Docstoc

Start

Document Sample
Start Powered By Docstoc
					 Myrovlytis Trus
BHD Research Resource

Click start to go to research summary
ytis Trust
Resource   beta

            START
  Free Download




BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library
                      Tobino K, Gunji Y, Kurihara M, Kunogi M, Koike K, Tomiyama N, Johkoh T, Kodama Y, Iwakam
                      Takahashi K, Seyama K.
                      Eur J Radiol. 2009 Sep 24.


                      Sporadic Birt-Hogg-Dube syndrome
                      Vandenbossche G, Piérard-Franchimont C, Quatresooz P, Piérard GE.
                      Rev Med Liege. 2009 Jul-Aug;64(7-8):358-60. French.
                      Novel intronic germline FLCN gene mutation in a patient with multiple ipsilateral renal neop
                      Gatalica Z, Lilleberg SL, Vranic S, Eyzaguirre E, Orihuela E, Velagaleti G.
                      Hum Pathol. 2009 Sep 4.




BHD Article Library
BHD Article Library




BHD Article Library




BHD Article Library




BHD Article Library




                      A BHD germline mutation identified in an Asian family with Birt-Hogg-Dubé syndrome.
                      Misago N, Joh K, Yatsuki H, Soejima H, Narisawa Y.
                      Acta Derm Venereol. 2008;88(4):423-5.
                      Interaction of folliculin (Birt-Hogg-Dubé gene product) with a novel Fnip1-like (FnipL/Fnip2)
                      Takagi Y, Kobayashi T, Shiono M, Wang L, Piao X, Sun G, Zhang D, Abe M,
                      Hagiwara Y, Takahashi K, Hino O.
                      Oncogene. 2008 Sep 11;27(40):5339-47.




                      Birt-Hogg-Dubé (BHD) syndrome: report of two novel germline mutations in the folliculin (F
                      Palmirotta R, Donati P, Savonarola A, Cota C, Ferroni P, Guadagni F.
                      Eur J Dermatol. 2008 Jul-Aug;18(4):382-6




BHD Article Library


BHD Article Library




BHD Article Library




BHD Article Library


BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library




BHD Article Library
BHD Article Library


BHD Article Library




BHD Article Library




BHD Article Library


BHD Article Library


BHD Article Library
BHD Article Library




BHD Article Library




BHD Article Library




BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library




BHD Article Library
BHD Article Library




BHD Article Library
                                                    Study
Nueva mutación en el síndrome de Birt Hogg Dubé (New Mutation in the Birt Hogg Dube Gene)
Sempaua L, Ruiza I, González-Moránb A, Susannac X and Hansend T
Actas Dermo-Sifiliográficas doi:10.1016/j.ad.2010.03.007
Article in press
Recurrent spontaneous pneumothorax in a patient with Birt-Hogg-Dubé syndrome.
Predina JD, Kotloff RM, Miller WT, Singhal S.
Eur J Cardiothorac Surg. 2010 Aug 5.
Birt-Hogg-Dubé syndrome.
Rehfeld A, van Steensel MA, Friis-Hansen L.
Ugeskr Laeger. 2010 Juli 19;172(29):2085-2090


Constitutional FLCN mutations in patients with suspected Birt-Hogg-Dubé syndrome ascertained for non-cutaneous manifesta
Maffé A, Toschi B, Circo G, Giachino D, Giglio S, Rizzo A, Carloni A, Poletti V, Tomassetti S, Ginardi C, Ungari S, Genuardi M.
Clin Genet. 2010 Jun 7.

Birt-Hogg-Dubé syndrome and multiple recurrent tumors
Vinit J, Friedel J, Bielefeld P, Muller G, Goudet P, Besancenot JF.
Rev Med Interne. 2010 Jun 22
Article in French

Tumor suppressor FLCN inhibits tumorigenesis of a FLCN-null renal cancer cell line and regulates expression of key molecules
Seung-Beom Hong, HyoungBin Oh, Vladimir A Valera, Jaime Stull, Duy-Tan Ngo, Masaya Baba, Maria J Merino, W.Marston Lin
Laura S Schmidt
Molecular Cancer 2010, 9:160




Investigation of the Birt-Hogg-Dube tumour suppressor gene (FLCN) in familial and sporadic colorectal cancer.
Nahorski MS, Lim DH, Martin L, Gille JJ, McKay K, Rehal PK, Ploeger HM, van Steensel M, Tomlinson IP, Latif F, Menko FH, Ma
J Med Genet. 2010 Jun;47(6):385-90.
Advances in the Genetics of Familial Renal Cancer.
Morrison PJ, Donnelly DE, Atkinson AB, Maxwell AP.
Oncologist. 2010 May 19.

Oncological Outcomes of Partial Nephrectomy for Multifocal Renal Cell Carcinoma Greater Than 4 cm.
Gupta GN, Peterson J, Thakore KN, Pinto PA, Linehan WM, Bratslavsky G.
J Urol. 2010 May 15.
Clinical and genetic spectrum of Birt-Hogg-Dube syndrome patients in whom pneumothorax and/or multiple lung cysts are th
Kunogi M, Kurihara M, Ikegami TS, Kobayashi T, Shindo N, Kumasaka T, Gunji Y, Kikkawa M, Iwakami S, Hino O, Takahashi K, S
J Med Genet. 2010 Apr;47(4):281-7.
Renal cancer associated with recurrent spontaneous pneumothorax in Birt-Hogg-Dube syndrome: a case report and review o
Warwick G, Izatt L, Sawicka E. J Med Case Reports. 2010 Apr 19;4(1):106.


Association between birt hogg dube syndrome and cancer predisposition.
Palmirotta R, Savonarola A, Ludovici G, Donati P, Cavaliere F, DE Marchis ML, Ferroni P, Guadagni F.
Anticancer Res. 2010 Mar;30(3):751-7.
The Birt-Hogg-Dube syndrome: dermatological features and internal malignancies.
Stavrakoglou A, Dubrey SW, Dorkins H, Coutts I. QJM. 2010 Apr 14.




Sporadic hybrid oncocytic/chromophobe tumor of the kidney: a clinicopathologic, histomorphologic, immunohistochemical,
ultrastructural, and molecular cytogenetic study of 14 cases.
Petersson F, Gatalica Z, Grossmann P, Perez Montiel MD, Alvarado Cabrero I, Bulimbasic S, Swatek A, Straka L, Tichy T, Hora M
Kuroda N, Legendre B, Michal M, Hes O.
Virchows Arch. 2010 Mar 19.
Intra- and interfamilial phenotype variation in Birt-Hogg-Dubé syndrome: Consequences for therapy
(Article in French)
Steff M, Bourillon A, Frebourg T, Balderi X, Descamps V, Joly P, Piette F, Crestani B, Grandchamp B, Soufir N.
Ann Dermatol Venereol. 2010 Mar;137(3):203-207. Epub 2010 Jan 15.




Birt-Hogg-Dubé syndrome
(Article in Japanese)
Koga S, Furuya M, Nakatani Y.
Nippon Rinsho. 2010 Feb;68(2):361-9.

Birt-Hogg-Dubé syndrome: diagnosis and management.
Menko FH, van Steensel MA, Giraud S, Friis-Hansen L, Richard S, Ungari S, Nordenskjöld M, Hansen TV, Solly J, Maher ER;
on behalf of the European BHD Consortium.
Lancet Oncol. 2009 Dec;10(12):1199-1206.
Birt-Hogg-Dubè Syndrome, Report of Two Novel Mutations and a Rare Tumor of the Lung.
Tomassetti et al. Am. J. Respir. Crit. Care Med..2009; 179: A4396
Serine 62 is a phosphorylation site in folliculin, the Birt-Hogg-Dubé gene product.
Wang L, Kobayashi T, Piao X, Shiono M, Takagi Y, Mineki R, Taka H, Zhang D, Abe M, Sun G, Hagiwara Y, Okimoto K,
Matsumoto I, Kouchi M, Hino O.
FEBS Lett. 2009 Nov 12.

[Spontaneous pneumothorax as the first manifestation of a hereditary condition with an increased renal cancer risk.]
Johannesma PC, Lammers JW, van Moorselaar JA, Starink TM, Postmus PE, Menko FH.
Ned Tijdschr Geneeskd. 2009;153(35). pii: A581. Dutch.


Homozygous loss of BHD causes early embryonic lethality and kidney tumor development with activation of mTORC1 and mT
Hasumi Y, Baba M, Ajima R, Hasumi H, Valera VA, Klein ME, Haines DC, Merino MJ, Hong SB, Yamaguchi TP, Schmidt LS,
Marston Linehan W.
Proc Natl Acad Sci U S A. 2009 Oct 22.




Renal tumor suppressor function of the Birt-Hogg-Dube syndrome gene product folliculin.
Hudon V, Sabourin S, Dydensborg AB, Kottis V, Ghazi A, Paquet M, Crosby K, Pomerleau V, Uetani N, Pause A.
J Med Genet. 2009 Oct 19.




Fibrofolliculoma with ancient/pseudosarcomatous features.
Cesinaro AM, Rusev BC, Kutzner H.
J Cutan Pathol. 2009 Oct 15.

Dermoscopic Features of Birt-Hogg-Dube Syndrome
Jarrett R, Walker L, Side L, Bowling J
Archives of Dermatology. 2009 Oct 9; 145 (10): 1208
Establishment and Characterization of Renal Carcinoma Cell Lines from a Bhd Gene Mutant (Nihon) Rat.
Matsumoto I, Kouchi M, Okimoto K, Kijima K, Ueda T, Hirayama Y, Inoue T, Seki T, Hino O.
Tumour Biol. 2009 Oct 7;30(5):249-256.

A new locus-specific database (LSDB) for mutations in the folliculin (FLCN) gene.
Lim DH, Rehal PK, Nahorski MS, Macdonald F, Claessens T, Van Geel M, Gijezen L, Gille JJ, Giraud S, Richard S, van Steensel M
Menko FH, Maher ER.
Hum Mutat. 2009 Oct 2.

Lung cysts in Birt-Hogg-Dubé syndrome: histopathological characteristics and aberrant sequence repeats.
Koga S, Furuya M, Takahashi Y, Tanaka R, Yamaguchi A, Yasufuku K, Hiroshima K, Kurihara M, Yoshino I, Aoki I, Nakatani Y.
Pathol Int. 2009 Oct;59(10):720-8.


Birt-Hogg-Dubé Syndrome: clinical and genetic studies of 10 French families.
Kluger N, Giraud S, Coupier I, Avril MF, Dereure O, Guillot B, Richard S, Bessis D.
Br J Dermatol. 2009 Sep 26.




Characteristics of pulmonary cysts in Birt-Hogg-Dubé syndrome: Thin-section CT findings of the chest in 12 patients.
Tobino K, Gunji Y, Kurihara M, Kunogi M, Koike K, Tomiyama N, Johkoh T, Kodama Y, Iwakami SI, Kikkawa M,
Takahashi K, Seyama K.
Eur J Radiol. 2009 Sep 24.


Sporadic Birt-Hogg-Dube syndrome
Vandenbossche G, Piérard-Franchimont C, Quatresooz P, Piérard GE.
Rev Med Liege. 2009 Jul-Aug;64(7-8):358-60. French.
Novel intronic germline FLCN gene mutation in a patient with multiple ipsilateral renal neoplasms.
Gatalica Z, Lilleberg SL, Vranic S, Eyzaguirre E, Orihuela E, Velagaleti G.
Hum Pathol. 2009 Sep 4.




Regulation of folliculin (the BHD gene product) phosphorylation by Tsc2-mTOR pathway.
Piao X, Kobayashi T, Wang L, Shiono M, Takagi Y, Sun G, Abe M, Hagiwara Y, Zhang D, Okimoto K, Kouchi M,
Matsumoto I, Hino O.
Biochem Biophys Res Commun. 2009 Aug 17.




Hereditary and familial kidney cancer.
Coleman JA, Russo P.
Curr Opin Urol. 2009 Sep;19(5):478-85.
A Japanese family with multiple lung cysts and recurrent pneumothorax: a possibility of Birt-Hogg-Dubé syndrome.
Ishii H, Oka H, Amemiya Y, Iwata A, Otani S, Kishi K, Shirai R, Tokimatsu I, Kawahara K, Kadota J.
Intern Med. 2009;48(16):1413-7.
Fibrofolliculoma/trichodiscoma and fibrous papule (perifollicular fibroma/angiofibroma): a revaluation of the
histopathological and immunohistochemical features.
Misago N, Kimura T, Narisawa Y
 J Cutan Pathol. 2009 Sep;36(9):943-51.
Spontaneous pneumothorax due to Birt-Hogg-Dube syndrome in a Chinese family.
So SY.
Respirology. 2009 Jul;14(5):775-6.
The folliculin mutation database: An online database of mutations associated with Birt-Hogg-Dubé syndrome.
Wei MH, Blake PW, Shevchenko J, Toro JR.
Hum Mutat. 2009 Jun 26




Familial spontaneous pneumothorax and lung cysts due to a Folliculin exon 10 mutation.
Sundaram S, Tasker AD, Morrell NW.
Eur Respir J. 2009 Jun;33(6):1510-1512.




The role of the Birt-Hogg-Dubé protein in mTOR activation and renal tumorigenesis.
Hartman TR, Nicolas E, Klein-Szanto A, Al-Saleem T, Cash TP, Simon MC, Henske EP.
Oncogene. 2009 Apr 2;28(13):1594-604.


Recurrent spontaneous pneumothorax as the presenting sign of the Birt-Hogg-Dubé syndrome.
Diamond JM, Kotloff RM.
Ann Intern Med. 2009 Feb 17;150(4):289-90.
Fibrofolliculoma in a patient with tuberous sclerosis complex.
Misago N, Narisawa Y.
Clin Exp Dermatol. 2009 Jan 12.
Deficiency of FLCN in mouse kidney led to development of polycystic kidneys and renal neoplasia.
Chen J, Futami K, Petillo D, Peng J, Wang P, Knol J, Li Y, Khoo SK, Huang D, Qian CN, Zhao P,
Dykyma K, Zhang R, Cao B, Yang XJ, Furge K, Williams BO, Teh BT.
PLoS ONE. 2008;3(10)




Familial non-VHL clear cell (conventional) renal cell carcinoma: clinical features, segregation analysis, and mutation analysis o
Woodward ER, Ricketts C, Killick P, Gad S, Morris MR, Kavalier F, Hodgson SV, Giraud S,
Bressac-de Paillerets B, Chapman C, Escudier B, Latif F, Richard S, Maher ER.
Clin Cancer Res. 2008 Sep 15;14(18):5925-30.




A BHD germline mutation identified in an Asian family with Birt-Hogg-Dubé syndrome.
Misago N, Joh K, Yatsuki H, Soejima H, Narisawa Y.
Acta Derm Venereol. 2008;88(4):423-5.
Interaction of folliculin (Birt-Hogg-Dubé gene product) with a novel Fnip1-like (FnipL/Fnip2) protein.
Takagi Y, Kobayashi T, Shiono M, Wang L, Piao X, Sun G, Zhang D, Abe M,
Hagiwara Y, Takahashi K, Hino O.
Oncogene. 2008 Sep 11;27(40):5339-47.




Birt-Hogg-Dubé (BHD) syndrome: report of two novel germline mutations in the folliculin (FLCN) gene.
Palmirotta R, Donati P, Savonarola A, Cota C, Ferroni P, Guadagni F.
Eur J Dermatol. 2008 Jul-Aug;18(4):382-6
No access to text




A case of Birt-Hogg-Dubé syndrome.
Kim EH, Jeong SY, Kim HJ, Kim YC.
J Korean Med Sci. 2008 Apr;23(2):332-5.
Identification and characterization of a novel folliculin-interacting protein FNIP2.
Hasumi H, Baba M, Hong SB, Hasumi Y, Huang Y, Yao M, Valera VA, Linehan WM, Schmidt LS.
Gene. 2008 May 31;415(1-2):60-7.




The dermatologist's guide to hereditary syndromes with renal tumors.
Ferzli PG, Millett CR, Newman MD, Heymann WR.
Cutis. 2008 Jan;81(1):41-8.


Folliculin mutations are not associated with severe COPD
Michael H Cho, Barbara J Klanderman, Augusto A Litonjua, David Sparrow, Edwin K Silverman, and Benjamin A Raby
BMC Med Genet. 2008; 9: 120. Published online 2008 December 30.




An unusual case of Birt-Hogg-Dube syndrome with renal involvement.
Janitzky A, Reiher F, Porsch M, Grube C, Evert M, Liehr UB.
Urol J. 2008 Fall;5(4):272-4.
BHD mutations, clinical and molecular genetic investigations of Birt-Hogg-Dubé syndrome: a new series of 50 families
and a review of published reports.
Toro JR, Wei MH, Glenn GM, Weinreich M, Toure O, Vocke C, Turner M, Choyke P, Merino MJ, Pinto PA, Steinberg SM,
Schmidt LS, Linehan WM.
J Med Genet. 2008 Jun;45(6):321-31.


The UOK 257 cell line: a novel model for studies of the human Birt-Hogg-Dubé gene pathway.
Yang Y, Padilla-Nash HM, Vira MA, Abu-Asab MS, Val D, Worrell R, Tsokos M, Merino MJ, Pavlovich CP,
Ried T, Linehan WM, Vocke CD.
Cancer Genet Cytogenet. 2008 Jan 15;180(2):100-9.


Kidney-targeted Birt-Hogg-Dube gene inactivation in a mouse model: Erk1/2 and Akt-mTOR activation,
cell hyperproliferation, and polycystic kidneys.
Baba M, Furihata M, Hong SB, Tessarollo L, Haines DC, Southon E, Patel V, Igarashi P, Alvord WG,
Leighty R, Yao M, Bernardo M, Ileva L, Choyke P, Warren MB, Zbar B, Linehan
JNCI. 2008 100(2):140-154




Novel mutations in the folliculin gene associated with spontaneous pneumothorax.
Fröhlich BA, Zeitz C, Mátyás G, Alkadhi H, Tuor C, Berger W, Russi EW.
Eur Respir J. 2008 Nov;32(5):1316-20.
Postoperative fibromatosis-type fibromas in the Bhd gene mutant (Nihon) rat.
Kouchi M, Okimoto K, Matsumoto I, Michimae Y, Yamada T, Inoue T, Kimura T, Seki T, Yasuba M, Hino O.
Exp Toxicol Pathol. 2008 Mar;59(5):273-9.




Letter: hyfrecation and curettage as a treatment for fibrofolliculomas in Birt-Hogg-Dube syndrome.
Farrant PB, Emerson R.
Dermatol Surg. 2007 Oct;33(10):1287-8.
Solitary Nasal Fibrofolliculoma
Zenggang Pan and Deba P. Sarm a
The Internet Journal of Dermatology 2007 : Volume 5 Number 2
Mutations in BHD and TP53 genes, but not in HNF1β gene, in a large series of sporadic chromophobe renal cell carcinoma
S Gad, S H Lefèvre, S K Khoo, S Giraud, A Vieillefond, V Vasiliu, S Ferlicot, V Molinié, Y Denoux, N Thiounn, Y Chrétien, A Méjea
M Zerbib, G Benoît, J M Hervé, G Allègre, B Bressac-de Paillerets, B T Teh, and S Richard
Br J Cancer. 2007 January 29; 96(2): 336–340.

Birt-Hogg-Dubé syndrome: clinical and genetic studies of 20 families.
Leter EM, Koopmans AK, Gille JJ, van Os TA, Vittoz GG, David EF, Jaspars EH, Postmus PE, van Moorselaar RJ,
Craanen ME, Starink TM, Menko FH.
J Invest Dermatol. 2008 Jan;128(1):45-9.
The Birt-Hogg-Dube and tuberous sclerosis complex homologs have opposing roles in amino acid homeostasis in
Schizosaccharomyces pombe.
van Slegtenhorst M, Khabibullin D, Hartman TR, Nicolas E, Kruger WD, Henske EP.
J Biol Chem. 2007 Aug 24;282(34):24583-90. Epub 2007 Jun 7.




Cystic lung disease in Birt-Hogg-Dube syndrome.
Ayo DS, Aughenbaugh GL, Yi ES, Hand JL, Ryu JH.
Chest. 2007 Aug;132(2):679-84.
Mutations of the Birt Hogg Dube gene in patients with multiple lung cysts and recurrent pneumothorax.
Gunji Y, Akiyoshi T, Sato T, Kurihara M, Tominaga S, Takahashi K, Seyama K.
J Med Genet. 2007 Sep;44(9):588-93.
[Birt-Hogg-Dube syndrome: a genodermatosis with cutaneous expression]
Billet A, Chaby G, Clais B, Werbrouck A, Fraitag S, Troche P, Denoeux JP, Lok C.
Ann Dermatol Venereol. 2007 Jan;134(1):103-4. French.
Identification and characterization of Birt-Hogg-Dubé associated renal carcinoma.
Murakami T, Sano F, Huang Y, Komiya A, Baba M, Osada Y, Nagashima Y,
Kondo K, Nakaigawa N, Miura T, Kubota Y, Yao M, Kishida T.
J Pathol. 2007 Apr;211(5):524-31.
Lung cysts, spontaneous pneumothorax, and genetic associations in 89 families with Birt-Hogg-Dubé syndrome.
Toro JR, Pautler SE, Stewart L, Glenn GM, Weinreich M, Toure O, Wei MH, Schmidt LS, Davis L, Zbar B, Choyke P,
Steinberg SM, Nguyen DM, Linehan WM.
Am J Respir Crit Care Med. 2007 May 15;175(10):1044-53.
Multiple/bilateral renal tumors in patients with Birt-Hogg-Dubé syndrome.
Fahmy W, Safwat AS, Bissada NK, Curry N, Guirguis N, Clarke HS, Fraig M, Finkbeiner A.
Int Urol Nephrol. 2007;39(4):995-9.


Radiological findings in Birt-Hogg-Dubé syndrome: a rare differential for pulmonary cysts and renal tumors.
Gupta P, Eshaghi N, Kamba TT, Ghole V, Garcia-Morales F.
Clin Imaging. 2007 Jan-Feb;31(1):40-3.
Role of carbonic anhydrases in the progression of renal cell carcinoma subtypes: proposal of a unified hypothesis.
Dorai T, Sawczuk I, Pastorek J, Wiernik PH, Dutcher JP.
Cancer Invest. 2006 Dec;24(8):754-79. Review.




Birt-Hogg-Dubé syndrome: clinicopathologic findings and genetic alterations.
Adley BP, Smith ND, Nayar R, Yang XJ.
Arch Pathol Lab Med. 2006 Dec;130(12):1865-70.
Novel mutations in the BHD gene and absence of loss of heterozygosity in fibrofolliculomas of Birt-Hogg-Dubé patients.
van Steensel MA, Verstraeten VL, Frank J, Kelleners-Smeets NW, Poblete-Gutiérrez P, Marcus-Soekarman D,
Bladergroen RS, Steijlen PM, van Geel M.
J Invest Dermatol. 2007 Mar;127(3):588-93.
Molecular classification of patients with unexplained hamartomatous and hyperplastic polyposis.
Sweet K, Willis J, Zhou XP, Gallione C, Sawada T, Alhopuro P, Khoo SK, Patocs A, Martin C, Bridgeman S, Heinz J,
Pilarski R, Lehtonen R, Prior TW, Frebourg T, Teh BT, Marchuk DA, Aaltonen LA, Eng C.
JAMA. 2005 Nov 16;294(19):2465-73.
Genetic basis of cancer of the kidney.
Sudarshan S, Linehan WM.
Semin Oncol. 2006 Oct;33(5):544-51.

A novel familial germline mutation in the initiator codon of the BHD gene in a patient with Birt-Hogg-Dubé syndrome.
Bessis D, Giraud S, Richard S.
Br J Dermatol. 2006 Nov;155(5):1067-9.


Folliculin encoded by the BHD gene interacts with a binding protein, FNIP1, and AMPK, and is involved in
AMPK and mTOR signaling.
Baba M, Hong SB, Sharma N, Warren MB, Nickerson ML, Iwamatsu A, Esposito D, Gillette WK, Hopkins RF 3rd,
Hartley JL, Furihata M, Oishi S, Zhen W, Burke TR Jr, Linehan WM, Schmidt LS, Zbar B.
Proc Natl Acad Sci U S A. 2006 Oct 17;103(42):15552-7.




Cytologic and histologic findings in multiple renal hybrid oncocytic tumors in a patient with Birt-Hogg-Dubé
syndrome: a case report.
Adley BP, Schafernak KT, Yeldandi AV, Yang XJ, Nayar R.
Acta Cytol. 2006 Sep-Oct;50(5):584-8.
Diagnosis of Birt-Hogg-Dube syndrome in a patient with spontaneous pneumothorax.
Pittet O, Christodoulou M, Staneczek O, Ris HB.
Ann Thorac Surg. 2006 Sep;82(3):1123-5.
Cancer-associated genodermatoses: a personal history.
Burgdorf WH.
Exp Dermatol. 2006 Sep;15(9):653-66. Review.
Birt-Hogg-Dubé (BHD) gene mutations in human gastric cancer with high frequency microsatellite instability.
Jiang W, Fujii H, Matsumoto T, Ohtsuji N, Tsurumaru M, Hino O.
Cancer Lett. 2007 Apr 8;248(1):103-11.

Familial spontaneous pneumothorax.
Chiu HT, Garcia CK.
Curr Opin Pulm Med. 2006 Jul;12(4):268-72. Review.

Birt-Hogg-Dubé gene mutations in human endometrial carcinomas with microsatellite instability.
Fujii H, Jiang W, Matsumoto T, Miyai K, Sashara K, Ohtsuji N, Hino O.
J Pathol. 2006 Jul;209(3):328-35.
A 40-year-old woman with facial papules and flank pain. Birt-Hogg-Dubé syndrome.
Vinson-Spencer DJ, Christiansen LR.
Arch Pathol Lab Med. 2006 May;130(5):e66-9.
The Drosophila homolog of the human tumor suppressor gene BHD interacts with the JAK-STAT and Dpp
signaling pathways in regulating male germline stem cell maintenance.
Singh SR, Zhen W, Zheng Z, Wang H, Oh SW, Liu W, Zbar B, Schmidt LS, Hou SX.
Oncogene. 2006 Sep 28;25(44):5933-41.

Pleuropulmonary pathology of Birt-Hogg-Dubé syndrome.
Butnor KJ, Guinee DG Jr.
Am J Surg Pathol. 2006 Mar;30(3):395-9


Transgenic rescue from embryonic lethality and renal carcinogenesis in the Nihon rat model by introduction of a wild-type Bh
Togashi Y, Kobayashi T, Momose S, Ueda M, Okimoto K, Hino O.
Oncogene. 2006 May 11;25(20):2885-9.

Birt-Hogg-Dubé syndrome: a rare cause of pulmonary cysts.
Souza CA, Finley R, Müller NL.
AJR Am J Roentgenol. 2005 Nov;185(5):1237-9.
Birt-Hogg-Dubé Syndrome.
Welsch MJ, Krunic A, Medenica MM.
Int J Dermatol. 2005 Aug;44(8):668-73.
Multiple facial angiofibromas: a cutaneous manifestation of Birt-Hogg-Dubé syndrome.
Schaffer JV, Gohara MA, McNiff JM, Aasi SZ, Dvoretzky I.
J Am Acad Dermatol. 2005 Aug;53(2 Suppl 1):S108-11.
High frequency of somatic frameshift BHD gene mutations in Birt-Hogg-Dubé-associated renal tumors.
Vocke CD, Yang Y, Pavlovich CP, Schmidt LS, Nickerson ML, Torres-Cabala CA, Merino MJ, Walther MM,
Zbar B, Linehan WM.
J Natl Cancer Inst. 2005 Jun 15;97(12):931-5.

Birt-Hogg-Dubé syndrome: germline mutation in the (C)8 mononucleotide tract of the BHD gene in a German patient.
Lamberti C, Schweiger N, Hartschuh W, Schulz T, Becker-Wegerich P, Küster W, Rütten A, Sauerbruch T,
Ruzicka T, Kruse R.
Acta Derm Venereol. 2005;85(2):172-3
Germline BHD-mutation spectrum and phenotype analysis of a large cohort of families with Birt-Hogg-Dubé syndrome.
Schmidt LS, Nickerson ML, Warren MB, Glenn GM, Toro JR, Merino MJ, Turner ML, Choyke PL, Sharma N,
Peterson J, Morrison P, Maher ER, Walther MM, Zbar B, Linehan WM.
Am J Hum Genet. 2005 Jun;76(6):1023-33.
Renal oncocytosis.
Nagashima Y, Mitsuya T, Shioi KI, Noguchi S, Kishida T, Hamano A, Ohgo Y, Tsuura Y, Ogawa T, Aoki I, Yao M.
Pathol Int. 2005 Apr;55(4):210-5.
Evaluation and management of renal tumors in the Birt-Hogg-Dubé syndrome.
Pavlovich CP, Grubb RL 3rd, Hurley K, Glenn GM, Toro J, Schmidt LS, Torres-Cabala C,
Merino MJ, Zbar B, Choyke P, Walther MM, Linehan WM.
J Urol. 2005 May;173(5):1482-6.
Nonsense mutations in folliculin presenting as isolated familial spontaneous pneumothorax in adults.
Graham RB, Nolasco M, Peterlin B, Garcia CK.
Am J Respir Crit Care Med. 2005 Jul 1;172(1):39-44. Epub 2005 Apr 1
Birt-Hogg-Dube syndrome.
Gruson LM.
Dermatol Online J. 2004 Nov 30;10(3):15.
[Mutations of tumor suppressor genes coding for folliculin in Birt Hogg Dube syndrome]
Dereure O.
Ann Dermatol Venereol. 2005 Jan;132(1):94. French.
A 4-bp deletion in the Birt-Hogg-Dubé gene (FLCN) causes dominantly inherited spontaneous pneumothorax.
Painter JN, Tapanainen H, Somer M, Tukiainen P, Aittomäki K.
Am J Hum Genet. 2005 Mar;76(3):522-7.
Detection of 1733insC mutations in an Asian family with Birt-Hogg-Dubé syndrome.
Kawasaki H, Sawamura D, Nakazawa H, Hattori N, Goto M, Sato-Matsumura KC, Akiyama M, Shimizu H.
Br J Dermatol. 2005 Jan;152(1):142-5.
Natural history of the Nihon (Bhd gene mutant) rat, a novel model for human Birt-Hogg-Dubé syndrome.
Kouchi M, Okimoto K, Matsumoto I, Tanaka K, Yasuba M, Hino O.
Virchows Arch. 2006 Apr;448(4):463-71.
Birt-Hogg-Dubé syndrome, a genodermatosis that increases risk for renal carcinoma.
Schmidt LS.
Curr Mol Med. 2004 Dec;4(8):877-85.

The Eker rat: establishing a genetic paradigm linking renal cell carcinoma and uterine leiomyoma.
Cook JD, Walker CL.
Curr Mol Med. 2004 Dec;4(8):813-24.




[Birt-Hogg-Dube syndrome associated with intestinal polyposis.]
Monteagudo Sánchez B, Alvarez Alvarez C, León Muiños E, Ginarte Val M, Labandeira García J.
Gastroenterol Hepatol. 2004 Dec;27(10):636. Spanish.
[Birt-Hogg-Dubé syndrome and kidney neoplasia]
Bonté I, Levy R, Wechsler J, Laroche L.
Ann Dermatol Venereol. 2004 Apr;131(4):418-9. French.
Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Warren MB, Torres-Cabala CA, Turner ML, Merino MJ, Matrosova VY, Nickerson ML, Ma W, Linehan WM, Zbar B, Schmidt LS.
Mod Pathol. 2004 Aug;17(8):998-1011.
A germ-line insertion in the Birt-Hogg-Dubé (BHD) gene gives rise to the Nihon rat model of inherited renal cancer.
Okimoto K, Sakurai J, Kobayashi T, Mitani H, Hirayama Y, Nickerson ML, Warren MB, Zbar B, Schmidt LS, Hino O.
Proc Natl Acad Sci U S A. 2004 Feb 17;101(7):2023-7.
Genetic basis of cancer of the kidney: disease-specific approaches to therapy.
Linehan WM, Vasselli J, Srinivasan R, Walther MM, Merino M, Choyke P, Vocke C, Schmidt L, Isaacs JS, Glenn G, Toro J,
 Zbar B, Bottaro D, Neckers L.
Clin Cancer Res. 2004 Sep 15;10(18 Pt 2):6282S-9S.
Analysis of the Birt-Hogg-Dubé (BHD) tumour suppressor gene in sporadic renal cell carcinoma and colorectal cancer.
da Silva NF, Gentle D, Hesson LB, Morton DG, Latif F, Maher ER.
J Med Genet. 2003 Nov;40(11):820-4.




A mutation in the canine BHD gene is associated with hereditary multifocal renal cystadenocarcinoma and nodular
dermatofibrosis in the German Shepherd dog.
Lingaas F, Comstock KE, Kirkness EF, Sørensen A, Aarskaug T, Hitte C, Nickerson ML, Moe L, Schmidt LS,
Thomas R, Breen M, Galibert F, Zbar B, Ostrander EA.
Hum Mol Genet. 2003 Dec 1;12(23):3043-53.




Birt-Hogg-Dubé syndrome: two patients with neural tissue tumors.
Vincent A, Farley M, Chan E, James WD.
J Am Acad Dermatol. 2003 Oct;49(4):717-9.
Birt-Hogg-Dubé syndrome: a review of the literature and the differential diagnosis of firm facial papules.
Vincent A, Farley M, Chan E, James WD.
J Am Acad Dermatol. 2003 Oct;49(4):698-705. Review.
Numerous asymptomatic facial papules and multiple pulmonary cysts: a case of Birt-Hogg-Dubé syndrome.
Kupres KA, Krivda SJ, Turiansky GW.
Cutis. 2003 Aug;72(2):127-31.
Inactivation of BHD in sporadic renal tumors.
Khoo SK, Kahnoski K, Sugimura J, Petillo D, Chen J, Shockley K, Ludlow J, Knapp R, Giraud S, Richard S, Nordenskjöld M, Teh BT
Cancer Res. 2003 Aug 1;63(15):4583-7.




Alterations of the Birt-Hogg-Dubé gene (BHD) in sporadic colorectal tumours
K Kahnoski, S Khoo, N Nassif, J Chen, G Lobo, E Segelov, and B Teh
J Med Genet. 2003 July; 40(7): 511–515.




Re: Chromophobe renal cell carcinoma in a patient with the Birt-Hogg-Dube syndrome.
Walther MM, Grubb RL.
J Urol. 2003 Jun;169(6):2303-4.
Birt-Hogg-Dubé syndrome.
Musse L.
Dermatol Nurs. 2003 Apr;15(2):178.
Mutations of the Birt-Hogg-Dubé (BHD) gene in sporadic colorectal carcinomas and colorectal
carcinoma cell lines with microsatellite instability.
Shin JH, Shin YK, Ku JL, Jeong SY, Hong SH, Park SY, Kim WH, Park JG.
J Med Genet. 2003 May;40(5):364-7


Birt-Hogg-Dubé syndrome.
Godbolt AM, Robertson IM, Weedon D.
Australas J Dermatol. 2003 Feb;44(1):52-6.
Clinical and genetic studies of Birt-Hogg-Dubé syndrome.
Khoo SK, Giraud S, Kahnoski K, Chen J, Motorna O, Nickolov R, Binet O, Lambert D, Friedel J, Lévy R, Ferlicot S,
Wolkenstein P, Hammel P, Bergerheim U, Hedblad MA, Bradley M, Teh BT, Nordenskjöld M, Richard S.
J Med Genet. 2002 Dec;39(12):906-12. Erratum in: J Med Genet. 2003 Feb;40(2):150.

Renal tumors in the Birt-Hogg-Dubé syndrome.
Pavlovich CP, Walther MM, Eyler RA, Hewitt SM, Zbar B, Linehan WM, Merino MJ.
Am J Surg Pathol. 2002 Dec;26(12):1542-52.




Birt-Hogg-Dubé syndrome and multinodular goitre.
Drummond C, Grigoris I, Dutta B.
Australas J Dermatol. 2002 Nov;43(4):301-4.
Histomorphologic and immunophenotypic analysis of fibrofolliculomas and trichodiscomas in Birt-Hogg-Dube syndrome and
Collins GL, Somach S, Morgan MB.
J Cutan Pathol. 2002 Oct;29(9):529-33.
Chromophobe renal cell carcinoma in a patient with the Birt-Hogg-Dube syndrome.
Durrani OH, Ng L, Bihrle W 3rd.
J Urol. 2002 Oct;168(4 Pt 1):1484-5.
Mutations in a novel gene lead to kidney tumors, lung wall defects, and benign tumors of the hair follicle
in patients with the Birt-Hogg-Dubé syndrome.
Nickerson ML, Warren MB, Toro JR, Matrosova V, Glenn G, Turner ML, Duray P, Merino M, Choyke P,
Pavlovich CP, Sharma N, Walther M, Munroe D, Hill R, Maher E, Greenberg C, Lerman MI, Linehan WM, Zbar B,
Schmidt LS.
Cancer Cell. 2002 Aug;2(2):157-64.




Risk of renal and colonic neoplasms and spontaneous pneumothorax in the Birt-Hogg-Dubé syndrome.
Zbar B, Alvord WG, Glenn G, Turner M, Pavlovich CP, Schmidt L, Walther M, Choyke P, Weirich G, Hewitt SM,
Duray P, Gabril F, Greenberg C, Merino MJ, Toro J, Linehan WM.
Cancer Epidemiol Biomarkers Prev. 2002 Apr;11(4):393-400.




Exclusion of PTEN, CTNNB1, and PTCH as candidate genes for Birt-Hogg-Dube syndrome
J Toro, Y Shevchenko, J Compton, and S Bale
J Med Genet. 2002 February; 39(2): e10.

[Renal cell carcinoma in the Birt-Hogg-Dubé syndrome: report of a case]
Takahashi A, Hayashi T, Yoshida O, Uede K, Furukawa F, Shuin T.
Hinyokika Kiyo. 2001 Oct;47(10):719-21. Japanese.
[Hornstein-Knickenberg and Birt-Hogg-Dube syndrome. Report of a case with spontaneous pneumothorax and aplasia of the
Frantzen B, Rose C, Schulz T, Bröcker EB, Hamm H.
Hautarzt. 2001 Nov;52(11):1016-20. German.

Birt-Hogg-Dube syndrome: an autosomal dominant disorder with predisposition to cancers of the kidney, fibrofolliculomas, a
Lindor NM, Hand J, Burch PA, Gibson LE.
Int J Dermatol. 2001 Oct;40(10):653-6.
Birt-Hogg-Dubé syndrome, a genodermatosis associated with spontaneous pneumothorax and kidney
 neoplasia, maps to chromosome 17p11.2.
Schmidt LS, Warren MB, Nickerson ML, Weirich G, Matrosova V, Toro JR, Turner ML, Duray P, Merino M,
Hewitt S, Pavlovich CP, Glenn G, Greenberg CR, Linehan WM, Zbar B.
Am J Hum Genet. 2001 Oct;69(4):876-82.




Birt-Hogg-Dubé syndrome: mapping of a novel hereditary neoplasia gene to chromosome 17p12-q11.2.
Khoo SK, Bradley M, Wong FK, Hedblad MA, Nordenskjöld M, Teh BT.
Oncogene. 2001 Aug 23;20(37):5239-42.




The genetic basis of renal epithelial tumors: advances in research and its impact on prognosis and therapy.
Phillips JL, Pavlovich CP, Walther M, Ried T, Linehan WM.
Curr Opin Urol. 2001 Sep;11(5):463-9. Review




Localized Birt-Hogg-Dubé syndrome with prominent perivascular fibromas.
Schulz T, Ebschner U, Hartschuh W.
Am J Dermatopathol. 2001 Apr;23(2):149-53.
[Multiple mantleomas in Birt-Hogg-Dubé syndrome: successful therapy with CO2 laser]
Kahle B, Hellwig S, Schulz T.
Hautarzt. 2001 Jan;52(1):43-6. German.
Birt-Hogg-Dube syndrome: treatment of cutaneous manifestations with laser skin resurfacing.
Jacob CI, Dover JS.
Arch Dermatol. 2001 Jan;137(1):98-9.
Parotid oncocytoma in the Birt-Hogg-Dubé syndrome.
Liu V, Kwan T, Page EH.
J Am Acad Dermatol. 2000 Dec;43(6):1120-2.
Treatment of Birt-Hogg-Dubé syndrome with erbium:YAG laser.
Gambichler T, Wolter M, Altmeyer P, Hoffman K.
J Am Acad Dermatol. 2000 Nov;43(5 Pt 1):856-8.
Guess what! Diagnosis and comments: Birt-Hogg-Dubé syndrome.
Aoki M, Kawana S.
Eur J Dermatol. 2000 Jul-Aug;10(5):407-9
Characteristics of the Birt-Hogg-Dubé/Hornstein-Knickenberg syndrome.
Schulz T, Hartschuh W.
Am J Dermatopathol. 2000 Jun;22(3):293-4.
Birt-Hogg-Dubé syndrome: a novel marker of kidney neoplasia.
Toro JR, Glenn G, Duray P, Darling T, Weirich G, Zbar B, Linehan M, Turner ML.
Arch Dermatol. 1999 Oct;135(10):1195-202.
Acrochordons are not a component of the Birt-Hogg-Dubé syndrome: does this syndrome exist? Case reports and review of t
De la Torre C, Ocampo C, Doval IG, Losada A, Cruces MJ.
Am J Dermatopathol. 1999 Aug;21(4):369-74. Review.
Birt-Hogg-Dubé syndrome and Hornstein-Knickenberg syndrome are the same. Different sectioning technique as the cause of
Schulz T, Hartschuh W.
J Cutan Pathol. 1999 Jan;26(1):55-61.
[Multiple trichodiscomas associated with colonic polyposis]
Le Guyadec T, Dufau JP, Poulain JF, Vaylet F, Grossin M, Lanternier G.
Ann Dermatol Venereol. 1998 Oct;125(10):717-9. French.
Hereditary multiple fibrofolliculomas, trichodiscomas and acrochordons: syndrome of Birt-Hogg-Dubè.
Scalvenzi M, Argenziano G, Sammarco E, Delfino M.
J Eur Acad Dermatol Venereol. 1998 Jul;11(1):45-7.


Asymptomatic facial papules and acrochordons of the thighs. Birt-Hogg-Dube syndrome.
Zabawski E, Styles A, Goetz D, Cockerell C.
Dermatol Online J. 1997 Dec;3(2):6.
Multiple, hereditary dome-shaped papules and acrochordons. Birt-Hogg-Dubé syndrome.
Haimowitz JE, Halpern AC, Heymann WR.
Arch Dermatol. 1997 Sep;133(9):1163, 1166. Review.
Flecked chorioretinopathy associated with Birt-Hogg-Dubé syndrome.
Walter P, Kirchhof B, Korge B, Heimann K.
Graefes Arch Clin Exp Ophthalmol. 1997 Jun;235(6):359-61.


Birt-Hogg-Dubé syndrome: a review and presentation of the first case with oral lesions.
Nadershahi NA, Wescott WB, Egbert B.
Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1997 Apr;83(4):496-500. Review.
Multiple lipomas, angiolipomas, and parathyroid adenomas in a patient with Birt-Hogg-Dube syndrome.
Chung JY, Ramos-Caro FA, Beers B, Ford MJ, Flowers F.
Int J Dermatol. 1996 May;35(5):365-7.
[Perifollicular fibroma of the skin and colonic polyps: Hornstein-Knickenberg syndrome]
Schachtschabel AA, Küster W, Happle R.
Hautarzt. 1996 Apr;47(4):304-6. German.
Miscellaneous genodermatoses: Beckwith-Wiedemann syndrome, Birt-Hogg-Dube syndrome, familial atypical multiple mole
hereditary tylosis, incontinentia pigmenti, and supernumerary nipples.
Cohen PR, Kurzrock R.
Dermatol Clin. 1995 Jan;13(1):211-29. Review.
Multiple perifollicular fibromas: report of a case and analysis of the literature.
Junkins-Hopkins JM, Cooper PH.
J Cutan Pathol. 1994 Oct;21(5):467-71. Review.




[Fibrofolliculoma. Treatment with copper vapor laser]
Giroux JM, Cadotte M, Barolet D, Provost N.
Ann Dermatol Venereol. 1994;121(2):130-3. French.
Bilateral renal cell carcinoma in the Birt-Hogg-Dubé syndrome.
Roth JS, Rabinowitz AD, Benson M, Grossman ME.
J Am Acad Dermatol. 1993 Dec;29(6):1055-6.
[Birt-Hogg-Dubé syndrome. Fibrofolliculoma, trichodiscoma and acrochordon]
Bayrou O, Blanc F, Moulonguet I, Millet P, Garrel JB, Civatte J.
Ann Dermatol Venereol. 1990;117(1):37-41. Review. French.
Fibrofolliculomas, tricodiscomas and acrochordons (Birt-Hogg-Dubé) associated with intestinal polyposis.
Rongioletti F, Hazini R, Gianotti G, Rebora A.
Clin Exp Dermatol. 1989 Jan;14(1):72-4.
[Trichodiscomas associated with fibrofolliculomas and acrochordons]
de Kaminsky AR, Sánchez GF, Lago R, Kaminsky CA.
Med Cutan Ibero Lat Am. 1988;16(6):469-73. Spanish.
Fibrofolliculomas, trichodiscomas, and acrochordons: the Birt-Hogg-Dubé syndrome.
Ubogy-Rainey Z, James WD, Lupton GP, Rodman OG.
J Am Acad Dermatol. 1987 Feb;16(2 Pt 2):452-7.
Birt-Hogg-Dubé syndrome as an expression of tuberous sclerosis. Apropos of 2 personal cases in 2 sisters]
Iranzo P, Martín E, del Olmo JA, Mascaró JM.
Med Cutan Ibero Lat Am. 1985;13(2):145-9. Spanish.
[Birt-Hogg-Dubé syndrome]
Chemaly P, Cavelier B, Civatte J.
Ann Dermatol Venereol. 1983;110(9):699-700. French.
[Fibrofolliculoma, trichodiscoma and acrochordon. The Birt-Hogg-Dubé syndrome]
Balus L, Fazio M, Sacerdoti G, Morrone A, Marmo W.
Ann Dermatol Venereol. 1983;110(8):601-9. French.
Multiple fibrofolliculomas (Birt-Hogg-Dubé) associated with a large connective tissue nevus.
Weintraub R, Pinkus H.
J Cutan Pathol. 1977 Dec;4(6):289-99.
Hereditary multiple fibrofolliculomas with trichodiscomas and acrochordons.
Birt AR, Hogg GR, Dubé WJ.
Arch Dermatol. 1977 Dec;113(12):1674-7.
                                                                Aim
            Case of a 54-year-old woman with a long history of whitish papules in the central region of the face and a family history of sim
            Biopsy and genetic study revealed a new mutation of the gene involved in Birt-Hogg-Dube syndrome.


            Case study of a patient, who was diagnosed with Birt-Hogg-Dubé syndrome after presenting with a history of recurrent spont
            pneumothorax, and a family history of spontaneous pneumothorax and renal cell carcinoma.

          REVIEW:
          Birt-Hogg-Dubé (BHD) is a rare autosomal dominant genodermatosis, characterized by cutaneous hamartomas, pulmonary cy
          spontaneous pneumothorax and kidney tumours. BHD is caused by mutation in the gene which codes for folliculin (FLCN). FLC
          of the mTOR-AMPK signal transduction pathway. Genetic testing of patients is now possible. Furthermore, understanding of t
          and mechanisms behind BHD-associated disease provides an opportunity for development of new treatment options.
          Usually, patients are referred for genetic examination by dermatologists because of the presence of typical multiple skin tum
          without additional symptoms. However, because of phenotypic variability and incomplete penetrance, the clinical presentati
          not yet fully defined. Criteria for genetic testing and diagnosis that take into account variable manifestations have recently be
          by the European BHD Consortium.
          Case report a male patient who presented with a history of recurrent pneumothorax and was treated by nephrectomy for a l
          carcinoma at 20 years old. Skin examination disclosed numerous fibrofolliculomas of the scalp. During follow-up, surgical rese
          parotid oncocytomas and of a parathyroid adenoma were performed. SBHD was confirmed by molecular biology. In the prese
          fibrofolliculomas and kidney tumors and recurrent spontaneous pneumothorax, a diagnosis of SHBD syndrome should be disc
          and tests need to be performed on the whole family.
          To examine the tumour suppressor function of FLCN.
Merino, W.Marston Linehan and




            Although colorectal neoplasia was reported initially to be part of the BHD phenotype, recent studies have not confirmed this
            The authors performed a series of clinical and laboratory studies was undertaken to investigate possible relationships betwee
            colorectal neoplasia and the BHD gene
            Recent advances in the diagnosis and management of renal cell cancer (RCC) are discussed given the enhanced molecular gen
            knowledge in this area. A number of hereditary renal cancer syndromes have been described, including von Hippel-Lindau dis
            Birt-Hogg-Dubé syndrome, hereditary leiomyomatosis/RCC syndrome, and hereditary papillary renal cancer. Early molecular
            facilitates the management and prevention of RCC in families. Recommendations for screening in families are discussed
            Oncological outcomes in patients with hereditary renal cell carcinoma treated with partial nephrectomy for multifocal solid tu
            largest lesion greater than 4 cm.

            BHD Syndrome may be caused by a germline deletion which cannot be detected by a conventional genetic approach. Real-tim
            polymerase chain reaction (qPCR) may be able to identify such a mutation and thus provide us with a more accurate
            clinical picture of BHD Syndrome. Thirty six patients with multiple lung cysts of undetermined causes had denaturing high per
            liquid chromatography (DHPLC) applied for mutation screening. If no abnormality was detected by DHPLC, the amount of eac
            in genome was quantified by qPCR.
            A 60-year-old Caucasian woman had a 10-year history of cystic lung disease and recurrent spontaneous pneumothoraces.
            She was noted to have papular lesions over her face and forehead. The result of a biopsy showed these lesions to be fibrofoll
            A diagnosis of Birt-Hogg-Dube syndrome was made and she was screened for renal tumors since these are a recognized assoc
            A hybrid oncocytoma was detected which was surgically excised by partial nephrectomy.
            This paper describes current knowledge on the association between BHD and cancer predisposition and
            briefly summarizes the authors' experience in this field.

            Cas report of a 56-year-old Caucasian male presented with a fast-growing subcutaneous tumour on the right shoulder.
              The patient was also concerned about cosmetic disfigurement from multiple small facial papules. These had been growing gra
              over the last 3 years. The past medical history revealed six episodes of spontaneous pneumothoraces, treated with a right-sid
              pleurectomy at the age of 28 years, with no recurrence since. Interestingly, his mother had developed identical lesions over h
              few years before she died from an undetermined internal cancer.
              Hybrid oncocytic/chromophobe tumors (HOCT) of the kidney have been described in patients with Birt-Hogg-Dubé syndrome
              and in association with renal oncocytosis without BHD. HOCT in patients without evidence of BHD or renal oncocytosis is exce
              and these cases have been poorly characterized. We have identified and studied 14 cases of HOCT from previously diagnosed
              oncocytomas (398 cases) and chromophobe renal cell carcinomas (351 cases) without evidence of BHD or renal oncocytosis.
              Immunohistochemical, ultrastructural, and molecular genetic studies analyzing numerical chromosomal changes, loss of hete
              BACKGROUND: Birt-Hogg-Dubé syndrome (BHDS) is an autosomal-dominantly inherited genodermatosis that predisposes
              to the development of benign hair follicle tumours, lung cysts, kidney tumours, and possibly colonic cancers, due to mutation
              gene. We report cases involving a new mutation in three unrelated families. MATERIALS AND METHODS: Blood samples of th
              probands were submitted for a molecular diagnosis of BHDS. Following DNA extraction, FLCN gene sequencing was performe
              The identified mutations were confirmed on a second sample. A cancer genetics consultation was organized and specific tests
              (dermatological examination, CT scan of chest and abdomen and colonoscopy) were proposed for each BHDS patient.
              RESULTS: FLCN gene-sequencing analysis revealed an identical complex harmful mutation in all three families. The first proba
              fibrofolliculomas (FF), a history of pneumothorax and colonic adenoma. The mutation was found in a brother and two sisters
              asymptomatic, and in a niece with FF. The second proband showed FF. The mutation was found in her mother, who had FF. T
              proband presented diffuse emphysema and very rare FF. DISCUSSION: This case report shows extremely wide intra- and inter
              phenotype variation within individuals having a similar FLCN gene mutation. In large cohorts of BHDS patients, no genotype-p
              correlation has been shown. This case emphasises the vital importance of presymptomatic diagnosis for each member of a BH
              by means of a cancer genetics consultation, followed by a CT scan of the chest and abdomen, colonoscopy and annual kidney
              Birt-Hogg-Dubé (BHD) syndrome is a rare disorder inherited in an autosomal dominant manner. The affected patients are pre
              to the development of cutaneous fibrofolliculomas, renal cell tumors and lung cysts with recurrent pneumothorax. The respo
              for this syndrome is named BHD gene which is mapped in the region of chromosome 17p11.2. Based on the neoplastic chang
              and the kidney, BHD gene is regarded as a tumor-suppressor gene. However, detailed mechanism of tumorigenesis is not wel
              In this review, we summarize current understanding of BHD syndrome with special attention to the pathophysiology of lung c
              An overview of current diagnosis and management of BHD Syndrome
, Solly J, Maher ER;


            Case report two novel BHD gene mutations in two Italian families.
           To carry ou a detailed characterization of FLCN phosphorylation to provide insight into the role of FLCN within mTOR signallin
, Okimoto K,




            An illustrative kindred is presented in which the index patient, a man aged 26, had recurrent episodes of pneumothorax
            without apparent skin lesions or renal abnormalities. He had bilateral mostly basally-located lung cysts.
            There was a family history of fibrofolliculomas, lung cysts, pneumothorax and clear cell renal cancer.
            Recognition of BHD is important since carriers of the mutation can be offered surveillance for early detection and treatment o
            renal cancer.
            Analysis of an embryonic lethal phenotype that occurs in a BHD homozygous knockout mouse models and charaterise
            and compare the kidney tumours that develop in a BHD heterozygous knockout mouse model with human BHD kidney tumou




            To clarify the functions of FLCN during tumor formation, the authors generated a mouse model of BHD and extensively chara
            the expression pattern of FLCN in adult tissues and cell types.
             when compared to the human expression.




            Case study of a solitary fibrofolliculoma arisen on the nose of a 63-year-old woman.




            Case report of 3 patients with confirmed follculin mutations illustrating the dermscopic pathologis of BHD Syndrome.


            In this study, we established 7 lines (NR cell lines NR22, 24, 32, 45, 49, 54 and 64) from an RCC found in a Nihon
            rat. All cell lines consisted mainly of round or polygonal cells arranged in a cobblestone-like growth pattern. Cells of NR
            cell lines had abundant cytoplasm and tight junctions as well as microvilli on electron microscopy and were positive
            for cytokeratin on immunocytochemistry.
            We have established a locus-specific database based on the Leiden Open (source) Variation Database (LOVD) software.
            The version of the database contains 60 previously published mutations and 10 previously unpublished novel germline FLCN m
            The mutations are comprised of deletions (44.3%), substitutions (35.7%), duplications (14.3%) and deletion/insertions (5.7%)
            The database is accessible online at http://www.lovd.nl/flcn.

              This study is an investigation of lung cysts in a patient who had no familial history of pneumothorax and renal tumors.
I, Aoki I, Nakatani Y.




            To report the clinical features and germline mutations of 22 patients from 10
non-related BHD families ascertained during a 5-year prospective study by the Department of
Dermatology at the University Hospital of Montpellier, France. To better define the
characteristics of pulmonary, thyroid, renal, and colorectal manifestations associated with
BHDS.

To describe in detail the characteristic chest computed tomography (CT) findings of Birt–Hogg–Dubé (BHD) syndrome




Birt-Hogg-Dube is a rare syndrome which is sporadic or hereditary with a dominant autosomal transmission.
Various organs, in particular the skin, can be affected. In the presently reported case, skin was covered by
hundreds of small molluscoid papules corresponding to trichodiscomas, fibrofolliculomas and skin tags.
Case study of a 64y/o male with suspectec BHD Syndrome




The Birt–Hogg–Dubé gene (BHD) encodes the tumor suppressor protein folliculin (FLCN). The function of FLCN has
recently been implicated in the regulation of rapamycin-sensitive mTOR complex (mTORC1). Reciprocally, the
mTORC1-dependent phosphorylation of FLCN was reported. However, precise mechanism of FLCN phosphorylation and
functional interaction of FLCN with tuberin, the product of tuberous sclerosis 2 gene (TSC2) which is a negative regulator
of mTORC1, are unclear. Here we report that multiple phosphorylation in FLCN are evoked by downregulation of tuberin
as well as by Rheb expression. We found that phosphorylation at Ser62 and Ser302 are differently regulated by
mTORC1-dependent pathway. Some unknown kinases downstream of tuberin-mTORC1 are thought to directly
phosphorylate FLCN. Interestingly, our results also suggest that the complex formation of FLCN with AMPK is
modulated by FLCN phosphorylation. These results suggest that FLCN is involved in a novel mechanism of signal
transduction downstream of tuberin.
The purpose of this review is to familiarize the reader with the known heritable forms of
kidney cancer, the recent advances in the field and their impact on patient management

Case report of a Japanese family presenting with symptoms associated with BHD Syndrome.


The multiple facial lesions of fibrofolliculoma (FF)/trichodiscoma (TD) and those of fibrous papule
(FP; perifollicular fibroma/angiofibroma, AF) are characteristic of Birt-Hogg-Dubé (BHD) syndrome and tuberous sclerosis,
respectively. However, there was a recently reported case of BHD syndrome with multiple facial FP lesions and a case of
tuberous sclerosis, in which one FF lesion was included among the multiple facial FPs.
A Chinese woman presented with a spontaneous pneumothorax and a family history suggestive of the autosomal dominan
transmission of pneumothorax. The patient also had skin fibrofolliculomas and folliculin gene deletion, compatible with
Birt-Hogg-Dube (BHD) syndrome. The importance of BHD syndrome and other familial spontaneous
pneumothoraces is discussed.
The folliculin gene (FLCN), also known as BHD, is the only known susceptibility gene for Birt-Hogg-Dubé syndrome. BHDS is th
To date, 53 unique germline mutations have been reported. FLCN mutation detection rate is 88%. FLCN encodes a predicted
We developed the first online database detailing all FLCN variants identified in our laboratory and reported in the literature. T
To date, the FCLN database includes 84 variants: 53 unique germline mutations and 31 SNPs. The majority of FLCN germline m
The FLCN mutations consist of: 45% (24/53) deletions, 32% (17/53) substitutions (10 putative-splice site, 5 nonsense, and 2 m
The database strives to systematically unify current knowledge of FLCN variants and will be useful to geneticists and genetic c


Case study of a unique exon 10 mutation resulting in 3 members of one family displaying specific phenotype-genotype
symptoms




BHD mouse model generated to assess whether FLCN regulates mTOR activity in vivo.




Case Report: A 33-year-old white woman presented with several hours of pleuritic chest pain and dyspnea after a long airplan


Observation of the first case of a TSC patient with a fibrofolliculoma.


To establish a suitable mouse model for BHD to further elucidate whether
kidney-specific knockout of BHD in the mouse is also implicated in kidney tumorigenesis,
and what mechanism is involved.




Familial renal cell carcinoma (RCC) is genetically heterogeneous. The most common histopathologic subtype of
sporadic and familial RCC is clear cell (cRCC) and von Hippel-Lindau (VHL) disease is the most common cause of
inherited cRCC. Familial cRCC may also be associated with chromosome 3 translocations and has recently been
described in patients with Birt-Hogg-Dube (BHD) syndrome, caused by germline FLCN mutation. Fewer than 20
kindreds with familial cRCC without VHL disease or a constitutional translocation have been described. The purpose of
this investigation was to define the clinical and genetic features of familial non-VHL cRCC (FcRCC) and to evaluate
whether unrecognized BHD syndrome might be present in patients with apparent nonsyndromic RCC susceptibility.
No online information avalaible
           This study identified FnipL (also independently identified as Fnip2) as a novel binding partner for FLCN.




           Molecular analysis of the folliculin (FLCN) gene was performed in four consenting patients from two families
           with Birt-Hogg-Dubé (BHD) syndrome, showing the occurrence of two frameshift mutations located respectively in
           exons 5 (802insA) and 9 (1345delAAAG) of the FLCN gene. A novel homozygous sequence variant in the
           intron 9 (IVS9 +5C>T) was also found. 1345delAAAG was associated with a wide variety of tumors, including stomach,
           colon, breast and parotid cancer. Conversely, the family carrying 802insA only had clinical evidence of dermatological
           lesions. These findings further suggest the relevance of exon 9 mutations in cancer predisposition for BHD.

           Report of a novel mutation in a 31yr old female Korean BHD patient - first of it's kind


           Identification and characterisatin of the novel Fnip1 homolog, Fnip2 (also see Takagi et al )




           Patients with hereditary syndromes with renal tumors initially may present to the dermatologist. It is essential that
           dermatologists recognize these syndromes because the early diagnosis of renal cancer may prove to be lifesaving. The
           4 hereditary syndromes with cutaneous manifestations are von Hippel-Lindau (VHL) syndrome, Birt-Hogg-Dube (BHD)
           syndrome, tuberous sclerosis (TS), and hereditary leiomyoma renal cell carcinoma (HLRCC) syndrome.
           This article reviews these disorders, emphasizing their cutaneous features and renal manifestations.
           To determine whether folliculin sequence variants are risk factors for severe COPD, we genotyped seven previously reported
           Birt-Hogg-Dubé or familial spontaneous pneumothorax associated folliculin mutations in 152 severe COPD probands
           participating in the Boston Early-Onset COPD Study. We performed bidirectional resequencing of all 14 folliculin exons in a su
           of 41 probands and subsequently genotyped four identified variants in an independent sample of345 COPD subjects
           from the National Emphysema Treatment Trial (cases) and 420 male smokers with normal lung function from the
           Normative Aging Study (controls).
           Case report of a 67-year-old woman with multiple renal cell tumors in one kidney with a history of spontaneous
           pneumothorax, but without skin lesions which are typical signs of BHD syndrome.

            To characterise the BHD mutation spectrum, novel mutations and new clinical features of one
            previously reported and 50 new families with BHDS.
A, Steinberg SM,




           Unlike other established renal tumor cell lines from sporadic renal cell carcinoma, this is the
first established renal tumor cell line of BHD, an inheritable neoplastic syndrome,
from long-term tissue culture. The line is derived from a patient was a previously healthy 46 year
old male who initially presented with acute onset gross hematuria and was found to have a
germline mutation in the FLCN gene and subsequent diagnosis of BHD syndrome was made.

Kidney-targeted BHD knockout mouse model used to examine how loss of BHD affects
kidney function, the potenial pathways involved and therapies that target such pathways




The aim of the present study was to investigate the presence and type of mutation in a Swiss pedigree and in a sporadic case
Clinical examination, lung function tests and high-resolution computed tomography were performed.

Fibromatosis-type fibromas were found to develop at abdominal surgical sites in 4 heterozygous Nihon rats, a model
for the human Birt–Hogg–Dubé syndrome. In all 4 rats, solitary and firm nodules were located within the lateral abdominal
musculature involving the full thickness of the abdominal wall at the sites of laparotomy. Histologically, the nodules
consisted of well-differentiated fibroblastic spindle-shaped cells. These cells were surrounded by large amounts of
collagen fibers, and appeared to infiltrate within the abdominal musculature. A portion of the spindle-shaped cells showed
features of myofibroblasts. These characteristics are consistent with desmoid tumors in human. Although the etiology
of desmoid tumors in human remains unclear, they are known to occur in association with hormonal factors, surgical
trauma, and familial adenomatous polyposis. In animals, they have been reported in dogs, cats, horses, and genetically
modified mouse models for human familial adenomatous polyposis. The development of the tumors in the Nihon rats
was apparently associated with surgical incisions. Genetic factor should be involved in the occurrence of the tumor,
since it was found only in the Nihon rats among many rats. Our present data suggest that Bhd gene mutation is not
likely to be a candidate.
No abstract available.


Case report of a 60 year old male presenting with a solitary nasal fibrofolliculoma and briefly review the literature.


Multiple losses of whole chromosomes were frequently found in chromophobe RCC, especially in chromosome 17. We hypot
that the lost chromosomal regions may harbour chromophobe RCC-specific tumour suppressor genes, and their inactivation
contributes to the tumorigenesis. Here, we focused on three cancer-related genes located at chromosome 17, BHD, TP53,
and HNF1b, and examined their involvement in chromophobe RCC by studying 46 cases and compared with 19 clear cell,
18 oncocytoma, and nine papillary subtypes.
Detailed clinical observations of 20 BHD families, ascertained by the department of dermatology
at a university hospital, a referral center for adnexal tumors of the skin. Family studies and DNA mutation
analysis were aimed at a detailed evaluation of the clinical and genetic variability of the syndrome.

Birt-Hogg-Dube (BHD) is a tumor suppressor gene disorder characterized by skin hamartomas, cystic lung disease, and renal c
The fact that hamartomas, lung cysts, and renal cell carcinoma can also occur in tuberous sclerosis complex (TSC) suggests th
the BHD and TSC proteins may function within a common pathway. To evaluate this hypothesis, we deleted the BHD homolog
in Schizosaccharomyces pombe .




To describe the clinical, radiologic, and histopathologic aspects of cystic lung disease occurring
in patients with Birt-Hogg-Dubé (BHD) syndrome, a rare, inheritable, multisystem disorder.

We hypothesised that mutations of the BHD gene are responsible for patients who have multiple
cysts of which the underlying causes have not yet been elucidated.

No abstract available.


This investigation aimed to elucidate the involvement of BHD in the development of renal neoplasms




This study inolved an evaluation of 198 patients from 89 families with BHDS to characterize the risk factors for
pneumothorax and genotype–pulmonary associations.


This study is a clinical observation of four patients with RCC in BHD syndrome.




case of a 63-year-old male patient with this syndrome. The radiological findings seen with this syndrome are described.
Radiologists should be aware of and able to recognize this syndrome.

Renal cell carcinoma (RCC) has the highest rate of occurrence within the US when compared with other countries. Recent adv
is not a single disease, but it is a mixture of several types of malignancies with unique molecular mechanisms and pathologica
and papillary type 2 neoplasms (10-15% of all RCC patients) and RCC with chromophobic and oncocytic features, called the Bi
such as the tuberous sclerosis (TSC) syndrome may occur with a mixed pathological features with a renal presentation. In this
have been analyzed to find out whether there is any common thread that could run through these disparate malignancies tha
certain non-traditional activities of the cabonic anhydrase (CA) family members, along with the differing levels of hypoxia ind
how the CA family members could participate in the genesis and progression of each and every one of these RCC subtypes an
and certain other pre-disposing factors. These rationalizations point towards a unified hypothesis that may help explain the o
further studies aimed toward a better understanding of the role played by carbonic anhydrases in RCC subtypes and b) would
To review the literature on this subject with a special emphasis on BHD syndrome-associated renal
pathology as well as recent advances in molecular genetic discovery of the BHD syndrome.
To determine whether LOH or second-hit somatic mutations play a role in the pathogenesis of the cutaneous
tumors arising in BHD syndrome, we examined fibrofolliculomas from three different patients.


To systematically classify patients with unexplained hamartomatous or hyperplastic/mixed polyposis by
extensive molecular analysis in the context of central rereview of histopathology results.


Kidney cancer is not a single disease. It is made up of a number of different types of cancer that occur in the kidney, each with
caused by a different gene. The identification of families with a predisposition to the development of renal neoplasms, includ
and hereditary leiomyomatosis and renal cell cancer (HLRCC), has made possible the identification of the different genes for t
focusing on the mechanisms of carcinogenesis. The elucidation of molecular pathogenesis in these familial forms of kidney ca
We report a patient with apparently sporadic BHD in which molecular analysis subsequently revealed a
novel germline mutation in the initiator codon of the BHD gene in the proband and her son.




Here, we report the identification of the FLCN-interacting protein, FNIP1, and demonstrate its interaction with
5' AMP-activated protein kinase (AMPK), a key molecule for energy sensing that negatively regulates
mTOR activity. FNIP1 was phosphorylated by AMPK, and its phosphorylation was reduced by AMPK
inhibitors, which resulted in reduced FNIP1 expression. AMPK inhibitors also reduced FLCN phosphorylation.




We report a case of a 48-year-old woman with BHD who initially presented to our institution with spontaneous pneumothora
We describe the fine needle aspiration findings of one of the renal tumors, which was suggestive of so-called hybrid oncocyti
kidney tumors that the patient subsequently had excised. When multiple kidney tumors from a single patient appear oncycyt
the possibility of oncocytomas and hybrid tumors associated with BHD must be entertained.
Case study of a patient with Birt-Hogg-Dube syndrome diagnosed after spontaneous pneumothorax.


The historical, clinical and dermatopathological aspects of basal cell nevus syndrome, Muir-Torre syndrome, Cowden syndrom
complex and Birt-Hogg-Dubé syndrome are reviewed in a personal and informal fashion. The latest advances in the molecular
the disorders are also summarized.
In the present study, we have investigated mutational frequencies in the poly(C)8 tract of BHD exon11
in gastric cancer with MSI-high and MSI-low. To test if BHD mutations are involved in gastric carginogenesis
in general, we have also investigated mutations in other exons in MSI and microsatellite stable (MSS)
gastric cancer.
Over 10% of patients with primary spontaneous pneumothorax report a positive family history of the disease. While
some cases can be attributed to rare inherited connective tissue diseases, several families with familial spontaneous pneumo
been described that do not show clinical evidence of these monogenic disorders. Until recently the molecular underpinning o
disease was unknown.
To test the hypothesis that the BHD gene is also a mutational target in sporadic endometrial carcinoma with microsatellite in
139 cases of sporadic endometrial carcinoma were screened for MSI status, and mutations of the poly(C)8 tract in exon 11 as
coding exons of the BHD gene.
No abstract available.


To understand the biological function of the BHD tumor suppressor gene, the biological effect of
downregulation of the Drosophila BHD homolog (DBHD) was studied. By using RNA interference (RNAi)
to decrease the expression of DBHD in Drosophila


Birt-Hogg-Dubé (BHD) syndrome is a rare inherited genodermatosis characterized by distinctive cutaneous lesions, an increas
few reports have detailed the pathologic features of pulmonary involvement. Herein we present the pathologic findings from
comprised of intraparenchymal collections of air surrounded by normal parenchyma or a thin fibrous wall and blebs consistin
causes of spontaneous pneumothorax, such as emphysematous bullae and idiopathic blebs. It is important for pathologists to
Patients with BHD are at increased risk for renal neoplasia and may benefit from periodic surveillance. Pathologists should ra
In this study, we constructed transgenic Nihon rats with introduction of a wild-type Bhd gene to ascertain whether suppressio
phenotype is possible. Rescue from embryonic lethality of mutant homozygotes (Nihon/Nihon) and suppression of renal carc
heterozygotes (Nihon/+) were both observed, defining the germline Bhd mutation in the Nihon rat as an embryonal lethal an
predisposing mutation.
This study sought to identify DNA sequence variations that confer susceptibility to pneumothoraces.


Birt–Hogg–Dubé Syndrome is an autosomal dominant condition characterized by a triad of fibrofolliculomas, trichodiscomas,
renal neoplasms and pneumothoracies. The BHD protein folliculin had recently been identified. The histological findings of th
The patient later developed pneumothorax. Clinical manifestations, histological findings, associations, management, and a re
This report describes multiple facial angiofibromas as the predominant initial manifestation of BHDS.


To address the mutation status of the BHD gene in tumors from Birt-Hogg-Dubé patients,
we analyzed a panel of 77 renal tumors by direct DNA sequence analysis. Tumor samples, as well as matched
normal samples, were obtained from 12 affected members of BHD families after renal surgery at the
National Cancer Institute (NCI). The protocol was approved by the institutional review board of NCI,
and the patients gave written informed consent.
No abstract available




Sixty-one families affected with BHD were recruited to the NCI for study over a 3-year period.
Previously, we evaluated a screening panel representing nine of these families with BHD and reported the
identification of one nonsense and two frameshift BHD mutations as well as five insertion/deletion
mutations in the C8 tract of exon 11.
Case report of s aingle patient with suspected BHD.


Herein we describe the evaluation and management of renal tumors in Birt-Hogg-Dubé (BHD), an autosomal
dominant disorder predisposing to cutaneous fibrofolliculomas, pulmonary cysts, spontaneous
pneumothorax and renal tumors.
To identify DNA sequence variations that confer susceptibility to pneumothoraces.


Case report of a 27-year-old woman presenting with multiple growths on her face and upper body and a family history of BHD


No abstract available.


This study describes the results of a genetic study of a large Finnish family with a dominantly
inherited tendency to prmary spontaneous pneumothorax.

This study reports the first Asian family that has been demonstrated to carry a BHD mutation.


In the Nihon rat, an established model of hereditary renal cell carcinoma (RCC), the propensity for tumor development, is inh
The renal lesions of the Nihon rat are characterized, and extrarenal lesions are also described in this work. The earliest lesion
ossification within RCCs and three extrarenal lesions, clear cell hyperplasia/adenoma of the endometrium, clear cell change o
Over the past decade cancer-causing genes have been identified for the most common histologic types of renal cancer, specif
until the recent discovery of a novel gene, BHD, on chromosome 17p that was found to be mutated in the germline of affecte
spontaneous pneumothorax. Importantly, BHD patients have an increased risk for developing a variety of renal neoplasia, mo
of BHD-associated renal tumors, the identification of this novel renal cancer-predisposing gene, the BHD mutation spectrum f
Renal Cell Carcinoma (RCC) and uterine leiomyoma (often referred to as fibroids) are tumors arising from tubular epithelium
whereas uterine leiomyoma are the most common tumor of women and are benign. Although they are distinct histologically,
mesenchyme induced by the developing ureteric bud, and have a shared mesenchymal lineage with smooth muscle cells of th
Eker rats carry a germline defect in the rat homologue of the tuberous sclerosis complex 2 (TSC-2) tumor suppressor gene an
the inherited cancer syndrome hereditary leiomyomatosis and renal cell cancer (HLRCC) that have germline defects in the fum
animals develop RCC and uterine leiomyoma with a high frequency. Identification of the tumor suppressor genes involved in
No abstract available.


No abstract available.


As a first step toward understanding the biological function of this novel renal cancer-associated gene, we
evaluated the specific cell type and tissue distribution of BHD mRNA by fluorescent in situ hybridization
in normal and neoplastic human tissues, and selected abnormal and neoplastic tissues from BHD patients.
The Nihon locus is narrowed down to a region of the rat chromosome 10 homologous with
human chromosome 17p11.2, and a rat BHD homologue is identified; mutations in which predispose to the renal
cancer phenotype in the Nihon rat.
Studies during the past two decades have shown that kidney cancer is not a single disease; it is made up of a number of differ
The VHL gene product forms a heterotrimeric complex with elongin C, elongin B, and Cul-2 to target hypoxia-inducible factors
epidermal growth factor receptor and transforming growth factor . Both hypoxia-inducible factor 1 and the epidermal growth
determined that the c-Met proto-oncogene on chromosome 7 is the gene for HPRC and for a number of sporadic papillary RC
associated with cutaneous tumors, lung cysts, and colon polyps or cancer has recently been identified. Studies are currently u
are at risk for the development of cutaneous leiomyomas, uterine leiomyomas (fibroids), and type 2 papillary RCC. The HLRC
To investigate whether somatic inactivation of the BHD gene region is implicated in the pathogenesis of sporadic
RCC and colorectal cancer (CRC), mutation analysis was performed in 30 RCC primary tumours and cell lines,
and 35 CRCs and cell lines.




Since the function of the protein folliculin, encoded by the BHD gene, is unknown and because of the
similarity in phenotype and the corresponding locations in the human and canine genomes, the BHD gene was
cloned and then searched for disease-associated mutations in the canine ortholog of the BHD gene.




2 unrelated patients found to have tumors of neural tissue origin, a neurothekeoma and a meningioma, who were additional
the syndrome of Birt-Hogg-Dubé (BHDS).

We will discuss the evolution of BHDS from the original description to the recent discovery of the genetic susceptibility locus,
illustrate the clinical differential diagnosis, and highlight the workup needed for newly diagnosed patients and their family me

Case study of a 47-year-old woman with BHDS who presented with numerous facial papules and the more recently associate
of pulmonary cysts.

This study evaluated the role of BHD in 39 cases of sporadic renal tumors by performing BHD mutation analysis of
7 renal oncocytomas, 9 chromophobe RCCs, 11 papillary RCCs, and 12 clear cell RCCs. LOH analysis was performed
on 28 matched normal/tumor samples and the BHD promoter methylation profile was determined in all of the tumors.
This study also examines the mutation and methylation status of 9 kidney cancer cell lines.




To asssess the incidence of BHD mutations in colorectal carcinomas.




No abstract available.


No abstract available.


To elucidate whether the BHD gene is associated with colon neoplasia and one of the MSI target genes,
we screened the poly (C)8 tract of the BHD gene, a mutational hot spot, in 32 MSI sporadic colorectal
carcinomas and 80 microsatellite stable (MSS) sporadic colorectal carcinomas. In addition, we screened the entire coding reg
in 13 MSI colorectal carcinoma cell lines and nine MSS colorectal carcinoma cell lines.


Three members of a Queensland family with clinical and histopathological features consistent with Birt-Hogg-Dubé syndrome
Two of the three family members were able to be screened for associated disorders.

The identification of flcn gene provides an opportunity for genetic testing
which will lead to a better understanding of the disease. In this study, clinical and genetic studies of four
apparently sporadic cases and four families with 23 affected subjects from France and Sweden are reported.


This study is a retrospective evaluation of renal neoplasms from patients in BHD families who
were screened and found to have renal tumors, as well as patients with BHD who presented with renal tumors.
Families affected by BHD are specifically recruited to the National Cancer Institute as part of an institutional review
board-approved protocol, and results from this screening program have previously been reported.
In addition, the recruitment of patients with familial renal tumors is ongoing under a separate protocol approved by
our institutional review board. Briefly, physical examinations, dermatologic screening, and confirmatory skin biopsies
are offered to BHD family members older than the age of 20 years because of the age-dependent onset of BHD
skin lesions. 2 Pathologic confirmation of a fibrofolliculoma in the context of multiple skin papules consistent
with fibrofolliculomas (>=10) is considered diagnostic of BHD syndrome. 32 All skin pathology, and thus the diagnosis of
BHD, was made at our institution and with the assistance of dermatologists and pathologists. Abdominal
computed tomography scans are used to screen for renal tumors in family members. When patients are found to have
renal tumors, they are measured radiographically and the patients counseled regarding surgery.
All patients in this series have undergone abdominal scanning, and 22 of these scans were reviewed by our group.
Case study of a 50-year-old woman presented with multiple skin-coloured facial papules. There was a family history of similar


The authors investigated the histomorphologic and immnophenotypic properties of 15 fibrofolliculomas and trichodiscomas i
with BHDS and eight with sporadic disease.

No abstract available


Studies of families with inherited cancer have revealed tumor suppressor genes and oncogenes
that play a major role in the pathogenesis of human neoplasia. Discovery of protein-truncating
mutations in a gene, which occur in patients with BHD and lead to an increased risk for
kidney cancer, represents evidence for a novel gene associated with oncocytoma or
chromophobe renal histology. Biologic significance of the BHD protein, folliculin,
is supported by sequence conservation between folliculin and homologs in mice,
Drosophila, and C. elegans, and by mapping studies that suggest that germline mutations in dog
and rat BHD homologs lead to inherited renal cancer. Because BHD is a novel gene, further
studies of the BHD protein may lead to the elucidation of novel mechanisms of tumorigenesis.
A precise way to define the risk of health problems associated with an inherited disease is to
compare the frequency of health problems in all family members who possess the disease gene (both
clinically affected individuals and disease gene carriers) to the frequency of these problems in family members
who do not carry the disease gene. We tested whether the inheritance of BHD or the BHD haplotype predisposed
to the development of renal or colonic neoplasms or of spontaneous pneumothorax by performing
a cross-sectional study of BHD families.

In this study,we report an extended family with BHD and renal cancer in which various molecular methods were used to evalu
PTCH, PTEN, and CTNNB1 as candidate genes for BHD. These genes were studied because mutations in each are associated
with a disorder that has clinical overlapping features with BHD and these disorders carry an increased risk for internal
malignancy.
The first reported case of renal tumor occurring in BHD syndrome in Japan.


A 36-year-old man presented with multiple skin-colored papules on his face, neck and back of several years duration. His fath
probably his grandfather suffered from similar skin lesions. The histological examination revealed fibrofolliculomas in all three
At the age of 33 years the patient developed a spontaneous pneumothorax, and one year later a subarachnoidal hemorrhage
of the left carotid artery. His grandfather had died from metastatic rectal carcinoma.
Case study of a male BHD patient


In the present study, Family 172 was used to perform an initial genomewide scan and two-point linkage analysis.
and subsequently performed linkage analysis in an additional eight families to identify the disease-gene locus for BHD.




Birt-Hogg-Dubé syndrome (BHD) is an autosomal dominant neoplasia syndrome characterized mainly by benign skin
tumors, and to a lesser extent, renal tumors and spontaneous pneumothorax. To map the BHD locus, we performed a
genome-wide linkage analysis using polymorphic microsatellite markers on a large Swedish BHD family. Evidence
of linkage was identified on chromosome 17p12-q11.2, with a maximum LOD score of 3.58 for marker D17S1852.
Further haplotype analysis defined a ~35 cM candidate interval between the two flanking markers, D17S1791 and D17S798.
This information will facilitate the identification of the BHD gene, leading to the understanding of its
underlying molecular etiology.
The genetics of renal cell carcinoma continues to elucidate the pathways of kidney tumorigenesis. The relationship between t
and clear cell carcinoma, MET and papillary carcinoma, and the families of genes that they regulate, continues to be unravele
hereditary kidney cancer syndromes, like familial oncocytoma and the Birt-Hogg-Dubé syndrome, have been identified and th
the genes that cause them is under way. Researching the genetics of these disorders is essential for an understanding of spor
cancer genetics. This chapter will review the current knowledge of the hereditary kidney cancer syndromes, the genes that ca
advances in genetic research and techniques, and how this information impacts upon diagnostic, prognostic, and therapeutic
 the future.
Case study describing a localized form of the Birt-Hogg-Dubé syndrome in a man with multiple mantleomas that were confine
half of the face, and which, in part, were arranged in the form of plaques.

Case study of a father and his daughter with Birt-Hogg-Dubé-syndrome who were treated with the CO2 laser for facial fbrofol
producing satisfactory results.
No abstract available


Case study reporting the first case of Birt-Hogg-Dubé syndrome in association with a parotid oncocytoma, a rare salivary glan


The authors describe a female patient with Birt-Hogg-Dubé syndrome presenting with multiple, disfiguring papules on the che
and ears. In addition, there was evidence of photoaggravation and inflammatory processes in this case. The patient was treat
erbium:YAG laser.
Case report of a 65-year-old Japanese man presentoing with 'facial warts'.


No abstract available


One hundred fifty-two patients from 49 families underwent complete oral and skin examination. Skin lesions
were identified by their clinical appearance, and the diagnosis was confirmed by results of histologic examination.
Individuals underwent screening for familial renal neoplasms.
Case study of a family who had the triad of tumors of the Birt-Hogg-Dubé syndrome. Two members were observed clinically a
histologically. Biopsies of the facial papules disclosed features of the fibrofolliculoma/trichodiscoma spectrum.
Lesions that were clinically acrochordon-like proved to correspond to the same histopathologic spectrum.
Case study of a father and his daughter in whom we initially diagnosed a BHDS


An 83-year-old man had a past history of adenomatous polyps of the colon. The subject's brother had died from cancer of the
Over the past 4 years, the patient had developed approximately 30 small asymptomatic papulonodular tumors on the trunk.
Skin biopsy demonstrated trichodiscomas.
The syndrome of Birt-Hogg-Dubè (BHD) is an autosomal dominant syndrome, characterized by a triad of cutaneous
 lesions including multiple fibrofolliculomas, trichodiscomas, and acrochordons. There are many clinical expressions,
solitary and multiple forms, with or without other skin tumors. In the literature BHD syndrome has been associated with
internal malignancy. We describe a patient with multiple firm, skin-colored papules in which the three types of lesion are
documented. No signs of systemic disease were present.
No abstract available.


No abstract available.


Two siblings suffering from Birt-Hogg-Dubé syndrome were examined clinically. Electrooculography and electroretinography
according to international standards. Color fundus photographs were taken as well as fluorescein angiograms. The two patien
multiple perifollicular fibromas and trichodiscomas of the skin of the head. Funduscopy and fluorescein angiography revealed
chorioretinopathy in one patient with progressive constriction of visual fields and severely reduced electroretinographic resp
Ophthalmoscopy in his sister showed peripheral pigmentary changes with only minor functional abnormalities.
Case study of a patient patient who had small, elevated, intraoral papules involving the mucosal surfaces of the lips, buccal m
gingivae, which represents a finding that had not been described in the literature previously.

No abstract available.
The syndrome of perifollicular fibromas and colonic polyps was delineated 20 years ago by Hornstein and Knickenberg; it prob
more frequently than suggested by the literature. Multiple perifollicular fibromas were found in a mother and daughter. The
had colonic polyps. This dermo-intestinal syndrome varies in its clinical manifestations, but it is probably an autosomal domin
The general characteristics, mucosal and skin manifestations, and noncutaneous features of all these conditions are reviewed
the associated malignancies of these genodermatoses and other conditions that are characterized by dermatologic manifesta
and may be either familial or secondary to an inherited gene defect are summarized.

Perifollicular fibroma is a cutaneous hamartomatous proliferation of the pilar connective tissue sheath. We describe a patien
perifollicular fibromas and analyze the literature on this topic. Histologically, perifollicular fibroma is characterized by a conce
arrangement of collagen fibers surrounding a generally unaltered hair follicle. Clinically, it is usually multiple and occurs predo
the face and upper trunk. This clinical presentation is similar to that observed in patients with the Birt-Hogg-Dubé syndrome w
addition to perifollicular fibromas, fibrofolliculomas, trichodiscomas, and acrochordons are found. Several reports of multiple
perifollicular fibroma prior to the recognition of this syndrome may, in fact, represent cases of the Birt-Hogg-Dubé syndrome
There are many clinical presentations to fibrofolliculoma, described by Birt, Hogg and Dubé: the solitary and multiple forms, w
other skin tumors, could also be markers of intestinal polyposis. Little is known of its pathogenesis. A case of multiple fibrofol
of the face and neck is described.
No abstract available.


No abstract available.


Case study of a patient with multiple fibrofolliculomas (FF), tricodiscomas (TD) and acrochordons (Birt-Hogg-Dubé)
associated with intestinal polyps. One of the polyps presented histological features of marked dysplasia.

A case of trichodiscomas associated to fibrofolliculomas and acrochordons is presented.


Case study of a family of three with multiple firm, skin-colored papules in whom the three types of lesions are documented.


Two familial observations of Birt-Hogg-Dubé syndrome are reported.


No abstract available


This study is concerned with two families whose various members belonging to two and three generations have the clinical a
lesions of this syndrome. In several biopsies performed, the main finding was the fibrofolliculoma isolated or associated with
perifollicular fibromas; in five biopsies, was noted a typical trichodiscoma associated, in two of them, with a perifollicular fibr
Multiple follicular tumors of the type recently described by Birt and colleagues as fibrofolliculomas were observed in the dors
white man in association with a large connective tissue nevus. No signs of systemic disease or phakomatosis were present. Th
lesions represents benign neoplasia of the fibrous root sheath of the hair follicle in association with proliferations of the infun
of the outer epithelial root sheath. Its existence supports the view that the mesodermal portions of the pilar apparatus can b
neoplastic, and also provides another example of the close interactions existing between the ectodermal and mesodermal co
hair follicle.
In a sibship of nine, six members had hereditary medullary carcinoma of the thyroid. Two of those with thyroid neoplasms an
had numerous small papular skin lesions. These proved to be a type of pilar tumor that we named fibrofolliculoma. Further in
the total kindred of 70 showed no other evidence of thyroid neoplasm. Skin tumors only appeared after the age of 25 years. F
37 members older than the age of 25 years exhibited the typical skin lesions. Obviously, the original sibship was the repositor
dominantly inherited traits. The fibrofolliculoma is characterized by abnormal hair follicles with epithelial strands extending o
infundibulum of the hair follicle into a hyperplastic mantle of specialized firbrous tissue. Associated skin lesions in this kindred
trichodiscomas and acrochordons.
                                                        Methods
nd a family history of similar lesions.




 tory of recurrent spontaneous




martomas, pulmonary cysts,
  for folliculin (FLCN). FLCN is part
more, understanding of the biology
 atment options.
                Patient Recruitment
                Molecular Analysis
  ations have recently been proposed

 by nephrectomy for a left kidney
  follow-up, surgical resection of
 lar biology. In the presence of
 yndrome should be discussed,

              Establishment of cell lines, cell culture, and cell growth.
              Colony formation assay.
              Tumor growth in nude mice.
              Immunoblotting.
              Immunohistochemistry.
              ELISA.
              RNA isolation, microarray analysis and pathway analysis.
              Quantitative real-time reverse transcription-PCR
              Patients and samples
              Molecular genetic analysis
              Statistical analysis
 nhanced molecular genetics
 g von Hippel-Lindau disease,
 ancer. Early molecular diagnosis now
ilies are discussed
              Between 1995 and 2008 we identified 58 patients with hereditary renal cell carcinoma treated at our institution with
              partial nephrectomy for solid tumors greater than 4 cm. Data collected included demographic parameters, tumour size,
              pathological findings and laterality.
              Mutation analysis of the FLCN gene
more accurate
had denaturing high performance
 PLC, the amount of each FLCN exon
us pneumothoraces.
 e lesions to be fibrofolliculomas.
e are a recognized association.




he right shoulder.
 e had been growing gradually
 treated with a right-sided surgical
 identical lesions over her face a

              Immunohistochemistry
              Ultrastructural Examination
              FISH
              c-kit , PDGFRA , and VHL mutation analysis
              FLCN mutation analysis
 sis that predisposes
ancers, due to mutations in the FLCN
DS: Blood samples of three
quencing was performed.
anized and specific tests
 h BHDS patient.
 amilies. The first proband showed
brother and two sisters, who were
  mother, who had FF. The third
ely wide intra- and interfamilial
patients, no genotype-phenotype
or each member of a BHDS family
copy and annual kidney imaging.
ffected patients are predisposed
eumothorax. The responsible gene
on the neoplastic changes in the skin
umorigenesis is not well understood.
 thophysiology of lung cysts formation.
          Plasmid construction
          Linkers and Primers
          Cell culture, plasmid transfection and drug treatments
          Antibodies
          Immunoblot analysis and immunoprecipitation
of pneumothorax


tection and treatment of

           Development of BHD knockout mouse model
           PCR Based BHD Genotyping
           Quantitative Real time PCR
           Whole Mount In Situ Hybrdization
           Histological and Immunohistochemical Analysis
           Western Blotting and Antibodies
           Tissue Genotyping by Southern Blotting.
           Endogenous FLCN Detection by Duolink System.
           Generation of a FLCN mouse model.
           Northern blot and semi-quantitative reverse transcription-PCR analysis
           Western blot analysis.
           X-Gal staining and Immunohistochemistry of adult mouse tissues.
           Human renal cell carcinoma cell lines.
           In vitro and in vivo growth analysis of RCC cell lines ad in vitro S6 activation assay
           Full histological examination.




           Clinical assessment and histologic assessment


            Growth rate and Double Time Determination
            Chromosome Analysis
            Morphological Examinatons
            Gene Analysis
(LOVD) software.
d novel germline FLCN mutations.
etion/insertions (5.7%).


           Immunostaining
           DNA Isolation
           Single-strand conformation polymorphism
           Plasmid constructs and transfection
           Western Blots
           Twenty-two patients with clinical and histological criteria of BHDS confirmed by BHD germline mutation were
            evaluated.
            Lung cysts, and pneumothorax were detected by thoracic computed tomography (CT) scan.
            Abdominal magnetic resonance imaging (MRI) or CT scans and/or renal ultrasonography were performed
            to screen for tumours. Thyroid nodules and goitres were assessed by clinical examination, ultrasound
            imaging, and measurement of serum thyroid-stimulating hormone (TSH) and thyrocalcitonin.
            Thin-section chest CT scans of consecutive 12 patients with genetically diagnosed
            BHD syndrome were retrospectively evaluated by two observers, especially about the characteristics
            (distribution, number, size, shape and relation to pleura) of pulmonary cysts. Interobserver agreement in
            the identification of abnormalities on the CT images was achieved using theκ statistic, and the degree of
            interobserver correlation for the characterization of pulmonary cysts was assessed using the Spearman
            rank correlation coefficient.




            Histopathology and immunohistochemistry
            Cytogenetics
            DNA preparation
            Polymerase chain reaction amplification of selected cancer genes
            Mutations scanning by Surveyor Nuclease analysis and fragment analysis
            Mutation identification by DNA sequencing
            DNA methylation analysis by COBRA PCR

             Plasmid Construction
             Site directed mutagenesis
             Kinase Assays
             RNA Intereference
gulation of tuberin




            Chest CT
            Family History Investigation
            Genetic Analysis
            The histopathological and immunohistochemical features of FF/TD and FP lesions were
            revaluated to study the relationship between the two. This investigation evaluated 20 FF/TD lesions
            including two cases of BHD syndrome and 35 FP lesions including three cases of tuberous sclerosis.

 autosomal dominan
, compatible with
é syndrome. BHDS is the autosomal dominant predisposition to the development of follicular hamartomas, lung cysts, spontaneous pneu
N encodes a predicted 579-amino acid protein, designated folliculin that is highly conserved between humans and homologs in mice, Dro
orted in the literature. The FLCN database applies, and assists researchers in applying HGVS nomenclature guidelines.
ority of FLCN germline mutations are predicted to produce a truncated folliculin, resulting in loss of function.
te, 5 nonsense, and 2 missense), 15% (8/53) duplications, 6% (3/53) insertion/deletions and 2% (1/53) insertions.
eneticists and genetic counselors while also providing a rapid and systematic resource for investigators


             Family History
             Antenatal diagnosis of lung pneumothorax
             Pulmonary function test
             High resolution CT of chest
             Mutation analysis


             Generation of a BHD mouse model
             Real-time quantitative reverse transcription-PCR analysis
             Small-interfering RNA transfections
             IHC analysis for phospho-S6 in oncocytic cysts and tumours
             Western blot analysis
             Chest CT
             Family History
             Mutation analysis
             Histopathologcal examination of one (of ten) angiofibromas from a male
             TSC patient was identified as being a fibrofolliculoma

             Design and generation of BHD conditional knocout construct
             identification of homologous recombinant ES cells and generation of
             kidney specific knockout mice
             Genotyping
             Western blot analysis
             IHC and tubular marker staining (FLCN, mTOR and phospho S6)
             Phenotyping and histopathologypathology
             Blood biochemical analyis
             Rapamycin treatment of knockout mice and wild-type
             control littermates.
             Patient recruitment
             Segregation analysis
             FLCN mutation analysis

. The purpose of
to evaluate
susceptibility.
             Plasmid constrction
             Northern blot analysis
             Cell culture and plasmid tranfection
             Immunoprecipitation and cell fractionation
             Western blot analysis
             ICC
             In vitro translation and in vitro kinase assay.
             RNA intereference

 spectively in

uding stomach,
dermatological


             Mutational analysis of exons 4-14 of BHD was undertaken
             Histopathological exmnation of facial fibrofolliculomas

             FNIP2 identification and bioinformatic analysis.
             Antibodies
             Immunoprecipitation
             Western blot analysis




essential that
 e lifesaving. The
ogg-Dube (BHD)


 en previously reported
 OPD probands
4 folliculin exons in a subset
COPD subjects
on from the




             Patient recruitment and evaluation
             BHD mutation analysis
             Statistical analysis
             Multiple sequence alignment of the folliculin protein
             Literature review


             Tissue Culture, Establishment of Transplantable Cell Line and sub-clone lines
            Cell Proliferation and Metaphase Preparation
            Cell Pellet Fixation and Thin Section for Ultrastructural Studies
            DNA Probes Preparation and DNA Sequencing Analysis
            Sky Analysis and FISH with Chromosome-specific Probes
            Image Acquisition
            Generation of BHD conditionl targeting vector and kidney
            specific BHD targeted mouse.
            Southern blot analysis of ES stem cells
            PCR genotyping of BHD knockout mice.
            Immunoblot analysis of FLCN
            qRT-PCR expression analysis of the BHD gene.

             Magnetic resonance imaging to examine kidney function in
             knockout mice.
             Phenotype evaluation and hostpathology
             Blood urea nitrogen analyses to measure kidney function
             Rapamycin treatment of knockout mice and control
             Renal tube cell prmary culture
             IHC and IF analysis of cell cycle markers and Akt-mTOR and
             Erk-MEK1/2 pathway signalling.
e and in a sporadic case.


n rats, a model
 he lateral abdominal
y, the nodules
  amounts of
 shaped cells showed
ugh the etiology
actors, surgical
s, and genetically
n the Nihon rats
 of the tumor,
utation is not




            Histology of fibrofolliculoma


            Tissue samples and DNA extraction
            Sequencing analysis
            SNP analysis
            Methylation analysis of the BHD promoter region
            Statistical analysis
            Patients and clinical studies
            Mutation analysis
            Imaging studies

            Yeast Strains, Media, and Growth Conditions
            Construction of bhd+, bhd+tor1+, and bhd+tsc1+-deficient Strains
            Construction of Plasmids
            BHD Plasmid Construction and Transfection
            Expression Profiling
            Western and Northern Blot Analyses
            Real Time Reverse Transcriptase-PCR
            We retrospectively reviewed five patients with BHD syndrome evaluated at the Mayo Clinic Rochester
            from 1998 through 2005.

            Mutation analysis of the BHD gene
            Reverse transcription PCR of BHD mRNA




            DNA preparation, SSCP and sequencing analysis of the BHD gene
            Microsatellite LOH analysis
            Measurement of gene expression by real-time quantitative PCR
            Hierarchical clustering analysis of the RQ-PCR data
            Patient Recruitment and Evaluation
            BHD sequence analysis
            Statistical Analysis

            Four patients with BHD syndrome and renal cell carcinoma presenting to our service between the period from 2000
            and 2003 were included. Their files were reviewed for age, sex, onset of diagnosis of BHD syndrome, symptoms
            and signs, imaging, management, histology, follow up and outcome were recorded.


me are described.


er countries. Recent advances in the basic research and molecular diagnostics of this malignancy have revealed that RCC
 anisms and pathological attributes. RCC is now divided into clear cell carcinoma (80% of all kidney cancers), papillary type 1
c features, called the Birt-Hogg-Dube (BHD) subtype, in roughly 5% of all patients. Apart from these, neoplasms
nal presentation. In this review, molecular evidence, both direct and indirect, published so far on all these RCC subtypes
parate malignancies that happen to occur in a single organ, i.e., the kidney. We believe that the role played by the expression and
ng levels of hypoxia induced within these tumors may be the most common denominators. Evidence is presented focusing on
  these RCC subtypes and how their function could be influenced by hypoxia, activities of receptor type protein tyrosine kinases
 may help explain the occurrence of all these RCC subtypes in a molecular manner. We hope that these analyses would a) stimulate
  subtypes and b) would pave way to a better and rationally designed therapies to interfere with their function to benefit patients with RC
              We used all data available after performing a literature search using MEDLINE and searching under the
              headings “Birt-Hogg-Dubé,” “hybrid oncocytic tumors,” and “folliculin.”
              PCR and mutation detection
              RT-PCR and LOH studies


              Molecular Genetic Analyses




 in the kidney, each with a different histologic type, having a different clinical course, responding differently to therapy and
renal neoplasms, including von Hippel-Lindau (VHL), hereditary papillary renal carcinoma (HPRC), Birt-Hogg-Dubé (BHD),
 he different genes for these cancers. The genetic basis for each of these has been identified with current investigation
milial forms of kidney cancer should provide the opportunity to determine successful approaches for novel therapeutic agents.
              Molecular analysis




            Identification of FLCN- and FNIP-1-Interacting Proteins.
            Molecular Cloning of Human FNIP1 cDNA.
            Antibodies.
            Immunoprecipitation, Western Blotting, and Northern Blotting.
            Immunofluorescence Microscopy.
            Plasmids, Transfection, Recombinant Protein Expression, and Purification.
            In Vitro Binding Assay.
            AMPK in Vitro Kinase Reactions.
            Metabolic Whole-Cell 32P Labeling.
ntaneous pneumothorax and was found to have multiple lung cysts and renal tumors on computed tomography.
-called hybrid oncocytic tumor. We also describe the gross and histologic findings of the multiple
patient appear oncycytic on fine needle aspiration, especially when focal clear cells are present,




rome, Cowden syndrome, Carney
vances in the molecular genetics of

            Microdissection and DNA extraction
            MSI analysis
            Mutation screening of BHD, BAX and TGFßRII genes
            Statistical analysis
disease. While
 l spontaneous pneumothorax have
olecular underpinning of this

 a with microsatellite instability,
(C)8 tract in exon 11 as well as other




              In situ hybridization
              Immunofluorescence staining and microscopy
              Generating GFP-marked germline stem cell clones
              Detection of apoptosis
              Quantitative RT–PCR assay for Drosophila BHD homolog and RP49 mRNA levels
eous lesions, an increased risk of renal and colonic neoplasia, and the development of pleuropulmonary blebs and cysts. Although the pat
 athologic findings from biopsies of 2 BHD patients with spontaneous pneumothorax: 1 with known BHD and another clinically suspected
wall and blebs consisting of collections of air within the pleura. Although these histologic findings are not specific to BHD, their predomina
rtant for pathologists to be aware of this rare cause of spontaneous pneumothorax because BHD can radiographically simulate other caus
 Pathologists should raise the possibility of BHD in nonapical lung biopsies from young or middle-aged patients that show blebs or cysts.
tain whether suppression of the Nihon
 ppression of renal carcinogenesis in
an embryonal lethal and tumor

              Haplotype Analysis
              Sequencing Analysis
              Restriction Fragment Analysis of Mutations
lomas, trichodiscomas, and acrochordons. Since the first description in 1977, many conditions have been described in association with its
stological findings of the clinical lesions are distinctive. We report a patient with a history of melanoma who presented for routine surveil
 management, and a review of the Birt–Hogg–Dubé Syndrome are discussed.




            Mutation analysis




            Mutation Analysis of the BHD Gene
            BHD Haplotype Carrier Analysis
            Statistical Analysis

            Pathology
            Analysis of BHD gene

            A total of 124 affected individuals underwent comprehensive clinical evaluation, including body
            computerized tomography, to determine cutaneous, pulmonary and renal manifestations of BHD.
            Of these individuals 14 had their renal tumors managed at our institution
             Haplotype analysis
             DNA sequencing
             Restriction fragment analysis of mutations
             Dermatological investigation of fibrofolliculoma




             Genome wide scan.
             Mutation anlaysis

             Mutation analysis


mor development, is inherited as an autosomal dominant trait due to a single germline nucleotide insertion mutation in the rat Bhd orthol
  ork. The earliest lesion of the RCC was identified as an altered tubule at as early as 3 weeks of age and rapidly progressed through adenom
 ium, clear cell change of the epithelium of striated portions of salivary glands, and cardiac rhabdomyomatosis. This rat model of hereditar
 s of renal cancer, specifically clear cell, papillary type 1 and papillary type 2. Genes predisposing to the more rare chromophobe renal car
  the germline of affected family members with the Birt-Hogg-Dubé (BHD) syndrome. These patients develop the hallmark BHD skin lesion
y of renal neoplasia, most commonly chromophobe and oncocytic hybrid tumors. This review will describe the phenotypic manifestations
HD mutation spectrum found in BHD patients, and will discuss the potential role of BHD as a tumor suppressor gene.
 om tubular epithelium and myometrial compartments of the kidney and uterus, respectively. These tumors have a very different clinical p
 e distinct histologically, with RCC arising from epithelial cells and leiomyoma arising from smooth muscle cells, they share a common emb
mooth muscle cells of the uterus. In addition to a common embryological origin, RCC and leiomyoma have been demonstrated to share a
mor suppressor gene and develop spontaneous RCC and uterine leiomyoma with a high frequency. TSC patients are also at risk for RCC, an
 mline defects in the fumarate hydratase (FH) gene develop papillary RCC and uterine and skin leiomyomas. Benign cutaneous lesions and
essor genes involved in these diseases, TSC, FH and BHD, and the elucidation of the function of their protein products, tuberin, fumarate h




             In Situ Hybridization Probes
             Tissue Preparation, Pretreatment, Hybridization and Signal Detection

             Tissues Samples, Mapping, and RC-Derived Cell Lines.
             RNA Isolation, Northern Blot Analysis, and cDNA Amplification.
             DNA Isolation, Southern Blot Analysis, and Loss of Heterozygosity (LOH) Analysis
up of a number of different types of cancer that occur in this organ. Clear cell renal carcinoma is characterized by mutation of the VHL gen
ypoxia-inducible factors 1 and 2 for ubiquitin-mediated degradation. VHL–/– clear cell renal carcinoma overexpresses
d the epidermal growth factor receptor are potential therapeutic targets in clear cell renal carcinoma. Studies of the hereditary form of re
of sporadic papillary RCCs. The HPRC c-Met mutations are activating mutations in the tyrosine kinase domain of the gene. The gene for a
. Studies are currently under way to determine what type of gene BHD is and how damage to this gene leads to kidney cancer. Individuals
apillary RCC. The HLRC gene has been found to be the Krebs cycle enzyme, fumarate hydratase. Studies are under way to understand the
            BHD mutation analysis
            Sequencing of PCR products
            BHD promoter methylation analysis
            BHD gene expression analysis by RT-PCR
            Bisulphite modification and methylation analysis

           Statistical analysis
           Genomic DNA isolation
           Partial canine gene sequences were obtained
           Construction of DNA minilibraries and screening for microsatellites
           Linkage and recombinant mapping
           Haplotype sharing analysis
           Cloning and sequencing of the canine BHD gene
           Mutation detection
           mRNA isolation, northern analysis and 5-RACE
           Comparison of kidney tumor histologic types
a, who were additionally diagnosed with


etic susceptibility locus,
ents and their family members.

more recently associated finding


            Sequencing Analysis.
            LOH Analysis.
            Genomic Characterization of BHD Promoter Region.
            Methylation Analysis.
            Statistical Analysis.




            DNA isolation and MSI analysis
             Mutation analysis of the BHD gene
             Statistical analysis




 t-Hogg-Dubé syndrome.


             Genotyping
             Haplotyping
             Loss of heterozygosity (LOH) analysis
             Mutation analysis

             Renal Pathology
             DNA analyses
 tional review

ol approved by
 ry skin biopsies


 s the diagnosis of

re found to have

y our group.
family history of similar lesions.


 as and trichodiscomas in two patients




             Patient recruitment and sampling
             Development of microsatellites
             Candidate gene selection and analysis
             Analysis of the BHD gene
             Northern blot analysis
             Somatic cell hybrid cell lines
             Isolation and sequencing of full length BHD cDNA clones


             Identification of BHD Haplotype Carriers
             Statistical Analysis.
predisposed




hods were used to evaluate
n each are associated
 risk for internal




years duration. His father, sister and
ofolliculomas in all three cases.
rachnoidal hemorrhage due to aplasia




            Skin and oral pathology
            Suspected fibrofolliculomas biopsied for histology
            DNA extraction from blood
            Renal ultrasound and abdominal CT
            Colonoscopy to detect colonic polyps.
            High-resolution thoracic CT scan to detect air-filled lung cysts (blebs).
            Standard chest CT and chest x-ray examination to look for evidence of old or new pneumothoraces.
            Genomewide scan
            Two point linkage analysis
by benign skin
we performed a

 D17S1852.
7S1791 and D17S798.


  relationship between the VHL gene
ontinues to be unraveled. New
e been identified and the search for
n understanding of sporadic kidney
omes, the genes that cause them, new
 nostic, and therapeutic methods of

omas that were confined to the left


2 laser for facial fbrofolliculomas,
ma, a rare salivary gland tumor.


uring papules on the cheeks, nose,
e. The patient was treated with an

            Dermatologogical investigation of facial skin lesions




            Dermatologic criteria: mucocutaneous legions were diagnosed clinically
            DNA extraction and mutation analysis

ere observed clinically and




died from cancer of the colon.
r tumors on the trunk.

of cutaneous
al expressions,
en associated with
 types of lesion are




nd electroretinography were performed
 ograms. The two patients showed
 n angiography revealed a flecked
ectroretinographic responses.

ces of the lips, buccal mucosa, and
and Knickenberg; it probably occurs
 her and daughter. The mother also
bly an autosomal dominant trait.
conditions are reviewed. Also,
dermatologic manifestations


h. We describe a patient with multiple
haracterized by a concentric
ultiple and occurs predominantly on
-Hogg-Dubé syndrome where, in
 eral reports of multiple
t-Hogg-Dubé syndrome.
ry and multiple forms, with or without
case of multiple fibrofolliculoma




 -Hogg-Dubé)




 ions are documented.




 tions have the clinical and histological
 ated or associated with
 with a perifollicular fibroma.
  re observed in the dorsal skin of a
matosis were present. This type of
  oliferations of the infundibular portion
  e pilar apparatus can become
mal and mesodermal components of the
h thyroid neoplasms and two without
ofolliculoma. Further investigation of
er the age of 25 years. Fifteen of
bship was the repository of two
lial strands extending out from the
n lesions in this kindred were
                                   Relevant findings




So far, no clear evidence of genotype/phenotype correlations has been observed in BHDS. The phenotype appears to be varia
In this series, we observed five heterozygotes for FLCN mutations who had not developed any manifestation at the age of 62,
compared with other pedigrees in this series, and segregated an exon 12 mutation. Interestingly, an association between pul
To conclude, the results obtained in this study add further information on BDHS phenotype and FLCN mutations and will be h




This study demonstrates a role for FLCN in the regulation of key molecules in TGF-β signaling and confirm deregulation of the
FLCN inactivation is likely to be an important step for tumorigenesis in BHD syndrome.




These findings suggest that the previously reported clinical heterogeneity for colorectal neoplasia may reflect allelic heteroge




Metastasis-free and overall survival of our patients is similar to that in the literature of those who undergo partial nephrectom
intermediate followup. Partial nephrectomy can be offered to patients with hereditary disease who present with multifocal t

BHD syndrome is due to large deletions as well as small nucleotide alterations. Racial differences may occur between Japanes
It is important to consider a possible diagnosis of Birt-Hogg-Dube syndrome in cases of recurrent pneumothorax. Affected ind




Genetic studies confirmed a mutation of folliculin, a novel protein with tumour suppressor effects. The actual mutation was s




No pathogenic mutations were found in the VHL, c-kit, PDGFR, and folliculin (FLCN) genes. We have shown that hybrid oncocy
Birt-Hogg-Dubé syndrome and without associated renal oncocytosis. These tumors constitute a relatively homogenous group
Sporadic hybrid oncocytic/chromophobe renal tumors are characterized by multiple numerical aberrations (both mono- and
c-kit, PDGFRA, and FLCN genes. The tumors seem to behave indolently as no evidence of malignant behavior was documente
nature of this rare neoplasm. At worst, these tumors could have a low malignant potential, which only can be found out with




Two novel BHD gene mutations in two Italian families. The first one in exon 10 (c.1127 G>A) in a patient
presenting with fibrofolliculomas of the skin, renal angiomiolipoma and a rare tumor of the lung with histiocytoma features. T
second one in exon 12 (c.1429C>T) in a patient presenting with fibrofolliculomas of the skin, lung cysts and a history of recurr
pneumothorax. To the best of the present authors' knowledge, mutation in exon 10 and association of BHDS with
pulmonary histiocytoma have not been previously reported.
Our analysis suggests that Ser62 phosphorylation is indirectly up-regulated by AMPK and that another residue is directly phos
Ser62 phosphorylation is increased. A phospho-mimic mutation at Ser62 enhanced the formation of the FLCN–AMPK comple
These results suggest that function(s) of FLCN–AMPK–FNIP complex is regulated by Ser62 phosphorylation.




Our data are consistent with a common consequence of BHD inactivation in mouse and man, regardless of BHD mutation typ
an important mechanism driving kidney tumorigenesis in BHD syndrome. Rapamycin does not inhibit mTORC2 effectively, wh
knockout mice. Taken together, data generated from our two BHD mouse models suggest that mTORC2 as well as mTORC1 in
effective form of therapy for patients with BHD-associated kidney cancer.




In order to clarify the functions of FLCN during tumor formation, we generated a mouse model of BHD. Our results demonstr
gene in mice is lethal prior to embryonic day (E) 8.5. We also extensively characterize the expression pattern of FLCN in adult
expressed but differed in certain key tissues when compared to the human expression. In addition, heterozygous Flcn knocko
of Flcn expression, and we confirmed tumor suppressor function of FLCN in two independent human RCC cell lines using a xen
loss of Flcn is associated with opposing impact on S6 activation, which may lead to formation of several molecular types of RC
fide renal tumor suppressor gene with a general function in renal oncogenesis.
In conclusion, the co-expression of CD34 and factor XIIIa in the perifollicular specialized stromal cells, unreported until now in
fibrofolliculomas, and supporting a common origin for the two types of dermal dendritic cells, or, at least, a possible transitio
The second peculiar feature is the presence of a pseudosarcomatous spindle cells component CD34- positive haphazardly infi
specialized periappendageal stromal cells.
Fibrofolliculomas have reproducible dermoscopic features which, if multiple, should prompt consideration of a diagnosis of B


This study has succeeded in establishing renal carcinoma cell lines from an RCC in a Bhd gene mutant (Nihon) rat. Although th
characteristics, as well as the metastatic behavior, all of the 7 NR cell lines had an insertion of a C in a 5-C tract in exon 3 of th
downstream .




the present study provides an insight into the lung cyst formation in BHD syndrome-associated pneumothorax. We demonstr
syndrome and localization of FLCN in human lung tissues. We also discussed several patterns of sequence repeats in affected
homeostasis. Further investigation is necessary to understand the pathological cascade of the abnormal cystic changes, uniqu
BHD gene mutation-harboring lungs.

This study reports the largest series of French patients with BHDS. They noted a high prevalence of thyroid nodules and rena
not allow assessing whether or not such association with BHDS is fortuitous.




Multiple, irregular-shaped cysts of various sizes with lower medial lung zone predominance are characteristic CT findings of B
lower pulmonary arteries or veins may also exist in this syndrome in a high probability.




We found that in diverse histologic types of renal tumors that are typical of BHDS, additional characteristic/tumor-defining m
the germline FLCN gene and result in hybrid morphologic presentation (eg, oncocytic papillary carcinoma). In addition, we fou
associated with BHDS. Further functional genetic studies are warranted to determine if the FLCN gene has a role in chromoso




Relationship of mTORC1-dependent pathways with FLCN function and phosphorylation suggests that dysregulation of those p
We and others reported the possibility of mTOR activation by FLCN. In recent reports using Bhd knockout mice, development
signal transduction systems including mTORC1-related pathway in those lesions were reported. It is expected that FLCN could
in a context-dependent manner. With regard to FLCN phosphorylation at S62 and S302 sites, identification of responsible kina
AMPK-dependent pathways as well as other signaling pathways will facilitate the understanding of BHD mutation-related pat




Hereditary kidney cancer syndromes offer valuable insight into the pathogenesis of kidney cancer through identification of th
hereditary and sporadic forms of disease. An understanding of the manifestations of these diseases is necessary to allow for a
the opportunity for appropriate screening. Conservative management strategies have been developed and should be followe
Confirmation of Birt Hogg Dube Syndrome in a Japanese family.


Both FF/TD and FP are hamartomas composed of perifollicular or interfollicular connective tissue
and a hair follicular epithelial component, which may be caused by an abnormal functioning of the hair follicle bulge cells.
ysts, spontaneous pneumothorax, and/or kidney neoplasms.
 homologs in mice, Drosophila, and C. elegans.




            We report a family with lung cysts and spontaneous pneumothorax in three generations, in whom a deletion mutation was id
            There was no evidence of skin lesions in the family. There was no history of renal or other neoplasia that might be expected a
            Mutations in FLCN cause the BHD syndrome and mutations have been identified along the entire length of the gene (exons 4,
            The isolated pneumothorax phenotype has previously been reported in association with mutations on exon 4 5 and exons 9 a
            (and exon 10) encode functional domains particularly relevant to lung development. It is interesting to note that, among pati
            significantly fewer renal tumours were observed in patients with c-deletion than those with c-insertion mutations . An alterna
            the BHD tumour phenotype requires the presence of additional modifier genes absent in the isolated pneumothorax families
            The mice developed spontaneous oncocytic cysts and tumors composed of cells that resemble the renal cell carcinomas in BH
            patients. The cysts and tumors had low levels of phospho-S6. Taken together, these data indicate that folliculin regulates the
            activity of TORC1, and suggest a new paradigm in which both inappropriately high and inappropriately low levels of TORC1 ac
            be associated with renal tumorigenesis.

            This case emphasizes that pulmonologists need to be aware of the Birt–Hogg–Dube´ syndrome, which is rare but is probably
            with cystic lung disease or spontaneous pneumothorax. It also emphasizes that a family history is important for providing dia

            This study supports suggestion that a relationship exists between BHD syndrome and TSC and may further suggest a relations
            between fibrofolliculomas/trichodiscomas and fibrous papules/angiofibromas.

            This study provides the first evidence that FLCN predminantly expresses in the proximal tubules and collecting ducts of the re
            Conditional mouse model demonstates hat the deletion of BHD in the mouse kidney leads to cystic renal cell carcinoma hyp
            in addition to polycistic kidney and




            The accurate diagnosis of inherited kidney cancer syndromes such as von Hippel-Lindau disease allows prediction of tumor ris
            to be undertaken to reduce morbidity and mortality. However, the inheritance patterns and tumor risks in patients with nons
            are not well defined. We report the clinical and genetic features of 60 kindreds containing two or more cases of RCC and no e
            syndrome. Segregation analysis was most consistent with autosomal dominant inheritance with sex- and age-dependent pen
            counseling and surveillance of families with nonsyndromic familial RCC. In addition, we investigated whether some patients w
            inherited susceptibility to RCC might have unrecognized Birt-Hogg-Dube syndrome. A germline FLCN mutation was detected i
            recommend these patients are offered germline FLCN analysis (in addition to constitutional cytogenetic and VHL gene mutati
The use of siRNA, identified a decrease in S6K1 phosphorylation in BHD-suppressed cels.
Additionaly a decrease in S6K1 phosphorylation in FNIP1- and, to a lesser extent, in FNIPL/FNIP2-suppressed cells was oberve
These results suggest that Flcn-FnipL/Fnip2 and Flcn-Fnip1 complexes positively regulate S6K1 phosphorylation and that
FnipL/Fnip2 provides an important clue to elucidating the function of Flcn and the pathogenesis of BHD.




Patient demonstarted a novel frameshift mutation in exon 14 of BHD predicted to esult in a truncated protein. Mutation not
as a common/rare variant in the normal population indicating it's pathogenicity.

This report identified a novel FLCN-interacting protein, FNIP2, with homology to FNIP1 that is conserved across species. FNIP2
with the C-terminal half of the folliculin tumor suppressor protein and with an important nutrient- and energy-sensing molec
of mTOR. Importantly it demonstrates that FNIP1 and FNIP2 can form multimers independent of FLCN expression, suggesting
independently or cooperatively with FLCN. Their differential expression in human tissues may indicate tissue-specific roles for




Genetic variation in folliculin does not appear to be a major risk factor for severe COPD. These data suggest that familial spon
despite some overlap in radiographic characteristics.




In our patient, clinical signs of the BHD syndrome were not completely developed. Typical skin lesions were not detected, ma
it even more difficult to include BHD syndrome in the differential diagnoses. In the literature, patients with missing typical ski
retrospectively, combining all the information on pathology, patient’s history, and family history. This clearly shows the neces
Advances in the diagnosis of BHDS using molecular genetic techniques has allowed us to expand the BHDS phenotypic spectru
and demonstrate clinical heterogeneity both within and among BHDS families. Although we report a large group of families, o
genotype–phenotype correlations rigorously. However, this should be possible in the future by combining our clinical and BH
BHDS patients and families with that from other centres. Future characterisation of BHD mutations and genotype–phenotype
valuable insights into the molecular pathogenesis of BHDS. Future clinical studies and laboratory investigations using in vitro s
to elucidate the sequence of pathogenetic events that lead to the clinical findings and the organ preference of involvement th

Due to the distinctive histological, morphological and genomic characteristics of UOK 257 that correlate with tumor cells deri
Birt-Hogg- Dubé patients, as well as the potential to grow this line in vitro as well as in xenograft models, this line serves as an
valuable resource to be used in studying the mechanism of this disease. In addition, UOK 257 shares many characteristics wit
chromophobe renal carcinomas and renal oncocytomas and may serve as an excellent model to examine these diseases as w
Furthermore, this line will facilitate the ability to characterize molecular markers for diagnosis and prognosis of FLCN, as well
drug therapies for the disease.
BHD knockout mice developed enlarged polycystic kidneys and died from renal failure by 3 weeks of age.
Targeted BHD knockout led to the activation of Raf-extracellular signal-regulated protein kinase (Erk)1/2
and Akt-mTOR pathways in the kidneys and increased expression of cell cycle proteins and cell proliferation.
Rapamycin-treated BHD knockout mice had smaller kidneys than buffer-treated BHD knockout mice had
(n = 4-6 mice per group, relative kidney/body weight ratios, mean = 4.64% vs 12.2%, difference = 7.6%,
95% confidence interval = 5.2% to 10.0%; P < .001) and longer median survival time (n = 4-5 mice per group, 41.5 vs 23 days;
 P = .0065 ). Therefore, Homozygous loss of BHD may initiate renal tumorigenesis in the mouse.
The conditional BHD knockout mouse may be a useful research model for dissecting multistep kidney carcinogenesis,
and rapamycin may be considered as a potential treatment for Birt-Hogg-Dubé syndrome.




Mutations in the folliculin gene are associated with cystic lung lesions in an otherwise morphological normal lung and predisp




Fibrofolliculoma is a very rare benign tumor of the skin that is derived from the perifollicular sheath. The tumor commonly pr
papules predominately over the scalp, face, oral cavity, neck, and upper trunk. Microscopically, the tumor shows a well-circum
The neoplastic epithelial cells form thin anastamosing cords that radiate from the central hair follicle. The perifollicular strom
BHD and TP53 may play an important role as tumour suppressors in chromophobe RCC




BHD should be suspected not only in patients with the classical dermatological manifestations but also in patients with few o
             without fibrofolliculomas and/or trichodiscomas who may present with (familial) renal tumors and/or spontaneous pneumot
             of renal tumors and spontaneous pneumothorax in BHD families may vary due to yet unknown reasons. Additional insight wi
             and molecular studies.
             Knockout of the FLCN homolog in S. pombe showed that FLCN, which is thought to act at the level of AMPK, has an opposite




             We conclude that cystic lung disease in BHD syndrome varies widely in severity, mimics pulmonary lymphangioleiomyomatos


             We found that germline mutations of the BHD gene are involved in some patients with multiple lung cysts and pneumothorax
             isolated phenotype with pulmonary involvement.




             Our present data suggest that the BHD gene should also be considered a new candidate responsible for the papillary variant o
             tumour case is likely to deviate somewhat from the conventional renal tumour classification. Further analyses concerning the
             BHD-associated papillary RCC and how it compares with other papillary RCC variants will be of interest. A functional study of
             to elucidate the mechanisms of tumorigenesis for this unique RCC subtype.
             This study indicates that patients with BHDS have a significant association between lung cysts and spontaneous pneumothora




             A high index of suspicion should be present in patients who present with the characteristic BHD syndrome skin lesions. As the
             consistent (in the series 1–35 years), the evaluation and follow up should start as soon as the diagnosis of BHD is established.
             tumors must have long term follow up. Given the need for screening and long term follow up of these patients, screening ren
             resonance imaging might be preferable to CT to avoid excessive radiation exposure. We also conclude that the principle of pa
             and utilizing the 3-cm threshold is as applicable in patients with BHD syndrome as in patients with other hereditary RCC.




 expression and
 ocusing on
osine kinases
 ould a) stimulate
benefit patients with RCC and possibly other cancers.
             The presence of BHD syndrome should be investigated in any patient with multiple bilateral kidney tumors, especially if the p
             the so-called hybrid oncocytic tumor. The genetic alteration for BHD syndrome has been mapped to chromosome 17p12q11,
             for the BHD syndrome. The function of the BHD product, called folliculin, is still unknown, although it is speculated to be a tum
               BHD gene. Studies are ongoing to determine the relationship between the BHD gene and development of sporadic renal cell c
               Our results obtained in fibrofolliculomas from BHD patients suggest that tumorigenesis in this syndrome does not necessarily
               Rather, haplo-insufficiency may be sufficient to cause uncontrolled growth and subsequent carcinogenesis in susceptible tissu
               proliferations in BHD syndrome (Pavlovich et al., 2002) remains to be determined. These lesions are thought to be the precur
               microscopic oncocytosis to be heterozygous for the BHD germline mutation.
               Systematic molecular classification of 49 patients with unexplained hamartomatous or hyperplastic polyposis uncovered a po
               Importantly, given the substantial proportion of patients found to have germline mutations, more extensive analysis of the kn
               dedicated gastrointestinal pathologist should be considered routinely, as organ-specific surveillance rests on defining syndrom




utic agents.
               Genotype–phenotype correlations remain to be evaluated for BHD, but it was recently suggested that significantly fewer rena
               C-insertion mutation among patients with a mutation in the exon 11 hotspot.6 To date, our patient and her son have no rena
               more information on the specific phenotype of this new mutation.
               Lastly, our observation confirms that dermatologists must systematically propose a molecular analysis of the BHD gene in any
               absence of typical cutaneous lesions in the family history.
               Based on these findings, we hypothesize that FNIP1 and FLCN might be downstream effectors of mTOR and AMPK and modu
               some as-yet-unknown molecular mechanism. Further clarification of FLCN function as a tumor suppressor may contribute to
               other hamartoma syndromes caused by mTOR dysregulation.




               The BHD gene is a target gene in MSI-high gastric cancer. However, its mutational frequency is lower than that of BAX, TGFRII
               tend to occur downstream of these target gene mutational events. BHD may not be a critical gene involved in MSI-high gastri




               these findings show that the BHD gene is a target gene in MSI endometrial carcinoma. However, its mutational frequency is lo
             acquisition of mutations in another MSI target gene, BAX.




             Our current study demonstrates that the Drosophila ortholog of the human tumor suppressor gene BHD regulates male GSC
             signal-transduction pathways. The human BHD protein, folliculin, may control tumor development either through modulating
             TGF- signal-transduction pathways. Reducing the DBHD activity in the fly testis causes a loss of GSCs. Mutations in certain hum
             and testicular tumors owing to the overproliferation of Sertoli cells or other somatic gonadal cells (Chomette et al., 1985; You

 cysts. Although the pathology of renal and cutaneous manifestations of BHD has been well described,
her clinically suspected to have lymphangioleiomyomatosis. Histologic features included basilar cysts
 o BHD, their predominantly basilar location contrasts with the apical distribution of other more well-recognized
ally simulate other causes of pulmonary cysts and the lung and pleura may be the initial sites of involvement.
at show blebs or cysts.
               This transgenic rescue system will be useful to analyse Bhd gene function, its relation to tumorigenesis in vivo, and genetic-en




             Isolated familial spontaneous pneumothorax can be caused by mutations of the FLCN gene. Because development of a pneum
             FLCN mutations, pulmonologists should be alert to the contribution of this gene toward this familial form of emphysema.

d in association with its clinical triad. Recent epidemiological studies have shown a significant association between the occurrence of lesio
nted for routine surveillance. Facial lesions in the fibrofolliculoma/trichodiscoma category were identified. Diagnostic work-up revealed c

             The patient had a total of 41 facial papules removed via shave excision, initially for diagnostic and then for therapeutic purpo
             only 2. BHDS should be considered, along with tuberous sclerosis and multiple endocrine neoplasia type 1, in the differential

             In conclusion, this report is the first comprehensive evaluation of a large number of renal tumors from BHD patients with a kn
             high frequency and wide spectrum of second mutations, which strongly support a tumor suppressor role for BHD. Inactivation
             histologic types of renal tumors, suggesting that BHD may act at an early stage of renal oncogenesis. Further understanding o
             awaits functional studies of the folliculin protein.




             In conclusion, we have completed mutation analysis of the largest cohort of families with BHD reported to date and have iden
             recruited to our study. The majority of mutations were predicted to truncate folliculin and most likely lead to a reduction in f
             spontaneous pneumothorax, and FFs develop as part of the complex BHD phenotype, with no particular correlation with mut

             Although there was no extrarenal involvement of BHD syndrome in the present cases, analysis of BHD was performed. The ge
             any abnormality. Because of inappropriate fixation, the analysis on the DNA extracted from the paraffin-embedded tumor tis
             BHD gene and oncocytosis might help to shed light on the pathogenesis of oncocytoma, chromophobe RCC and hybrid tumor
             Patients with BHD are at risk for multiple renal tumors that are often malignant and can metastasize. Individuals at risk or aff
             at periodic intervals and they are best treated with nephron sparing surgical approaches. Genetic testing for this syndrome is
            Isolated familial spontaneous pneumothorax can be caused by mutations of the FLCN gene. Since development of a pneumot
            may be the earliest or the only clinical manifestation of FLCN mutations, pulmonologists should be alert to the contribution o




            In this Finnish family, a 4-bp deletion in FLCN causes inherited PSP. However, determination of the general importance of FLC
            familial and sporadic patients for mutations in this gene. This, in turn, may help to elucidate the function of the FLCN protein
            with generalized emphysema, and perhaps may shed further light on its role in tumorogenesis.
            This study is the first to find the same hot-spot 1733insC mutation in Asian kindred. The mutations in this polycytosine tract m
            arising from a different ethnic background.

on in the rat Bhd ortholog. The Birt–Hogg–Dubé (BHD) syndrome is a rare autosomal dominant disease characterized by fibrofolliculoma,
gressed through adenoma to carcinoma with the primary cell type being clear/acidophilic where some similarities were evident to RCCs in
s rat model of hereditary RCC provides a useful tool for analyzing the series of events leading to renal tumorigenesis and for studying BHD
chromophobe renal carcinoma and renal oncocytoma were unknown
allmark BHD skin lesions (fibrofolliculomas), lung cysts and
 notypic manifestations of BHD including the histologic features

a very different clinical presentation, with RCC being one of the less common cancers, having a very poor prognosis, and occurring predom
 y share a common embryological origin. Renal tubular epithelial cells arise during nephrogenesis as a result of the mesenchymal-epithelia
 monstrated to share a common genetic etiology. The Eker rat model was the first demonstration of a specific genetic linkage between RC
  also at risk for RCC, and sporadic human uterine leiomyomas exhibit loss of function of the TSC-2 gene product, tuberin. Individuals with
  cutaneous lesions and uterine leiomyoma also arise in German Shepherd dogs with germline mutations in the Birt-Hogg-Dube (BHD) gen
cts, tuberin, fumarate hydratase and folliculin, respectively, opens new avenues for understanding the pathogenesis of both RCC and uter




            The observations in this study suggest a tumor suppressor role for BHD, which is further supported by the reduced expression
            Studies are ongoing to evaluate tissue expression of the BHD protein, folliculin, using polyclonal antibodies prepared against s
            of these studies will contribute further to our understanding of the role of the BHD gene product, folliculin, in regulating cell p
            Constructing transgenic Nihon rats with the wild-type Bhd gene should allow us to ascertain whether suppression of the Niho
            the Nihon rat continues to be a valuable experimental model for studying BHD gene function and its role in tumorigenesis.

mutation of the VHL gene.

he hereditary form of renal cell carcinoma (RCC) associated with hereditary papillary renal carcinoma (HPRC)
 e gene. The gene for a new form of hereditary RCC (Birt Hogg Dubé syndrome)
dney cancer. Individuals affected with hereditary leiomyomatosis renal cell carcinoma
 way to understand the downstream pathway of this cancer gene.
The BHD gene product, folliculin, has no known function at present and so functional assays are not available to investigate th
Arg320Gln missense substitution identified in this study. However, the identification of further BHD missense mutations in BH
provide insights into folliculin function by identifying critical domains for normal tumour suppressor activity.
Common sequence variants in tumour suppressor genes provide good candidates for low penetrance susceptibility alleles. It
sequence variant to be more frequent in CRC cases than in controls (p = 0.055). The GA transition is not predicted to significa
so it may be that the intron 9+6 GA variant is in linkage dysequilibrium with other pathogenic variants. Nevertheless, our resu
the role of BHD sequence variants in CRC susceptibility may be indicated.
Our work described here constitutes the first example of human and canine inherited cancer syndromes with similar phenoty
mutations in a both a human gene and its canine ortholog. The work has implications for analysis of human pedigrees, segreg
but for who obvious disease associated changes, such as large genomic deletions or insertions, have not been found. This par
but we hypothesize that similarly structured studies could be used to map other cancer susceptibility genes as well.




We are unaware of previous BHDS patients with neural tissue tumors. In light of recent linkage analysis studies delineating th
neural tissue tumors.




The modest frequencies of LOH and methylation of the BHD gene in sporadic renal tumors suggest its role as a TSG, and epige
an alternative to mutations to disrupt its functions. Unlike other cell type-specific kidney cancer genes, inactivation of BHD ca
of sporadic renal tumors, indicating that BHD is intimately involved in kidney tumorigenesis. Additional functional analysis of
allow better understanding of the tumorigenesis of renal tumors.




Our results suggest that the BHD gene is involved in the tumorigenesis of a subset of MSS sporadic colorectal carcinomas, and
the BHD gene may play a role in colorectal tumour progression.




This study identified mutations of the poly (C)8 tract of the BHD gene in MSI sporadic colorectal carcinomas and the frequenc
is comparable with that of the IGF2R gene, which is one of the well known MSI target genes. In addition, two heterozygous m
were found in SNU-1040 and LoVo cell lines with MSI, respectively. Functional studies are required to understand the biologic
Our findings suggest that the BHD gene is associated with colon cancer and putative MSI target genes involved in the develop


The mother of the family was found to have a solitary colonic polyp, a large ovarian cyst and two chorioretinal scars. No asso


The clinical and genetic findings in 23 affected cases from four BHD families and four
sporadic cases were described.We confirmed a hot spot for BHD mutation, the presence of phenocopies, late age of onset or
penetrance of BHD, association with colorectal neoplasia, and the nature of the second hit in a BHD related tumour.


The visceral manifestations of Birt-Hogg-Dubé are heterogeneous and include renal tumors, lung cysts, and/or spontaneous p
Birt-Hogg-Dubé predisposes individuals to a wide spectrum of renal tumors, including hybrid oncocytic tumors, chromophobe
clear cell renal cell carcinoma, and renal oncocytosis. Pathologists are in a unique situation to help recognize this syndrome. I
consider the diagnosis of Birt-Hogg-Dubé whenever oncocytosis, hybrid renal tumors, or chromophobe renal cell carcinoma is
multifocal setting. The present series supports the notion that the Birt-Hogg-Dubé gene is important to the histogenesis of tu
and distal renal tubule. However, until the Birt-Hogg-Dubé gene(s) is characterized, it will remain difficult to determine what
individuals and what role, if any, it plays in the development of sporadic renal cell carcinoma.




Despite subtle histomorphologic differences, trichodiscomas and fibrofolliculomas are immunophenotypically similar, and are
immunophenotype of the hair mantle, our findings would support an origin of these lesions from the mantle of the hair follic
other CD34 (+) dermal entities.




Studies of families with inherited cancer have revealed tumor suppressor genes and oncogenes that play a major role in the p
human neoplasia. Discovery of protein-truncating mutations in a gene, which occur in patients with BHD and lead to an increa
kidney cancer, represents evidence for a novel gene associated with oncocytoma or chromophobe renal histology.
Biological significance of the BHD protein, folliculin, is supported by sequence conservation between folliculin and homologs
Drosophila, and C. elegans, and by mapping studies that suggest that germline mutations in dog and rat BHD homologs lead t
cancer. Because BHD is a novel gene, further studies of the BHD protein may lead to the elucidation of novel mechanisms of t




BHD needs to be considered in the differential diagnosis in any patient with renal cancer, particularly in patients with chromo
and/or patients with multiple or bilateral renal carcinomas. BHD also needs to be considered in the differential diagnosis in an
pneumothorax, particularly when there is a family history of pneumothorax. It is important to emphasize that in some patien
renal tumors occurred in the absence of cutaneous manifestations of the syndrome. Although in some patients affected with
skin lesions, in other patients there were few characteristic skin lesions, and the diagnosis was more difficult to establish. Onc
possible to determine the role of germ-line BHD mutations in BHD and in clinically overlapping disorders, and to determine th
BHD gene to the pathogenesis of sporadic renal carcinomas.
No germline PTEN, PTCH, or CTNNB1 mutations were found in eight subjects affected with BHD whose DNA
was analysed. There was no linkage to 3p21 or 10q21, the loci for CTNNB1 and PTEN, respectively. These data
suggest that PTEN, PCTH, and CTNNB1 are excluded as candidate genes for BHD.




A diagnosis of Hornstein-Knickenberg-/Birt-Hogg-Dubé syndrome was made, which is characterized by fibrofolliculomas and c
Hornstein-Knickenberg-/Birt-Hogg-Dubé syndrome. Apart from the skin several other organs may be involved, including the k
typical skin lesions which can be the marker for neoplasia and other characteristic associated findings.




The BHD locus lies within chromosomal band 17p11.2, a genomic region that, because of the presence of low-copy-number r
and that is associated with a number of diseases. Identification of the gene for BHD may reveal a new genetic locus responsib
lung and hair-follicle developmental defects.




Another striking finding in this patient was a conspicuous vascular component in the lesions, characterized by a pronounced,
perivascular fibromas have already been observed in other patients with Birt-Hogg-Dubé-syndrome, the perivascular fibroma
Although the lesions could be successfully ablated up to the papillary dermis without scar formation, a relapse was observed


BHD diagnosis confirmed clinically




Birt-Hogg-Dubé syndrome may be associated with familial renal tumors. Birt-Hogg-Dubé and renal tumors segregate togethe
Patients with BHD and their relatives are at risk for development of renal tumors. Therefore, patients with BHD and their rela
computed tomography and renal ultrasound screening for renal tumors.
In light of our conclusion that fibrofolliculoma, trichodiscoma, and the acrochordon-like lesions are histologic variations of a s


Results indicate that the histologic differences between the skin lesions in Hornstein and Knickenberg (HKS),and Birt, Hogg an
consequently HKS and BHDS are the same. Therefore, it is necessary to look for colonic polyps in the syndrome in question, re

This case suggests that patients with hamartomas of the pilosebaceous system should undergo explorations in search for dige




These findings suggest that Birt-Hogg-Dubé syndrome may be associated with a progressive flecked chorioretinopathy with c
The authirs believe that the Horn-stein-Knickenberg syndrome and the Birt-Hogg-Dubé syndrome are identical. If perifollicula
should be examined for colonic polyps as an appropriate from of cancer screening.




A new therapeutic approach by copper vapour laser is proposed.




This association may not be fortuitous and suggests that patients with multiple hamartomas of the perifollicular connective t


The histological and histogenic characteristics are discussed. Bibliographic revision is made. It is possible to consider the case


In addition to the case study, the clinical differential diagnosis of multiple firm, skin-colored papules is also discussed.


Observed cases were identified as tuberous sclerosis. The authors comment that probably this syndrome is an expression for




Clinically, the fibrofolliculomas were indistinguishable from trichodiscomas. We believe that the Birt-Hogg-Dubé syndrome is
interaction between the epithelial and mesodermal components of the pilar complex.
 ype appears to be variable within and between families, and a few instances of non-penetrance have been reported.
station at the age of 62, 42, 38, 32 and 22 years. Family 11 was characterized by a strong history of pneumothorax and lung cysts
ssociation between pulmonary manifestations and exon 12 mutations has previously been observed.
mutations and will be helpful to refine clinical criteria for FLCN mutation testing. Our data also show that parotid oncocytomas




irm deregulation of their expression in BHD-associated renal tumors. Thus, deregulation of genes involved in TGF-β signaling by




y reflect allelic heterogeneity and the risk of colorectal neoplasia in BHD syndrome requires further investigation.




ergo partial nephrectomy for T1B tumors in the sporadic population. Multifocality does not affect oncological outcomes at
esent with multifocal tumors greater than 4 cm.

occur between Japanese and patients of European decent in terms of FLCN mutations and clinical manifestations.
mothorax. Affected individuals must be screened for renal tumors, a potentially lethal consequence of this syndrome




e actual mutation was shown to be a 4 nt deletion in exon 9 of folliculin gene, c.1345_1348 (p.Glu297fs).




own that hybrid oncocytic/chromophobe tumors of the kidney do occur, albeit rarely, outside the
vely homogenous group with histomorphologic features of both chromophobe renal cell carcinoma and renal oncocytoma.
tions (both mono- and polysomies) of chromosomes 1, 2, 6, 9, 10, 13, 17, 21, and 22 and lack of mutations in the VHL,
 havior was documented in our series, although admittedly, the follow-up was too short to fully elucidate the biological
 can be found out with longer follow-up.




histiocytoma features. The
s and a history of recurrent
f BHDS with
 residue is directly phosphorylated by AMPK. By binding with FLCN-interacting proteins (FNIP1 and FNIP2/FNIPL),
he FLCN–AMPK complex.




ss of BHD mutation type, and support activation of AKT signaling as
mTORC2 effectively, which may explain its partial effect on kidney-targeted BHD
C2 as well as mTORC1 inhibition may be needed for the development of an




D. Our results demonstrate that homozygous disruption of the Flcn
pattern of FLCN in adult tissues and cell types, where it was widely
 terozygous Flcn knockout mice developed renal cysts and tumors upon loss
RCC cell lines using a xenograft assay. Our data demonstrate that
al molecular types of RCC. The data also show that FLCN is a bona

 unreported until now in
 ast, a possible transition from one type to the other, depending on the evolution of the lesion.
 ositive haphazardly infiltrating the deep dermis, that we considered a benign proliferation of the

ation of a diagnosis of BHD syndrome as well as monitoring for associated complications


 Nihon) rat. Although there were some differences in the doubling time, chromosome number and histopathological
 5-C tract in exon 3 of the cDNA. This germline mutation results in a frameshift and produces a stop codon 26 amino acids




mothorax. We demonstrated distinctive histopathological features of the lung lesion in BHD
 nce repeats in affected BHD gene. Currently, little is known about the role of FLCN in normal lung development and
 al cystic changes, unique localization of the cysts in the lung and the possibility of tumorigenesis in


 yroid nodules and renal cysts. However, the lack of control group does
 teristic CT findings of BHD syndrome. Cysts abutting or including the proximal portions of




ristic/tumor-defining mutations in renal cancer genes are acquired along with
ma). In addition, we found the presence of a low-level CIN, which previously has not been
 has a role in chromosomal maintenance.




dysregulation of those pathways may play a role in the development of BHDS.
out mice, development of cysts and/or tumors in the kidney and activation of
 pected that FLCN could be both positive and negative regulator of mTORC1
ation of responsible kinases and exploration of the effects on mTORC1- and/or
 D mutation-related pathogenesis.




ough identification of the underlying genetic mechanisms common to
 necessary to allow for accurate diagnosis of patients and to provide
d and should be followed to limit treatment-related morbidity.




r follicle bulge cells.
 eletion mutation was identified in exon 10 of the FLCN gene.
hat might be expected as part of the BHD syndrome.
th of the gene (exons 4, 5, 6, 7, 9, 11, 12, 13 and 14) .
  exon 4 5 and exons 9 and 12 6. It is possible that these regions
o note that, among patients with mutations in the exon 11 hotspot,
n mutations . An alternative explanation may be that
 pneumothorax families
nal cell carcinomas in BHD
  folliculin regulates the
  low levels of TORC1 activity can


 is rare but is probably underdiagnosed, when evaluating patients
ortant for providing diagnostic clues to the presence of rare genetic disorders.

 ther suggest a relationship


ollecting ducts of the renal cortex.
enal cell carcinoma hyperplasia




s prediction of tumor risks and enables targeted surveillance
 ks in patients with nonsyndromic forms of renal cell carcinoma (RCC)
 e cases of RCC and no evidence of a specific RCC susceptibility
 nd age-dependent penetrance. These findings will facilitate genetic
 hether some patients with a clinical diagnosis of nonsyndromic
mutation was detected in 3 of 69 (4.3%) patients tested and we
 ic and VHL gene mutation analysis).
ressed cells was oberved.
orylation and that




 protein. Mutation not identified


ed across species. FNIP2 interacts
d energy-sensing molecule, AMPK, a negative regulator
 expression, suggesting that they may function
 tissue-specific roles for FNIP1 and FNIP2 in normal




ggest that familial spontaneous pneumothorax and COPD have distinct genetic causes,




 were not detected, making
 with missing typical skin lesions are described, as well. The diagnosis was made
 clearly shows the necessity of precise clinical information for the investigating pathologist.
HDS phenotypic spectrum of associated hamartomas and tumours,
arge group of families, our dataset is too small to examine
ning our clinical and BHD mutation data on clinically well described
 d genotype–phenotype correlations in BHDS may provide
 tigations using in vitro systems and animal models may help us
rence of involvement that we observe in BHDS.

te with tumor cells derived from
els, this line serves as an extremely
many characteristics with sporadic
 ine these diseases as well.
  gnosis of FLCN, as well as potential




group, 41.5 vs 23 days;

 carcinogenesis,




normal lung and predispose to spontaneous pneumothorax.




 he tumor commonly presents as asymptomatic, multiple, small, white or flesh-colored, smooth, dome-shaped
 mor shows a well-circumscribed dermal tumor with a central well-formed dilated hair follicle.
 The perifollicular stroma is accentuated and fibrotic.




o in patients with few or even
 spontaneous pneumothorax. However, the prevalence
ns. Additional insight will be gained from future clinical

AMPK, has an opposite biochemical role of the AMPK target TSC2 in amino acid transport .




mphangioleiomyomatosis, and may be worsened by smoking.


 ysts and pneumothorax. Pulmonologists should be aware that BHD syndrome can occur as an




or the papillary variant of RCC. Moreover, our BHD-mutated
analyses concerning the biological characteristics for
t. A functional study of the BHD gene can be expected

ntaneous pneumothorax.




ome skin lesions. As the timing of occurrence of RCC is not
s of BHD is established. In addition, those identified with renal
 patients, screening renal ultrasound and the use of magnetic
 that the principle of parenchymal sparing surgery
er hereditary RCC.




mors, especially if the predominant histologic type is chromophobe renal cell carcinoma or
hromosome 17p12q11, and the gene in this region has been cloned and believed to be responsible
s speculated to be a tumor suppressor gene. Numerous mutations have been described in the
 t of sporadic renal cell carcinoma and other lesions.
me does not necessarily reflect the consequence of a complete loss of folliculin function.
nesis in susceptible tissues. If this is also the case for the renal microscopic oncocytic
hought to be the precursors to malignant kidney tumors. From our findings, we would expect

olyposis uncovered a potential novel susceptibility gene, ENG, for juvenile polyposis.
ensive analysis of the known susceptibility genes is indicated. Rereview of histology results by a
ests on defining syndromic diagnosis.




 significantly fewer renal tumours were observed in patients with the C-deletion than those with the
 d her son have no renal tumour and no colorectal lesions, but long-term follow-up will provide

 of the BHD gene in any patient with multiple fibrofolliculomas even in the

R and AMPK and modulate energy/nutrient-sensing signaling pathways by
ssor may contribute to a broader understanding of the molecular mechanisms responsible for




han that of BAX, TGFRII or other major MSI-high target genes, and BHD mutations
olved in MSI-high gastric tumorigenesis.




utational frequency is lower than that of BAX, and BHD mutation tends to occur during neoplastic progression after the
HD regulates male GSC maintenance and functions downstream of the JAK/STAT and Dpp
her through modulating stem cells or through regulating the JAK/STAT or
Mutations in certain human and mouse genes have been reported to cause germ cell loss
omette et al., 1985; Youngren et al., 2005).




 s in vivo, and genetic-environmental interactions in carcinogenesis.




 evelopment of a pneumothorax and/or pulmonary blebs may be the earliest or the only clinical manifestation of
orm of emphysema.

  the occurrence of lesions in the fibrofolliculoma/trichodiscoma category with
 stic work-up revealed concomitant multinodular goiter, pulmonary cyst, and renal mass.

 n for therapeutic purposes; histologic evaluation revealed diagnostic features of angiofibroma in 39 lesions and fibrofolliculoma in
 pe 1, in the differential diagnosis of multiple facial angiofibromas, particularly when onset is in adulthood.

m BHD patients with a known germline BHD mutation. Our results document the
 ole for BHD. Inactivation of both copies of BHD occurred in several
 urther understanding of the mechanism of BHD-induced tumorigenesis




ed to date and have identified 22 different germline BHD mutations in 84% (51/61) of families
 lead to a reduction in folliculin expression. Renal tumors, lung cysts,
 ar correlation with mutation type or location within the gene.

 was performed. The genomic DNA extracted from the peripheral lymphocytes failed to show
in-embedded tumor tissue was unsuccessful. Despite this, examinations on the
e RCC and hybrid tumor.
 ndividuals at risk or affected by BHD should be radiographically screened for renal tumors
 ng for this syndrome is now available.
elopment of a pneumothorax and/or pulmonary blebs
rt to the contribution of this gene toward this familial form of emphysema




neral importance of FLCN in the development of PSP requires further screening of both
on of the FLCN protein in the lung, in association with PSP and, even more importantly,

 his polycytosine tract may have a wide, global distribution despite their


ed by fibrofolliculoma, pulmonary cysts, spontaneous pneumothorax, and renal neoplasm.
were evident to RCCs in BHD syndrome. The Nihon rats demonstrate a heterotopic
is and for studying BHD gene functions.




 , and occurring predominantly in men,
 mesenchymal-epithelial transition of condensed
etic linkage between RCC and uterine leiomyoma.
uberin. Individuals with
t-Hogg-Dube (BHD) gene, and these
 is of both RCC and uterine leiomyoma.




 the reduced expression of the BHD transcript in BHD renal tumors.
odies prepared against synthetic peptides. The results
culin, in regulating cell proliferation and growth in skin, lung and kidney.
suppression of the Nihon phenotype is possible. Thus,
ole in tumorigenesis.
vailable to investigate the pathogenicity of the germline
 issense mutations in BHD kindreds and sporadic tumours may

susceptibility alleles. It is intriguing that we found an intron 9
ot predicted to significantly influence splicing efficiency,
. Nevertheless, our results suggest that further investigation of

es with similar phenotypes displaying disease-associated
uman pedigrees, segregating disease linked to the BHD region,
ot been found. This particular example focused on kidney cancer,
genes as well.




s studies delineating the genetic susceptibility locus for BHDS, we speculate about a possible association between BHDS and




role as a TSG, and epigenetic inactivation acts as
, inactivation of BHD can be detected in several cell types
l functional analysis of this interesting gene should




orectal carcinomas, and that allelic loss in the region close to




omas and the frequency of mutations in the BHD gene
on, two heterozygous missense mutations, Arg137Cys and Arg462Ser,
 understand the biological role of folliculin in colorectal carcinogenesis.
 involved in the development of MSI colorectal carcinomas.


ioretinal scars. No associated disorders were found on investigation of one of the two affected sons.




 es, late age of onset or reduced
 lated tumour.


 , and/or spontaneous pneumothorax.
c tumors, chromophobe renal cell carcinoma,
ognize this syndrome. It is important to
e renal cell carcinoma is identified in a familial and/or
o the histogenesis of tumors from both the proximal
 ult to determine what risk it confers to specific




typically similar, and are thus likely derived from a similar histogenic precursor. Given the previously reported CD34 (+)
mantle of the hair follicle. The proliferation of CD34 (+) spindle cells seen in conjunction with these lesions should not be confused with




lay a major role in the pathogenesis of
HD and lead to an increased risk for
nal histology.
olliculin and homologs in mice,
at BHD homologs lead to inherited renal
f novel mechanisms of tumorigenesis.




n patients with chromophobe renal carcinomas,
ferential diagnosis in any patient with spontaneous
ize that in some patients, spontaneous pneumothorax and
e patients affected with BHD, there were numerous characteristic
 ifficult to establish. Once the BHD gene is identified, it will be
ers, and to determine the contribution of somatic mutations in the




 fibrofolliculomas and colon adenomas. Our familial observation speaks in favor of autosomal dominant transmission of the
nvolved, including the kidneys, urogenital tract, eyes and endocrine system. By this report we wish to draw intention to the




e of low-copy-number repeat elements, is unstable
 genetic locus responsible for renal neoplasia and for




rized by a pronounced, well-demarcated fibrosis in the region of cutaneous blood vessel proliferations. Because
he perivascular fibroma, with fibrofolliculoma and trichodiscoma, must be included within this syndrome's spectrum of skin changes.
a relapse was observed after 6 months. Thus deeper laser ablations may possibly prevent relapses from dermal residual lesions.




mors segregate together in an autosomal dominant fashion.
with BHD and their relatives should undergo abdominal

 tologic variations of a single lesion, the authors question whether the term "syndrome" is valid.


(HKS),and Birt, Hogg and Dube (BHDS) are artificial ones, caused by interpretation of different sectioning planes, and that
yndrome in question, regardless if one prefers the name HKS or BHDS for it.

ations in search for digestive tract polyposis.




horioretinopathy with constricted visual fields and that patients with the syndrome should undergo ophthalmological examination.
identical. If perifollicular fibromas are observed and cannot be explained as postinflammatory sequelae of acne, the patient




rifollicular connective tissue should be examined periodically for intestinal polyps before malignancy develops.


 le to consider the case above mentioned as a Birt-Hogg-Dubé syndrome.


 also discussed.


me is an expression form of tuberous sclerosis.




Hogg-Dubé syndrome is an autonomous well individualized skin disease. Its existence supports the view of the close
een reported.
 mothorax and lung cysts

t parotid oncocytomas




ed in TGF-β signaling by




ogical outcomes at
this syndrome




 renal oncocytoma.
ons in the VHL,
 e the biological
pathological
n 26 amino acids




opment and
ession after the
ons and fibrofolliculoma in
n between BHDS and
orted CD34 (+)
ns should not be confused with
 transmission of the
aw intention to the




e's spectrum of skin changes.
dermal residual lesions.




g planes, and that




halmological examination.
of acne, the patient




of the close
Southern blot analysis of ES stem cels and PCR gentyping of BHD knockout mice (Baba et al, 2008)

5' external probe wa generated by PCR using the following primers:
            Forward: 5'-TCGACCTCGATGGAGTGATCC
            Reverse: 5'- GGCAATGGCACCCATTTAAGG
            3' externl probe was alsgeenrated by PCR using the following primers:
            Forward: 5'- CAGGCTCAAGCAGTAGTGAGACCA
            Reverse: 5'-CATTCTGCTTTGGGGCATGA

Genomic DNA isolated from tail samples using: DirectPCR Reagent (Viagen Biotech Inc, LA)
Nonradioactive Southern blotting was performed with DIG OMNI System for PCR samples (Roche Molecular Biochemicals)

DNA Isolation, Southern Blot Analysis, and Loss of Heterozygosity (LOH) Analysis (Okimoto et al, 2004)
           Tail DNA was extracted from 113 backcross animals at 13 weeks of age. DNA was isolated by digestion with prote
           Southern blotting and genomic PCR were performed as described previously. Primers used for detection of LOH b
           and BHDG6, 5'-CGGAATGGACAAGGTTCACATCTC-3' (reverse). For analysis of the germ-line insertion in “C tract” by
           were used. For search of second-hit mutations, genomic PCR and direct sequence analysis were performed by usi
           The entire coding regions of rat Bhd (exons 3–13) were screened for mutation. Primers used are detailed beloew:

             Exon                     5' primer
               3                GATGCCGTCCTTCCCTACA
               4               ATTTTGTCGTCCTTTGTGTGC
               5               ACTTCCCCTAAAGTTACTGTG
               6               ACTGAAAGGTTCGGTGGTAG
               7                AGCCTCAGGTTCAGTTTTCC
               8                ATGCTCACTCCATACCTGTC
               9               CCTAAAGAACTATGTGCTGTG
              10                TTCTGAGCACCTTGTTGTCC
             11, 12            ACTTTACAAGCTAGCACGTGT
              13               TGTGGGTCTAAGTGTTCATCT

Tissue Genotyping by Southern Blotting (Hasumi et al, 2009)
          A 3' external probe for Southern blot analysis of the tumors from BHDd/ mice and normal kidneys was generated
          CAGGCTCAAGCAGTAGTGAGACCA-3 ; and reverse; 5 -TGATGAATGGGGACAGCAGCAG-3 (GenBank NT 096135.5). N
          with DIG OMNI System for PCR Probes according to the manufacturer’s protocol (Roche).
Review article
                       To Birt-Hogg-Dubé (BHD) tumour suppressor gene in sporadic renal cell carcinoma the pathogenesis o
           Analysis of theinvestigate whether somatic inactivation of the BHD gene region is implicated in and colorectal canc
                        Gentle D, Hesson cancer (CRC), mutation analysis was performed in 30 RCC primary tumours and cel
           da Silva NF,RCC and colorectalLB, Morton DG, Latif F, Maher ER.
                       and 35 Nov;40(11):820-4.
           J Med Genet. 2003CRCs and cell lines.




Human in vitro
          Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI
            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
ng of BHD knockout mice (Baba et al, 2008)




ng the following primers:




R Reagent (Viagen Biotech Inc, LA)
IG OMNI System for PCR samples (Roche Molecular Biochemicals)

rozygosity (LOH) Analysis (Okimoto et al, 2004)
 nimals at 13 weeks of age. DNA was isolated by digestion with proteinase K and extraction with phenol/chloroform.
 formed as described previously. Primers used for detection of LOH by genomic PCR were BHDG5, 5'-ATCATCCTTTCTCTCAGCCTGTGG-3' (fo
CTC-3' (reverse). For analysis of the germ-line insertion in “C tract” by genomic PCR, primers BHDRI and BHDRJ (5'-CTCGCACATGTCTGACTT
ns, genomic PCR and direct sequence analysis were performed by using DNAs extracted from tumor and matched normal kidney tissue.
–13) were screened for mutation. Primers used are detailed beloew:

                               3' primer                         Product size, bp
                       AAGGCTAAAACCAGCTCACG                           329
                       ACAGCAATGAACCTATCTGTC                          232
                        CCAGCATCCATGCCAAACG                           298
                       TGTTCTAATGGCTCACAGATG                          264
                        TATGGCAGCCACAAGCCAG                           221
                        TCTTCTCAGTTCGGACCACA                          259
                       AGTCAAGCATTAGCATACAGG                          175
                        GGCAGTACGTGTCTCACAG                           178
                        AGCTGTCAAGGCAAGGCTG                           381
                        ATGTACACCACCTTCCAGAC                          269



s of the tumors from BHDd/ mice and normal kidneys was generated by PCR with primers: forward;5 -
verse; 5 -TGATGAATGGGGACAGCAGCAG-3 (GenBank NT 096135.5). Nonradioactive Southern blotting was performed
ding to the manufacturer’s protocol (Roche).
           BHD mutation analysis
           Sequencing of PCR products
           BHD promoter methylation analysis
           BHD gene expression analysis by RT-PCR
           Bisulphite modification and methylation analysis
           Statistical analysis
normal and neoplastic human tissues.

                                                              of sporadic renal tumors, indicating that BHD is intimately involved in kid
                                                              allow better understanding of the tumorigenesis of renal tumors.
TTTCTCTCAGCCTGTGG-3' (forward),
 (5'-CTCGCACATGTCTGACTTCT-3', reverse)
 ed normal kidney tissue.




                                                BACK




                                         BACK
 is intimately involved in kidney tumorigenesis. Additional functional analysis of this interesting gene should
esis of renal tumors.
PCR genotyping of BHD knockout mice (Baba et al, 2008)




Genotyping (Dykyma et al, 2008)
BHD primers for mouse tail genotyping
Primer ID
BHD-condKO-F1-5’-GenTyp-F1/R1 (Flox)
BHD-condKO-F1-5’-GenTyp-F1/R3 (KO)
BHD-condKO-F1-5’-GenTyp-F1/Rwt (WT)
Bhd-F1-wt-F/R (WT)


BHD long-range PCR primers for ES cell clone genotyping and confirmation
Primer ID
Bhd-ConKO-F1-Confirm-5’-OF1/OR1
Bhd-ConKO-F1-Confirm-5’-F1/R1
Bhd-ConKO-F1-Confirm-3’-OF1/OR2
Bhd-ConKO-F1-Confirm-3’-F2/R2


BHD 5' end Southern blot probes (PCR fragments) for genotyping
Primer ID
Bhd-ConKO-F1-5'prob-F1/R1
Bhd-ConKO-F1-5'prob-F2/R2
Bhd-ConKO-F1-5'prob-F3/R3


BHD 3' Southern blot probes (PCR fragments) for genotyping
Primer ID
Bhd-ConKO-F1-3'prob-F1/R1
Bhd-ConKO-F1-3'prob-F2/R2
Bhd-ConKO-F1-3'prob-F3/R3




Identification of BHD Haplotype Carriers (Zbar et al, 2002)
Because we wished to determine the frequency of health problems in all of the family members who possessed the BHD gene,
we constructed haplotypes based on genotyping results to identify individuals predicted to possess the BHD disease gene but who
lacked cutaneous signs of the disease (BHD haplotype carriers). We have recently shown that the BHD gene is located at chromoso
in a 4-cM region between the polymorphic DNA markers D17S1857 and D17S805. Haplotypes were constructed by examining the
of polymorphic DNA markers located in the BHD gene region to identify alleles that were consistently inherited with the disease ph




Genotyping, haplotyping, and loss of heterozygosity (LOH) analysis (Khoo et al, 2002)

Ten microsatellite markers from chromosome 17p12-q11.2, D17S921, D17S1857, D17S740, D17S2196, D17S620, D17S805,
D17S2187, D17S1871, D17S783, and D17S1824, were genotyped on all lymphocytes and tumour DNA. PCR was
performed in a 7.5 ml reaction volume containing 0.17 mmol/l each of fluorescence labelled forward and unlabelled reverse
primer, 10 mmol/l Tris-HCl (pH 8.3), 50 mmol/l KCl, 4 mmol/l MgCl2, 0.3 U AmpliTaq Gold polymerase (ABI), 0.25 mmol/l
dNTPs (Invitrogen), and 15 ng of genomic DNA. PCR was performed using PE 9700 thermocyclers with an initial 10 cycles
(15 seconds at 94°C, 15 seconds at 55°C, 30 seconds at 72°C) followed by 20 cycles (15 seconds at 89°C, 15 seconds at 55°C,
30 seconds at 72°C). PCR amplified products were then denatured and run on an ABI 377 genetic analyser (Applied
Biosystem). Allele sizes were assigned using Genescan v 3.1 and Genotyper v 2.5 software (Applied Biosystem). Pedigrees
were drawn using Cyrillic v 2.1 and haplotypes were confirmed with Genehunter v 2.1.16 LOH was performed by
comparing the genotypes of tumour DNA with matched lymphocyte DNA. LOH was determined as previously described

PCR Based BHD Genotyping (Hasumi et al, 2009)
Mouse genomic DNA was isolated from tails (weaned neonates), yolk sacs (E8.5 or later), and
whole embryos (E7.5 or earlier). KOD Hot start DNA polymerase (Toyobo) was used for generating probes and routine
PCR (PCR) genotyping. PCR genotyping was performed with three primer sets to amplify wild-type (178 bp PCR product),
floxed (210 bp PCR product), and deleted (392 bp PCR product) BHD alleles: P1, 5 GTTGTCTGGAGTGCTACTTAGTCAGG-
3 , which is complementary to the genomic sequence upstream of the 5 -loxP sequence; P2, 5 -CAACACCCCAGCATCCAG-
3 , which is complementary to the sequence downstream of 5 -loxP; and P3, 5 CAGCTCCCTCTACCCAGACA-
3 , which is complementary to the sequence downstream of 3 -loxP.
PCR genotyping was performed on laser-capture microdissected embryo regions. For the LCMed samples, Crimson Taq
Polymerase (New England Biolabs) and different primers were used for amplifying wild-type (307-bp PCR product) and deleted
(403-bp PCR product) BHD alleles: P4, 5 GTTGTCTGGAGTGCTACTTAGTCAGG-3 , P5, 5 -CATTGTATTCTTCTCCAGGCTCCTGAAGGC
-3 , and P3, 5 -CAGCTCCCTCTACCCAGACA-
Renal tumors in the Birt-Hogg-Dubé syndrome.
 knockout mice (Baba et al, 2008)

                    3 Primer sets used to amplify:
                    Wildtype BHD allele (178bp product). P1: 5'-GTTGTCTGGAGTGCTACTTAGTCAGC
                    floxed BHD allele(292bp product). P2: 5'-CAACACCCCAGCATCCAG
                    deleted allele (392bp product). P3: 5'-CAGCTCCCTCTACCCAGACA

                    For CRE genotyping:
                    Forward: 5'-GCAACATTTGGGCCAGCTAAAC
                    Reverse: 5'-CCGGCATCAACGTTTTCTTTTC




ail genotyping
                    Forward
                    5’-CCATCAGCTCCACCAGAACC-3’
                    5’-CCATCAGCTCCACCAGAACC-3’
                    5’-CCATCAGCTCCACCAGAACC-3’
                    5’-CCC TAT ATG TGC TGC AGG G-3’

ers for ES cell clone genotyping and confirmation
                       Forward
                       5’-CTGCCTCTCAAAGTATGACGCTGAG-3’
                       5’-GGTAGACATTGGGATTGGGAGAGTA-3’
                       5’-AGGAGTAGAAGGTGGCGCGAAG-3’
                       5’-TAC CGG TGG ATG TGG AAT GTG T-3’

 probes (PCR fragments) for genotyping
                    Forward
                    5'-CATGCGTTGGAAGAAATGG-3'
                    5'-GCACGTGCAT GCTTTGCT-3'
                    5'-GTGGGATGTTTGGTCTTGGT-3'

bes (PCR fragments) for genotyping
                     Forward
                     5'-CTGGCCTGAAACTCACTCTG-3'
                     5'-GGCTGTACCAGCTGACGTG-3'
                    5'-CTACTGTCACGGGAGAGCTCAATA-3'




aplotype Carriers (Zbar et al, 2002)
determine the frequency of health problems in all of the family members who possessed the BHD gene,
 pes based on genotyping results to identify individuals predicted to possess the BHD disease gene but who
 of the disease (BHD haplotype carriers). We have recently shown that the BHD gene is located at chromosome 17p11.2
en the polymorphic DNA markers D17S1857 and D17S805. Haplotypes were constructed by examining the inheritance
 rkers located in the BHD gene region to identify alleles that were consistently inherited with the disease phenotype.




ng, and loss of heterozygosity (LOH) analysis (Khoo et al, 2002)

 ers from chromosome 17p12-q11.2, D17S921, D17S1857, D17S740, D17S2196, D17S620, D17S805,
D17S783, and D17S1824, were genotyped on all lymphocytes and tumour DNA. PCR was
eaction volume containing 0.17 mmol/l each of fluorescence labelled forward and unlabelled reverse
HCl (pH 8.3), 50 mmol/l KCl, 4 mmol/l MgCl2, 0.3 U AmpliTaq Gold polymerase (ABI), 0.25 mmol/l
 15 ng of genomic DNA. PCR was performed using PE 9700 thermocyclers with an initial 10 cycles
 seconds at 55°C, 30 seconds at 72°C) followed by 20 cycles (15 seconds at 89°C, 15 seconds at 55°C,
R amplified products were then denatured and run on an ABI 377 genetic analyser (Applied
 were assigned using Genescan v 3.1 and Genotyper v 2.5 software (Applied Biosystem). Pedigrees
 c v 2.1 and haplotypes were confirmed with Genehunter v 2.1.16 LOH was performed by
es of tumour DNA with matched lymphocyte DNA. LOH was determined as previously described

 ping (Hasumi et al, 2009)
 as isolated from tails (weaned neonates), yolk sacs (E8.5 or later), and
  earlier). KOD Hot start DNA polymerase (Toyobo) was used for generating probes and routine
PCR genotyping was performed with three primer sets to amplify wild-type (178 bp PCR product),
duct), and deleted (392 bp PCR product) BHD alleles: P1, 5 GTTGTCTGGAGTGCTACTTAGTCAGG-
ntary to the genomic sequence upstream of the 5 -loxP sequence; P2, 5 -CAACACCCCAGCATCCAG-
ntary to the sequence downstream of 5 -loxP; and P3, 5 CAGCTCCCTCTACCCAGACA-
ntary to the sequence downstream of 3 -loxP.
rformed on laser-capture microdissected embryo regions. For the LCMed samples, Crimson Taq
 nd Biolabs) and different primers were used for amplifying wild-type (307-bp PCR product) and deleted
 HD alleles: P4, 5 GTTGTCTGGAGTGCTACTTAGTCAGG-3 , P5, 5 -CATTGTATTCTTCTCCAGGCTCCTGAAGGC
CCCTCTACCCAGACA-
Renal tumors in the Birt-Hogg-Dubé syndrome.
TGTCTGGAGTGCTACTTAGTCAGC                                     Complementary togenomic sequence upstream of the 5'loxP seque
                                                             Complementary togenomic sequence downstream of the 5'loxP se
                                                             Complementary togenomic sequence downstream of the 3'loxP se




               Reverse                             Size
               5’-TCTGACCCACTGCAGCCAC-3’           251 bp
               5’-CCGGTACCTTACAAGCCGA-3’           152 bp
               5'-TCATTATCTCCCACACCTGT-3'          201 bp
               5’-CAGAGGGACAGGCATCAA-3’            171 bp



               Reverse                             Size
               5’-GGAAGGTGCCACTCCCACTGTC-3’        5414 bp
               5’-GGAAATTGCATCGCATTGTCTG-3’        5267 bp
               5’-TTGAGGGTTCACAACCATCTG-3’         3639 bp
               5’-CTGGAACTAGGATCCAACTCTTCT TC-3’   3483 bp



               Reverse                             Size
               5'-CTGAATTCCGGTGAGGAAG-3'           801 bp
               5'-GCTAAGGCGGGAGTCACAG-3'           801 bp
               5'-GGAATATGAGAGGAGGTAGGC-3'         800 bp



               Reverse                             Size
               5'-CTTTGGGTTGTTCTAATGGC-3'          801 bp
               5'-CTGAGGAAGCATTCTGTGAGA-3'         801 bp
               5'-GGTTGGCTGGCAGGTTCAC-3'           801 bp
bers who possessed the BHD gene,
possess the BHD disease gene but who
at the BHD gene is located at chromosome 17p11.2
es were constructed by examining the inheritance
nsistently inherited with the disease phenotype.




 D17S2196, D17S620, D17S805,
mour DNA. PCR was
d forward and unlabelled reverse
olymerase (ABI), 0.25 mmol/l
yclers with an initial 10 cycles
 nds at 89°C, 15 seconds at 55°C,
 netic analyser (Applied
Applied Biosystem). Pedigrees
OH was performed by
 ned as previously described




erating probes and routine
d-type (178 bp PCR product),
GGAGTGCTACTTAGTCAGG-
 , 5 -CAACACCCCAGCATCCAG-


 Med samples, Crimson Taq
e (307-bp PCR product) and deleted
GTATTCTTCTCCAGGCTCCTGAAGGC
                                                   BACK
c sequence upstream of the 5'loxP sequence
c sequence downstream of the 5'loxP sequence
c sequence downstream of the 3'loxP sequence




                                               BACK




                                               BACK
BACK
Immunoblot analysis of FLCN (Baba et al, 2008)
Protein extraction:
            Snap frozen kidney 'sections' homogenised in radioimmunoprecipitation assay buffer with a polytron homogenise on i
            Protein concentrations of cleared supernatants were determined by the BCA Protein Assay Kit (Pierce, IL) and adjusted
            4x SDS-sample buffer was added and samples were boiled for 5 minutes to produce 1 mg/mL sample lysates.
            A total of 20 µg of protein was subjected to 4%–20% or 4%–15% SDS-polyacrylamide gel electrophoresis.

1 ° Antibody Dilutions:
           Mouse monoclonal FLCN, 1:1000;                             phospho-MEK1/2(Ser217/221), 1:1000;
           ß- actin, 1:500;                                           phospho-Erk1/2(Thr201/Tyr204), 1:1000;
           cyclin D1, 1:1000;                                         phospho-p90RSK(Ser380), 1:1000
           cyclin A, 1:1000;                                          phospho-Akt(Thr308), 1:1000;
           cyclin B1, 1:1000;                                         Akt, 1:1000;
           dc2, 1:1000;                                               phospho-mTOR(Ser2448), 1:1000
           CDK4, 1:1000;                                              mTOR, 1:1000;
           phospho-c-Raf(Ser338), 1:1000;                             phospho-S6R(Ser240/244), 1:1000;
           S6R, 1:1000;                                               phospho-AMPK, 1:500.

2° Antibody Dilutions:
           goat anti-mouse IgG–horseradish peroxidase, 1:1000;
           goat anti-rabbit IgG–horseradish peroxidase, 1:1000
           Antibody–protein complexes were detected using ECL Western Blotting Detection Reagent (Amersham, Buckinghamsh




Western blotting (Hartman et al, 2008)
Protein extraction:
            Cells were lysed in radioimmunoprecipitation assay buffer. 20 g of total protein was loaded on 4–20% SDS–PAGE gels (B
            Proteins were transferred onto Immobilon membranes (Millipore, Billerica, MA, USA) for western blotting with the follo
            anti-tuberin (TSC2 (Abcam, Cambridge, MA, USA)), anti-FLCN (a rabbit polyclonal antibody generated against a 20 amin
            anti-FLCN (a mouse monoclonal antibody against folliculin (Baba et al., 2006), the generous gift of Dr Laura Schmidt, Na
            Western blots were developed using horseradish peroxidase-conjugated secondary antibodies and enhanced chemilum

           20 g of total protein was loaded on 4–20% SDS–PAGE gels (Bio-Rad Laboratories, Hercules, CA, USA).
           Proteins were transferred onto Immobilon membranes (Millipore, Billerica, MA, USA) for western blotting.

1 ° Antibodies:
           anti-phospho-S6 (Ser 235/236) (Cell Signaling Technology, Danvers, MA, USA),
           anti-tuberin (TSC2 (Abcam, Cambridge, MA, USA)),
           anti-FLCN (a rabbit polyclonal antibody generated against a 20 amino-acid peptide comprising the C terminus of follicul
           anti-FLCN (a mouse monoclonal antibody against folliculin from Dr Laura Schmidt, National Cancer Institute, Bethesda,
           and anti--actin (Cell Signaling Technology). (Amersham Biosciences, Piscataway, NJ, USA).

2° Antibodies:
           Horseradish peroxidase-conjugated secondary antibodies
Western blot analysis (Dykyma et al 2008)
Protein extraction:
            Cultured cells and kidney whole-cell extracts prepared by homogenization were lysed in 1% Nonidet P-40, 50 mM Tris (
             plus standard protease inhibitors (protease inhibitor cocktail tablets, Roche Diagnostics). Equal amounts of mutant and
            size-separated by 10% SDS-PAGE and transferred to PVDF membranes (Invitrogen).

1 ° Antibodies:
           Mouse monoclonal anti-FLCN antibody (Laboratory of Antibody Technology), 1:1750
           Antibody–protein complexes were detected using ECL Western Blotting Detection Reagent (Amersham, Buckinghamsh




Western blot analysis (Takagi et al 2008)
          Protein concentration was determined by the DC-protein assay (Bio-Rad, Hercules, CA, USA).
          Equal amounts of proteins were subjected to SDS–polyacrylamide gel electrophoresis, transferred to Immobilon-P mem
          blocked in 1% skim milk in Tris-buffered saline containing 0.05% Tween 20, and blotted with the appropriate antibodie
          To probe with rabbit antibodies, Envision system (Dako) was used as described (Fukuda et al , 2000).
          To probe with mouse antibodies, anti-mouse immunoglobulin and streptavidin-biotinylated horseradish peroxidase (GE
          For detection, ECL reagents (GE Healthcare) were used.


Western blot analysis (Hasumi et al, 2008)
          ReliaBlot (Bethyl Laboratories, Montgomery, TX) was used for rabbit polyclonal western blotting to detect proteins imm


Antibody Production and Western Blot Analysis.
          Antibodies against 15 amino acid residues (Leu-Met-Ser-Thr-Val-Arg-Ser-Pro-Thr-Ala-Ser-Glu-Ser-Arg-Asn) of human fo
          This sequence differs by one residue from the rat sequence (rat exon 13). Antibodies were affinity-purified from serum
          and protein concentration was determined by DC (detergent compatible) protein assay (Bio-Rad). After addition of 2-m
          separated by SDS/PAGE (10% gel) and transferred onto nylon membranes. Reaction of primary and secondary antibodi
          described by Fukuda et al, 2000)

           Fukuda, T., Tani, Y., Kobayashi, T., Hirayama, Y. & Hino, O. (2000) Anal. Biochem. 285:, 274–276.




Immunoprecipitation, Western Blotting, and Northern Blotting (baba et al , 2006)
         Cells were lysed in lysis or RIPA buffer and immunoprecipitated at 4°C overnight with protein G-Sepharose- (Amersham
         The resin was washed five times with lysis buffer, proteins were eluted with SDS sample buffer, followed by boiling, an
         Cells were lysed in lysis buffer (20 mM Tris·HCl, pH 7.5, 135 mM NaCl, 1 mM EDTA, 1 mM Na3VO4, 50 mM NaF, 0.1% T
         (20 mM Tris·HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM Na3VO4, 50 mM NaF, 1.0% Triton X-100, 0.5% deoxycholate
         amounts of protein were immunoprecipitated at 4°C overnight with various antibodies bound to protein G-Sepharose (
           five times with lysis buffer, proteins were eluted with SDS sample buffer, followed by boiling, and Western blotting.
           For Northern blotting, a FNIP1 probe was PCR-generated from the unique FNIP1 sequence: forward, 5'-TGGAATCATTCA
           A BHD probe was generated by using exon 11 primers (7). Northern blotting was performed as described by using a Hu

Immunostaining (Koga et al, 2009)
         Rabbit polyclonal antibodies against full-length FLCN (sc-25777, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and pro
         and mouse monoclonal antibody against human cytokeratin (clone CAM5.2, BD Biosciences, Mountain View, CA, USA)
         (Dako, Carpinteria, CA, USA) and autoclave antigen retrieval. Working dilutions of the antibodies were 1:50 for FLCN, 1:

Western Blots (Koga et al, 2009)
          The same amount of proteins of cell lysates were electrophoresed on 12.5% sodium dodecylsufate–PAGE and transferr
          Horseradish peroxidase-conjugated goat anti-rabbit IgG (1:2500) was used as the secondary antibody. Bands were dete
          according to the Hybond ECL protocol (GE Healthcare, Buckinghamshire, UK).

Western blot analysis (Hudon et al, 2009)
          Protein extracts were resolved by SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes
          milk/TBST, the membranes were probed with monoclonal and polyclonal antibody against FLCN (monoclonal antibody
          (NCI, USA) and polyclonal antibody was raised against full-length human protein in our laboratory), β-actin (Sigma-Aldr
          Signaling Technology) or p-S6 ribosomal protein (Ser235/236) (Cell Signaling Technology).

Western Blot and Antibodies (Hasumi et al, 2009)
          The aged mice were euthanized by CO2 asphyxiation, their kidneys were removed, cut into small pieces, snap frozen in
          further analysis. For each mouse, one frozen kidney piece was homogenized in RIPA buffer [20mMTris-HCl, pH 7.5, 150
          X-100, 0.5% deoxycholate, 0.1% SDS (SDS), 100 nM Calyculin A, and Complete Protease Inhibitor mixture (Roche)] with
          16,000 g for 30 min. Protein concentrations of cleared supernatants were measured with BCA Protein Assay Kit (Pierc
          SDS-sample buffer was added, and samples were boiled for 5 min to produce 1 mg/mL sample lysates. A total of 20 g p
          was performed as previously described (1). Antibodies were diluted as follows: mouse monoclonal FLCN 1:1,000, beta -
          p-mTOR (Ser2448) 1:1,000, Raptor 1:1,000, p-mTOR(Ser2481) 1:1,000, Rictor 1:1,000, mTOR 1:1,000, p-S6K (Thr421/Se
          p-GSK3 / 1:1,000, Cyclin D1 1:1,000, p-FOXO1 1:2,0000, p-FOXO3a 1:500 [all antibodies except FLCN and beta actin
          (Biomedical Technologies, Inc.) are from Cell Signaling]. Secondary antibodies were diluted as follows: goat anti-mouse
          peroxidase, 1:10,000 (Vector laboratories). Antibody-protein complexes were detected using SuperSignal West pico ch
          according to the manufacturer’s instructions.

Immunoblot analysis and immunoprecipitation (Wang et al, 2009)
         Preparation of total cellular proteins, determination of protein concentration, immunoblot analysis and immunoprecip
         In immunoblot analysis, pre-absorption of antibodies was performed by mixing with phosphorylated or non-phosphory
         in 0.5% Tween 20/Tris-buffered saline (TBST) supplemented with 1% skimmed milk at room temperature for 1h.

Western and Northern Blot Analyses (van Slegtenhorst et al, 2007)
          For Western blots, 20 μg of each sample was run on 4–20% SDS-PAGE gel (Bio-Rad) and transferred to nitrocellulose us
          were detected using enhanced chemiluminescence (Amersham Biosciences). For Northern blots, 10 μg of total RNA wa
          nylon membrane overnight in 20× SSC. Probes for bhd+, c869.10+, isp4+, isp5+, and gpd3+ were PCR amplified from cD
          and hybridized using standard methods.
assay buffer with a polytron homogenise on ice followed by centrifugation at 16,000xg
BCA Protein Assay Kit (Pierce, IL) and adjusted to 1.33 mg/mL.
 to produce 1 mg/mL sample lysates.
yacrylamide gel electrophoresis.


1/2(Ser217/221), 1:1000;
 2(Thr201/Tyr204), 1:1000;




 er240/244), 1:1000;




Detection Reagent (Amersham, Buckinghamshire, UK)




 rotein was loaded on 4–20% SDS–PAGE gels (Bio-Rad Laboratories, Hercules, CA, USA).
 a, MA, USA) for western blotting with the following antibodies: anti-phospho-S6 (Ser 235/236) (Cell Signaling Technology, Danvers, MA, USA),
 lyclonal antibody generated against a 20 amino-acid peptide comprising the C terminus of folliculin: Ac-CYKSHLMSTVRSPTASESRN-OH),
006), the generous gift of Dr Laura Schmidt, National Cancer Institute, Bethesda, MD, USA) and anti--actin (Cell Signaling Technology).
 secondary antibodies and enhanced chemiluminescence (Amersham Biosciences, Piscataway, NJ, USA).

atories, Hercules, CA, USA).
a, MA, USA) for western blotting.




d peptide comprising the C terminus of folliculin: Ac-CYKSHLMSTVRSPTASESRN-OH),
Schmidt, National Cancer Institute, Bethesda, MD, USA)
n were lysed in 1% Nonidet P-40, 50 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, and 15% glycerol,
he Diagnostics). Equal amounts of mutant and control kidney cell protein extracts were




Detection Reagent (Amersham, Buckinghamshire, UK)




 Hercules, CA, USA).
 ctrophoresis, transferred to Immobilon-P membrane (Millipore, Billerica, MA, USA),
 0, and blotted with the appropriate antibodies.
cribed (Fukuda et al , 2000).
avidin-biotinylated horseradish peroxidase (GE Healthcare, Buckinghamshire, UK) were used in second and third steps, respectively.




 clonal western blotting to detect proteins immunoprecipitated by rabbit polyclonal antibodies.




Pro-Thr-Ala-Ser-Glu-Ser-Arg-Asn) of human folliculin (human exon 14) were generated by immunizing rabbits.
. Antibodies were affinity-purified from serum. Cell extracts were obtained by lysis with sample buffer for SDS/PAGE,
  protein assay (Bio-Rad). After addition of 2-mercaptoethanol, equal amounts of proteins were
s. Reaction of primary and secondary antibodies and chemiluminescent detection were performed as



 ochem. 285:, 274–276.




 ernight with protein G-Sepharose- (Amersham Pharmacia Biotech, Piscataway, NJ) bound antibodies.
 ith SDS sample buffer, followed by boiling, and Western blotting.
mM EDTA, 1 mM Na3VO4, 50 mM NaF, 0.1% Triton X-100, 5% glycerol, and Complete Protease Inhibitor mixture) or RIPA buffer
mM NaF, 1.0% Triton X-100, 0.5% deoxycholate, 0.1% SDS, and Complete Protease Inhibitor mixture), and lysates containing equal
ous antibodies bound to protein G-Sepharose (Pharmacia Biotech, Piscataway, NJ). The resin was washed
 followed by boiling, and Western blotting.
e FNIP1 sequence: forward, 5'-TGGAATCATTCAGACCCAGAA-3'; reverse, 5'-ACATCAGACACTGACGGAACC-3'.
ing was performed as described by using a Human 12-lane Multiple Tissue Northern Blot (BD Biosciences).


uz Biotechnology, Santa Cruz, CA, USA) and prosurfactant protein C (proSP-C, Millipore, Bedford, MA, USA),
5.2, BD Biosciences, Mountain View, CA, USA) were used. Immunohistochemistry was done using Envision kit
utions of the antibodies were 1:50 for FLCN, 1:100 for cytokeratin and 1:1000 for proSP-C.



 5% sodium dodecylsufate–PAGE and transferred to a PVDF membrane (Millipore).
 d as the secondary antibody. Bands were detected using an enhanced chemiluminescence system,




s and transferred to nitrocellulose membranes (Bio-Rad). After blocking in 5% nonfat
 antibody against FLCN (monoclonal antibody was kindly provided to us by Dr. Laura Schmidt
protein in our laboratory), β-actin (Sigma-Aldrich), β-tubulin (Abcam), S6 ribosomal protein (Cell




 removed, cut into small pieces, snap frozen in liquid nitrogen, and stored at 80 °C for
zed in RIPA buffer [20mMTris-HCl, pH 7.5, 150mM NaCl, 1 mM EDTA, 1 mM Na3VO4, 50 mM NaF, 1.0% Triton
plete Protease Inhibitor mixture (Roche)] with a Polytron homogenizer on ice followed by centrifugation at
 re measured with BCA Protein Assay Kit (Pierce Biotechnology, Inc.) and adjusted to 1.33 mg/mL, 4
duce 1 mg/mL sample lysates. A total of 20 g protein was loaded onto 4–20% or 4–15% SDS/PAGE gels. Immunoblotting
 llows: mouse monoclonal FLCN 1:1,000, beta - actin 1:250, p-AKT (Thr308) 1:1,000, AKT1 1:1,000, AKT2 1:1,000,
 ctor 1:1,000, mTOR 1:1,000, p-S6K (Thr421/Ser424)1:1,000, S6K 1:1,000, p-S6R (Ser240/244) 1:1,000, S6R 1:1,000,
  00 [all antibodies except FLCN and beta actin
  dies were diluted as follows: goat anti-mouse IgG-horseradish peroxidase, 1:10,000; goat anti-rabbit IgGhorseradish
were detected using SuperSignal West pico chemiluminescent Substrate (Pierce Biotechnology, Inc.)




 tion, immunoblot analysis and immunoprecipitation were performed as described previously.
mixing with phosphorylated or non-phosphorylated peptides (1 µg of antibodies : 1 µg of peptides)
mmed milk at room temperature for 1h.



 l (Bio-Rad) and transferred to nitrocellulose using standard methods. The immobilized proteins
ces). For Northern blots, 10 μg of total RNA was run on a 1% formaldehyde gel and transferred to
  isp5+, and gpd3+ were PCR amplified from cDNA, labeled with *α-32P+dCTP (PerkinElmer Life Sciences),
                   [Buffer recipe here]




                      BACK




aling Technology, Danvers, MA, USA),
 YKSHLMSTVRSPTASESRN-OH),
n (Cell Signaling Technology).




                      BACK
nd third steps, respectively.




                                BACK




mixture) or RIPA buffer
 lysates containing equal
BACK




BACK




BACK




BACK




BACK




BACK
qRT-PCR expression analysis of the BHD gene (Baba et al, 2008)
          Total RNA was isolated from frozen kidney tissues (one sample per kidney, one kidney sample per mouse ) using Trizol

Primer sequences:
           ß-actin forward: 5'-GACAGGATGCAGAAGGAGATTACTG
           ß-actin reverse: 5'-GCTGAT CCACATCTGCTGGAA
           BHD forward: 5'-GATGACAACTTGTGGGCGTGTC
           BHD reverse: 5'-CATCTGGACCAGGGTGTCCTCT




Real-time quantitative reverse transcription-PCR analysis (Hartman et al, 2009)
           For comparison of BHD mRNA levels in human cancer cell lines, mRNA was isolated using Trizol (Invitrogen).

Primer sequences:
           BHD forward: 5'-CAAGGCGCTCAAGGTGTTT
           BHD reverse: 5'-AATGGCGTGAAGGCTGTGT


qRT -PCR (Hasumi et al, 2008)
           qRT-PCR of human normal tissue was performed using TissueScan Real-Time Human-48 tissues (Origene, Rockville, MD
           and 7300 Real Time PCR System (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol.
           Sequence specific primers were designed using Primer Express computer software (Applied Biosystems).
           FLCN forward: 5'-TGC AGG TGC TGG TGA AGG TAA CCT-3'
           FLCN reverse: 5'-GGG ATT GGG CAA GTC AGA TGC TTG-3';
           FNIP1 forward: 5'-TTT GTT CCT CCC CAC TGC TTC CCA-3'
           FNIP1 reverse: 5'-AGT AGC AGC AGC TCA TTC CTT GGG-3';
           FNIP2 forward: 5'-CAC CCC ACA TCC GTT TCT CAT TAC G-3'
           FNIP2 reverse: 5'-CCC TGG AAG GTG GTG AAT GAG GGA A-3'.
           All samples normalized to ßactin measured with ßactin primer provided by the manufacturer.


           To investigate the expression levels of FLCN, FNIP1 and FNIP2 in renal tumors, qRT-PCR analysis was carried out with 10
           The isolation of total RNA, cDNA preparation and qRT-PCR with Taq-Man fluorescent probes for the measurement of e
           Primer sequences are: FNIP1 forward, 5'-AGA TTG GGC AGA AGA GGA TGA G-3', FNIP1 reverse, 5'-TTG GCA ATG TTG G
           FNIP1 forward: 5'-AGA TTG GGC AGA AGA GGA TGA G-3'                                FNIP1 reverse: 5'-TTG GCA AT
           FNIP1 TaqMan probe: 5'-CCT GGG TCA AAG TTA ATC GAA GTG AGT GCT G-3'             FNIP2 forward: 5'-GGT CCT TGG
           FNIP2 reverse: 5'-GTG AGC GGC CAA AGT TCC T-3'                                     FNIP2 TaqMan probe: 5'-CAA



BHD gene expression analysis by RT-PCR (da Silva et al, 2003)
          RNA was prepared after treatment using RNABee (AMS Biotechnologies, Milton, Oxfordshire, UK) according the manuf

           BHD gene expression was determined by RT-PCR using two pairs of primers: 5'-ATG AACAGTCGGATGCGTG-3' and 5'-TG
           producing an amplicon of 536 bp, and 5'-GGAGTGGATGAACAAAGTGA-3'and 5'-AACCTCGGGAGCAGACAT-3, resulting in

           GAPDH was used as positive control, where the GAPDH primers were (5'-GACCCCTTCATGACCTCAACTACA-3' and 5'-CTA




Reverse transcription PCR of BHD mRNA (Gunji et al, 2007)
           An Epstein–Barr virus-transformed lymphoblastoid cell line (EBV-LCL) was established from peripheral blood mononucl
           medium supplemented with 10% fetal calf serum. Total RNA was isolated from EBV-LCL (RNeasy Plus Mini Kit; Invitroge
           (ThermoScript RT-PCR system; Invitrogen).




RT-PCR and LOH studies (van Steensel et al. 2007)
          Skin punch biopsies (3 mm) of facial lesions were taken, after obtaining informed consent from the patients. The tissue
          extracted using the RNEasy mini kit from Qiagen, according to the manufacturer's recommendation. The tissue was ho
          homogenizer. First-strand synthesis was performed using the Superscript first-strand synthesis system (Invitrogen, Gro
          was then performed following the protocol outlined above. RT-PCR products were analyzed on a 1.5% agarose gel. Indi

           For LOH analysis, DNA was isolated from snap-frozen biopsies using the Puregene DNA isolation kit (Gentra Systems, M
           of the biopsy material was subjected to PCR and direct sequencing as described.




Quantitative RT–PCR assay for Drosophila BHD homolog and RP49 mRNA levels (Singh et al, 2006)
           Total RNAs were isolated from stages 6 to 12 of V32-Gal4/+ or V32-Gal4/UAS-iDBHD embryos using Trizol (Gibco BRL, L
           purified with Qiagen Rneasy kit. To avoid DNA contamination, the RNAs were first treated with 1 mu DNase I (2 /ml) fo
           reverse transcribed (RT) using SuperScriptIII First-Strand Synthesis System for RT–PCR (Invitrogen, Carlsbad, CA, USA). T

Quantitative RT–PCR (Hasumi et al, 2009)
           qRT-PCR of normal mouse tissue was performed using Mouse Major-Tissue Rapid-Scan containing
           single strand DNA from 24 major mouse organs (Origene). The primer sequences were: mouse-FLCN forward; 5 -TCCCA
           mouse-FLCN reverse; 5'- TGCACGTGACCTGAGAAGTCACCAA-3 . For AKT expression
           in mouse kidney tissues, qRT-PCR was performed according to manufacturer’s instructions. Total RNA was isolated
           from frozen kidney tissues and tumors using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions.
           The following PCR primers to amplify beta actin and AKT 1 and 2 were generated by using Primer express software: be
           forward: 5'- GATCTGGCACCACACCTTCTAC-3', beta actin reverse: 5 - TGGATGGCTACGTACATGGCTG-3 (GenBank
           accession no. NM 007393.3); and AKT1 forward: 5'-AGGACTGACGCGACCATGTTG.
           AKT1 reverse: 5'-GGACCCTAGAGACAGGTGGC-3 (GenBank accession no. NM 009652.2); AKT2 forward: 5 - TGGGCTCCC
           3' , AKT2 reverse: 5'-CACCCTCTTGGAGGCTAGTGG-3 (GenBank accession no. NM 001110208.1). Three independent ex
           beta-actin gene as an internal control.

Real Time Reverse Transcriptase-PCR (van Slegtenhorst et al, 2009)
           Contaminating DNA from RNA preparations was removed using TURBO DNA-free ™ (Ambion, Austin, TX). RNA was qua
           with a RNA 6000 Nano LabChip. RNA was reverse-transcribed using Moloney murine leukemia virus reverse transcripta
           random decamers. For each sample, 2 RT reactions were performed with inputs of 50 and 10 ng. A–RT control reaction
           5′-Nuclease assays using TaqMan chemistry were run on a 7900 HT sequence detection system (Applied Biosystems, Fo
           software from Applied Biosystems. The 5′ and 3′ ends of the probes were labeled with the reporter dye 6-FAM (6-carbo
           quencher dye BHQ1 (Black Hole Quencher) (Biosearch Technologies, Novato, CA), respectively. Cycling conditions were
           Ct (cycle threshold) values were converted to quantities (in arbitrary units) using a standard curve (5 points, 5-fold dilut
           For each sample, the 2 values of relative quantity (from 2 PCR) were averaged.
y, one kidney sample per mouse ) using Trizol reagent (Invitrogen)




                                                                                                      BACK




as isolated using Trizol (Invitrogen).




 me Human-48 tissues (Origene, Rockville, MD), Power SYBR Green PCR Master Mix
cording to the manufacturer's protocol.
 software (Applied Biosystems).




by the manufacturer.


mors, qRT-PCR analysis was carried out with 106 sporadic renal tumor specimens and 37 normal kidney specimens.
 fluorescent probes for the measurement of ene expression were performed essentially as previously described ([Yao, 2005] and [Yao, 2007]).
GA G-3', FNIP1 reverse, 5'-TTG GCA ATG TTG GGC TGA-3',
                 FNIP1 reverse: 5'-TTG GCA ATG TTG GGC TGA-3'
G-3'           FNIP2 forward: 5'-GGT CCT TGG AAG TGG AGC TG-3',
                  FNIP2 TaqMan probe: 5'-CAA GGT CTC AGA GCA TCA GCA CCC AGA-3'.                        BACK




 Milton, Oxfordshire, UK) according the manufacturer’s guidelines.

ers: 5'-ATG AACAGTCGGATGCGTG-3' and 5'-TGGTGTAGGAATGGCGTGA-3',
and 5'-AACCTCGGGAGCAGACAT-3, resulting in a PCR product of 595 bp.

 GACCCCTTCATGACCTCAACTACA-3' and 5'-CTAAGCAGTTGGTGGTGCAGGA-3'), producing a PCR product of 369 bp.




s established from peripheral blood mononuclear cells using standard methods and maintained in RPMI 1640
d from EBV-LCL (RNeasy Plus Mini Kit; Invitrogen) and cDNA synthesised by reverse transcriptase (RT) PCR




nformed consent from the patients. The tissue samples were snap frozen in liquid nitrogen. RNA was
acturer's recommendation. The tissue was homogenized, without prior thawing, with a high-speed stationary
 first-strand synthesis system (Invitrogen, Groningen, The Netherlands) according to the manufacturer's instructions. PCR
ucts were analyzed on a 1.5% agarose gel. Individual PCR products were isolated and directly sequenced.

 uregene DNA isolation kit (Gentra Systems, Minneapolis, MN) according to the manufacturer's recommendations. Genomic DNA



                                                                                                                   BACK



 UAS-iDBHD embryos using Trizol (Gibco BRL, Life technologies Inc., Grand Island, NY, USA), and then
were first treated with 1 mu DNase I (2 /ml) for 30 min at 37°C. Total RNA (100 ng) was
m for RT–PCR (Invitrogen, Carlsbad, CA, USA). The RT–PCR products were visualized in 1% agarose gel.

                                                                                                                   BACK
ue Rapid-Scan containing
quences were: mouse-FLCN forward; 5 -TCCCACCATGGAAGACAGCAAGCA-3',

urer’s instructions. Total RNA was isolated
 ccording to the manufacturer’s instructions.
nerated by using Primer express software: beta-actin
ATGGCTACGTACATGGCTG-3 (GenBank

 NM 009652.2); AKT2 forward: 5 - TGGGCTCCCCTCTGTTCCAG-
 no. NM 001110208.1). Three independent experiments were performed in triplicate using the
                                                                                                                    BACK


 NA-free ™ (Ambion, Austin, TX). RNA was quantified using the Agilent 2100 BioAnalyzer in combination
 ney murine leukemia virus reverse transcriptase (Ambion) and a mixture of anchored oligo(dT) and
  inputs of 50 and 10 ng. A–RT control reaction with 50 ng of input was also performed for each sample.
ence detection system (Applied Biosystems, Foster City, CA). TaqMan sets were designed using Primer Express™ version 2.0
  labeled with the reporter dye 6-FAM (6-carboxyfluorescein) (Glen Research, Sterling, VA) and the
 ato, CA), respectively. Cycling conditions were 95 °C, 15 min followed by 40 (two steps) cycles (95 °C, 15 s; 60 °C, 60 s).
s) using a standard curve (5 points, 5-fold dilutions) established with a calibrator sample.

                                                                                                                    BACK
cribed ([Yao, 2005] and [Yao, 2007]).
ndations. Genomic DNA
Radioimmunoprecipitation buffer:
         20 mM Tris-HCl,
         pH 7.5,
         150 mM NaCl,
         1 mM EDTA,
         1 mM Na3VO4,
         50 mM NaF,
         1.0% Triton X-100,
         0.5% deoxycholate,
         0.1% sodium dodecylsulfate (SDSS,
         100 nM calyculin A,
         Complete Protease Inhibitor cocktail (Roche, Molecular Biochemicals, Indianapolis, IN)
Review article




Human in vitro
          Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI
            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
BACK
IHC analysis for phospho-S6 in oncocytic cysts and tumours (Hartman et al 2009)

           Paraffin sections were deparaffinized, rehydrated, boiled in 10 mm sodium citric buffer (pH 6.0; Sigma) and blocked wi
           The sections were incubated with rabbit polyclonal antibody against phospho-S6 (Ser 235/236) (Cell Signaling Technolo
           and lightly counterstained with hematoxylin (Biomeda, Burlingame, CA, USA). For mouse tissues, EnVision+ System-HRP
           was used in place of the rabbit secondary antibody and Histostain-Plus kit HRP-Streptavidin was used to reduce backgr

           Negative control included substitution of phosphate-buffered saline for the primary antibody.




IHC and tubular marker staining (FLCN, mTOR and phospho S6) (Dykyma et al, 2008)

           The antibodies used include anti-FLCN mAb, anti-Phospho-mTOR Rabbit mAb (Cell Signaling), and anti-Phospho-S6 Ribo
           Proximal tubules were stained by biotinylated Lotus Tetragonolobus Lectin (LTL, Vector Laboratories), and distal tubule
           rabbit anti-thiazide-sensitive NaCl contransporter affinity purified polyclonal antibody (TSC, Chemicon) Tubular marker
           Marker biotinylated Peanut Agglutinin (PNA, Vector Laboratories) was used to stain collecting ducts.



Histology ( Gatalica et al , 2009)
            Formalin-fixed, paraffin-embedded tissue sections were used throughout the study. Immunohistochemical assays were
            of low-molecular-weight cytokeratin CK7 (mouse monoclonal IgG1 antibody OV-TL 12/30 , 1:200 dilution, DakoCytoma
            CD10 (mouse monoclonal IgG1 antibody, manufacturer prediluted, Ventana, Tucson, AZ), and Fhit (Polyclonal rabbit IgG
            The tissue sections were deparaffinized and then were treated with DAKO Target Retrieval Solution (DakoCytomation)
            For Fhit assay, primary incubation was carried out at room temperature, whereas CK7 and CD10 primary antibody incu
            detection kit with 3,3'-diaminobenzidine chromagen (DakoCytomation); slides were counterstained with hematoxylin.

Histological and Immunohistochemical Analysis (Hasumi et al, 2009)
            Embryos were isolated at 5.5–6.5 dpc and fixed overnight in 4% PFA then embedded in paraffin, sectioned at 5 m and
            for DAB2 was performed as previously described (3). The primary antibody for DAB2 (BD Biosciences) was diluted 1:100
            for the negative controls. The slides were read by at least three persons, including two pathologists (Drs. M.J. Merino a
Review article
Human in vitro
           Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI




            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
 m citric buffer (pH 6.0; Sigma) and blocked with 3% hydrogen peroxide in methanol.
spho-S6 (Ser 235/236) (Cell Signaling Technology) overnight at 4 °C, developed using the Histostain-Plus kit (Invitrogen)
USA). For mouse tissues, EnVision+ System-HRP labeled polymer (DakoCytomation, Carpinteria, CA, USA)
 t HRP-Streptavidin was used to reduce background staining of the kidney.

he primary antibody.




mAb (Cell Signaling), and anti-Phospho-S6 Ribosomal Protein (Cell Signaling).
in (LTL, Vector Laboratories), and distal tubules were detected by using
 nal antibody (TSC, Chemicon) Tubular markers.
ed to stain collecting ducts.




  the study. Immunohistochemical assays were used to evaluate the expression
ody OV-TL 12/30 , 1:200 dilution, DakoCytomation, Carpinteria, CA),
ana, Tucson, AZ), and Fhit (Polyclonal rabbit IgG antibody, ZR44, dilution 1:400, Zymed Laboratories, Inc, San Francisco, CA).
O Target Retrieval Solution (DakoCytomation) at pH 6.0 and incubated at 90°C for 30 minutes to retrieve specific epitopes.
 whereas CK7 and CD10 primary antibody incubations were carried out at 37°C. Detection was performed using a standard
slides were counterstained with hematoxylin.



 embedded in paraffin, sectioned at 5 m and stained with hematoxylin and eosin (H&E). Immunohistochemical analysis
dy for DAB2 (BD Biosciences) was diluted 1:100. Primary antibody was replaced by normal mouse IgG antibody
including two pathologists (Drs. M.J. Merino and D.C. Haines).
BACK




BACK




BACK




BACK
Northern blot analysis (Takagi et al, 2008)
           FNIPL and FNIP1 cDNA fragments showing lowest homology were used as probes.
           Briefly, a FNIPL cDNA was amplified by PCR from the constructed plasmid using primers FNOF2 (5'-CCGAATTCCCAGCAT
           subcloned and then used as a probe. Similarly, a FNIP1 cDNA was generated from the constructed plasmid cDNA using
            For BHD, the full-length cDNA was used as a probe. Northern blotting was performed by using a human multiple tissue


Northern blot analysis (Nickerson et al , 2002)
           Northern blot analysis of BHD expression was carried out with standard methods. The exon 11 amplicon of the BHD ge
           RNA antisense probe labeling using the Strip-EZ Probe Synthesis and Removal Kit (Ambion, Inc.) in a linear PCR reaction
           antisense gene specific primer according to the manufacturer’s protocols. Hybridizations were carried out in Ultrahyb s
           (Ambion, Inc.) at 42 C overnight, and washed using the manufacturer’s protocols.



mRNA isolation, northern analysis and 5-RACE (Lingaas et al , 2003)
          Tissues were collected from all dogs shortly post-mortem. All tissues were then immediately immersed in liquid nitroge
          TRIZOL reagent (Invitrogen Inc., Carlsbad, CA, USA) as recommended by the manufacturer. Total RNA was isolated from
          In addition, total RNA was isolated from kidneys from three unaffected and three dogs affected with RCND.

           A kit was used for the Northern blot procedure (NorthernMax, Ambion Inc., Austin TX, USA). Ten micrograms of total R
           containing formaldehyde and electrophoresed at 5 V/cm for 2 h. Ribosomal RNA was visualized under UV light after eth
           RNA was transferred to a nylon membrane (Hybond N+, Amersham, Inc. Piscataway, NJ, USA) by capillary transfer, then

           The blot was prehybridized in ULTRAhyb solution (Ambion Inc., Austin, TX USA) for 30 min at 68°C. A PCR product from

           Four microlitres [32P]dCTP were added and the following protocol was used: initial denaturation at 95°C for 3 min follo
           The radiolabeled DNA probe was added at a concentration of 106 cpm per ml to the ULTRAhyb solution. The blot was i

           The blot was washed in 2x SSC at room temperature two times for 5 min each, then washed in 0.1x SSC at 42°C (exon 5
           The blot was then exposed to film at -80°C with an intensifying screen overnight for autoradiography.

           For 5' amplification of BHD cDNA, the SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA) was used. One
           First-strand cDNA was made according to the manufacturer's instructions. The cDNA was then specifically amplified acc
           BHD-specific primer (5'-CGATGGCATTCATGGTGTCCTGGAG-3').



RNA Isolation, Northern Blot Analysis, and cDNA Amplification (Okimoto et al, 2004)
           Total RNAs were isolated by TRIzol reagent (Invitrogen). Northern blotting and RT-PCR were performed as described by
           Bhd cDNA fragments, total RNAs from whole mouse embryos at embryonic day 13.5 and the following primer sets wer
           and B2-46B, 5'-CCCACAAGTTGTCATCACTG-3' (reverse); primer set 2, B2-50A, 5'-TCATGGGGAATCAGGTGATC-3' (forwar
           For amplification of rat Bhd cDNA fragments, the following primer sets were used: primer set 1, BHDRI, 5'-CCCTCTGCCA
           primer set 2, BHDRA, 5'-GCACCCAGGTTATATCAGTC-3' (forward), and BHDRB, 5'-AGACAGGTTCTGGTTGGTCA-3' (revers
           BHDRF, 5'-CTCCGTGACTCTGTAGCTG-3' (reverse). Amplified cDNA fragments were characterized by direct sequence an
           Briefly, for 5'-RACE, first-strand cDNAs were synthesized by using total RNAs from a whole rat embryo with primer BHD
           by RNA ligase, first inverse PCR was performed by using a primer set, BHDG8 (5'-CAAGAAGTCAGACATGTGCG-3', forwar
           portions of first PCR mixture were subjected to second PCR using a primer set, BHDRA and BHDG10 (5'-GAGCGTGTAGA
           by using a primer, cDNA-1 (5'-GAGAGAGAAGAGAGAGAGAACTAGTGCGGCCGCTTTTTTTTTTTTTTTTTT-3'). For first PCR an
           BHDRH, 5'-TTGTGGTGACCAGCGGTAG-3' (forward) and NOT3-1, 5'-AGAACTAGTGCGGCCGCTT-3' (reverse) for first PCR;
           NOT3-1 for second PCR. cDNA fragments amplified by RACE were sequenced both directly and after subcloning in plasm
           Kobayashi, T., Hirayama, Y., Kobayashi, E., Kubo, Y. & Hino, O. (1995) Nat. Genet. 9:, 70–74.
           Satake, N., Kobayashi, T., Kobayashi, E., Izumi, K. & Hino, O. (1999) Cancer Res. 59:, 849–855.


Northern blot and semi-quantitative reverse transcription-PCR analysis (Hudon et al, 2009)
           Total RNA was isolated from embryonic mice and adult mouse kidneys using RNA PureLink Micro-to-Midi (Invitrogen) a
           Single-stranded cDNAs were synthesized using SuperScript II-RNas H-reverse transcriptase (Invitrogen) with random pr
           900-bp cDNA probe for Flcn. A GAPDH probe was used as a loading control.




Review article
Human in vitro
           Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI




            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
d plasmid using primers FNOF2 (5'-CCGAATTCCCAGCATCAGACGCTTCCT-3') and FNOR2 (5'-TGGACACGACCTCGGACAACTTAAGGG-3'),
as generated from the constructed plasmid cDNA using primers FNOF1 (5'-GGGAATTCTTGCAGTCATCCACTCCTTG-3') and FNOR1 (5'-AAGGAGTCGTCCTG
 otting was performed by using a human multiple tissue northern blot membrane (Clontech, Mountain View, CA, USA).




tandard methods. The exon 11 amplicon of the BHD gene was used as a template for
 and Removal Kit (Ambion, Inc.) in a linear PCR reaction with 32P-dATP and the
protocols. Hybridizations were carried out in Ultrahyb solution with a 1 hr prehybridization




sues were then immediately immersed in liquid nitrogen. RNA was isolated from 50–100 mg canine tissues using
nded by the manufacturer. Total RNA was isolated from tissues of two unaffected adult dogs.
ffected and three dogs affected with RCND.

Ambion Inc., Austin TX, USA). Ten micrograms of total RNA for each sample were loaded onto 1.0% agarose gels
 . Ribosomal RNA was visualized under UV light after ethidium bromide staining to check for possible degradation.
ham, Inc. Piscataway, NJ, USA) by capillary transfer, then UV crosslinked.

Austin, TX USA) for 30 min at 68°C. A PCR product from exon 6–9 or exon 5 was radioactively labeled and used as probe.

col was used: initial denaturation at 95°C for 3 min followed by 30 cycles each of 95°C for 30 s, 58°C for 20 s, 72°C for 60 s and 72°C for 5 min.
06 cpm per ml to the ULTRAhyb solution. The blot was incubated overnight at either 42 or 68°C in a roller bottle hybridization oven.

for 5 min each, then washed in 0.1x SSC at 42°C (exon 5 probe) or 65°C (exon 6–9 probe) two times for 15 min each. The blot was then exposed to film
screen overnight for autoradiography.

fication kit (Clontech, Palo Alto, CA, USA) was used. One microgram of total RNA isolated from a Beagle kidney was used.
structions. The cDNA was then specifically amplified according to the manufacturer's instructions using a canine




rn blotting and RT-PCR were performed as described by Koayashi et al , 1995. For amplification of mouse
  embryonic day 13.5 and the following primer sets were used: primer set 1, B2-46A, 5'-CAAGAAGTCGGACATGTGTG-3' (forward),
 et 2, B2-50A, 5'-TCATGGGGAATCAGGTGATC-3' (forward) and B2-50B, 5'-CGTCATCCAGAACTTCAGCA-3' (reverse).
 er sets were used: primer set 1, BHDRI, 5'-CCCTCTGCCACTTCTGCGA-3' (forward), and BHDRG, 5'-AAGCCATGTTGCTCATCACC-3' (reverse);
), and BHDRB, 5'-AGACAGGTTCTGGTTGGTCA-3' (reverse); primer set 3, BHDRH, 5'-TTGTGGTGACCAGCGGTAG-3' (forward), and
 A fragments were characterized by direct sequence analysis. 5'- and 3'-RACE were performed as described by Satake et al, 1995.
 g total RNAs from a whole rat embryo with primer BHDG7 (5'-GGCTGACGTACTTGATAGAG-3'). After circularization
 r set, BHDG8 (5'-CAAGAAGTCAGACATGTGCG-3', forward) and BHDG9 (5'-CTTCCTCAGCCTGCTCAAC-3', reverse). Then,
 g a primer set, BHDRA and BHDG10 (5'-GAGCGTGTAGAACCTCCGT-3', reverse). For 3'-RACE, first-strand cDNA was synthesized
 GTGCGGCCGCTTTTTTTTTTTTTTTTTT-3'). For first PCR and second, nested PCR, the following primers were used:
 5'-AGAACTAGTGCGGCCGCTT-3' (reverse) for first PCR; BHDRK, 5'-CAAGGAGGACACCCAGAAG-3' (forward) and
re sequenced both directly and after subcloning in plasmid vectors.
 995) Nat. Genet. 9:, 70–74.
99) Cancer Res. 59:, 849–855.




 idneys using RNA PureLink Micro-to-Midi (Invitrogen) according to the manufacturer’s instructions.
Nas H-reverse transcriptase (Invitrogen) with random primers. Nothern blot analysis was done with a
GACCTCGGACAACTTAAGGG-3'),
CACTCCTTG-3') and FNOR1 (5'-AAGGAGTCGTCCTGGTTTCTCTTAAGCC-3').




                                                                     BACK




 and used as probe.

or 20 s, 72°C for 60 s and 72°C for 5 min.
oller bottle hybridization oven.

or 15 min each. The blot was then exposed to film at -80°C with an intensifying screen overnight for autoradiography.


 le kidney was used.

                                                                     BACK




GGACATGTGTG-3' (forward),

GCCATGTTGCTCATCACC-3' (reverse);
CGGTAG-3' (forward), and
cribed by Satake et al, 1995.


nd cDNA was synthesized
BACK




BACK
Immunocytochemistry (Takagi et al, 2008)
         HeLa cells transfected with Myc-FnipL, Myc-FnipLDBglII, Myc-Fnip1 and Flag-Flcn expression plasmids were cultur
         on a glass bottom dish (Matsunami, Osaka, Japan) for 48 h. Cells were washed with ice-cold PBS and
         fixed with 2% paraformaldehyde and permeabilized with 0.1% Triton X-100 for 30 min at 4 1C. Incubation with an
         (mouse) and anti-Myc (rabbit) antibodies was performed at 4 1C for 1 h in PBS containing 0.05% Tween 20.
         The secondary antibodies used were Alexa Fluor 488-conjugated goat anti-mouse IgG and Alexa Fluor 568-
         conjugated goat anti-rabbit IgG (Invitrogen, Carlsbad, CA, USA). DAPI was used for counterstaining. After 1 h incub
         with the secondary antibodies, cells were examined by using a laser-scanning microscope (LSM510 META; Zeiss,
         using a laser-scanning microscope (LSM510 META; Zeiss, Thornwood, NY, USA).
Review article




Human in vitro
          Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI
            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
n expression plasmids were cultured
with ice-cold PBS and
30 min at 4 1C. Incubation with anti-Flag
 ontaining 0.05% Tween 20.
 e IgG and Alexa Fluor 568-
 or counterstaining. After 1 h incubation
 croscope (LSM510 META; Zeiss,




                                            BACK
RNA interference (Takagi et al, 2008)
           Transfection of siRNA into HeLa cells was performed with Lipofectamine 2000 (Invitrogen) at a final concentration
           40 nM according to the manufacturer’s instructions. After 48 h cells were lysed with SDS–PAGE lysis buffer and an
           western blotting. siRNA sequences used were as follows (sense and antisense in 50–30 orientation): for BHD, SIHB
           CAGCAUCAUCACCAUTT and AUGGUGAUGAUGCUGUACCTT); for FNIPL, HFLS1 (GCCUGAUCUUGUG
           FNIP1, HFP1S1 (CCCUGUGAACUUCCCUGUUTT and AACAGGGAAGUUCACAGGGTT). Results of western
           blotting were analysed by using ImageJ software (ver. 1.39u)




RNA Intereference (Piao et al. 2009)
          Transfection of siRNA (25 nM, Final) was performed with Lipofectamine 2000 (Invitrogen) and OPTI-MEM (Gibco)
          to the manufacturer’s protocols. Forty-eight hours after transfection, cells were lysed for further analysis. Sequen
          (sense strands without 3'-overhang) were: Tsc2, 5'-GCCCUCACAGACAAUGGAA-3'; raptor, 5'-GCCUGAGUCUGUGAA
          rictor, 5'-CCUCCUCAGUUAGGUCUAU-3'; S6K1, 5'-CUCAGCGUUCGUAAGGAUU-3'; S6K2, 5'-GCCAGUAGAUAGUCCA
          control, 5'-GCUGCAAUCGAUUGAUAGC-3'.
Review article




Human in vitro
          Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI
            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
nvitrogen) at a final concentration of
with SDS–PAGE lysis buffer and analysed by
 50–30 orientation): for BHD, SIHB3(GGUA
GCCUGAUCUUGUG
 T). Results of western




                                                   BACK




nvitrogen) and OPTI-MEM (Gibco) according
 lysed for further analysis. Sequences of siRNAs
 '; raptor, 5'-GCCUGAGUCUGUGAAUGUA-3';
 ; S6K2, 5'-GCCAGUAGAUAGUCCAGAU-3'



                                                   BACK
Mutational Analysis (Kim et al, 2008)
          Genomic DNA was extracted from peripheral blood leukocytes.
          All the coding regions of the BHD gene (exons 4-14) were amplified using polymerase chain reaction (PCR) with oligonu

                 Exon                      Primer name                  Sequence (5' - 3')
                   4                         FLCN- E4-f                 TCATGGAGTCAATAGGCATTGGCA
                                             FLCN- E4-r                 TGCAGTGAGCCATGATCACACCAT
                  5                          FLCN- E5-f                 GTTACCTACTTCGTAAGTGCTCAGC
                                             FLCN- E5-r                 CCTGTGCAATGCTGGCTCCGAGC
                  6                          FLCN- E6-f                 AGAGTACAGTCTTCGGCTCTCATGG
                                             FLCN- E6-r                 ACAATTCACACAGTGCACTGGCTG
                  7                          FLCN- E7-f                 TCCAGGAGTCAGGTCCTGGAGTT
                                             FLCN- E7-r                 CAGATCTGTGCTCACTGACAAGTG
                  8                          FLCN- E8-f                 GTTGACTTGTGGAACTGCCTGCAT
                                             FLCN- E8-r                 CTCGTTCTGGGCTGATTCAGAGC
                  9                          FLCN- E9-f                 CCAGGAATCTACACTGACCGGCT
                                             FLCN- E9-r                 GAGGCTGTCAGTCACTTCCTGCA
                  10                        FLCN- E10-f                 GCCTCCCTGAGAAGATAAGTGTCTT
                                            FLCN- E10-r                 GGTGCACAGCGGTTCTGTGCT
                  11                        FLCN- E11-f                 GTACAAGCTGGTGTGTGACTGGC
                                            FLCN- E11-r                 TCTCCACAACCCATGACAGAGATCT
                12, 13                    FLCN- E12, 13-f               ACTGACCTGGGATGAGCGGAGT
                                          FLCN- E12, 13-r               ACCTGAGCTTTGCAGTGGCGGA
                  14                        FLCN- E14-f                 GCTGGTGCCAAAGCCGTGTCA
                  15                        FLCN- E14-r                 ACAGCTCCTTCCAGCAGTTGAGA

BHD mutation analysis (Toro et al, 2008)
         DNA was extracted from peripheral blood leucocytes according to standard procedures. Methods for identification of e
         sequencing were as previously described (Nickerson et al, 2002). At least 160 unrelated control individuals were exam
         Insertion and deletion mutations were confirmed by subcloning using Topo Cloning Kit (Invitrogen) and sequencing.


Analysis of the BHD gene (Nickerson et al, 2002):
BHD cDNA isolation and analysis
            Full length BHD cDNA was isolated and sequenced as follows: cDNA was obtained from normal adult kidney, and adult
                                                                                          '
            Gene-specific primers were designed approximately 50 bases from the 5' and 3•ends of BC015687 and BC015725, resp
            amplify a 3.2 kb transcript from each library which was shotgun sequenced. Takara long and accurate (LA) reagents we
            with recommended buffer conditions and extension times. Sequencing primers were spaced approximately 500 bp apa
            double -stranded sequencing. A minimum of 4 fold coverage was obtained for each transcript. PCR from these cDNA po
            Advantage Polymerase Mix (Clontech).The structure of the normal transcript was assembled from the consensus seque
            Independently, Origene Technologies, Inc. screened several cDNA libraries and isolated a longest clone from lung. The
            sequenced to > 4 fold, double-stranded coverage. Spliced I.M.A.G.E. Clones identified from the UCSC Genome Browser
                            '                                                                                    '     '
            for additional 5•end sequence. These clones extended the Clontech transcript sequence 106 bases. 5•and 3•RACE stud
            lung and kidney are underway to confirm the complete sequence of the normal gene.

Mutation analysis of the BHD gene
          Two overlapping, uncharacterized, full-length transcripts from skin melanoma (MGC project; BC015725 and BC015687)
          2001 UCSC Genome Browser release, and highlighted a spliced EST cluster on BAC clone RP11-45M22 (AC055811) whic
          Exon/intron structure was determined as described above and intronic primers were designed to amplify 14 coding exo
          Family cosegregation of frameshift mutations with disease was determined by sequencing subcloned amplicons. A 28 b
                                                                                                                            fs
           the wild-type allele by electrophoresis on a 4%-20% gradient polyacrylamide gel (Novex) according to manufacturer• p
           Family consegregation studies of missense mutations were conducted using DHPLC

 Exon #    Forward primer
    1      SKB1: 5′-GGA CTC TGG CCC TAA ACC C
    2      SKB3: 5′ GAC AGC AAG CCT GGG CCA AG
    3      SKB5: 5′ AAG GAC GAT GTG CAT GGT GG
    4      SKB7: 5′ CAC TGC TCT CAG GTC CTC C
    5      SKB9: 5′ AGT GCC TGC CTC CCT GTG C
    6      SKB11: 5′ TCA GCA CAG AGC GGC TCA TG
    7      SKB13: 5′ CCA ATG TAT CGT GAC TGC TCT ATC
    8      SKA1: 5′ GCC CCA GAT CAG GAA CCT G
    9      SKA3: 5′ CCA TGA CTG GCT CTC CTC CT
   10      SKA5: 5′ GCA CCA GGC CAA TAC TGC
   11      SKA7: 5′ GGT TCC ACT TTG GGC CTG AG
 12 + 13   SKA9: 5′ CAG CTC CAG GTT TTC TCC AGG
   14      SKA11: 5′ CCT CGG GAG CAG ACA TGT TAT TG

PCR reaction components are standard. Cycling conditions: 95°C for 3 min, 94°C for 45 s, anneal Tm for 1 min, 72°C for 1 min for 40




Mutation analysis (Leter et al, 2007)
          Genomic DNA was extracted from blood samples. Histologically normal tissue from a renal carcinoma slide of a decease
          extraction. Primers for the amplification and sequencing of the 14 exons were as detailed by Nickerson et al. (2002). Am
          thermocycler (Applied Biosystems, Forster City, CA). Sequencing reactions were performed using Big Dye Terminator (A


           PE 9700 thermocycler (Applied Biosystems, Forster City, CA). Sequencing reactions were performed using Big Dye Term
           ABI 3100 genetic analyzer (Applied Biosystems).

           Nickerson et al (2002) Technique


DNA Probes Preparation and DNA Sequencing Analysis (Yang et al, 2008)
         BAC based DNA hybridization probes for FISH were prepared by using Vysis Nick-translation Kit (Abbott Molecular Inc./
          or Spectrum-Green. Sky painting probes were prepared in-house, as detailed in: http://www.riedlab.nci.nih.gov/proto
          line was performed on our lab ABI PRISM™ 310 Genetic Analyzer (Perkin Elmer, CA).




BHD Sequence Analysis (Toro et al, 2007 )
               see        Nickerson et al (2002) Technique


DNA preparation, SSCP and sequencing analysis of the BHD gene (Murakami et al, 2007)
          High-molecular-weight genomic DNA was prepared from tissue samples by proteinase K/phenol chloroform extraction
          PCR primers, single-strand conformational polymorphism (SSCP) analysis, and direct sequencing for detecting intrageni
           were performed essentially as previously described (Nickerson et al, 2002) . Sequencing was carried out using the Dual

Microsatellite LOH analysis (Murakami et al, 2007)
           Two microsatellite markers, D17S925 and D17S2196 (GenBank Accession Nos Z23 567 and G27265, res- pectively), bot
           After standard PCR amplification for 35 cycles, the products were electrophoresed by a GenePhor DNA separation syste
           according to the manufacturer's protocols (GE Healthcare Biosciences). The intensity of each allele was measured using
           for determining allelic imbalance.

          Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study
          The DNA was extracted from peripheral blood leukocytes of patients. The presence of mutations in the VHL gene was t
          as previously described.(Stolle et al, 1998). For screening of mutations of the MET proto-oncogene, conformational, se
          followed by sequencing of exons 16 through 19 of abnormally migrating bands, as described (Schimdt et al , 1997)

           Stolle C, Glenn G, Zbar B, et al. Improved detection of germline mutations in the von Hippel-Lindau disease tumor supp
           Schmidt L, Duh FM, Chen F, et al. Germline and somatic mutations in the tyrosinase kinase domain of the MET proto-on


Mutation analysis (Khoo et al , 2002)
           For mutation analysis of BHD, we used the primer sequences
           14 exons. Amplicons were verified by gel electrophoresis before purification with Multiscreen PCR cleanup plates (Milli
           Sequencing reactions were performed using Big Dye Terminator (Applied Biosystem), purified through Sephadex
           G-50 (Pharmacia), and run on an ABI 3700 genetic analyser. We aligned and analysed all sequences by Blast 2 Sequence




DNA Analyses (Pavlovich et al, 2002)
          Renal tumor DNA was prepared from 32 tumors for microsatellite and sequence analyses. Flash-frozen specimens were
          from microdissected formalin-fixed, paraffin-embedded tissue sections (N = 10). Proteinase K digestions overnight at 5
          Mannheim, Germany) were followed by DNA preparation under high-salt conditions (Puregene kit, Gentra Systems, Mi
          Corresponding peripheral blood DNA was prepared, and matched tumor and normal DNA was used to perform fluoresc
          microsatellite analysis for LOH as per Cawkwell et al. using an ABI Prism Sequencing machine with POP4 matrix and Ge
          4 Primers for two chromosome 3p25–26 markers flanking the VHL gene (d3s1038 and d3s1110) were used, and an alle
          in tumor compared with matched normal DNA were <0.5 or >2.0. All PCR was performed in duplicate and repeated at l
          von Hippel-Lindau gene (VHL) was performed as previously described. (Stolle et al, 1998).

           Cawkwell L, Bell SM, Lewis FA, et al. Rapid detection of allele loss in colorectal tumors using microsatellites and fluores
           Stolle CA, Glenn G, Zbar B, et al. Improved detection of germline mutations in the von Hippel-Lindau disease tumor sup

DNA isolation and MSI analysis (Shin et al, 2003)
           In a total of 310 cases of sporadic colorectal cancers, genomic DNA from the tumour and corresponding normal tissues
           Renal tumors in the Birt-Hogg-Dubé syndrome.
           with fluorescent dye labelled primers of BAT-26 and BAT-25 markers. Thirty-two of 310 (10.3%) sporadic colorectal car

Mutation analysis of the BHD gene (Shin et al, 2003 )
          To screen for mutations in the BHD gene, entire exons of the gene were examined by DNA sequence analysis. The prim
          for amplification have been described previously (Nickerson et al, 2002). Bidirectional sequences of PCR products were
            Nickerson et al (2002) Technique



Sequencing Analysis (Khoo et al, 2003)
          The entire coding region of the BHD gene (exons 4–14) was screened for mutations. Primer sequences and PCR conditi
          performed using a DNA Engine Tetrad (MJ Research, Waltham, MA). PCR products were analyzed on standard 1.5% aga
          purification with Multiscreen PCR cleanup plates (Millipore, Molsheim, France). Sequencing reactions were performed
          purified through Sephadex G-50 (Amersham Biosciences, Uppsala, Sweden), and run on an ABI 3700 genetic analyzer (A
          sequences by Blast 2 Sequences and manually verified them again. All of the sequence changes were verified by reamp
          sequencing of both DNA strands.
          Nickerson et al (2002) Technique


LOH Analysis (Khoo et al, 2003)
          LOH was performed on 28 matched normal/tumor tissue pairs. Allelic deletions of the chromosome 17p region flanking
          D17S740 and D17S2196. The region is 0.3 Mb. PCR was performed in a 7.5 µl reaction volume containing 0.17 µM each
          primer, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 4 mM MgCl2, 0.3 units AmpliTaq Gold polymerase (Applied Biosystems), 0
          (Invitrogen Life Technologies, Inc., Gaithersburg, MD), and 15 ng of genomic DNA. Amplification was done in a DNA Eng
          10 min; followed by 10 cycles of 94°C for 15 s, 55°C for 15 s, and 72°C for 30 s; and 20 cycles of 89°C for 15 s, 55°C for 1

            One µl of each PCR product was added to 5 µl of DNase-free, RNase-free distilled water, 10 µl of Hi-Di formamide, and
            95°C for 5 min before loading the samples into an ABI Prism 3700 Genetic Analyzer (Applied Biosystems). Analysis of ra
            Genescan v. 3.7 and Genotyper v. 3.7 software (Applied Biosystems). LOH was defined according to the following form
            tumor sample, N was the matched normal sample, and 1 and 2 were the intensities of smaller and larger alleles, respec
            determined to be LOH. Tumors with positive LOH around the BHD region will be analyzed with another marker, D17S16
            D17S1678 is 40-kb telomeric to p53. The PCR and genotyping conditions were similar to the previous markers.

            Canzian F., Salovaara R., Hemminki A., Kristo P., Chadwick R. B., Aaltonen L. A., de la Chapelle A. Semiautomated assess

Genomic Characterization of BHD Promoter Region (Khoo et al, 2003)
          The presence of CpG islands was analyzed using the CpG promoter program, which is an expansion of the CpG plot pro
          on the results of discriminant analysis between the promoter-associated and nonassociated CpG islands. This program
          if there is a CpG island in the interval (-500 to +1500) around a transcription start site. In this study, a CpG-rich region is
          content >50% and the average of CpG ratio (observed:expected) >0.6.

Methylation Analysis (Khoo et al, 2003)
          We examined the promoter methylation status of BHD in all 39 of the tumor samples. DNA methylation was determine
          treated with sodium bisulfite, which converted all of the unmethylated cytosines to uracils, whereas methylated cytosi
          denatured by incubation with 0.2 M NaOH at 37°C for 10 min. Cytosines were sulfonated in 3 M sodium bisulfite (adjus
          (Sigma) in a 50°C water bath for 16 h. The samples were then purified through columns (Microcon YM-100; Millipore, B
          with ethanol with glycogen as a carrier, and resuspended in 20 µl of sterile water before storing at -20°C. The specific p
          BHD-BISF-OF (5'-ATGTGGATAGGAAGTTTTAGGTTGGTTATATTT-3') as the forward primer and BHD-BISF-OR (5'-ACAAAAT
          Two µl of the bisulfite-treated product was added to 25 µl of total reaction volume containing 2 mM MgCl2, 0.24 mM o
          0.02 units of TaqDNA polymerase (Invitrogen), and 0.1 µM of each primer. PCR conditions were 95°C for 5 min followed

            A nested PCR was then performed using 1 of 25 of the initially amplified products. The primers used were BHD-BISF-IF
            and BHD-BISF-IR (5'-CCCAAAACCCCCAAACCCA-3') with conditions similar to those described for the preceding PCR amp
            Microcon YM-100 (Millipore). Twenty µl of the 414-bp PCR product were incubated with 0.3 U of RsaI (New England Bi
            DNA (0.3 µg) and distilled water were used, respectively, as positive and negative controls. The sizes of the RsaI digesti
            The restriction enzyme digestion products were then visualized in 2% agarose gels containing ethidium bromide, and th
BHD mutation analysis (da silva et al, 2003)
          BHD mutation analysis was performed as described in Nickerson et al . In brief, 14 exons were amplified by polymerase
          from a PCR reaction of 50–100 ng of genomic DNA, 20 pmol/l of each primer, 0.25 mmol/l dNTPs, 1.5 mmol/l MgCl2 an
          (Sigma Chemical Co., Poole, Dorset, UK).
          Nickerson et al (2002) Technique




Sequencing of PCR products (da silva et al, 2003)
          PCR products were cleaned up by an enzymatic treatment using exonuclease I to digest excess PCR primers, and shrimp
          to degrade excess nucleotides carried over from the PCR. The treatment was carried out for 15 minutes at 37°C and de
          by direct sequencing from the forward and reverse PCR primers using the ABI Prism® BigDyeTM Terminator cycle sequ
          and analysed on an ABI 377 DNA Analyzer (Perkin Elmer, Beckinsfield, Bucks, UK).


BHD promoter methylation analysis (da Silva et al, 2003)
Cell lines and patients’ samples:
             A total of 10 colorectal (SW48, LS 174T, LoVo, LS411, HCT 116, DLD-1, HAC7, SW480, SW620, HT-29) and nine kidney (S
             tumour cell lines were analysed. Twenty primary kidney tumours and 10 corresponding normal kidney DNA samples we


5-aza-2'-deoxycytidine treatment of cell lines:
           5-aza-2'-deoxycytidine (5-aza-dC; Sigma) was freshly prepared in double distilled H2O (at 2mg/ml) and filter sterilised. I
           with 10% fetal calf serum and left to settle for 24 h (day 0). Colorectal and kidney cell lines were treated with 2 µmol/l
           5-aza-dC on days 1, 3, and 5 and harvested on day 6, with a change of medium on days 2 and 4.


Mutation detection (Lingaas et al, 2003)
          The sequence of exon 7 was identified by sequencing of a PCR-product from cDNA using primers from exon 6 to exon 9
          an affected dog, new primers were designed from the start of exon 7 (Ex7F) to intron 7 (In7R) for the purpose of genom
          reaction was performed with a nested primer (Ex7FS) 18 bp downstream of the forward primer. A PCR product of 1500
          and In7R (5'-TGTTGGATGATTTTGTGTTTGA-3') and standard protocols for PCR under the following cycling conditions: 95
          72°C for 90 s. The sequencing reaction was performed with the ET-terminator kit for MegaBACE (Amersham) in accorda
          primer Ex7FS 5'-GAGAATGAACACGGCCTTC-3' in a 20 µl reaction mixture containing 8 µl ‘ET-mix’, 2.5 µl PCR product, 1.
          The sequencing reaction was performed by cycle sequencing with the following protocol: initially 95°C for 1 min then 2
          Sequencing was done using an automated sequencer (Molecular Dynamics MegaBACE 1000).



Mutation Analysis (Sundaram et al, 2009)
          Direct sequencing of the coding exons of the FLCN gene from genomic DNA of the index case (I2) found her to be heter
FLCN mutation analysis Woodward et al 2008)
          DNA was extracted from peripheral leukocytes using the Nucleon BACC2 kit (Amersham Biosciences). The FLCN gene (N
          PCR amplification of all the coding exons and exon-intron boundaries followed by direct sequencing of PCR products. P
          PCR was done in 30-µL volumes using 2 mmol/L magnesium chloride, 2.5 mmol/L deoxynucleotide triphosphates, and 1
          A 10-µL aliquot of each reaction was cleaned by addition of 10 units of Exonuclease I and 5 units of Antarctic phosphata
          done in 10-µL volumes using 4 µL of cleaned PCR product, 1x ABI sequencing buffer, and 1 µL Big Dye terminator cycle
          were run on an ABI 3730 automated sequencer (ABI Applied Biosystems). Novel missense substitutions were verified in




BHD mutation analysis (Toro et al, 2008)
          DNA was extracted from peripheral blood leucocytes according to standard procedures. Methods for identification of e
          previously described (Nickerson et al, 2002). At least 160 unrelated control individuals were examined for each disease
          confirmed by subcloning using Topo Cloning Kit (Invitrogen) and sequencing.
          Nickerson et al (2002) Technique



Mutation analysis (Kawasaki et al, 2005)
          Total genomic DNA was extracted from peripheral blood lymphocytes, and then subjected to mutation screening. The s
          exon–intron borders were amplified by polymerase chain reaction (PCR) using pairs of oligonucleotide primers synthes
          For PCR amplification, approximately 200 ng of genomic DNA, 40 pmol of each primer, 0·5 mmol L-1 MgCl2, 20 µmol of
          The amplification conditions were 94 °C for 5 min, followed by 40 cycles of 94 °C for 45 s, 64 °C for 45 s and 72 °C for 45
          The PCR products were subjected to automated nucleotide sequencing in an ABI 310 genetic analyser (Perkin Elmer Ap
          Nickerson et al (2002) Technique

           To determine presence of loss of heterozygosity (LOH), we also excised (but did not microdissect) several large tumour
           prepared a DNA sample from each tumour. We examined whether the tumour showed a homozygous pattern of germ


Mutation analysis (Painter et al, 2005)
          Nickerson et al (2002) Technique




Mutation analysis of the BHD gene (Gunji et al, 2007)
          Genomic DNA was isolated from peripheral blood leukocytes. Exons with flanking intronic sequences of the BHD gene w
          in a 25 µl reaction mixture containing 100 ng of genomic DNA, 1 µmol/l of each primer, PCR buffer II (Applied Biosystem
          and 0.625 U of AmpliTaq Gold (Applied Biosystems). PCR primers were prepared according to the method of Nickerson
          55°C for 30 sec, 72°C for 1 min; and 72°C for 5 min. Each PCR product was first screened for mutations by denaturing h
          Omaha, Nebraska, USA) and followed by sequence analysis if heteroduplex formation was detected. Although genomic
          because it is sufficiently sensitive to screen for genetic alterations and commonly used for mutation analysis of heredit

           Sequencing was performed using commercial reagents and an automated sequencer (ABI Prism BigDye Terminator v1.
           Both strands were sequenced to confirm nucleotide alterations. If direct sequencing revealed a superimposed nucleoti
           the PCR products were cloned (TA Cloning Kit; Invitrogen, Carlsbad, California, USA) and then sequenced.
PCR and mutation detection (van Steensel et al. 2007)
          DNA was isolated from peripheral blood samples using a salt precipitation technique described elsewhere. All coding re
          PCR reactions (25 l) contained 1 buffer (Qiagen Benelux BV, Venlo, The Netherlands), 0.2 mm dNTPs, 100 ng of each pr
          72°C for 35 cycles, initiated by 90 seconds at 94°C, and terminated by 7 minutes at 72°C. PCR products were purified w
          sequencing kit, Applied Biosystems, Foster City, CA) with the aforementioned PCR primers, according to the specificatio


               Name                   Sequence (5'–3')                       PCR product size (bp)
           BHD4F            AGGTGCTCCCTGTGCTCCAG                                     440
           BHD4R            CCGTCCACTGCTCTCAGGTC                                      —
           BHD5F            CCGAGCTCAGATTTGCATAAACC                                  326
           BHD5R            CCTGCCTCCCTGTGCAATG                                       —
           BHD6F            TGATTTGTGCCAGCTGACTCTG                                   400
           BHD6R            CCAGGCCTCAACCTCAGCAC                                      —
           BHD7F            CCTGGAGTTGGCTGTGAACG                                     327
           BHD7R            TCCCAAATCCATGGACAAGC                                      —
           BHD8F            GTTGTGCCCTGCTGGTGTTC                                     315
           BHD8R            TTCCCTCCCTCAGCGATTCC                                      —
           BHD9F            GGCCGCAGCCAGGAATCTAC                                     394
           BHD9R            GTGGAGGGTCCAGAGGCAAG                                      —
           BHD10F           CACCCGCCTCCCTGAGAAG                                      391
           BHD10R           CCAGTGGAGACCGTGTGGTG                                      —
           BHD11F           GGTTCCACTTTGGGCCTGAG                                     289
           BHD11R           AGGAGGCGTGTGGGGTTTG                                       —
           BHD12F           CTAGCGCAGGGGAGGTGAGG                                     478
           BHD13R           ACGGCCCAGCTCCTCTTTTG                                      —
           BHD14F           CCGTGTCACCCCTGGTTGG                                      400
           BHD14R           TGCTGGGACACAGCTCCTTC                                      —
           BHD10cF          TCTGGAAAAGCAGAGACGTGGAC                              355 (cDNA)
           BHD13cR          TGGTTGGTCAGAGCCGCTTC                                      —
           BHD9cF           CCCCGGAAGCTGCCAGTC                                   500 (cDNA)
           BHD13cR2         CAGACGAGGCACTGGTCCAC                                      —



Molecular analysis (Bessis et al , 2006)
           The BHD gene was performed after informed consent from the patient. DNA was extracted from peripheral blood leuco
           primer sequences and polymerase chain reaction conditions according to Nickerson et al.
           Nickerson et al (2002) Technique




Mutation screening of BHD, BAX and TGFßRII genes (Jiang et al 2006)
          From the initial screening of MSI, 30 MSI cases, including 19 MSI-high cases and 11 MSI-low cases, were screened for m
          These cases were further subjected to mutational screening of other coding exons (exon 4–10, exon 12–14). Fifty cases
          All primers were custom made, (and the sequences are listed under MSI analysis section). PCR was performed as descr
          electrophoresed on MDE™ gels (BioWhittaker Molecular Applications, Inc., Rockland, ME) for SSCP analysis according t
          mutational detection of the poly(C)8 tract in BHD exon 11 and other MSI target genes, denaturing gel electrophoresis w
           bands were subjected to direct sequencing using an ABI PRISM Big Dye terminator Cycle Sequencing Ready Reaction Ki
           an ABI 373A sequencer to confirm the identity of the mutations or polymorphisms. Both sense and anti-sense strands w




Molecular Genetic Analyses (Sweet et al. 2005)
          Mutation analysis was carried out on coded samples in a blinded fashion. Genomic DNA was extracted from peripheral
          PTEN, BMPR1A, SMAD4, STK11, and ENG were analyzed for mutations using polymerase chain reaction–based denatur
          were carried out.34 Genomic rearrangements of STK11 were investigated using quantitative multiplex polymerase cha
          and BHD (exons 7, 9, 11, 12, and 13), including intron-exon boundaries, was performed using direct sequencing or dena


Mutation analysis (Vocke et al, 2005)
          The entire coding region of BHD (exons 4–14) was sequenced in each tumor sample, following polymerase chain reacti
          A modified primer, SKA3–1, with the sequence TTCCTGCCGGTTTTGAAGGTG, was substituted for primer SKA3 because
          0.4 µM concentrations of each primer, and a volume of input tumor DNA that was empirically determined to result in s
          Genetic Analyzer (PE/Applied Biosystems, Foster City, CA). Each mutation was verified by repeat PCR and sequencing. T
          somatic BHD mutation were cloned into the TOPO TA cloning vector or the TOPO XL cloning vector (Invitrogen, Carlsba


Mutation Analysis of the BHD Gene (Schmidt et al, 2005)
          DNA was extracted from peripheral-blood leukocytes, in accordance with standard procedures. Exon/intron structure o
          (GenBank accession numbers BC015725 and BC015687), against the BAC clone RP11-45M22 (GenBank accession numb
          Subsequent analyses showed that this exon/intron structure matched the cloned full-length BHD transcript. PCR produ
          as described elsewhere (Nickerson et al. 2002). Sequence variants were examined for cosegregation with disease in the
          and were sequenced. At least 160 unaffected individuals were examined for each disease-associated sequence variant.

BHD Haplotype Carrier Analysis (Schmidt et al 2005)
          Family members were evaluated for inheritance of the BHD-affected haplotype in cases in which a BHD germline muta
          markers (D17S953, D17S740, [location of BHD] D17S2196, D17S620, AGAT100, D17S805, and D17S1824) that spanned
          All members of BHD-affected families who presented with FFs inherited the family’s BHD-affected haplotype.




Analysis on the BHD gene on genomic DNA (Nagashima et al, 2005)
           To examine the abnormality of the BHD gene, peripheral lymphocytes were collected from the patient with informed c
           SSCP/heteroduplex analysis and direct sequencing for detecting mutation of the entire coding region (exons 4–14) of th
olymerase chain reaction (PCR) with oligonucleotide primers.



CAATAGGCATTGGCA
CCATGATCACACCAT
 TCGTAAGTGCTCAGC

TCTTCGGCTCTCATGG
 CAGTGCACTGGCTG

GCTCACTGACAAGTG
 GGAACTGCCTGCAT




 GAAGATAAGTGTCTT


 CCATGACAGAGATCT




  procedures. Methods for identification of exon/intron boundaries and high throughput DNA
 60 unrelated control individuals were examined for each disease associated sequence variant.
 Cloning Kit (Invitrogen) and sequencing.




 tained from normal adult kidney, and adult and fetal lung (Clontech).
      '
nd 3•ends of BC015687 and BC015725, respectively, and were used to
  Takara long and accurate (LA) reagents were used to amplify the transcript
mers were spaced approximately 500 bp apart on both strands for overlapping,
for each transcript. PCR from these cDNA pools was repeated with
pt was assembled from the consensus sequence of these extension reactions.
and isolated a longest clone from lung. The clone was also shotgun
  identified from the UCSC Genome Browser were purchased and examined
                           '     '
 ipt sequence 106 bases. 5•and 3•RACE studies of Clontech cDNA from




ma (MGC project; BC015725 and BC015687), appeared in the December,
on BAC clone RP11-45M22 (AC055811) which was analyzed for mutations.
mers were designed to amplify 14 coding exons and splice junctions for sequencing.
 by sequencing subcloned amplicons. A 28 bp duplication allele was separated from
                                       fs
e gel (Novex) according to manufacturer• protocols.


                    Reverse primer                                            size (bp)        temperature (°C)
                    SKB2: 5′ GTA CGG CTC AGG GAG TCA C                               385              64
                    SKB4: 5′ CAT GCT ACG AAG GCC TCT AAT C 2                         225              64
                    SKB6: 5′ CAC TGC CAG CCC AGC TAA G                               256              64
                    SKB8: 5′ GGA GGT TTC ATG GAG TCA ATA GG                          406              64
                    SKB10: 5′ ACC TAA GAG AGT TTG TCG CCC TG                         310              64
                    SKB12: 5′ GAA GAG GCT TTG ATT TGG TGT CAC                        354              64
                    SKB14: 5′ GGT CCG AGC TGC TGG CAG                                278              64
                    SKA2: 5′ CTG GGT GAG CGT CAG GTT TGC                             607              64
                    SKA4: 5′ GTA TCT TGG GCT GAA GTC ACA GG                          313              64
                    SKA6: 5′ GTC TTT CTC CTG AGC CCT GTC                             290              64
                    SKA8: 5′ GGT AGT AGA GCA TGG ATG GCC                             270              64
                    SKA10: 5′ CAC GGT GGG CTA GCG CAG                                463              64
                    SKA12: 5′ ACC AGG GCT CGA GGG ATT G                              639              64

s, anneal Tm for 1 min, 72°C for 1 min for 40 cycles; then 72°C for 7




ue from a renal carcinoma slide of a deceased member of family 6 was also included for DNA
ere as detailed by Nickerson et al. (2002). Amplification by PCR was performed using a PE 9700
were performed using Big Dye Terminator (Applied Biosystems) and run on an ABI 3100 genetic analyzer (Applied Biosystems).


actions were performed using Big Dye Terminator (Applied Biosystems) and run on an




 Nick-translation Kit (Abbott Molecular Inc./Vysis, IL) incorporated with Spectrum-Orange
ed in: http://www.riedlab.nci.nih.gov/protocols.asp. Germline mutation sequencing analysis for the cell




proteinase K/phenol chloroform extraction, using standard protocols.
nd direct sequencing for detecting intragenic mutation of the BHD coding region (exons 4-11)
. Sequencing was carried out using the Dual CyDye Terminator Sequencing Kit (GE Healthcare Biosciences, Little Chalfont, UK)


 os Z23 567 and G27265, res- pectively), both flanking the BHD gene, were used to determine allelic imbalance.
 oresed by a GenePhor DNA separation system with GeneGel HyRes Native gels and silver-stained
  intensity of each allele was measured using a digital scanner employing NIH image software (version 1.55) for determining allelic imbalance.




 resence of mutations in the VHL gene was tested using Southern blotting and sequencing,
he MET proto-oncogene, conformational, sensitive gel electrophoresis was performed,
nds, as described (Schimdt et al , 1997)

n the von Hippel-Lindau disease tumor suppressor gene: human mutation. Hum Mutat. 1998;12:417-423.
rosinase kinase domain of the MET proto-oncogene in papillary renal carcinomas. Nat Genet. 1997;16:68-73.




                                and PCR conditions reported by Nickerson et al15 to amplify all
n with Multiscreen PCR cleanup plates (Millipore).
 osystem), purified through Sephadex
d analysed all sequences by Blast 2 Sequences as well as manually




 ence analyses. Flash-frozen specimens were used when available (N = 22) and otherwise
= 10). Proteinase K digestions overnight at 50°C (Boerhinger Mannheim GmbH,
onditions (Puregene kit, Gentra Systems, Minneapolis, MN, USA).
 d normal DNA was used to perform fluorescence-based polymerase chain reaction (PCR)
quencing machine with POP4 matrix and Genescan and Genotyper software.
3s1038 and d3s1110) were used, and an allele was considered lost if allele amplitude ratios
 as performed in duplicate and repeated at least once. Sequencing of the three exons of the


tal tumors using microsatellites and fluorescent DNA technology. Br J Cancer 1993; 67:1262–7.
in the von Hippel-Lindau disease tumor suppressor gene. Hum Mutat 1998; 12:417–23.


e tumour and corresponding normal tissues were procured from formalin fixed and paraffin

y-two of 310 (10.3%) sporadic colorectal carcinomas were defined as MSI.


amined by DNA sequence analysis. The primer sequences and the detailed reaction conditions
 directional sequences of PCR products were analysed using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA).
utations. Primer sequences and PCR conditions were according to Nickerson et al. PCR was
 oducts were analyzed on standard 1.5% agarose gels stained with ethidium bromide (0.5 µg/ml) before
nce). Sequencing reactions were performed using Big Dye Terminator (Applied Biosystems, Foster City, CA),
 , and run on an ABI 3700 genetic analyzer (Applied Biosystems). We aligned and analyzed all of the
 e sequence changes were verified by reamplification of the corresponding BHD fragment and




ions of the chromosome 17p region flanking the BHD gene were assessed using the microsatellite markers
µl reaction volume containing 0.17 µM each of fluorescence-labeled forward and unlabeled reverse
 aq Gold polymerase (Applied Biosystems), 0.25 mM deoxynucleoside triphosphates
c DNA. Amplification was done in a DNA Engine Tetrad (MJ Research) with an initial cycle of 95°C for
0 s; and 20 cycles of 89°C for 15 s, 55°C for 15 s, 72°C for 30 s, with a final extension at 72°C for 10 min.

 stilled water, 10 µl of Hi-Di formamide, and 0.2 µl of ROX 400HD size standard, and denatured at
Analyzer (Applied Biosystems). Analysis of raw data and assessment of LOH were performed with
was defined according to the following formula: LOH index = (T2/T1)/(N2/N1), where T was the
tensities of smaller and larger alleles, respectively (Canzanian et al, 1996 ) . If the ratio was <0.67 or >1.3, the result was
 ill be analyzed with another marker, D17S1678, to evaluate the LOH near the p53 region as well.
ere similar to the previous markers.

 A., de la Chapelle A. Semiautomated assessment of loss of heterozygosity and replication error in tumors. Cancer Res., 56: 3331-3337, 1996.


m, which is an expansion of the CpG plot program from EMBOSS. The CpG promoter program is based
 d nonassociated CpG islands. This program enables an efficient mapping of human promoters with 2-kb resolution,
n start site. In this study, a CpG-rich region is defined as stretches of DNA with both the average of G+C




or samples. DNA methylation was determined by a methylation-specific PCR approach. DNA was
osines to uracils, whereas methylated cytosines remained unchanged. Briefly, 2 µg of DNA was
 re sulfonated in 3 M sodium bisulfite (adjusted to pH 5.0; Sigma Chemical Co., St. Louis, MO) and 10 mM hydroquinone
ugh columns (Microcon YM-100; Millipore, Bedford, MA), desulfonated in 0.3 M NaOH, precipitated
 water before storing at -20°C. The specific primers for methylated sequences were designed as follows:
 ward primer and BHD-BISF-OR (5'-ACAAAATCACAC CCAAAACCCCC-3') as the reverse primer.
 volume containing 2 mM MgCl2, 0.24 mM of each deoxynucleoside triphosphate (Invitrogen),
PCR conditions were 95°C for 5 min followed by 35 cycles of 94°C (30 s), 60°C (30 s), and 72°C (45 s), and then 72°C for 7 min.

oducts. The primers used were BHD-BISF-IF (5'-GAAATGGTTTTTTTTAGTATTTTTAGTTGGTG-3')
o those described for the preceding PCR amplification but for 40 cycles. The PCR products were purified using
 cubated with 0.3 U of RsaI (New England BioLabs, Inc., Beverly, MA) for 2 h at 37°C.
 gative controls. The sizes of the RsaI digestion products were 160 and 254 bp.
 se gels containing ethidium bromide, and the presence of methylation was verified by direct sequencing.
rief, 14 exons were amplified by polymerase chain reaction (PCR). Amplicons were obtained
er, 0.25 mmol/l dNTPs, 1.5 mmol/l MgCl2 and 0.8 U of Taq polymerase enzyme




se I to digest excess PCR primers, and shrimp alkaline phosphatase (both Amersham Biosciences, Amersham, Bucks, UK)
as carried out for 15 minutes at 37°C and denatured for further 15 minutes at 80°C. Products were confirmed
 BI Prism® BigDyeTM Terminator cycle sequencing kit according to the manufacturer’s instructions




7, SW480, SW620, HT-29) and nine kidney (SKRC18, SKRC39, SKRC45, SKRC47, SKRC54, KTLC26, 786-0, UMRC2, UMRC3)
 rresponding normal kidney DNA samples were also analysed.




 tilled H2O (at 2mg/ml) and filter sterilised. In a 75 cm2 flask, 1x106 cells were plated in RPMI 1640 media supplemented
kidney cell lines were treated with 2 µmol/l 5-aza-dC for 5 days. Both tumour cell lines were treated with
 um on days 2 and 4.




m cDNA using primers from exon 6 to exon 9. After initial identification of a mutation in the end of exon 7 in
) to intron 7 (In7R) for the purpose of genomic PCR and mutation detection. The sequencing
  the forward primer. A PCR product of 1500 bp was generated using primers Ex7F (5'-GAGGCAGAGCAATTTGGTT-3')
CR under the following cycling conditions: 95°C for 3 min, followed by 35 cycles each of 95°C for 30 s, 60°C for 45 s and
tor kit for MegaBACE (Amersham) in accordance with recommendations from the manufacturer using the sequencing
 ntaining 8 µl ‘ET-mix’, 2.5 µl PCR product, 1.5 µl sequencing primer (5 pmol/µl) and 8 µl H2O.
wing protocol: initially 95°C for 1 min then 29 cycles each of 95°C for 20 s, 59°C for 15 s and 60°C for 60 s.




 of the index case (I2) found her to be heterozygous for a novel exon 10 c.1537 del-C mutation. The same mutation was identified in her daughter, II4.
t (Amersham Biosciences). The FLCN gene (NM_144997.4) was screened for mutations by
wed by direct sequencing of PCR products. Primer sequences are available on request.
 mol/L deoxynucleotide triphosphates, and 1 unit of Taq polymerase (Invitrogen).
nuclease I and 5 units of Antarctic phosphatase (New England Biolabs). The sequencing reaction was
 g buffer, and 1 µL Big Dye terminator cycle sequencing mix (ABI Applied Biosystems). Products
Novel missense substitutions were verified in 280 normal control samples by restriction digestion or direct sequencing.




 procedures. Methods for identification of exon/intron boundaries and high throughput DNA sequencing were as
 individuals were examined for each disease associated sequence variant. Insertion and deletion mutations were




then subjected to mutation screening. The segments of the BHD gene including all 14 exons and all
ng pairs of oligonucleotide primers synthesized as described by Nickerson et al.
ach primer, 0·5 mmol L-1 MgCl2, 20 µmol of each deoxyribonucleoside triphosphate and 1·25 U of Taq polymerase were used in a total volume of 50 µ
94 °C for 45 s, 64 °C for 45 s and 72 °C for 45 s, and extension at 72 °C for 10 min in GeneAmp PCR System 9700 (Perkin Elmer Applied Biosystems, War
n ABI 310 genetic analyser (Perkin Elmer Applied Biosystems).


t did not microdissect) several large tumours from the proband, removed the normal tissue as much as possible and
our showed a homozygous pattern of germline mutation.




anking intronic sequences of the BHD gene were amplified by PCR using genomic DNA. Each PCR was performed
each primer, PCR buffer II (Applied Biosystems, Foster City, California, USA), 1.02.0 mmol/l MgCl2, 0.2 mmol/l dNTPs
pared according to the method of Nickerson et al.13 PCR conditions were 94°C for 4 min; 35 cycles of 94°C for 30 sec,
irst screened for mutations by denaturing high-performance liquid chromatography (DHPLC) (WAVE; Transgenomic,
 formation was detected. Although genomic sequencing may be more sensitive to detect mutations, we used DHPLC
monly used for mutation analysis of hereditary diseases.

 equencer (ABI Prism BigDye Terminator v1.1 Cycle Sequencing Kit and ABI 3130 Genetic Analyzer; both Applied Biosystems).
quencing revealed a superimposed nucleotide chromatogram suggesting nucleotide alteration of either insertion or deletion,
nia, USA) and then sequenced.
 echnique described elsewhere. All coding regions and the adjacent splice sites of the BHD gene were amplified by PCR.
 herlands), 0.2 mm dNTPs, 100 ng of each primer, 3% DMSO, and 0.75 U Taq DNA polymerase (Qiagen). PCR conditions were; 30 seconds 94°C, 30 seco
nutes at 72°C. PCR products were purified with a MultiScreen-PCR filter plate (Millipore, Billerica, MA) and subsequently directly sequenced (BigDye deo
ed PCR primers, according to the specifications of the manufacturer. Sequence analysis was performed with the software tools Phred, Phrap, and Cons




A was extracted from peripheral blood leucocytes, and subjected to mutation screening. All the exons of the BHD gene for the proband were amplified




 and 11 MSI-low cases, were screened for mutations in the poly(C)8 tract in BHD exon 11, the BAX poly(G)8 tract and the TGFßRII poly(A)10 tract.
g exons (exon 4–10, exon 12–14). Fifty cases of MSS gastric cancer were also subjected to BHD mutational screening of the all of the exons.
alysis section). PCR was performed as described for MSI analysis using 0.4 µM [?-32P]ATP-radiolabeled primers. The PCR products were then
 Rockland, ME) for SSCP analysis according to the manufacturer’s recommendations. For insertion/deletion
rget genes, denaturing gel electrophoresis was also performed as described for MSI analysis. Cases with aberrant
minator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA), and the products were analyzed using
phisms. Both sense and anti-sense strands were sequenced to confirm the somatic hemizygous mutations.




 enomic DNA was extracted from peripheral blood leukocytes, and the entire coding sequence, the exon-intron boundaries, and the flanking sequences
 g polymerase chain reaction–based denaturing gradient gel electrophoresis and direct sequencing.8- PTEN and BMPR1A deletion analyses
using quantitative multiplex polymerase chain reaction of short fluorescence. Targeted screening of BRAF (exons 11 and 15), MYH (exons 7 and 13),
s performed using direct sequencing or denaturing high-performance liquid chromatography.




 r sample, following polymerase chain reaction (PCR) amplification. PCR was carried out using genomic primers for the BHD gene as previously describe
G, was substituted for primer SKA3 because it produced more reliable amplification. Reactions were carried out in a 25 µL volume using Taq PCR Maste
hat was empirically determined to result in sufficient product under standard PCR conditions. Sequencing was carried out using Big Dye Terminator che
was verified by repeat PCR and sequencing. To confirm a somatic BHD mutation in a tumor sample independent of the second gene copy, PCR amplicon
 TOPO XL cloning vector (Invitrogen, Carlsbad, CA) and characterized by sequencing.




tandard procedures. Exon/intron structure of the BHD gene was determined by BLAST alignment of two overlapping, uncharacterized, full-length trans
 one RP11-45M22 (GenBank accession number AC055811); intronic primers were designed to amplify 14 coding exons and splice junctions for sequenc
 loned full-length BHD transcript. PCR products were generated using standard conditions and were purified; double-stranded sequencing was perform
amined for cosegregation with disease in their respective families by denaturing high-performance liquid chromatography or by single-stranded sequen
 r each disease-associated sequence variant.


type in cases in which a BHD germline mutation was not identified in the proband. To determine if a family member inherited the BHD-affected haploty
100, D17S805, and D17S1824) that spanned an 8-cM distance flanking the BHD locus on chromosome 17p. Haplotypes were determined from the geno
e family’s BHD-affected haplotype.




  collected from the patient with informed consent. High-molecular-weight DNA was isolated from the lymphocytes by protease K/phenol chloroform e
 f the entire coding region (exons 4–14) of the BHD gene were performed.
BACK
BACK




BACK
r determining allelic imbalance.




                                   BACK




ystems, Foster City, CA).
                                  BACK




ncer Res., 56: 3331-3337, 1996.
                                    BACK




                                    BACK



tation was identified in her daughter, II4.




                                    BACK
                                  BACK




erase were used in a total volume of 50 µL.
00 (Perkin Elmer Applied Biosystems, Warrington, U.K.).




                                  BACK
onditions were; 30 seconds 94°C, 30 seconds 62°C, 60 seconds
sequently directly sequenced (BigDye deoxy terminator V3.1 cycle
he software tools Phred, Phrap, and Consed.




                                  BACK


BHD gene for the proband were amplified using Eurobluetaq (Eurobio, les Ulis, France),




act and the TGFßRII poly(A)10 tract.
eening of the all of the exons.
rs. The PCR products were then
                                  BACK




n boundaries, and the flanking sequences of
d BMPR1A deletion analyses
ns 11 and 15), MYH (exons 7 and 13),




s for the BHD gene as previously described By Nickerson et al.
ut in a 25 µL volume using Taq PCR Master Mix (Qiagen, Valencia, CA),
 carried out using Big Dye Terminator chemistry and run on an ABI Prism 310
nt of the second gene copy, PCR amplicons that contained a




apping, uncharacterized, full-length transcripts from skin melanoma
ng exons and splice junctions for sequencing, as described elsewhere (Nickerson et al. 2002).
double-stranded sequencing was performed using BigDye Terminators (Applied Biosystems),
matography or by single-stranded sequencing. Insertions and deletions were subcloned with Topo Cloning Kit (Invitrogen)




ember inherited the BHD-affected haplotype, individuals were genotyped using seven microsatellite
 plotypes were determined from the genotype order in which the least number of recombinants occurred.

                                  BACK




ocytes by protease K/phenol chloroform extraction using a standard protocol.
Immunoprecipitation (Hasumi et al, 2008)
         Cells were lysed in lysis buffer *20 mM Tris–HCl, 150 mM NaCl, 5% glycerol, 0.1% TritonX-100, Complete Protease
         immunoprecipitated at 4 °C overnight with protein G-Sepharose (GE Healthcare Bioscience, Piscataway, NJ) bound
         anti-Flag M2-Agarose(Sigma Aldrich). For sequential immunoprecipitation, cell lysates were immunoprecipitated w
         five times followed by elution with HA-peptide (Roche Applied Science) competition as described previously (Baba
         immunoprecipitated with anti-Flag M2-Agarose overnight. The resin was washed five times with lysis buffer and p
         sample buffer followed by boiling and subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE).




X-Gal staining and Immunohistochemistry of adult mouse tissues (Hudon et al, 2009).
            For X-gal staining, tissues were fixed (0.2% glutaraldehyde) and embedded in optimal cutting temperature (OCT) f
            were prepared and β-galactosidase activity was detected using X-gal staining solution (1mg/ml of 5-bromo-4-chlo
            potassium ferricyanide and 5mM potassium ferrocyanide in PBS). Sections were counterstained with Nuclear Fast
            microscope imaging system or an Aperio XT Slide Scanner. For immunohistochemistry Tissues samples were fixed
            paraffin-embedded by standards methods. Sections (4 μm) were stained by standard immunohistochemistry tech
            against Caspase-3 (Biocare), Ki-67 (Ventana), FLCN (kindly provided by Dr Bin Tean Teh (Van Andel Research Instit
            Technology), p-S6 ribosomal protein (Ser235/236) (Cell Signaling Technology), as well as biotinylated Lotus Tetrag
            Secondary detection was done with biotinylated anti-mouse and anti-rabbit antibodies. Staining was visualized us
            diaminobenzidine (Sigma). For the p-Erk1/2 and p-S6 staining, antibodies were diluted in SignalStain® antibody dil
            using the EnVision+ detection kit (DAKO) and Nova Red as a substrate (Vector Laboratories). Hematoxylin or Nucle
            counterstain.
Review article




Human in vitro
          Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI
            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
% TritonX-100, Complete Protease Inhibitor Cocktail, Phostop Phosphatase Inhibitor Cocktail (Roche Applied Science)+ and
 Bioscience, Piscataway, NJ) bound antibodies, anti-HA affinity matrix (Roche Applied Science), anti-V5-Agarose or
ysates were immunoprecipitated with anti-HA affinity matrix overnight. Immunoprecipitates were washed
 tion as described previously (Baba et al., 2006). Eluted protein was diluted with lysis buffer and
d five times with lysis buffer and proteins were eluted with sodium dodecyl sulfate (SDS)-containing
 rophoresis (SDS-PAGE).




 timal cutting temperature (OCT) freezing medium (Tissue-Tek). Cryostat sections (15 μm)
 ution (1mg/ml of 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, 2mM MgCl2, 5mM
  counterstained with Nuclear Fast Red (Sigma) and analyzed with a Carl Zeiss AxioSkop
mistry Tissues samples were fixed in 10% formalin and
 dard immunohistochemistry techniques with hematoxylin and eosin (H&E) or using antibodies
 an Teh (Van Andel Research Institute, MI, USA), p-Erk1/2 (Thr202/Tyr204) (Cell Signaling
s well as biotinylated Lotus Tetragonolobus Agglutinin (LTA) (Vector Laboratories).
 bodies. Staining was visualized using the avidin-biotin complex technique and 3,3’-
diluted in SignalStain® antibody diluent (Cell Signaling) and detection of the staining was obtained
 boratories). Hematoxylin or Nuclear Fast Red nuclear (Sigma) was used for
lied Science)+ and




                     BACK




                     BACK
Antibodies (Hasumi et al, 2008)
           Normal rabbit immunoglobulin (IgG; Santa Cruz Biotechnology, Santa Cruz, CA), HRP-labeled anti-mouse and anti-rabbit secon
           AMPKα mouse monoclonal(F6), AMPKα, and AMPKβ1 rabbit polyclonal antibodies (Cell Signaling, Beverly, MA), A
           HA and Flag rabbit polyclonal antibodies (Santa Cruz Biotechnology), V5 rabbit polyclonal antibody (Sigma Aldrich
           were used according to manufacturer's protocol. FNIP1-189 rabbit polyclonal antibody was generated against a H
           FNIP2-3G and FNIP2-4G rabbit polyclonal antibodies were raised against FNIP2 peptide CSRDLGLKPDKEANR and FN
           We chose non-homologous regions to use as antigens to generate FNIP1 and FNIP2 antibodies, and these antibod
           105 rabbit polyclonal antibody was raised against GST-FLCN and FLCN monoclonal antibody (FLCN-mAb) was raise
           Culture medium from a single clone hybridoma cell line was used as the antibody source.


Antibodies (Baba et al 2007).
           Normal rabbit IgG, HRP-labeled anti-mouse and anti-rabbit secondary antibodies (Santa Cruz Biotechnology, Santa
           phospho-AKT(S473), phospho-p70 S6 kinase(T389), p70 S6 kinase, phospho-AMPKa(T172), AMPKa, and AMPKß1 a
           AMPK?1 antibody (Zymed, San Francisco, CA); AMPKß mouse monoclonal antibody (BD Biosciences, Franklin Lake
           synthetic peptide (MAPTLFQKLFSKRTGLGAC); FLCN-102, rabbit polyclonal antibody against a FLCN peptide (QGDG
           FLCN-mAb from single-clone hybridoma cell line raised against full length GST-FLCN in the mouse.



Antibodies (Wang et al, 2009)
           Anti-FLCN C1 antibody has been reported previously. Anti-phospho-S6K (Thr 389), anti-phospho-ACC (Ser 79), ant
           Anti-S6K (C18) was supplied by Santa Cruz Biotechnology. Anti-GST, rabbit polyclonal and mouse monoclonal (M2
Review article




Human in vitro
          Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI
            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
 eled anti-mouse and anti-rabbit secondary antibodies (Vector Laboratories, Burlingame, CA),
 es (Cell Signaling, Beverly, MA), AMPKγ1 rabbit polyclonal antibody (Zymed, San Francisco, CA),
 olyclonal antibody (Sigma Aldrich, St. Louis, MO), and HA rat monoclonal(3F10) antibody (Roche Applied Science, Indianapolis, IN)
 tibody was generated against a His6X-tagged recombinant protein corresponding to codons 765–929 of FNIP1.
peptide CSRDLGLKPDKEANR and FNIP2 peptide CDKGFAEDRGSRND, respectively.
 IP2 antibodies, and these antibodies were confirmed not to cross react with each other.
 al antibody (FLCN-mAb) was raised against full length GST-FLCN in the mouse.                             BACK




s (Santa Cruz Biotechnology, Santa Cruz, CA); phospho-S6R, phospho-4EBP1(T37/46), phospho-ACC,
PKa(T172), AMPKa, and AMPKß1 antibodies (Cell Signaling Technology, Beverly, MA); actin antibody (Biomedical Technologies, Stoughton
ody (BD Biosciences, Franklin Lakes, NJ); FNIP-181, rabbit polyclonal antibody against a FNIP1
ody against a FLCN peptide (QGDGNEDSPGQGEQAEE): FLCN-104, rabbit polyclonal antibody against GST-FLCN;
LCN in the mouse.

                                                                                                           BACK

9), anti-phospho-ACC (Ser 79), anti-ACC, anti-phospho-AMPK (Thr 172), and anti-AMPK were purchased from Cell Signaling Technology.
lonal and mouse monoclonal (M2) anti-Flag, mouse monoclonal and rabbit polyclonal anti-Myc antibodies were obtained from Sigma.

                                                                                                           BACK
d Science, Indianapolis, IN)




omedical Technologies, Stoughton, MA);




from Cell Signaling Technology.
es were obtained from Sigma.
Immunofluoresence microcopy(Hasumi et al, 2008)
         Immunofluorescence microscopy of MCF7 cells transfected with FNIP2-Flag and HA-FLCN was performed as previo
         Alexa488 conjugated goat anti-rabbit antibody and Alexa594 conjugated goat anti-rat antibody (Invitrogen) were
          Images were obtained by confocal microscopy.




Immunofluorescence Microscopy (Baba et al 2006) .
         HeLa cells transfected with FNIP1-HA and FLAG-folliculin expression plasmids were cultured on Chamber Slides (N
         for 12 h. Cells were washed with ice-cold PBS and fixed with 2% paraformaldehyde for 15 min at room temperatu
         Triton X-100 for 10 min and blocked with 3% goat serum and 10% calf serum in PBS for 1 h at room temperature.
         anti-FLAG antibody (Sigma) incubations were performed at room temperature for 1 h in buffer containing 10 mM
         Tween 20, 1.5% goat serum, and 0.1% (wt/vol) BSA. The secondary antibodies used were Alexa Fluor 488-conjuga
         Cy3-conjugated goat anti-mouse antibody (Amersham Pharmacia Biosciences). TO-PRO-3 iodide (Molecular Probe
         mounted with a Slow Fade Antifade kit (Molecular Probes) and were viewed with a confocal microscope system (L




Immunofluorescence staining and microscopy (Singh et al, 2006)
         Transfection and staining of S2 cells were performed as described previously (Chen et al., 2002). Fixing and stainin
         The following antisera were used: rabbit polyclonal anti-Vasa antibody (1:5000; gift from R Lehmann); rabbit poly
         mouse monoclonal anti-Hts antibody 1B1 (1:4; Developmental Studies Hybridoma Bank (DSHB)); mouse monoclon
         mouse monoclonal anti-Armadillo N7A1 (1:4; DSHB); rabbit polyclonal anti-GFP antibody (1:200; Molecular Probe
         Secondary antibodies were goat anti-mouse, goat anti-rat and goat anti-rabbit immunoglobulin G conjugated to A
         was used to stain DNA. Confocal images were obtained by using a Zeiss LSM510 system, and processed using Ado
Review article




Human in vitro
          Expression of Birt-Hogg-Dubé gene mRNA in normal and neoplastic human tissues.
Gene expression study

Nihon rat model
Mutation analysis

Canine in vivo modle
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis




Human in vitro
Mutation analysis
MSI
            Renal tumors in the Birt-Hogg-Dubé syndrome.
Patient study
Clinical
Mutation analysis
 HA-FLCN was performed as previously described (Baba et al., 2006).
nti-rat antibody (Invitrogen) were used as secondary antibodies.

                                                                                 BACK




ere cultured on Chamber Slides (Nalgene Nunc International, Roskilde, Denmark)
 de for 15 min at room temperature. Cells were then permeabilized with 0.1% (vol/vol)
PBS for 1 h at room temperature. Anti-HA antibody (3F10; Roche Applied Science) and
or 1 h in buffer containing 10 mM Tris·HCl, p H7.5, 150 mM NaCl, 0.01% (vol/vol)
sed were Alexa Fluor 488-conjugated goat anti-rabbit (Molecular Probes, Eugene, OR) and
TO-PRO-3 iodide (Molecular Probes) was used to stain nuclei. The samples were
 h a confocal microscope system (LSM 510; Zeiss, Thornwood, NY).
                                                                                  BACK




hen et al., 2002). Fixing and staining of the testes were performed as described (Tulina and Matunis, 2001).
 gift from R Lehmann); rabbit polyclonal anti--Galactosidase antibody (1:1000; Cappel, ICN Pharmaceuticals, Inc., Aurora, OH, USA);
ma Bank (DSHB)); mouse monoclonal anti-Fas III antibody (1:10; DSHB);
antibody (1:200; Molecular Probes, Eugene, OR, USA); rat anti-BamC antibody (1:500; gift from D. McKearin).
mmunoglobulin G conjugated to Alexa 488 or Alexa 568 (1:400; Molecular Probes). 4',6-diamidine-2'-phenylindole dihydrochloride (DAPI)
 system, and processed using Adobe Photoshop 7.0.
als, Inc., Aurora, OH, USA);


enylindole dihydrochloride (DAPI)
Cloning and sequencing of the canine BHD gene (Lingaas et al, 2003)
           To obtain the partial canine sequence corresponding to the human BHD gene, the associated human gene sequence w
           Canine sequence was found within 1 kb of all the corresponding human exons. BLAST (www.ncbi.nlm.nih.gov:80/BLAST
           were used to identify any repeated elements in the sequence. Primers were designed using Primer3 (www-genome.wi
           exons except exon 1 by at least 40 bp. PCR product sizes ranged from 304 to 1755 bp. Treatment of the PCR products w
           done prior to sequencing. Sequencing was done using the BigDye kit (Applied Biosystems Inc., Foster City, CA, USA) and
           The sequence of canine BHD exon 7 has been submitted to Genbank (Accession no. AY326427). Alignment and compar
           was done using the Phred/Phap/Consed software packages

Genomic DNA isolation (Lingaas et al, 2003)
           Genomic DNA was isolated from EDTA-anticoagulated whole blood using standard procedures (39). All DNA samples w
           then quantitated by spectrophotometry.

In Situ Hybridization Probes (Warren et al, 2004)
            In situ hybridization was performed using a riboprobe designed from the cDNA sequence of the BHD gene. The primers
            exons 11, 12 and 13 of the BHD mRNA sequence (F 5'-CTG TGT TGC CAG AGA GTA CAG AAG G-3' and R 5'-CCA CAG ACA
            a 561 bp product from BHD cDNA isolated from fetal heart (Clonetech) using standard conditions with a 64°C annealing
            sequence were ligated directly to the PCR product using the Lig-n-Scribe kit (Ambion) following the manufacturer's pro
            The templates were in vitro transcribed with fluorescein-labeled dUTP (Roche) using the MAXIscript in vitro transcriptio
            A riboprobe to a keratin known to be expressed in the inner root sheath of the hair follicle, Ker6IRS1,16 was used as a p
            for Ker6IRS1 were designed (F 5'-CAT CAG CAG CAC CAG TGG CGG-3' and R 5'-CAG GAA CTA TGC TAG GTC CCA G-3') an
            annealing temperature using standard conditions. Ker6IRS1 was designed as a 589 bp PCR probe amplified from the 3'U

Tissue Preparation, Pretreatment, Hybridization and Signal Detection (Warren et al, 2004)

           xylene and rehydrated in gradient alcohol washes. Frozen sections and dewaxed paraffin sections on slides were fixed a
           in phosphate-buffered saline. Pretreatment of slides included quenching endogenous peroxidase with 1–3% hydrogen
           acetic anhydride treatment in 0.1 M triethanolamine with 25 mM acetic anhydride (added right before slide addition) f
           solution containing 0.3 M NaCl, 20 mM Tris pH 7.5, 5 mM EDTA, 1 Denhardt's solution, 0.5 mg/ml yeast tRNA, and 60%
           same as the prehybridization solution with the addition of 10% dextran sulfate. The hybridization solution was heated t
           heated for an additional 5 min. The probe and hybridization solution were cooled on ice, applied to the slides, and incu
           antisense and sense probes separately, and a third section was stained with hematoxylin and eosin to visualize tissue m

           Following hybridization, the slides were washed in 1 SSC and subjected to RNase A treatment (0.131–1.0 g/ml in PBS, A
           50% formamide in 2 SSC. Next, slides were run through a series of SSC-containing washes (1 , 0.1 , 4 /0.1% Tween20) a
           Tyramide System Amplification (TSA) Plus kit for fluorescein from Ambion using the manufacturer's suggested protocol
           was added to the slides and slides were examined using a Zeis Axioplan epifluorescence microscope with DAPI and FITC
           black and white Photometrics Cool Snap camera and IP-Lab 3.6.3-imaging software was used to layer and pseudocolor




Segreagation analysis (Woogward et al, 2008)
           Segregation Analysis was done using the jPAP program. UK population incidences for RCC were obtained from the canc

           Statistical Analysis was done using Student's independent t test. Statistical significance was taken at 5%.


           jPAP program
           Registrations of cancer diagnosed in 2004, England. London: Office for National Statistics
Multiple sequence alignment of the folliculin protein (Toro et al, 2008)
           We analysed evolutionary conservation by comparing human folliculin against the orthologous folliculin sequences of c
           chicken, frog, zebrafish and sea urchin from the National Center for Biotechnology information (NCBI) protein database
           algorithm (European Bioinformatics Institute) was used to evaluate sequence conservation

Genomewide scan (Painter et al, 2005)
        Genomic DNA was extracted from blood samples of 25 family members, 13 affected and 12 unaffected. The genome-sc
        Finnish Genome Center, University of Helsinki, by use of the Linkage Mapping Set MD10 (Applied Biosystems), with an
        were obtained for 371 markers. Two-point LOD scores were calculated with the MLINK program of the FASTLINK packa
        nonparametric linkage (NPL) scores were calculated with GENEHUNTER 2.0 (Kruglyak et al. 1996). For all analyses, inhe
        penetrance (85%), with a disease allele frequency of 0.001. Allele frequencies for each marker were the same as for th


Molecular Cloning of Human FNIP1 cDNA (Baba et al, 2006).
           The 130-kDa protein that coimmunoprecipitated with folliculin, designated FNIP1, was identified by mass spectrometri
           The KIAA1961 mRNA encodes an ORF of 943 aa, followed by a poly (A) tail, but lacks an ATG start codon (BAB85547). B
           Genome Browser, human EST track; NCBI, human EST) identified several overlapping human ESTs corresponding to KIA
           start codon (AAH01956) that shares 284 aa from its C terminus with the N terminus of BAB85547. We performed a gen
           were located at the same genomic locus, 5q23.3, and shared coding sequences. Further evaluation of the mass spectro
           the AAH01956 protein. The full-length FNIP1 transcript was amplified from a pooled tissue cDNA library (Clontech, Mou
           sequences of BC001956 cDNA (5' UTR of FNIP1) and 3'-end sequences of AB075841 cDNA (3' UTR of FNIP1): 5'-GCCTAG
           5'-CTCCATAAATGCATGTTGTGTCTGC-3' (reverse primer). Amplified cDNAs were TOPO-cloned into pCR II cloning vector
           sequencing reactions using Big Dye Terminators (Applied Biosystems) were purified by using Performa plates (Edge Bio
           on an ABI 3700 genetic analyzer. Sequencing reactions provided >6-fold coverage of all clones. Sequence alignment wa
           was determined from the majority of clones and was identical to the assembled overlapping sequences of BC001956 a
           majority of cDNA clones contained the full-length 3,626-nt FNIP1 sequence. Several alternative transcripts lacking 1 or



MSI analysis (Jiang et al 2006)
           The following microsatellite markers were used for the detection of MSI: BAT25, BT26, D2S123, D5S346, and D17S250.
           The PCRs consisted of 1 µl of DNA lysate, 0.4 µM *?-32P+ATP-radiolabeled microsatellite primers, 0.2 mM dNTP, 10 mM
           reaction volume of 10 µl. The reaction was carried out over 35 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s
           polyacrylamide–urea–formamide gel, after which the gel was dried and the signals were visualized using an image anal
           was judged to be present when at least two of the five markers showed new alleles of altered sizes as compared to the
           altered allele, the case was scored as MSI-low. The results were confirmed by replicating the reactions in more than thr

           Primer Sequence (5'–3')                                                              Primer
           BAT25                                                                                BHD exon 4 (1)
           Sense cctcgcctccaagaatgtaa                                                           Sense
                   c
           Antisenseattctgcattttaactatggctct                                                    Antisense
           BAT26                                                                                BHD exon 4 (2)
           Sense ggatattgcagcagtcagagc                                                          Sense
                   ttcttcagtatatgtcaatgaaaacat
           Antisense                                                                            Antisense
           D2S123                                                                               BHD exon 5 (1)
           Sense caacattgctggaagttctgg                                                          Sense
                   c
           Antisensecctttctgacttggataccat                                                       Antisense
           D5S346                                                                               BHD exon 5 (2)
          Sense tggcatatgaataccaggatagc                                                  Sense
                  ttcagggaattgagagttacagg
          Antisense                                                                      Antisense
          D17S250                                                                        BHD exon 6
          Sense ggaagaatcaaatagacaataaaaa                                                Sense
                  g
          Antisenseccactcagctggccata                                                     Antisense
          BAX poly(G)8                                                                   BHD exon 7
          Sense tgtggcacagatttgaggag                                                     Sense
                  c
          Antisenseactcgctcagcttcttggt                                                   Antisense
          TGFßRII                                                                        BHD exon 8
          Sense agagacagtttgccatgacc                                                     Sense
                  tgcactcatcagagctacagg
          Antisense                                                                      Antisense
                                                                                         BHD exon 9 (1)
                                                                                         Sense
                                                                                         Antisense
                                                                                         BHD exon 9 (2)
                                                                                         Sense
                                                                                         Antisense
                                                                                         BHD exon 10
                                                                                         Sense
                                                                                         Antisense
                                                                                         BHD11 exon 11 poly(C)8 (1)
                                                                                         Sense
                                                                                         Antisense
                                                                                         BHD11 exon 11 poly(C)8 (2)
                                                                                         Sense
                                                                                         Antisense
                                                                                         BHD exon 12
                                                                                         Sense
                                                                                         Antisense
                                                                                         BHD exon 13
                                                                                         Sense
                                                                                         Antisense
                                                                                         BHD exon 14 (1)
                                                                                         Sense
                                                                                         Antisense
                                                                                         BHD exon 14 (2)
                                                                                         Sense




Site Directed Mutagenesis (Piao et al, 2009)
            Common primers:
            GAINTN; 5'-TGGTTATTGTGCTGTCTCATC-3' (21mer, sense in vector sequence) and
            CAGR1; 5'-ATTAGCCAGAAGTCAGATGCT-3' (21mer, anti-sense in vector sequence).
            For generation of S298A mutant:
           BPMF12; 5'-GAATCAGAAGCTTGGGATAATTCAGA-3' (26mer, sense) and
           BPMR12; 5'-TCTGAATTATCCCAAGCTTCTGATTC-3' (26mer, anti-sense).
           For generation of S302A mutant:
           BPMF13; 5'-GTTGGGATAATGCAGAGGCTGAA-3' (23mer, sense) and
           BPMR13; 5'-TTCAGCCTCTGCATTATCCCAAC-3' (23mer, anti-sense).
           For generation of S407A mutant:
           BPMF14; 5'-CCCTTACAGCGCCCAGTATGAGG-3' (23mer, sense) and
           BPMR14; 5'-CCTCATACTGGGCGCTGTAAGGG-3' (23mer, anti-sense).
           For generation of S302D mutant:
           BPMF18; 5'-GTTGGGATAATGACGAGGCTGAA-3' (23mer, sense) and
           BPMR18; 5'-TTCAGCCTCGTCATTATCCCAAC-3' (23mer, anti-sense).




Plasmid construction (Piao et al, 2009)
          Expression plasmids for amino-terminal Flag-tagged or carboxy-terminal glutathione-S-transferase (GST)-tagged full-len
          Details of those constructions are described elsewhere (L. W. et al., submitted). To introduce site-directed mutations, P
          Prediction of candidate phosphorylation sites was performed by database search (PhosphoBase), (http://www.cbs.dtu.
          the first PCRs were performed using primers covering the 5' or 3' parts of a partial cDNA clone (aa 289-419) from the ta
          anti-sense BPMR primers or sense BPM primers and anti-sense CAGR1 primer, respectively). Two amplified overlapping
          second PCR was performed with GAINTN and CAGR1 primers. Then, finally, the resulting fragments were digested with
          in pCAG-GS vector-based clones for Flag-tagged FLCN fragments. Primer list is provided below. Expression plasmids for
          Myc-AMPK 1and HA-Rheb were previously described [2, 3]. To express GST-S6K1 fusion protein, the coding region of ra
          transcription-polymerase chain reaction (RT-PCR) with the following primers, S6KF1 (5'-CGGAATTCGCAGGAGTGTTTGAC
          S6KR1 (5'-CGGGATCCTCATAGATTCATACGCAGGTG-3'), and cloned into a modified pCAG-GS vector. Then, the fragment
          derived from pGEX-5X-1 (GE Healthcare Bioscience), was cloned 5' upstream of S6K1-coding region, finally generating G
          expression plasmids for amino-terminal His-tagged proteins were generated using pQE-30, -31 and -32 vectors (Qiagen
          from the full length cDNA were subcloned. For His-S6, the full-coding region of human S6 cDNA was amplified by RT-PC
          HS6F1 (5'-CCGAATTCAAGCTGAACATCTCCTTCCCA-3') and HS6R1 (5'-GGGATATCTTATTTCTGACTGGATTCAGACTT-3'), and
          To establish stable cell lines, plasmid vectors in the pRevTet-Off system (Clontech) were used. Full-length rat Tsc2 or ra
          generating pRevTRE-rTsc2 or pRevTRE-rBhd, respectively. A plasmid for expression of the tetracycline-controlled transa
          was generated by subcloning the tTA-coding fragment excised from the pRevTet-Off vector into the multicloning site o

DNA preparation (Gatalica et al, 2009)
           DNA extractions from tumor and normal tissues were performed after manual microdissection of unstained tissue sect
           Tissue samples were digested with proteinase K at 55°C overnight with continuous agitation (120 rpm). DNA was purifi
           YM-30 column (Millipore Corp, Billerica, MA). RNA was extracted from Formalin fixed paraffin embedded (FFPE) tissues
           instructions (Ambion, Austin, TX). Any trace gDNA was removed from each aliquot of extracted RNA with DNase I using

Polymerase chain reaction amplification of selected cancer genes (Gatalica et al, 2009)
          Primer pairs were designed to amplify selected exons of the following genes: FLCN, VHL, c-MET, FH, SDH, EGFR, KRAS, N
          sequence to allow for detection of mutations residing in/near splice junction regions. Primer selection was performed w
          Software (Transgenomic, Inc, Omaha, NE), which incorporates Primer 3 oligonucleotide selection and design criteria. Sp
          gel electrophoresis (2% agarose, 1× TAE [Tris-acetate-EDTA buffer] buffer).

Mutations scanning by Surveyor Nuclease analysis and fragment analysis (Gatalica et al, 2009)
          Heteroduplexed PCR products were combined with 15 U of Surveyor nuclease and 1 µL Enhancer (Transgenomic) and t
          solution (0.5 mol/L EDTA at pH 8.0) and analyzed on a Transgenomic WAVE System equipped with a High Sensitivity De
           This scanning methodology has shown a limit of detection of 1 mutant copy in 100 to 200 total copies.

Mutation identification by DNA sequencing (Gatalica et al, 2009)
           PCR products were purified and cycle sequenced with amplicon-specific primers. Sequencing products were run on an
           and by manual review of chromatograms.

DNA methylation analysis by COBRA PCR (Gatalica et al, 2009)
         BHD promoter region methylation was assessed by using a COBRA PCR assay after routine Na Bisulphite/NaOH treatme
         analyzed was located within the region 2108 to +854 bp relative to the transcription start site, and the assay was desig
         templates during the amplification process. Final end-products were detected and quantified using the WAVE fragmen

DNA Isolation (Koga et al, 2009)
           Written informed consent was obtained from the patient and her parents for the analysis of BHD genes prior to this stu
           Chiba University School of Medicine. DNA from peripheral blood leukocytes was obtained using LabPass Blood Mini kit

Drect sequencing (Koga et al, 2009)
           Fourteen exons of BHD gene were amplified on polymerase chain reaction (PCR) using the primers described previousl
           60°C for 5 s, 68°C for 3 s, with an extension step of 1 min at 72°C at the end of the last cycle. After purification, DNA wa
           (Applied Biosystems, Cleveland OH, USA) and DNA sequencing was done using an ABI Prism 3100 Genetic Analyzer (Ap
           the PCR products were subcloned (TA Cloning Kit, Invitrogen, San Diego, CA, USA) and then sequenced to clarify the mu

Single-strand conformation polymorphism (Koga et al, 2009)
            A total of 2 µl of PCR products and formamid were incubated at 97°C for 5 min, then loaded onto microgel and electrop

Plasmid constructs and transfection (Koga et al, 2009)
          The cDNA fragments encoding full-length FLCN were amplified by PCR from human cDNA library and sub-cloned into pH
          All constructs were verified by DNA sequencing. Cos7 cells, HeLa cells and HEK293 cells were cultured and transfected

Tissue samples and DNA extraction (Gad et al, 2007)
          Ninety-two frozen sporadic renal tumour samples were collected from various hospitals in France and USA (French Kidn
          All patients are of Caucasian origin. This included two patients with bilateral chromophobe RCC but without evidence o
          This study was performed after approval from our local Ethics Committee. Informed consent was obtained from each p
          QIAamp DNA Mini Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions.

Sequencing analysis (Gad et al, 2007)
          The entire coding region of BHD, TP53, and HNF1? was screened for mutations by direct sequencing (Nickerson et al, 2
          Nickerson et al (2002) Technique

SNP analysis (Gad et al, 2007)
           Intronic and exonic SNPs (iSNPs and eSNPs) were obtained from the sequencing results. Rare homozygous genotypes h
           the allelic frequencies of HapMap–CEU (http://www.hapmap.org).

Methylation analysis of the BHD promoter region (Gad et al, 2007)
          Genomic DNA were incubated with or without HpaII (Invitrogen, Cergy-Pontoise, France). Polymerase chain reaction (P
          products were analysed on standard agarose gels. The presence of methylated cytosines was determined by comparing
          if cytosines were methylated, HpaII would not be cleaved at the restriction enzyme sites, and PCR amplification would

Generation of a FLCN mouse model (Hudon et al, 2009)
          All procedures for generating the Flcn mouse model were performed at the transgenic facility of McGill University. Mai
           animals were performed according to the guidelines and regulations of the McGill University Research and Ethic Anima
           Care. See Supplemental Materials and Methods for details on ES-cell clones, backgrounds and genotyping of mutant m

Development of a BHD knockout mouse model (Hasumi et al, 2009)
         The BHD flox mice, which carried the floxed allele, were crossed with beta-actin-cre mice to delete the genomic region
         loxP sites. Deletion of exon 7 causes a frameshift and produces a premature termination codon in the beginning of exo
         should result in degradation of the mRNA by nonsense mediated decay (NMD). BHD deletion and inactivation was conf
         qRT-PCR of BHD mRNA extracted from conditionally targeted kidneys from our BHD/KSP Cre mouse model previously d
         (1). We confirmed the absence of truncated BHD protein (FLCN) in BHDd/ mouse kidneys by Western blotting
         using anti-FLCN antibodies that react with the N-terminal portion of FLCN. All mice which were used in these experime
         were housed in the NCI-Frederick animal facility in standard cages with food and water ad libidum, grouped by age, sex
         strain according to the NCI-Frederick Animal Care and Use Committee guidelines. C57BL/6 mice were purchased from
         Charles River Laboratories. All other mouse strains were produced in-house. Animal care procedures followed National
         Cancer Institute (NCI)-Frederick Animal Care and Use Committee guidelines.

Endogenous FLCN Detection by Duolink System (Hasumi et al, 2009)
         Five-micrometers thick frozen sections were prepared and mounted onto positively charged slides, fixed in methanol/a
         min, dried and blocked with 10% normal goat serum. They were then rinsed with PBS, quenched in 0.5M ammonium ch
         washed with PBS, blocked with M.O.M. blocking system(Vector Laboratories) for 1 h at room temperature, and were in
         at 4 °C. The primary antibodies were diluted as follows: FLCN mouse monoclonal antibody 1:200, FLCN rabbit polyclona
         Biotechnology, Inc.), 1:200. PBS with 0.1% Tween-20 (PBS-T) was used for washing. Duolink in situ PLA was performed
         incubation with primary antibodies, we applied combinations of corresponding PLA probes (i.e., anti-rabbit PLUS, anti-m
         ligations and detections using Duolink 100 Detection Kit 563 (OLink Biosciences) were performed. The kit 563 includes
         nm and Hoechst 33432 nuclear dye. As negative control, normal mouse IgG antibody and normal rabbit IgG antibody w
         confocal laser scanning microscope (Carl Zeiss).


Construction of bhd+, bhd+tor1+, and bhd+tsc1+-deficient Strains (van slegtenhorst et al, 2007)
           The entire open reading frame of bhd + was deleted from the genome of the haploid strain 972h, using double fusion P
           to create DK1. Correct integration was confirmed by PCR. Δbhd was crossed into the ura4-D18 strain to generate DK2 (
           deficient strain MVS3 was used to generate Δtsc1Δbhd by isolating spores and using PCR to identify double mutants, w
           was generated by crossing TA99 (gift from R. Weisman) and DK2 using random spore analysis on selective plates. Durin
           to compensate for sterility of this mutant strain.

Construction of Plasmids
           The bhd + gene was amplified from genomic DNA and cloned into the pREP4X expression vector. After sequence verific
           pSLF173/273/373 series with different nmt (no message in thiamine) promoter strength (ATCC, Manassas, VA). The BH
           site-directed mutagenesis (Stratagene, La Jolla, CA) to generate Bhd-H352 and was verified by sequencing. Human BHD
           using BHD-specific oligos and inserted in-frame into the hemagglutinin-tagged yeast pSLF173.



BHD Plasmid Construction and Transfection (van Slegtenhorst et al, 2007)
          Myc-BHD plasmid DNA was created by amplifying human cDNA (the generous gift of Laura Schmidt) using BHD-specific
          The Myc-BHD-H255R plasmid DNA was created using site-directed mutagenesis of the myc-BHD plasmid and was verifi



Expression Profiling (van Slegtenhorst et al, 2007)
           Yeast were grown overnight in EMM to early log phase (A 595 = 0.2–0.3) and total RNA was isolated by phenol extractio
           RNA from two independent biological samples was pooled (10 μg of each sample), reverse transcribed into cDNA, and
           were carried out overnight at 42 °C. The slides were scanned with a GMS 428 Scanner (Affymetrix, Santa Clara, CA) and
           Each S. pombe gene was present in duplicate on each slide, and the experiments were repeated using opposite labels (
           Genes were considered expressed when all eight measurements exceeded a threshold of 3.5 times above the backgrou
           Genes were grouped and annotated on the basis of predicted function in the Sanger Institute S. pombe Gene Data base

Molecular Genetics Analysis (Nahorski et al, 2010)
          DNA was extracted from blood using standard methods and from paraffin embedded CRC samples using standard proc
          and exon–intron boundaries by PCR amplification and direct sequencing of the PCR products. Primer sequences are sho
          microsatellite unstable (MSI) tumour samples small range, specific PCR reactions were designed. Primer sequences are
          20 mM MgCl2, 200 uM of each dNTP, 20 pmol primers and 1 unit of Faststart Taq DNA polymerase (Roche, Mannheim,
          Antarctic Phosphatase and 5 units of Exonuclease 1 (New England Biolabs, Hitchin, UK). The sequencing reaction consis
          20 pmol primer and 0.75 ul Big Dye terminator cycle sequencing mix (ABI Applied Biosystems, Warrington, UK) made u
          automated sequencer (ABI Applied Biosystems).

           Details of primers for FLCN mutation analysis
             Exon              Forward primer                    Reverse primer
               4          GCAGGAAGTCCATGGCACC              CCTGAGAAGCAGTCTGTGTC
               5         GCTTGAGTTTTCCGAGCTCAG              CCTGTGCTGTGCTGATCTGC
               6         GCTGATTTGTGCCAGCTGAC              GCAAGCAAACACGGCTAAGG
               7         GGACTGATCCTCCAGGAGTC              GCAAGCAAACACGGCTAAGG
               8        GCTGGGTGAGCGTCAGGTTTGC             CGTTCTGGGCTGATTCAGAGC
               9         CCATGAAGTATCTTGGGCTG                GCTGTCAGTCACTTCCTGC
              10         CGCCTCCCTGAGAAGATAAG                CACAGCGGTTCTGTGCTG
              11         ACAAGCTGGTGTGTGACTGG              TCCACAACCCATGACAGAGA
            12+13         CACGGTGGGCTAGCGCAG               CAGCTCCAGGTTTTCTCCAGG
              14         GGTGTGGATTCCAGCTCTGC               CCTTGCTGGGACACAGCTCC
gene, the associated human gene sequence was searched against the complete 1.3x collection of dog reads.
exons. BLAST (www.ncbi.nlm.nih.gov:80/BLAST/ ) and Repeat Masker (www.repeatmasker.genome.washington.edu/cgi-bin/RepeatMasker)
ere designed using Primer3 (www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) to flank all
4 to 1755 bp. Treatment of the PCR products with exonuclease I and shrimp alkaline phosphatase was
plied Biosystems Inc., Foster City, CA, USA) and an ABI3700 or 3730 automated sequencer.
cession no. AY326427). Alignment and comparison of sequences from affected and unaffected dogs




 standard procedures (39). All DNA samples were resuspended in 10 mM Tris–HCl (pH 8.0),




 cDNA sequence of the BHD gene. The primers for the BHD probe were designed and synthesized from
 AGA GTA CAG AAG G-3' and R 5'-CCA CAG ACA GGT TCT GGT TGG TC-3'). The primers were used to PCR amplify
sing standard conditions with a 64°C annealing temperature. Sp6 adapter ends containing a primer
 kit (Ambion) following the manufacturer's protocol, and PCR-amplified to produce sense and antisense templates.
 oche) using the MAXIscript in vitro transcription kit (Ambion) and treated with DNase I per manufacturer's protocol.
of the hair follicle, Ker6IRS1,16 was used as a positive control and to optimize the in situ hybridization method. PCR primers
d R 5'-CAG GAA CTA TGC TAG GTC CCA G-3') and the probe of interest was amplified by PCR at a 64°C
d as a 589 bp PCR probe amplified from the 3'UTR of the KER6 gene using genomic DNA as the template.




ewaxed paraffin sections on slides were fixed at room temperature in 4% paraformaldehyde prepared
 endogenous peroxidase with 1–3% hydrogen peroxide for 10 min, 25 g/ml proteinase K for 7 min and an
anhydride (added right before slide addition) for 10 min. The slides were incubated with prehybridization
ardt's solution, 0.5 mg/ml yeast tRNA, and 60% formamide for 2 h at 37°C. Hybridization solution was prepared
ulfate. The hybridization solution was heated to 70°C, and then probe (1 ng/l final concentration) was added and
e cooled on ice, applied to the slides, and incubated overnight at 37°C. Serial tissue sections were probed with the
 ith hematoxylin and eosin to visualize tissue morphology.

o RNase A treatment (0.131–1.0 g/ml in PBS, Ambion) for 10 min at 37°C. Slides were soaked twice for 8 min in a 50°C solution of
ontaining washes (1 , 0.1 , 4 /0.1% Tween20) at 50°C while shaking. The hybridized signal was detected using the
n using the manufacturer's suggested protocol. Mounting media containing DAPI nuclei stain (Vector Laboratories)
 pifluorescence microscope with DAPI and FITC filters from Chroma. The slides were photographed using a
g software was used to layer and pseudocolor the images.




cidences for RCC were obtained from the cancer diagnoses registrations for England 2004.

al significance was taken at 5%.
gainst the orthologous folliculin sequences of chimpanzee, monkey, mouse, rat, dog, horse, cow,
echnology information (NCBI) protein database. The ClustalW Multiple Sequence Alignments




 13 affected and 12 unaffected. The genome-scan genotyping and scoring was performed by the
pping Set MD10 (Applied Biosystems), with an average intermarker distance of 10 cM. Genotypes
 ith the MLINK program of the FASTLINK package (Cottingham et al. 1993), and multipoint and two-point
 .0 (Kruglyak et al. 1996). For all analyses, inheritance was assumed to be autosomal dominant with reduced
ncies for each marker were the same as for the Finnish population (Finnish Genome Center).




ed FNIP1, was identified by mass spectrometric analysis (17 peptide matches) as the protein product of KIAA1961 (AB075841).
 il, but lacks an ATG start codon (BAB85547). BLAST analysis of the publicly available databases (UCSC Human
 overlapping human ESTs corresponding to KIAA1961. The clone BC001956 encodes a 508-aa protein with an ATG
N terminus of BAB85547. We performed a genomic BLAST analysis and confirmed that these two cDNA clones
uences. Further evaluation of the mass spectrometric data for FNIP1 revealed one peptide fragment that matched
 m a pooled tissue cDNA library (Clontech, Mountain View, CA) by PCR with primers designed from 5'-end
  AB075841 cDNA (3' UTR of FNIP1): 5'-GCCTAGCAAGCGCCCAGCG-3' (forward primer) and
 s were TOPO-cloned into pCR II cloning vectors (Invitrogen, Carlsbad, CA). Double-stranded
 re purified by using Performa plates (Edge BioSystems, Gaithersburg, MD) and electrophoresed
coverage of all clones. Sequence alignment was performed with Lasergene (DNAStar, Madison, WI) software. The consensus sequence
embled overlapping sequences of BC001956 and AB075841 cDNAs. Sequencing results confirmed that the
 ce. Several alternative transcripts lacking 1 or more of the 18 coding exons were identified and are currently being verified.




 BAT25, BT26, D2S123, D5S346, and D17S250. All PCR primers for MSI were custom made, and their sequences are shown in below.
d microsatellite primers, 0.2 mM dNTP, 10 mM Tris–HCl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl, and 0.4 U of Taq polymerase in a
94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The amplified products were then electrophoresed on a 5% denaturing
 he signals were visualized using an image analyzer (Bas 2500, Bio Imaging System, Fuji Film, Tokyo, Japan). MSI-high
new alleles of altered sizes as compared to the matched normal control DNA. When only one marker showed an
ed by replicating the reactions in more than three wells.

                  Sequence (5'–3')
          BHD exon 4 (1)
                  cctgttgcagtctccaagg
                  aatgccaccttcctcttcttc
          BHD exon 4 (2)
                  gggatgggaatgaggacagt
                  aaaccaagaccccaaagaca
          BHD exon 5 (1)
                  ccctgcttcccaactaacag
                  cggacaatgctgaagagctg
          BHD exon 5 (2)
        ccgggatatatcagccatga
        ggctcccacagagacagg
BHD exon 6
        gaggaaagggctgtctgagtc
        tcatgatggtgatgatgctg
BHD exon 7
        atcccttccctttgcatttc
        cagagacgcccgttacca
BHD exon 8
        cgagaacgctcatagctggt
        aacagcacccctgcctca
BHD exon 9 (1)
        tctgtaactgtccttgtcatctg
        tcccacagcctgagagagag
BHD exon 9 (2)
        agaagggcgggagctgac
        actggctctcctcctgagc
BHD exon 10
        gctgaaagcactgcactctc
        ccgcacacctaaggaaaaga
BHD11 exon 11 poly(C)8 (1)
        tccttggtctgagtcctgct
        cacgcacctgaggagagc
BHD11 exon 11 poly(C)8 (2)
        gtccgcatcatcccatacag
        gttccactttgggcctgag
BHD exon 12
        gggccttgtgttgttacag
        tcacaaaaaggacactctgc
BHD exon 13
        ctaacgcctgcccttgct
        cctcacccacactgttgctt
BHD exon 14 (1)
        tggtgtctgagtgttttgttttg
        ctcaggccagtcatccaga
BHD exon 14 (2)
        ccaaagaggacacacagaagc
        ttaggcaggtgtgtgtgacg
 glutathione-S-transferase (GST)-tagged full-length rat FLCN were constructed in pCAG-GS vector.
mitted). To introduce site-directed mutations, PCR-based methods were employed.
 e search (PhosphoBase), (http://www.cbs.dtu.dk/databases/PhosphoBase/). Briefly,
 f a partial cDNA clone (aa 289-419) from the target site (sense GAINTN primer and
  imer, respectively). Two amplified overlapping PCR fragments were mixed and the
 ly, the resulting fragments were digested with EcoRI and BglII and used for replacement
 list is provided below. Expression plasmids for Myc-FNIP1, Myc-FNIP2/FNIPL,
 ST-S6K1 fusion protein, the coding region of rat S6K1 cDNA was amplified by reverse
mers, S6KF1 (5'-CGGAATTCGCAGGAGTGTTTGACATAGAC-3') and
 modified pCAG-GS vector. Then, the fragment of GST-coding region without stop codon,
eam of S6K1-coding region, finally generating GST-S6K1 expression plasmid. Bacterial
  ted using pQE-30, -31 and -32 vectors (Qiagen). For His-FLCN fragments, restriction fragments
 ion of human S6 cDNA was amplified by RT-PCR with the following primers,
 ATATCTTATTTCTGACTGGATTCAGACTT-3'), and then subcloned.
 Clontech) were used. Full-length rat Tsc2 or rat Bhd cDNA was cloned into pRevTRE vector,
expression of the tetracycline-controlled transactivator (tTA) with puromycin-resistant gene
pRevTet-Off vector into the multicloning site of pIRESpuro2 (Clontech), thereby generating prTA-IRES-Puro.



 anual microdissection of unstained tissue sections to differentiate somatic from germline mutations.
ontinuous agitation (120 rpm). DNA was purified and concentrated using an Amicon Microcon
ormalin fixed paraffin embedded (FFPE) tissues using the Paraffin Block RNA Isolation kit according to the manufacturer's
ch aliquot of extracted RNA with DNase I using a commercial DNA-free Kit (Ambion).



 nes: FLCN, VHL, c-MET, FH, SDH, EGFR, KRAS, NRAS, and BRAF. Amplicons included 50 base pairs (bp) of intronic
 tion regions. Primer selection was performed with MutationDiscovery.com, Web-based
  ligonucleotide selection and design criteria. Specificity and yield of each PCR product were routinely assessed by




 lease and 1 µL Enhancer (Transgenomic) and then incubated at 42°C for 20 minutes. Digestions were terminated with 2-µL Stop
 VE System equipped with a High Sensitivity Detection module (WAVE-HS) for fluorescent detection of dsDNA fragments.
opy in 100 to 200 total copies.



primers. Sequencing products were run on an ABI 3100 Genetic Analyzer. Data were analyzed using Sequencer (GeneCodes, Ann Arbor, MI)




ssay after routine Na Bisulphite/NaOH treatment of tumor gDNA as previously described. The CpG island
anscription start site, and the assay was designed to ensure no bias toward methylated or unmethylated
ected and quantified using the WAVE fragment analysis system. The same approach was used to assess VHL promoter methylation status.



s for the analysis of BHD genes prior to this study. The study was approved by the Institutional Review Board (IRB) of
tes was obtained using LabPass Blood Mini kit (Cosmo Genetech, Seoul, Korea) according to the manufacturer's instructions.



n (PCR) using the primers described previously.3 PCR conditions were as follows: 95°C for 5 min, 35 cycles at 96°C for 5 s,
nd of the last cycle. After purification, DNA was labeled with Big Dye Terminator v1.1 Cycle Sequencing Kit
using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). In the region where nucleotide alteration was suggested,
CA, USA) and then sequenced to clarify the mutation pattern.



5 min, then loaded onto microgel and electrophoresed for 10 min using micro TGGE (Taitec, Saitama, Japan).



om human cDNA library and sub-cloned into pHA-C1 mammalian expression vector containing hemagglutinin (HA) epitope tag.
d HEK293 cells were cultured and transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.



arious hospitals in France and USA (French Kidney Tumour Consortium and Cooperative Human Tissue Network).
eral chromophobe RCC but without evidence of genetic predisposition.
e. Informed consent was obtained from each patient. Genomic DNA was extracted using the
 nufacturer's instructions.


ations by direct sequencing (Nickerson et al, 2002).




 encing results. Rare homozygous genotypes have the lowest allelic frequencies according to the Hardy–Weinberg's law. We used




ontoise, France). Polymerase chain reaction (PCR) was then performed with specific primers (available on request) and
ylated cytosines was determined by comparing the same sample under the digested or nondigested conditions, that is,
on enzyme sites, and PCR amplification would be successful.



 he transgenic facility of McGill University. Maintenance and experimental manipulation of
he McGill University Research and Ethic Animal Committee and the Canadian Council on Animal
nes, backgrounds and genotyping of mutant mice.



 ta-actin-cre mice to delete the genomic region flanked by
ure termination codon in the beginning of exon 8, which
NMD). BHD deletion and inactivation was confirmed by
 m our BHD/KSP Cre mouse model previously described
/ mouse kidneys by Western blotting
N. All mice which were used in these experiments
ood and water ad libidum, grouped by age, sex and
 idelines. C57BL/6 mice were purchased from
use. Animal care procedures followed National




o positively charged slides, fixed in methanol/acetone (1:1) at -20 °C for 10
sed with PBS, quenched in 0.5M ammonium chloride/0.1% BSA (BSA) in PBS for 15 min at room temperature,
 ries) for 1 h at room temperature, and were incubated with combination of the primary anti-FLCN antibodies overnight
noclonal antibody 1:200, FLCN rabbit polyclonal antibody 1:200, FL-342 FLCN antibody (Santa Cruz
 r washing. Duolink in situ PLA was performed per manufacturer’s instruction (OLink Biosciences). Briefly, after
onding PLA probes (i.e., anti-rabbit PLUS, anti-mouse MINUS PLA probes) for 1 h at 37 °C. Subsequent hybridizations,
 iences) were performed. The kit 563 includes a Tye 563 fluorophore with excitation at 557 nm and emission at 563
 gG antibody and normal rabbit IgG antibody were used at the same dilution. Images were taken using a LSM710




 the haploid strain 972h, using double fusion PCR homologous recombination and replaced by the kanamycin cassette
sed into the ura4-D18 strain to generate DK2 (ura4Δbhd) using random spore analysis on selective plates. Tsc1+-
 s and using PCR to identify double mutants, which were verified by Northern blot. The Δtor1Δbhd-deficient strain
 ndom spore analysis on selective plates. During mating, Tor1 was being expressed in TA99 from a plasmid




EP4X expression vector. After sequence verification, bhd + was inserted in-frame into the hemagglutinin-tagged
 moter strength (ATCC, Manassas, VA). The BHD H352R mutation was introduced into the pSLF373 constructs using
2 and was verified by sequencing. Human BHD was amplified from cDNA (the generous gift of Laura Schmidt)
agged yeast pSLF173.




erous gift of Laura Schmidt) using BHD-specific oligos. PCR product was ligated into myc-tagged pCMV-Tag3 vector (Stratagene).
genesis of the myc-BHD plasmid and was verified by sequencing.




 nd total RNA was isolated by phenol extraction and purified using RNeasy (Qiagen, Valencia, CA). Total
h sample), reverse transcribed into cDNA, and labeled with Cy3 and Cy5 (Amersham Biosciences). Hybridizations
 428 Scanner (Affymetrix, Santa Clara, CA) and spot quantification was performed with the ImaGene software (BioDiscovery, Marina del Rey, CA).
 riments were repeated using opposite labels (dye-flip), resulting in a total of eight measurements for each gene per sample.
ed a threshold of 3.5 times above the background. A linear regression normalization was applied to the data and fold changes were calculated.
  the Sanger Institute S. pombe Gene Data base.



n embedded CRC samples using standard procedures. FLCN mutation analysis was performed for all coding exons
of the PCR products. Primer sequences are shown below. To test for the presence of frameshift mutations in
eactions were designed. Primer sequences are shown below. PCR was performed in 50 ul volumes using
start Taq DNA polymerase (Roche, Mannheim, Germany); 10 ul of product was cleaned using 5 units of
s, Hitchin, UK). The sequencing reaction consisted of 4 ul of cleaned PCR product, 1× ABI sequencing buffer,
 Applied Biosystems, Warrington, UK) made up to 10 ?l with clean H2O. Products were sequenced using an ABI 3730


                    Details of primers for analysis of mononucleotide repeat regions in IGF2R, TGFBR2, MSH6 and FLCN
                      Gene                  F primer                       R primer
                      IGF2R       CCCGAACCAAACCTTGTTTA            ATATGATCCCAGCAGCCTGA
                     TGFBR2       CCTCGCTTCCAATGAATCTC           TGCACTCATCAGAGCTACAGG
                      MSH6        CTGATAAAACCCCCAAACGA             TAGGCTTTGCCATTTTCCTG
                       FLCN        TCCTCCTCAGACCATGCTTC            GGTTCCACTTTGGGCCTGA
ashington.edu/cgi-bin/RepeatMasker)



                                      BACK




n method. PCR primers

                                      BACK




or 8 min in a 50°C solution of




                                      BACK
                                  BACK




of KIAA1961 (AB075841).




oftware. The consensus sequence

urrently being verified.
                                  BACK


sequences are shown in below.
U of Taq polymerase in a
BACK
                            BACK




                            BACK


the manufacturer's
                            BACK




                            BACK


terminated with 2-µL Stop
 dsDNA fragments.
                                      BACK


equencer (GeneCodes, Ann Arbor, MI)
                                      BACK




ss VHL promoter methylation status.   BACK




ufacturer's instructions.
                                      BACK

ycles at 96°C for 5 s,

ation was suggested,

                                      BACK



                                      BACK

glutinin (HA) epitope tag.
manufacturer's protocol.
                                      BACK




                                      BACK


dy–Weinberg's law. We used
                                      BACK




                                      BACK
                                               BACK




                                               BACK




                                               BACK




                                               BACK




                                               BACK

V-Tag3 vector (Stratagene).



                                               BACK




software (BioDiscovery, Marina del Rey, CA).
each gene per sample.
e data and fold changes were calculated.

                                           BACK




                                           BACK
Identification of FLCN- and FNIP-1-Interacting Proteins (Baba et al , 2006).
            HA-FLCN- or FNIP1-HA-inducible HEK 293 cells were cultured with or without 1 µg/ml doxycycline for 36 h, lysed, immu
            and eluted with HA peptide according to the manufacturer's protocol (Roche Applied Science, Indianapolis, IN). The elu
            transferred to PVDF membranes (ProBlott PVDF; Applied Biosystems, Foster City, CA), stained with Colloidal Gold Total
            excised and analyzed by MALDI-TOF/MS using an Applied Biosystems Voyager-DE/STR (40). Peptide mass fingerprinting

Kinase Assays (Piao et al, 2009)
           In vitro kinase assay for mTORC1 or mTORC2 was performed using the immunoprecipitated kinase complex. Semi-conf
           with CHAPS lysis buffer *20 mMTris–HCl (pH 7.4), 120 mM NaCl, 1 mM EDTA, 5 mM EGTA, 50 mM b-glycerophosphate,
           aprotinin and 4 µg/ml leupeptin] and the lysate was subjected to immunoprecipitation with anti-raptor or anti-rictor an
           was washed twice with CHAPS lysis buffer and then twice with buffer A *10 mM Hepes–NaOH (pH 7.4), 50 mM NaCl, 50
           In the case of mTORC2, the resin was washed four times with CHAPS lysis buffer and then once with buffer B *25 mM H
           potassium acetate and 1 mM MgCl2]. In the assay for mTORC1, GST-S6K1 or FLCN-GST was incubated with the immuno
           consisting of 10 mM Hepes–NaOH (pH 7.4), 50 mM NaCl, 50 mM b-glycerophosphate, 10 mM MnCl2, 100 µM ATP, and
           at 30 °C. In the assay for mTORC2, Akt (Upstate) or FLCN-GST was incubated with the immunoprecipitated complex in a
           Hepes–NaOH (pH 7.5), 100 mM potassium acetate, 1 mM MgCl2, 500 µM ATP, 15 µCi/tube gamma-32P-ATP for 30 min
           kinase was performed using His-S6 and His-FLCN fragments as substrates, and recombinant S6K1 (Upstate) according t
           Samples were separated by SDS–PAGE and either visualized by (CBB) staining or transferred onto nylon membrane (Mi
           Then, autoradiography was performed. Proteins on nylon membrane were visualized by immunoblot with alkaline phos
           antibodies using the substrate, nitro-blue-tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (WAKO).

Cytogenetics (Gatalica et al, 2009)
           Cytogenetic analysis was carried out on biopsy tissue from oncocytoma and also from peripheral blood with mitogen st
           maintenance, and harvest were done using standard methods. Chromosomes were G-banded using pancreatin and the
           image analysis system (Applied Imaging, Santa Clara, CA).

Human renal cell carcinoma cell lines (Hudon et al, 2009)
         RCC cell lines were obtained from ATCC and maintained in DMEM supplemented with 10% fetal bovine serum (Hyclone
         humidified 5% CO2 atmosphere. We developed a stable FLCN-knockdown RCC cell line by infecting ACHN cells
         with five different FLCN small hairpin (sh) RNA-expressing lentiviruses (Mission, Sigma-Aldrich) according to the instruc
         vector was included as control. Stable lentiviral cell lines were established using puromycin selection. To produce a stab
         RCC cell line with a FLCN-expressing lentiviral vector using the ViraPower Lentiviral Expression System (Invitrogen) and



In vitro and in vivo growth analysis of RCC cell lines ad in vitro S6 activation assay (Hudon et al, 2009)
Cell Proliferation Assay
             For each cell line, 1x105 cells were seeded in 12-well plates on day 0. Cells were collected in triplicate by trypsination a
             Size Analyser (Beckman) every 24 hours for eight days.

Xenograft tumor assay
           For the nude mouse xenograft assay, a total of 5 x 106 RCC cells suspended in 150 μl of PBS and 150 μl of Growth Facto
           injected subcutaneously into both flanks of CD1 nude (nu/nu) mice (Charles River Laboratories).

S6 activation in vitro
            5x105 ACHN and 786-0 cells were seeded in 10 cm dishes and grown overnight in DMEM supplemented with 10% FBS.
            One dish received normal growth media (10% FBS) while two dishes were serum starved (0.1% FBS). After 24 hours, on
            shock (20% FBS) after which all cells were harvested on ice by direct lysis in the dish using cold Laemmli buffer (62.5 mM
            mercaptoethanol, 2% SDS and 0.002% bromophenol blue).
Whole mount in situ hybridization (Hasumi et al, 2009)
         The embryos were collected from wild-type C57BL/6 mice intercrossed at different stages of gestation, fixed overnight
         mount in situ hybridization as previously described (2). The primers for the BHD probe were designed and synthesized
         GCCTTCAAGGTGTTTGAGGCAGA-3' and reverse; 5'-TCCACGACAACTACGAACTCTGAGGCC-3 ).

Plasmid construction (Wang et al, 2009)
          An EcoRI restriction site was introduced at the start codon of full-length rat Bhd cDNA (GenBank accession no. AB09621
          fragment (nt 178-340) with a double-stranded linker (RBNM1/RBNM2) in pBluescript plasmid (Stratagene). Using this m
          an expression plasmid for the amino-terminally Flag-tagged full-length rat FLCN (pCAG-Flag-rBhd) was constructed. For
          deleted FLCN, an internal SacI fragment (nt 335-901), or the 3' part downstream from a HindIII site (nt 1167) of Bhd cD
          generating pCAG-Flag-rBhd-?SacI or pCAG-Flag-rBhd-?Cter, respectively. To introduce site-directed mutations, PCR-bas
          Briefly, the first PCRs were performed using primers covering the 5' or 3' parts of the SacI fragment from the target site
          BPMR primers or sense BPM primers and anti-sense BPMR1 primer, respectively). Two amplified overlapping PCR fragm
          performed with BPMF1 and BPMR1 primers. Then, finally, the resulting fragments were digested with SacI and used fo
          pCAG-Flag-rBhd to generate expression plasmids for carboxy-terminally deleted or full-length FLCN with an amino-acid
          plasmid for full-length FLCN-GST fusion protein, first, the 3' region of the full-length Bhd cDNA, downstream from an Ap
          with a PCR fragment amplified by BHDRH and RBCM1 primers. By this replacement, the stop codon was deleted and a
          in the derived plasmid (pcDNA-rBhd-?TGA). Next, the GST-coding sequence was amplified by PCR from pGEX-5X-1 (GE
          GSTMR1 primers and subcloned into the BamHI site of pcDNA-rBhd-?TGA. Then the cDNA fragment, consisting of FLCN
          pCAG-Flag-rBhd-GST. Control GST-expression vector (pCAG-Flag-GST) was obtained by the introduction of the GST-cod
          fused to GST, plasmids were obtained by inserting the restriction fragment or the PCR fragment into pCAG-Flag-GST. Fo
          cDNA restriction fragments were cloned into pQE30 vector (QIAGEN). To prepare the positive control for the in vitro kin
          tuberin (NP_036812), containing AMPK phosphorylation site, was cloned into the pQE32 vector (QIAGEN). Expression p
          FNIP2/FNIPL have been described previously.



Linkers and Primers (Wand et al, 2009)
           For generation of EcoRI site at the start codon:
           RBNM1; 5'-AATTCAACGCCATTGTGGCTCTCTGCCACTTCTGCGAGCTC-3' (41mer, sense)
           RBNM2; 5'-CATGGAGCTCGCAGAAGTGGCAGAGAGCCACAATGGCGTTG-3' (41mer, anti-sense)
           The 5'-overhang sequences used for ligation are underlined.
            For site-directed mutagenesis:
           BPMF1; 5'-AACGCCATTGTGGCTCTCTGC-3' (21mer, sense)
           BPMR1; 5'-CCAAACTGTTCTGCCTCAAACAC-3' (23mer, anti-sense)
           BPMF2; 5'-TCTTCTGCGCGGAGGTTCTACA-3' (22mer, sense for T22A)
           BPMR2; 5'-TGTAGAACCTCCGCGCAGAAGA-3' (22mer, anti-sense for T22A)
           BPMF3; 5'-GAAGTGGGGACGCTCCTGGC-3' (20mer, sense for S38A)
           BPMR3; 5'-GCCAGGAGCGTCCCCACTTC-3' (20mer, anti-sense for S38A)
           BPMF4; 5'-CCAGATGGCCAGCCGAGTCCGT-3' (22mer, sense for S55A)
           BPMR4; 5'-ACGGACTCGGCTGGCCATCTGG-3' (22mer, anti-sense for S55A)
           BPMF5; 5'-TGCCCACGCTCCAGCCGAG-3' (19mer, sense for S62A)
           BPMR5; 5'-CTCGGCTGGAGCGTGGGCA-3' (19mer, anti-sense for S62A)
           BPMF6; 5'-GCGCCGCCACTGACTCCGCCAGCC-3' (24mer, sense for S68A/S72A)
           BPMR6; 5'-GGGCTGGCGGAGTCAGTGGCGGCG-3' (24mer, anti-sense for S68A/S72A)
           BPMR7; 5'-GGAGACCGCTATCAAGTACGTCAG-3' (24mer, sense for S103A)
           BPMR7; 5'-CTGACGTACTTGATAGCGGTCTCC-3' (24mer, anti-sense for S103A)
           BPMF8; 5'-CAGCCTGGCCTGTGAGGTGTGC-3' (22mer, sense for S130A)
           BPMR8; 5'-GCACACCTCACAGGCCAGGCTG-3' (22mer, anti-sense for S130A)
           BPMF9; 5'-CTGGTACGCCATCATCGCCATC-3' (22mer, sense for S171A)
           BPMR9; 5'-GATGGCGATGATGGCGTACCAG-3' (22mer, anti-sense for S171A)
           BPMF10; 5'-TGCCCACGACCCAGCCGAG-3' (19mer, sense for S62D)
           BPMR10; 5'-CTCGGCTGGGTCGTGGGCA-3' (19mer, anti-sense for S62D)
           Mutated nucleotides are indicated by underlining.
            For modification of the 3' end of the FLCN-coding region:
           BHDRH; 5'-TTGTGGTG ACCAGCGGTAG-3' (19mer, sense)
           RBCM1; 5'-CTGGATCCCCGTTCCGTGACTCTGCGGCTG-3' (30mer, anti-sense)
           The BamHI site introduced after the coding sequence is underlined.
            For amplification of the GST-coding region:
           GSTMF1; 5'-CAGGATCCAGAATTCATGTCCCCTATAC-3' (28mer, sense)
           GSTMR1; 5'-GAGGCAGATCGTCAGTCAGTCACGA-3' (25mer, anti-sense)
           The BamHI site used for ligation is underlined.



Cell culture, plasmid transfection and drug treatments (Wang et al, 2009)
            Cos7 and HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Sigma) containing 10% fetal bovine
            humidified 5% CO2 at 37°C. ERC33 cells were cultured as described previously. Plasmids were transfected into Cos7 cel
            according to the manufacturer's protocol. Treatment with rapamycin (20 nM; Sigma) or Compound C (30 µM; Calbioch



Yeast Strains, Media, and Growth Conditions (van Slegtenhorst et al , 2007)
            CHP428 and CHP429 were constructed by Charlie Hoffman (Boston College, MA) and were a gift from Janet Leatherwo
            Wild-type strain 972 and ura4-D18 were gifts from J. Bähler (Sanger Institute). The methionine auxotrophic strain 1945
            of Yeast Cultures, UK. S. pombe cells were grown in essential minimal medium (EMM; Qbiogene, Carlsbad, CA) at 30 °C
            were performed with Frozen-EZ Yeast Transformation II kit (Zymol Research, Orange, CA). Where indicated, cells were
hout 1 µg/ml doxycycline for 36 h, lysed, immunoprecipitated with anti-HA affinity matrix,
 che Applied Science, Indianapolis, IN). The eluted proteins were subjected to SDS/PAGE,
 ter City, CA), stained with Colloidal Gold Total Protein stain (Bio-Rad, Hercules, CA),
yager-DE/STR (40). Peptide mass fingerprinting and protein database searches confirmed protein identities.
                                                                                                             BACK

mmunoprecipitated kinase complex. Semi-confluent HeLa cells in a 100 mm dish were lysed
DTA, 5 mM EGTA, 50 mM b-glycerophosphate, 50 mM NaF, 0.3% CHAPS, 1 mM DTT, 4 µg/ml
 oprecipitation with anti-raptor or anti-rictor antibody. In the case of mTORC1, the resin
 10 mM Hepes–NaOH (pH 7.4), 50 mM NaCl, 50 mM b-glycerophosphate+.
   buffer and then once with buffer B *25 mM Hepes–NaOH (pH 7.5), 100 mM
1 or FLCN-GST was incubated with the immunoprecipitated complex in a solution
   ophosphate, 10 mM MnCl2, 100 µM ATP, and 15 µCi/tube gamma-32P-ATP incubated for 30 min
 ted with the immunoprecipitated complex in a solution consisting of 25 mM
M ATP, 15 µCi/tube gamma-32P-ATP for 30 min at 37 °C. In vitro kinase assay for p70 S6
  , and recombinant S6K1 (Upstate) according to the manufacturer’s instructions.
 ning or transferred onto nylon membrane (Millipore).
 re visualized by immunoblot with alkaline phosphatase conjugated secondary
  oro-3-indolylphosphate (WAKO).
                                                                                                             BACK

 nd also from peripheral blood with mitogen stimulation. Culture initiation,
omes were G-banded using pancreatin and then analyzed using a Cytovision

                                                                                                             BACK

mented with 10% fetal bovine serum (Hyclone), and antibiotics at 37°C in a
n RCC cell line by infecting ACHN cells
ission, Sigma-Aldrich) according to the instructions of the manufacturer. A scrambled shRNA
d using puromycin selection. To produce a stable FLCN-restored cell line, we infected 786-0
 Lentiviral Expression System (Invitrogen) and selected expressing cells with blasticidin.
                                                                                                             BACK




 ls were collected in triplicate by trypsination and counted using a Z2 Coulter Particle Count and




 ed in 150 μl of PBS and 150 μl of Growth Factor Reduced Matrigel (BD Biosciences) were
 les River Laboratories).


rnight in DMEM supplemented with 10% FBS. Experimental media was then added as follows:
e serum starved (0.1% FBS). After 24 hours, one serum-starved dish was subjected to a 15 min serum
 in the dish using cold Laemmli buffer (62.5 mM Tris (pH 6.8), 10% glycerol, 5% β-

                                                                                                             BACK
 t different stages of gestation, fixed overnight in 4% PFA, and processed for whole
he BHD probe were designed and synthesized from exons 5–11 of the BHD mRNA sequence (forward; 5 -

                                                                                                                     BACK

 at Bhd cDNA (GenBank accession no. AB096213) by replacing the 5' terminal EcoRI-NcoI
   pBluescript plasmid (Stratagene). Using this modified cDNA and pCAG-GS vector,
 t FLCN (pCAG-Flag-rBhd) was constructed. For expression of amino- or carboxy-terminally
 stream from a HindIII site (nt 1167) of Bhd cDNA, was removed from pCAG-Flag-rBhd,
 To introduce site-directed mutations, PCR-based methods were employed.
 parts of the SacI fragment from the target site (sense BPMF1 primer and anti-sense
ectively). Two amplified overlapping PCR fragments were mixed and the second PCR was
ragments were digested with SacI and used for replacement in pCAG-Flag-rBhd-?Cter or
deleted or full-length FLCN with an amino-acid substitution. For construction of an expression
 full-length Bhd cDNA, downstream from an ApaI site (nt 1736) in pcDNA3.1(-), was replaced
placement, the stop codon was deleted and a BamHI site was introduced after the coding sequence
 ce was amplified by PCR from pGEX-5X-1 (GE Healthcare Bioscience) using GSTMF1 and
A. Then the cDNA fragment, consisting of FLCN- and in-frame GST-coding sequences, was used to generate
s obtained by the introduction of the GST-coding PCR fragment. For expression of FLCN deletion mutants
nt or the PCR fragment into pCAG-Flag-GST. For bacterial expression of amino-terminally His-tagged FLCN fragments,
 prepare the positive control for the in vitro kinase assay, a partial rat Tsc2 cDNA fragment covering aa 1125-1424 of
  into the pQE32 vector (QIAGEN). Expression plasmids for Myc-AMPK 1, Myc-FNIP1 or Myc-

                                                                                                                     BACK
                        BACK



m (DMEM; Sigma) containing 10% fetal bovine serum (FBS) and antibiotics (penicillin/strepmycin) in
ously. Plasmids were transfected into Cos7 cells in antibiotic-free conditions using Fugene 6 (Roche)
 nM; Sigma) or Compound C (30 µM; Calbiochem) was performed for 24h.




ge, MA) and were a gift from Janet Leatherwood (Stony Brook University of New York, New York).
tute). The methionine auxotrophic strain 1945h+ was obtained from the National Collection
 dium (EMM; Qbiogene, Carlsbad, CA) at 30 °C unless otherwise stated. Transformations
rch, Orange, CA). Where indicated, cells were treated with rapamycin (100 ng/ml) for 3 h prior to harvest.
BACK




BACK

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:70
posted:3/16/2011
language:English
pages:270