteinase K (5.10 ) 10mg/ml (Stock Solution)

                    8.1.4.1 Using autoclaved glassware, plastic ware and utensils, reconstitute
                            according to manufacturers directions in order to achieve a stock
                            solution of 10mg/ml.

                    8.1.4.2 Dispense 0.5 ml aliquots into 1.5ml autoclaved microcentrifuge
                            tubes.
Charlottetown Laboratory           SOP CL-DIA-DIA-074-02                          Page 8 of 26


                   8.1.4.3 Label and store at -20°±5°C for a maximum of 1 year.

           8.1.5   TE buffer ( pH 8.0 )

                   8.1.5.1        Add 10 ml of 1M Tris-HCl pH 8 (8.1.1 or 5.33) and 2 ml of
                                  0.5 M EDTA (8.1.2 or 5.32) to 900 ml of autoclaved water.

                   8.1.5.2        Mix well and adjust volume to 1000 ml.with autoclaved
                                  type 1 water

                   8.1.5.3        Label store at room temperature for up to 90 days

           8.1.6   70% Ethanol

                   8.1.6.1        Measure 70ml of absolute alcohol (5.7 ).

                   8.1.6.2        Adjust volume to 100 ml with Type 1 water.

                   8.1.6.3        Label and store at -20°±5°C for a maximum of 1 year.



UNCONTROLLED
           8.1.7   10 % Blotto

                   8.1.7.1        Prepare a 10% solution with skim milk powder (5.8) and
                                  0.1% sodium azide (5.29) in sterile water. Aliquot 20 µl into
                                  sterile microcentrifuge tubes and store at -20°±5°C for a
                                  maximum of one year.

           8.1.8   Preparation of Stock solution of Primers and Probe
                   (100 :M Stock Concentration)

                   8.1.8.1        Lyophilized primers received from the manufacturer are re-
                                  suspended in TE-1 in a volume that will give a concentration
                                  of 100:M. For example for primers weighing 76.8 nmoles
                                  add 768 ul of TE-1 for a final concentration of 100 uM

           ie.     76.8nM X        1 uM    X     L   X 1000ml X 1000ul = 768 ul
                                 1000nM        100uM     L        ml

                   8.1.8.2        Label, aliquot in 50 :l volume and store one half of the
                                  aliquots at -70/C (as a back-up) and the other half at -20°C.
                                  They may be used for up to one year.
Charlottetown Laboratory          SOP CL-DIA-DIA-074-02                          Page 9 of 26


            This stock solution of the Primers and Probe will be diluted and used to
            make the Master Mix for PCR reactions. Please consult your Master Mix
            worksheet for the working dilution required and dilute the stock in fresh
            TE-1 accordingly.


           8.1.9   Extraction Buffer

             Extraction Buffer must be made fresh each day, thaw the proteinase K
             immediately before use.



                   8.1.9.1       1X Extraction Buffer - Used for Freeze dried
                                 Homogenate extracts, (Refer to Appendix 1.0)

                   8.1.9.2       3.5 X Extraction Buffer - Used for Fresh or Frozen
                                 Homogenates when extracting with the KingFisher
                                 method (Refer to Appendix 1.0)



UNCONTROLLED
     8.2   Preparation for The Test

           8.2.1   Maceration of Potato tuber or stem tissue is performed according to
                   Bacterial Ring Rot Protocol (2.3), SOP CL-DIA-DIA-002 (2.4), SOP CL-
                   DIA-DIA-040 (2.5)

            Ideally the filtrate is used immediately after being processed.

     8.3   Agarose gel electrophoresis

           8.3.1   A commercially prepared Egel (5.28, Appendix 9.0) may be used according
                   to manufacturer’s directions or a gel may be prepared as follows.

           8.3.2   The PCR products are generally analysed in a 4 % agarose gel containing
                   0.5 µg/ml (final concentration) ethidium bromide. A 50 bp ladder should
                   also be run as a molecular weight reference (preferably at each side of the
                   gel). The thickness of the gel should be between 0.4-0.75cm.
                   NOTE: To make the agarose gel, for a gel size of 10 cm X 8 cm, pour 25
                   mls of 0.5x TBE (see 8.4.2.2.) into a 125 ml Erlenmeyer flask, add 1.00 g
                   of agarose. Heat in a microwave just to the boiling point (approximately 45
                   secs. ). Keep checking while heating to ensure the agarose is completely
                   dissolved. Place on a rocker while cooling and prepare second gel, if
                   required. Once cooled (65°C) and just prior to pouring, add 1.25 µl of
Charlottetown Laboratory           SOP CL-DIA-DIA-074-02                       Page 10 of 26

                   Ethidium bromide (final concentration 0.5 µg/ml). The gel thickness should
                   be between 0.4-0.75 cm. For gels of other sizes please alter the components
                   accordingly.

                   SAFETY NOTE: Ethidium bromide is highly mutagenic and is
                   carcinogenic. Always wear gloves when handling gels stained with this
                   material. See related MSDS and section 6.1.

           8.3.3   The gel is loaded with 5 µl of a PCR product mixed with 1 µl of loading
                   dye. The gel is run at 80 volts for approximately 40-60 min. 0.5 × Tris-
                   Borate EDTA is used as for making the gel and as gel running buffer.

                   8.3.3.1 Loading dye:

                           0.25% bromophenol blue (5.36)
                           0.25 % Xylene cyanole (5.37)
                           30 % glycerol in water (5.38)
                           Autoclave according to Section 7.1.
                           Aliquot and store at -20°C for up to one year.

                           NOTE: Commercial loading dye may be used. But one must be


UNCONTROLLED               aware of the possible absence of some components (e.g. Xylene
                           cyanole).

                   8.3.3.2 Tris-Borate EDTA buffers (TBE), 5× stocks

                           54 g Trizma base (5.12)
                           27.5 g Boric acid (5.34)
                           20 ml of 0.5 M EDTA solution, pH 8.0 (8.1.2 or 5.32)
                           Make up to 1 litre using Milli Q water
                           Autoclave according to Section 7.1.
                           Ensure the final pH is 8.3±0.1.
                           Store at room temperature for up to one year.

                   8.3.3.3 Gel electrophoresis conditions described in this SOP are based on
                           the BIO Max Q’S 710 Agarose gel electrophoresis system, the
                           standard size of the tray is 8 × 10 cm. and the gel is 0.4-0.75 cm
                           thick. The Bio-Rad Power/Pac 200 is used as a power supply. The
                           gel is generally run at 80 volts for approximately 60 min or until
                           the lower dye reaches 2 cm from the bottom of the gel.

           8.3.3   View the gel using a UV transilluminator. Document by capturing a digital
                   image or photograph.
 Charlottetown Laboratory             SOP CL-DIA-DIA-074-02                            Page 11 of 26

       8.4    Total DNA Extraction from the sample homogenate

              8.4.1   For 1-15 samples refer to DNA Extraction Worksheet - KingFisher® mL ,
                      Appendix 1. For 16-96 samples refer to DNA Extraction Worksheet.
                      KingFisher® 96 - Appendix 6.0.

              8.4.2   Fill out all sample information required on the “Samples for Extraction or
                      PCR Worksheet”, refer to Appendix 2.0

         If commercially prepared buffers or reagents are used refer to section 7.8 and
         Appendix 7.0



        At this point the bench and all utensils (e.g. pipets, tube racks etc.) must be
        wiped down with 70% alcohol. All tubes, tips etc. must be autoclaved and every
        precaution should be taken to prevent contamination of the sample.


       When extracting sample homogenate a positive, a negative a water control ( Water
       used in the preparation of the Extraction Buffer ) must also be extracted at the same

 UNCONTROLLED
9.
       time.


       Performing RealTime qPCR using the CEPHEID® ( Smart Cycler )

     Technician must read and sign SOP-CL-MSP-043 “Design and use of the
     Molecular Biology Laboratories at CL before using Clean room M2-06


       9.1    The PCR Master Mix is prepared in M2-06. This is considered the clean room for
              the preparation of the Master Mix, Refer to Appendix 3.0. This form can be
              printed from the computer located in M2-06.

              File Location #
              Ralstonia: M:\Plant\Progrmas\PCR worksheets\CFIA_ACIA#1390261-v1-Ralstonia-
              qPCR_T aqM an_W orksheet.xls



       Increase the amount of Master Mix required by approximately 10% to allow for
       losses due to pipetting, etc.
Charlottetown Laboratory           SOP CL-DIA-DIA-074-02                        Page 12 of 26

     9.2    Remove the components used in the Master mix from the -20± 5°C Freezer in
            M2-06, approximately 30 minutes before preparation of Master mix and place at
            4± 3°C fridge located in M2-06 to thaw.

     The Master Mix and some of its components (the SYBR Jumpstart Mix and the
     probe) are light sensitive, please use precautions ie. amber tubes for Master Mixes
     when handling.


     9.3    When all the components of the Master Mix with the exception of the internal
            control (pRB2C2) have been aliquoted into a sterile amber tube, gently mix by
            inversion..

 The Master mix is to be dispensed into the Smart Cycler reaction Tubes in the
 Biosafety Hood in M2-12



     9.4    Using the BioSafety Hood in M2-12 add the appropriate amount of internal control
            (according to Appendix 3.0) to the Master Mix.



UNCONTROLLED
     9.5    Before dispensing the Master mix preform a quick centrifuge spin to pull down all
            of the solution from the top and sides of the tube.


 Do not autoclave the Smart cycler reaction tubes. Handle the reaction tubes by the
 ribbed portion of the tube . Avoid touching the optical detection window. Tubes
 when not in use should be sored out of direct light.



     9.6    In M2-12 aliquot 23 µl of the master mix into a smart cycler reaction tube (tube is
            labelled with sample ID) and 2 µl of the DNA Template for a total volume of 25
            µl reaction volume.


   Alway use sterile barrier tips to fill the smart cycler reaction tubes , dispense the
   reaction mixture slowly to minimize trapping bubbles. Bubbles can interfere with the
   optical measurements.
Charlottetown Laboratory             SOP CL-DIA-DIA-074-02                          Page 13 of 26


        It is essential that the cap is seated properly on the tube before the reaction tube is
        closed , when capped correctly , the tube becomes pressurized and the sides of the
        diamond - shaped area of the reaction tube bulge slightly. This will provide proper
        contact between the sides of the tube and the heaters in the Smart cycler to ensure
        efficient thermal cycling and amplification. When closing a reaction tube ,it is
        recommended to put the tube in the Smart Cycler reaction rack , then press down
        on the cap until you feel a “SNAP”


      9.7    The Smart Cycler (CEPHEID) unit is located in M2-05. Before placing the
             reaction tubes in the Smart Cycler, centrifuge the tubes for 2 - 3 sec in the mini-
             centrifuge located beside the Smart Cycle System.

             9.7.1   Insert the capped reaction tubes into the I-CORE site slot of the smart
                     cycler , press down firmly into place

             9.7.2   Using the instructions for the Smart Cycler, noted in Appendix 4.0, start the
                     program.

             9.7.3    When the run is completed print off a report according to the Appendix


 UNCONTROLLED9.7.4
                     4.0 instructions.

                     Using Appendix 8.0 “Ralstonia Taq Man qPCR Results” summarize and
                     interpret the results.

10.   Interpretation of R. Solanacearum race 3 biovar 2 TaqMan Real Time PCR Results

      10.1   The TaqMan test for R. Solanacearum race 3 biovar 2 is similar in design to the
             test for BRR (SOP CL-DIA-DIA-067) in that it incorporates an internal reaction
             control for validating negative results. As with the BRR TaqMan, the internal
             control consists of a plasmid (pRB2C2, see Appendix 3.0) that contains a sequence
             unrelated to R. Solanacearum flanked by the race 3 biovar 2 - specific primer
             sequences.

      10.2   Two dyes are used in this assay. The probe reporter is detected the Cy5 channel
             and the FAM channel is used to detect SYBR Green-mediated fluorescence of any
             double strated DNA (R. Solanacearum race 3 biovar 2 or the internal control).
Charlottetown Laboratory                SOP CL-DIA-DIA-074-02                            Page 14 of 26

         10.3 Table 1.0 Interpretation of R. Solanacearum race 3 biovar 2 TaqMan Real time
         PCR results

 Cy5        Melt Peak                      FAM            Melt Peak         Verdict
 Ct         Ralstonia                      Ct             1C
 < 40       Potato Tuber:                  not relevant   not relevant      * Sample is positive.
            82.49 - 83.51 oC
            Potato Stems:
            81.94 - 83.40oC
            Tomato:
            82.23 - 83.47oC
            Other/Unknown
            81.94 - 83.51oC
 $36        no melt peak. Check            # 32.34        89.01 -           * If a melt peak is observed, run
            1st derivative or sample melt                 90.03°C           the PCR product on a 4%
            curve. Determine if the melt                                    agarose gel (5.28 or 8.3). If the
            peak is visible just below the                                  Ralstonia product (68 bp) and
            flourescent threshold and                                       the internal control product
            within the R.sol target melt                                    (94bp) are visible, the sample is
            ranges listed above                                             considered positive. If only the
                                                                            internal control product is
                                                                            visible the sample is considered
                                                                            negative. If no R.sol melt curve


 UNCONTROLLED                                                               is observed in the 1st derivative
                                                                            and the fam ct is <32.34 with an
                                                                            IC melt peak of 89.01 - 90.03°C
                                                                            the sample is negative.
 No Ct      No Melt curve                 # 32.34         89.01 -           * Sample is negative
                                                          90.03°C
 No Ct      No Melt curve                 $ 32.34         Or the Melt       * This indicates a poor reaction
                                                          Curve is out of   or that inhibitors are present.
                                                          range             Repeat analysis from the
                                                          (89.01-90.03o     template stage adding a
                                                          C)                clean-up step using the Mo-Bio
                                                                            Ultra Clean Plant DNA
                                                                            Isolation Kit (5.27, see
                                                                            Appendix 5.0) If the sample
                                                                            still does not fit into the
                                                                            parameters for a positive or a
                                                                            negative, further dilute the
                                                                            cleaned up template at 1/10
                                                                            dilution with autoclaved water
                                                                            and repeat the real time PCR.
                                                                            Then if the sample does not fit
                                                                            the parameters of a positive, the
                                                                            sample is considered negative.

* Follow -up or confirmatory testing may be required.
 Charlottetown Laboratory                  SOP CL-DIA-DIA-074-02                           Page 15 of 26

                                               Appendix 1.0

                                        CL - Example
                           DNA Extraction Worksheet - Kingfisher mL

Date:                                  Samples:                                Performed by:

Preparation of Extraction Buffer

Extraction Buffer 1X -Freeze Dried Homogenates (Example For 10 mls)

        50 mM Tis-HCl ph 8.0        = 1M Tris-HCl ph 8.0 X 0.5 ml
        25mM EDTA                   = 0.5M EDTA X         0.5     ml
        1% SDS                      = 10% SDS X       1          ml
        10ug/ml Proteinase K        = (10mg/ml) X    10       µl
        Distilled water Dnase/RNaseFree           To Total volume of 10ml

Extraction Buffer 3.5 X - Fresh or Frozen crude Homogenate

 Total # of Samples
 Volume of buffer /      200 µl buffer /
 sample                  500 µl sample
                                             Example given volume for one sample


 UNCONTROLLED
 Component


 Tris - HCL
                   Stock conc.


                   1        M
                                       Lot #           Volume
                                                       tube
                                                       35µl
                                                                      Final conc.


                                                                      0.175       M
                                                                                           Total vol .



 pH 8.0
 EDTA              0.5      M                          35µl           0.088       m
 SDS               10       %                          70µl           3.5         %
 Proteinase K      10       mg/ml                      0.7µl          0.035       mg/ml
 Dnase/RNase                                           59.3µl
 Free Water

Cell Lysis
Add 1000     ul 1X Extraction buffer to Freeze Dried Extracts

Add      500 ul Fresh or Frozen crude homogenate to       200 ul 3.5X Extraction buffer.

To avoid cross-contamination, dispense the extraction buffer first, then add the sample.
Vortex 5 sec.

Incubation - 3 hrs to overnight at 55 °C -60 °C
Temp:            Heat Block:: PD 051 or Oven: PD127 Date In :                     Date Out:
Temperature out :
 Charlottetown Laboratory                 SOP CL-DIA-DIA-074-02                              Page 16 of 26

DNA Extraction :
Load the desired number of Kingfisher sample strip tube (1 x 5) into the King Fisher sample tray.
Ensure that they are properly oriented, with the upper tab to the left.
Using the reagents from the Promega ,Magnesil KF Genomic System Kit
Prepare the Kingfisher sample strip tubes with the following reagents 1 to 5 as shown below:


                                                                              1 - Lysis buffer Lot #

                                                                              2 - Salt Wash Lot #
                                                                              3 - Alcohol Wash Lot #
                                                                              4 - Nuclease Free Water
                                                                                  Lot #
                                                                              5 - Magnetic Beads
                                                                               Lot #
                                                                              Ensure Bead are in solution
                                                                              before placing into Tube



        Add 50 0 µl o f sample                  Collect 25µl of eluate at end of run.


Following the 3 hour or overnight incubation at 55° C - 60° C add 500 µl sample to the first well of the
KingFisher sample tube (i.e. the well containing the Lysis Buffer KF and the magnetic beads). Avoid
aspirating the insoluble material at the bottom of the sample tube.


 UNCONTROLLED
Power up the Kingfisher CFIA# 615771 . Install the proper number of rod covers. Install the King Fisher
tube tray containing the loaded sample strip tubes.

Select the “PromegaGenomic” program by pressing the arrow key until displayed in the window.

Press “Start”. Ensure that there are no position errors.

At the end of the run, press “Stop” . Remove the samples. Transfer the contents of the fifth well into a
fresh, sterile micro tube. Approx 25µl avoiding the Magnetic Beads

Label and Store @-20°C            LOCATION:

Remove the rod covers and dispose with the used sample tube strips as biohazardous waste. Shut off the
power on the Kingfisher.
M:\Plant\Programs\PCR worksheets\CFIA_ACIA-#831055-V1-KingFisher_DNA_Extraction_worksheet.wpd


Reference SOP CL-DIA-DIA-061, 067, 068 and 074
Charlottetown Laboratory              SOP CL-DIA-DIA-074-02                   Page 17 of 26

                                         Appendix 2.0
                                  Charlottetown Laboratory
                           Samples for Extraction or PCR (Circle one)

Date:_______________                          Performed By:_____________

Sample Type:      ______Fresh or Frozen Crude Extracts          _____Freeze Dried Extracts

 #of Samples                                      Sample Inventory ID




 UNCONTROLLED



Extraction Performed by:                              Date performed by:

Real Time PCR Performed by:

M:\Plant\Programs\PCR worksheets\sample extract.wpd
Refer to SOP’s CL-DIA-DIA-051, 052, 061, 067, 068 and 074
Charlottetown Laboratory                    SOP-CL-DIA-DIA-074-01                                                    Page 18 of 26

                                                      Appendix 3.0



                                Charlottetown Laboratory PCR Workup
                                Sheet


   Date:                                   File name:                                      Initia l:
   Target                Ralstonia solanacearum Race 3, Biovar 2
   Prime rs              B2-I-F + B2-II-R
   Probes                B2-P             (5' Cy5 - 3' Iowa Black RQ)

   Total Reaction Volume            25                ul
   Num ber of Samples:               1

   Com ponent                                   Supplier Lot #              Volume         Fin al             Tota l Vol. (ul)
                                                                             ul/tube       Conc.              in M aster Mix

   Jum pStart + Sybr     2           X    Sigma            107K6003         12.5             1          X   12.500
   B2-I-F                100        uM    Eurogentech      2006/09/22              0.075    0.3        uM   0.075
   B2-II-R               100        uM    Eurogentech      2006/09/22              0.075    0.3        uM   0.075
   Probe B 2 -P          100        uM    IDT              485265                   0.05    0.2        uM   0.050
   pRB2C2 control        100         X    in-house         08-A-002         0.25             1          X   0.250
   BLOTTO                10          %    CEPD             08-01                     0.5    0.2         %   0.500
   DMSO                  100         %    Sigma            109H2319                  0.2    0.8         %   0.200
   W ater                                      in-house    1354863                  9.35                               9.350


UNCONTROLLED
   Template DNA
   Total Volume

   Cycling                                 Sm artCycler
                                                                                       2
                                                                                      25                              23.000



   Conditions

   Denaturation                                             2 min @ 95 oC
   Am plification                                          15 sec @ 95 oC
                                                       o
                                          60 sec @ 64 C
   Num ber of Cycles                                  40
   Final Extension                                          3 min @ 72 oC
   Melt (Channel 1)                              default
   Other:                Program:                  Jum pstart T64+m elt

   Hoods Cleaned with 70% Ethanol or Eliminase                                     Before W ork                  After W ork



   Analyse Products: Examine melt curves, if necessary run on 4 % agarose gel

   Produc ts                             Mo lecular Size          Melt Temperature

   Ralstonia B2 target          68 bp Tuber                82.49-83.51C
                                      Potato Stem          81.94-83.40C
                                      To m ato             82.23-83.47C
                                      Other                81.94-83.51C
   Reaction control target      94 bp                      89.01-90.03°C

   For samples with Negative Results in the Cy5 channel, the FAM Ct m ust be #32.34
   Reference SOP-CL-DIA-DIA-062-Current Version
 Charlottetown Laboratory                    SOP-CL-DIA-DIA-074-01                                         Page 19 of 26


                                                     App endix 4 .0
                             Instructions for BRR T aq Man for the Cepheid Smart Cycler

- Turn on Sm art Cycler unit(s) first. There are two units, one is A and the other is B,and each unit holds 16 samples. If
you have 16 or less sa m ples then it is only necessary to turn on cycler A

- Turn on the com puter and log on norm ally

- Op en w ith the S m art Cycler icon (it takes a few m inutes to conne ct to the instrum ent)

- Click on Create Run

- Assign a Run N am e for example the pathogen, date, run # and initials.

- If you wish you can add Notes

- The Dyeset should be set on FCTC 25

- Under Analysis Settings: You will need to see the results of the FAM and the Cy5 Channels, under the Usage
column for both these dyes set to Assay, the remaining dyes should be set to Unused.
Set the Threshold Setting column to M anual for both the FAM and Cy5 dyes. Set the M anu al Th resh old F luor.
Unit colum n for FAM at 15.0 and for Cy5 to 4.0.

- Click on Add/Rem ove Sites

- Under Protocols - click “JumpStart T64 +melt” see Appendix 3.0, for cycle conditions.

- Under Sites click on the sites (ex: if you have samples in 1,2,3,4 of cycler A then you would select A1,A2,A3,A4) you
wan t to select an d m ove them over to Selections with the arrow button. W hen you click on site A1 and then click on


 UNCONTROLLED
the arrow it will appear un der Selections along with the protocol you have chosen -JumpS tart T 64 +melt

- W hen you have selected all the sites click on OK

- You can now fill in the sample ID (to identify what is in each site) and any notes you wish, save the run at the bottom
left hand side of the screen.

- Click on Start Run

 - The run begins. There is a split screen, each with the heading Views ,where you can view two different graphs or
reports at the same time. For example you can view the progress of the run by viewing the FAM graph and also the
Cy5 grap h.

- The run takes approx. 1 hour and is automatically saved

- W hen the run is finished you can print off a report by clicking on Rep ort and then print. You can also print off any
graphs (ex:the FAM graph ) by right clicking on the graph itself and then clicking on print. In order to analyse BRR
results you will need to print off the FAM graph, the Cy5 graph and the M elt graph.

-Stop all sites by clicking the Stop Run icon and saying ‘Yes’ to all sites.

- Close the program and shutdown the computer. Turn off the cycler(s) last.
 Charlottetown Laboratory                      SOP-CL-DIA-DIA-074-01                                            Page 20 of 26


                                                    Appendix 5.0
                                                        CL
                                            Mo-Bio DNA Clean-up Worksheet
                                                     Worksheet
Date:                                       Samples:                                            Performed by:

STOCKS: Mo-Bio Solution P3                    Reagent #
        Mo-Bio Solution P4                    Reagent #
        Mo-Bio Solution P5                    Reagent #


Add 600 :l Solution P3. Mix and add to top of Spin Filter. Centrifuge 1 min at 13,000 RPM (10,000 g).
Discard flow-through.

 Add 300 :l Solution P4 to Spin Filter. Centrifuge 1 min at 13,000 RPM (10,000g). Discard flow-
through.

Centrifuge Spin Filter for 2 min at 13,000 RPM (10,000 g) to remove excess solution P4. Discard
collector tube and replace with a new, sterile, collector tube.

Add 35 :l Solution P5 to the top of the spin filter.. Centrifuge 1 min at 13,000 RPM (10,000g) to elute
the DNA.

Storage @-20°C                 LOCATION:

 UNCONTROLLED
Reference SOP CL-DIA-DIA-067, 068 and 074 - current version


M:Plant\Programs\PCR worksheets\BRR\CFIA_ACIA#936646-v1-Mo-BIO Clean-Up Worksheet for BRR.wpd
Charlottetown Laboratory              SOP-CL-DIA-DIA-074-01                                    Page 21 of 26


                                               Appendix 6

Charlottetown Laboratory                                        page 1 of 3
DNA Extraction Worksheet - For Kingfisher 96®
Date:                           Samples:                                       Performed by:
Pathogen : ______
Preparation of Extraction Buffer

Extraction Buffer 1X -Freeze Dried Pellet from Enrichment Broth (Example For 10 mls)
       50 mM Tis-HCl ph 8.0 = 1M Tris-HCl ph 8.0 X 0.5 ml
       25mM EDTA                   = 0.5M EDTA X         0.5     ml
       1% SDS                      = 10% SDS X X      1           ml
       10ug/ml Proteinase K = (10mg/ml) X    10      µl
       Distilled water Dnase/RNaseFree            To Total volume of 10ml

Extraction Buffer 3.5 X - Fresh or Frozen ( Pellet from Enrichment Broth )

 Total # of Samples
 Volume of buffer /      200 µl buffer /
 Pellet                  500 µl sample

Example given volume for one sample
 Component        Stock conc.          Lot #         Volume tube      Final conc.              Total vol .


 UNCONTROLLED
 Tris - HCL
 pH 8.0
                  1        M                         35µl             0.175         M


 EDTA             0.5      M                         35µl             0.0875        m
 SDS              10       %                         70µl             3.5           %
 Proteinase K     10       mg/ml                     0.7µl            0.035         mg/ml
 Dnase/RNase                                         59.3µl
 Free Water

Cell Lysis
Add 1000 ul 1X Extraction buffer to Freeze Dried Pellet
Add      500 ul Fresh or Frozen homogenate to 200 ul 3.5X Extraction buffer.

To avoid cross-contamination, dispense the extraction buffer first, then add the sample.
Vortex 5 sec.

Incubation - 3 hrs to overnight at 55 °C -60 °C
Temp:            Heat Block:: PD 051 or Oven: PD127           Date In :              Date Out:
Temperature out :
 Charlottetown Laboratory                        SOP-CL-DIA-DIA-074-01                                        Page 22 of 26

                                                 Appendix 6.0                                         page 2 of 3
                                           Charlottetown Laboratory
                                    DNA Extraction Worksheet - Kingfisher 96®

DNA Extraction :
Identify the location of each sam ple to be extracted on the plate m ap provided (see page 3).
Ensure that the Prom ega, M agne sil KF G enom ic System Kit reagen ts hav e been check ed for qu ality.
Using the above reagents, set up the KingFisher 96 ® Deep Well plates as below;

Plate 1 =      0.4 ml Lysis Buffer
               0.1 Magnetic Beads (Ensure beads are in solution before dispensing)
               0.4 ml of sample obtained above (after 3hr incubation, see pg 1)

Plate #2=      1.0ml of Salt Wash

Plate #3=      1.0ml of Alcoh ol W ash

Plate #4=      1.0 of A lcohol W ash

Plate #5=      0.06ml of Dnase/RNase Free Water

Plate #6=      Tip Plate (Load the tip plate on top of an empty 96 deep well plate, fig 6.5 in the KingFisher 96 ®
               M anu al, SO P C L-D IA-DIA -067 section 2 .4).

Power up the KingFisher 96® Asset ID C615935 and using the up/down arrow keys select the program
“M agnesil_gDNA”.

Press start, the machine will prompt you to load Plate 6 (Tip Plate). Place the A1 well of the plate so that it is in the
upper right corner. The first A1 row is consequently always in the inner circle. The machine will “Pause” until the


 UNCONTROLLED
plate is loaded. Press start again, the machine will rotate to the next position and again prompt you to load Plate 5
(W ater), con tinue with the same process until all the plates are loaded, press start a fina l time and th e machine w ill
begin th e extrac tion pro cess.

At the end of the run, press stop. Remove the samples and transfer them to a sterile Dnase/RNase free 96 well PCR
pate, seal the plate.
Discard the remaining reagent plates and the tip plate as biohazardous waste.
Shut off the power to the King Fisher 96®

Reag ent Lot #
Lysis Buffer                        Lot   #   _______________________
M agnetic Beads Buffer              Lot   #   _______________________
Salt Wash Buffer                    Lot   #   _______________________
Alcohol Wash B uffer                Lot   #   _______________________
Dnase/RNase Free W ater             Lot   #   _______________________
Charlottetown Laboratory             SOP-CL-DIA-DIA-074-01                            Page 23 of 26


                                  Appendix 6             (page 3 of 3)

                                                                   8         9   10    11     12

 A


 B


 C


 D


 E


 F


 G


 H




 UNCONTROLLED
Label and Store at -20°C     Location: ____________________



Reference SOP CL-DIA-DIA-067, 061, 068 and 074 - current version

M :\Plant\Programs\PCR worksheets\CFIA_ACIA #1578930-v-1 KingFisher_96.wpd
Charlottetown Laboratory            SOP-CL-DIA-DIA-074-01                                                                        Page 24 of 26


                                                             Appendix 7.0
                            QC Check for Commercially Prepared Buffers & Reagents

Using a positive, a negative and a water control, conduct a quality control check on the reagent/buffer by testing to ensure that
they comply with the criteria described in the results interpretation section of the pertinent SOP


          Reagent                   Supplier                  Lot #               Results Date                QC Check
                                                                                                        Ac cep table   Not A ccep table




 UNCONTROLLED

Reference SOP CL-DIA-DIA-061, 067, 068 and 074

M:\Plant\PROGRAMS\Projects\PCR\pam 080513\CFIA_ACIA-#766322-v1-QA_Check_for_Commercial_Reagents.WPD
Charlottetown Laboratory           SOP-CL-DIA-DIA-074-01                                                            Page 25 of 26


                                                             Appendix 8

                                                      Charlottetown Lab
                                  Ralstonia Taq Man qPCR Results (see SOP CL-DIA-DIA-074)

Run # RAL-                                       Controls:      Acceptable           Not Acceptable       (Circle One)

 Sample ID                              Cy5 Ct               FAM Ct          Melt Peak        Melt Peak             Verdict
                                                                              (R.sol)           (IC)




 UNCONTROLLED
R.sol Melt Range         Tuber - 82.49 - 83.51°C / Stem - 81.94 - 83.40°C          Internal Control Melt Range 89.01 - 90.03°C
                         Tomato - 82.23 - 83.47°C                                     Fam Ct <32.34
                         Other/Unknown - 81.94 - 83.51°C
Completed By: ______________________________________                  Date: _____________________________

Verified By: ________________________________________        Date: _____________________________
M:\Plant\PROGRAMS\PCR worksheets\Ralstonia\CFIA_ACIA-#1429386-v1-Ralstonia_Taqman_qPCR_verdict_sheet.WPD
Charlottetown Laboratory             SOP-CL-DIA-DIA-074-01                        Page 26 of 26

                                       Appendix 9
                                Charlottetown Laboratory
                                    Gel Results Sheet
Pathogen: _________________       Run #: ________________              Accept/Reject: ________
When E-Gels are used * does not apply


 * Agarose Lot #: D072108                Gel %:                  E-Gel Lot #
 * Ethidium Bromide Lot #: 1147021       * Running Buffer Lot #:
 Loading Dye Lot #: 08-01                Voltage:
 Time Start:                             Time End:
When E-Gels are used * does not apply
                                         Gel # Results       Gel # Results        Comment
 Well   Sample                          PCR                PCR
 1
 2
 3
 4
 5
 6

 UNCONTROLLED
 7
 8
 9
 10
 11
 12
 13
 14
 15
 16
 17
 18
 19
 20
Gel Completed By: _______________________________                Date: __________________
Gel Verified By:  _______________________________                Date: __________________
Refer to SOPs C L-DIA-DIA -051, 061 and 0 74 - Latest Versions      Date Implemented:
         Photo located at M:\Plant\PROG RAM S\Projects\PCR\pictures
M:\Plant\PROGRAMS\PCR worksheets\CFIA_ACIA-#768116-v1-Gel_Results_Form-20_well_comb.WPD
       STANDARD OPERATING PROCEDURE APPROVAL

       Confidential Property of:     Charlottetown Laboratory

       Section:                      Diagnostics

       SOP Number:                   CL-DIA-DIA-074-02

       Title:                        Procedure for the total extraction of DNA from potato stem and
                                     tuber tissues, geranium stems and tomato stems using the
                                     KingFisher mL® and KingFisher® 96 magnetic particle
                                     processors for the detection of Ralstonia solanacearum race 3
                                     biovar 2 using Real Time Taq Man PCR and the CEPHEID®
                                     unit

                                         APPROVAL COVER PAGE

       This cover page serves as final approval of a document. Retain it as the first page of the document.
       When a document revision has received the final approval, this cover page replaces any previous cover
       pages. It provides you with all current coding information.

                              NAME/FUNCTON                           SIGNATURE                        DATE
Originator               Jane Gourley
Modified by              Pamela Ross/Technician

        UNCONTROLLED
Group Leader
Reviewed by
Management System
                         Jane Gourley
                         Dr. Umadatt Singh

Coordinator


       Next Scheduled Review Date:                  ______    ____     ___
                                                    YYYY      MM       DD

								
To top