Docstoc

Ammonium transport and pH regulation by K -Cl cotransporters.pdf

Document Sample
Ammonium transport and pH regulation by K -Cl cotransporters.pdf Powered By Docstoc
					Ammonium transport and pH regulation by K+-Cl-
cotransporters
Marc J. Bergeron, Édith Gagnon, Bernadette Wallendorff, Jean-Yves Lapointe
and Paul Isenring
Am J Physiol Renal Physiol 285:F68-F78, 2003. First published 25 March 2003;
doi:10.1152/ajprenal.00032.2003

You might find this additional info useful...

This article cites 53 articles, 37 of which can be accessed free at:
          http://ajprenal.physiology.org/content/285/1/F68.full.html#ref-list-1

This article has been cited by 10 other HighWire hosted articles, the first 5 are:
          A mathematical model of rat ascending Henle limb. I. Cotransporter function
          Alan M. Weinstein
          Am J Physiol Renal Physiol, March, 2010; 298 (3): F512-F524.
          [Abstract] [Full Text] [PDF]

           Negative Shift in the Glycine Reversal Potential Mediated by a Ca2+- and pH-Dependent




                                                                                                                                      Downloaded from ajprenal.physiology.org on February 2, 2011
           Mechanism in Interneurons
           Yuil Kim and Laurence O. Trussell
           J. Neurosci., September, 16 2009; 29 (37): 11495-11510.
           [Abstract] [Full Text] [PDF]

           Homooligomeric and Heterooligomeric Associations between K+-Cl− Cotransporter
           Isoforms and between K +-Cl− and Na+-K+-Cl− Cotransporters
           Charles F. Simard, Marc J. Bergeron, Rachelle Frenette-Cotton, Gabriel A. Carpentier,
           Marie-Eve Pelchat, Luc Caron and Paul Isenring
           J. Biol. Chem., June, 22 2007; 282 (25): 18083-18093.
           [Abstract] [Full Text] [PDF]

           Evidence from knockout mice against physiologically significant aquaporin 8-facilitated
           ammonia transport
           Baoxue Yang, Dan Zhao, Eugene Solenov and A. S. Verkman
           Am J Physiol Cell Physiol, September, 1 2006; 291 (3): C417-C423.
           [Abstract] [Full Text] [PDF]

           Expression of the ammonia transporter proteins Rh B glycoprotein and Rh C glycoprotein
           in the intestinal tract
           Mary E. Handlogten, Seong-Pyo Hong, Li Zhang, Allen W. Vander, Marshall L. Steinbaum,
           Martha Campbell-Thompson and I. David Weiner
           Am J Physiol Gastrointest Liver Physiol, May, 1 2005; 288 (5): G1036-G1047.
           [PDF]

Updated information and services including high resolution figures, can be found at:
        http://ajprenal.physiology.org/content/285/1/F68.full.html

Additional material and information about AJP - Renal Physiology can be found at:
        http://www.the-aps.org/publications/ajprenal


This infomation is current as of February 2, 2011.




AJP - Renal Physiology publishes original manuscripts on a broad range of subjects relating to the kidney, urinary tract, and their
respective cells and vasculature, as well as to the control of body fluid volume and composition. It is published 12 times a year
(monthly) by the American Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2003 by the
American Physiological Society. ISSN: 0363-6127, ESSN: 1522-1466. Visit our website at http://www.the-aps.org/.
Am J Physiol Renal Physiol 285: F68–F78, 2003.
First published March 25, 2003; 10.1152/ajprenal.00032.2003.



Ammonium transport and pH regulation by K -Cl
cotransporters
                                ´
             Marc J. Bergeron,1 Edith Gagnon,1 Bernadette Wallendorff,2
             Jean-Yves Lapointe,2 and Paul Isenring1
             1
                                                                                      ´
              Nephrology Group, Department of Medicine, Faculty of Medicine, Universite Laval,
             Quebec G1R 2J6; and 2Groupe de Recherche en Transport Membranaire, Physics
               ´
                                  ´         ´         ´      ´
             Department, Universite de Montreal, Montreal, Quebec, Canada H3C 3J7
             Submitted 22 January 2003; accepted in final form 18 March 2003

                           ´
   Bergeron, Marc J., Edith Gagnon, Bernadette Wal-                     pression occurring in nonpolarized as well as polarized
lendorff, Jean-Yves Lapointe, and Paul Isenring. Am-                    cell types (25, 29, 35, 36, 53). The two other K -CCCs
monium transport and pH regulation by K -Cl cotransport-                (NKCC2 and KCC2) are tissue specific; i.e., NKCC2 is
ers. Am J Physiol Renal Physiol 285: F68–F78, 2003. First               found exclusively in the kidney (28, 41) and KCC2 in
published March 25, 2003; 10.1152/ajprenal.00032.2003.—                 the brain (42). As a group of carriers, hence, the K -
The Na -K -Cl cotransporters (NKCCs), which belong to




                                                                                                                                                  Downloaded from ajprenal.physiology.org on February 2, 2011
the cation-Cl cotransporter (CCC) family, are able to trans-
                                                                        CCCs could potentially facilitate the transmembrane
locate NH4 across cell membranes. In this study, we have                movement of NH4 and modulate intracellular NH4
used the oocyte expression system to determine whether the              concentration ([NH4 ]i) in a wide variety of cell types.
K -Cl cotransporters (KCCs) can also transport NH4 and                    Several physiological effects may result from
whether they play a role in pH regulation. Our results dem-             changes in [NH4 ]i. By way of illustration, an increase
onstrate that all of the CCCs examined (NKCC1, NKCC2,                   in cellular influx of NH4 (but not of NH3) is typically
KCC1, KCC3, and KCC4) can promote NH4 translocation,                    accompanied by a decrease in intracellular pH (pHi) as
presumably through binding of the ion at the K site. More-              dissociation into NH3 and H takes place (1, 30, 33).
over, kinetic studies for both NKCCs and KCCs suggest that              Similarly, an increase in [NH4 ]i may accentuate glu-
NH4 is an excellent surrogate of Rb or K and that NH4                   tamine synthesis in certain cell types (52) and increase
transport and cellular acidification resulting from CCC ac-              vectorial NH3-NH4 movement across epithelial tissues
tivity are relevant physiologically. In this study, we have also        (12). In the kidney, for example, such movement is
found that CCCs are strongly and differentially affected by
changes in intracellular pH (independently of intracellular
                                                                        essential to ensure NH3 transfer from the proximal
[NH4 ]). Indeed, NKCC2, KCC1, KCC2, and KCC3 are inhib-                 tubule, where the gas is produced, to the collecting duct
ited at intracellular pH 7.5, whereas KCC4 is activated.                (CD), where H ions are secreted (12, 14, 54).
These results indicate that certain CCC isoforms may be                   Different groups have shown that extracellular acid-
specialized to operate in acidic environments. CCC-mediated             ification affects the normal operation of NKCCs and of
NH4 transport could bear great physiological implication                the KCC1 isoform (Isenring and Forbush, unpublished
given the ubiquitous distribution of these carriers.                    observations; see also Refs. 26, 34); for example, the
NKCC; KCC; ion affinity; acidification; collecting duct                   activity of NKCC1 in duck erythrocytes decreases pro-
                                                                        gressively as extracellular pH (pHo) is lowered from 7.2
                                                                        to 6.0. The physiological relevance of these findings is
VARIOUS MEMBERS of the cation-Cl cotransporter (CCC)                    unknown, in part because the effect of changes in pHi
family, namely, K -dependent CCCs (K -CCCs), have                       has not been concomitantly determined. Because mem-
been shown to mediate NH4 transport through binding                     bers of the K -CCC family share several functional
of the ion at the K site (1, 24, 30, 31, 51). The                       and structural characteristics, changes in pHi could
K -CCCs, which are highly homologous to one another,                    also influence the operation of KCC2, KCC3, and
include two types of carriers: the Na -K -Cl cotrans-                   KCC4. In such a case, titration of residues within the
porters (NKCC1 and 2; Refs. 18, 41, 53) and the K -Cl                   K -CCCs could correspond to a key mechanism by
cotransporters (KCC1–4; see Refs. 20, 27, 38, 42, 45).                  which NKCC- and KCC-mediated NH4 transport is
Evidence supporting a direct implication of the K -                     autoregulated.
CCCs in NH4 transport, however, is only available for                     In this work, we demonstrate for the first time that
NKCC1 and 2 (24, 30, 31, 51); for these two isoforms,                   the KCCs (including KCC1, KCC3, and KCC4) are able
                                                                        to transport NH4 probably at the K site. We also
interestingly, NH4 behaves as an almost perfect sur-
                                                                        provide evidence that several members within the K -
rogate of K or Rb .
                                                                        CCC family (both within the NKCC group and the KCC
  Four of the six known K -CCCs (NKCC1, KCC1,
KCC3, KCC4) have wide tissue distribution, with ex-
                                                                          The costs of publication of this article were defrayed in part by the
  Address for reprint requests and other correspondence: P. Isenring,   payment of page charges. The article must therefore be hereby
    ˆ              ´
L’Hotel-Dieu de Quebec Research Ctr., 10 rue McMahon (Rm. 3852),        marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
   ´
Quebec, Canada G1R2J6 (E-mail: paul.isenring@crhdq.ulaval.ca).          solely to indicate this fact.

F68                              0363-6127/03 $5.00 Copyright © 2003 the American Physiological Society               http://www.ajprenal.org
                                       CATION-CL COTRANSPORTERS AND NH4 TRANSPORT                                                             F69

Table 1. Composition of flux solutions
                                                                                                                                 Suc,    Osmolality,
                                                                                    2    2
                                      Na ,    Rb , NH4 ,   Cl ,   Ca2 , Mg2      PO4, SO4     HEPES,     NMDG,    Glu,   Ace,    Gly,    mosmol/kg
Medium              Type              mM      or K , mM    mM     (each), mM    (each), mM     mM         mM      mM     mM      mM        H 2O

   a     Hyposmolar                    58       3.3 K       5.3      1.3              0.7       6.7         0     52      0        0        128
   b     Hyperosmolar                  87       5 Rb       86        2                1        10           0      0      0      84         278
   c     Basic (variable Rb )          87    0.1–20 Rb     86        2                1        10        0.1–20   15      0        0        224
   d     Basic (variable NH4)          87    0.1–20 NH4    86        2                1        10        0.1–20   15      0        0        224
   e     Rb (variable pHi or pHo)      64       5 Rb       56        2                1         0          43      0     60        0        234
   f     Rb (variable pHo)             64       5 Rb       56        2                1         0          43     60      0        0        234
   g     NH4 (variable pHi or pHo)     64       5 NH4      56        2                1         0          43      0     60        0        234
   h     Gly                           64       5 Rb       56        2                1         0          13     30      0     60 Gly      234
   i     Suc                           64       5 Rb       56        2                1         0          13     30      0     60 Suc      234
   j     Wash                          19       73 Rb       8        2                1        10           0     78      0        0        194
   k     Equilibration medium          90        3K        96      0.7 Ca2            0         5           0      0      0        0*       200
           (variable pHo)                                          0.8 Mg2
                                                                                       2
   l     Barth’s medium                90       1K         90      0.7 Ca2       0.8 SO4       10          0       0      0       0†        200
                                                                   0.8 Mg2
   Unless specified, solutions are at pH 7.2–7.4, and osmolalities vary from 200 to 234 mosmol/kgH2O. NMDG, N-methyl-D-glucamine; Glu,
gluconate; Ace, acetate; Suc, sucrose; Gly, glycerol; pHi and pHo, intracellular and extracellular pH, respectively. *Also contains 5 mM TRIS.
† Also contains 0.7 NO3 and 2 mM HCO3 .




                                                                                                                                                       Downloaded from ajprenal.physiology.org on February 2, 2011
group) are regulated by changes in pHi. A preliminary                   huKCC3B, the yo1, yo2, and yo3 constructs described above
report has been presented (17).                                         were cut with BamHI-SphI, SphI-HindIII, and HindIII-XbaI,
                                                                        respectively, and their inserts were assembled into the
MATERIALS AND METHODS                                                   BamHI-XbaI sites of Pol1.
                                                                           cRNA was produced as previously described (7, 15, 16).
cDNA Construction and Vectors                                           Briefly, expression constructs were linearized with NheI and
   The cDNAs used in this work (huNKCC1, rbNKCC2A,                      inserts were in vitro transcribed with T7 RNA polymerase
rbKCC1, rtKCC2, huKCC3A, and msKCC4) are the same as                    using the mMESSAGE mMACHINE T7 kit (Ambion). Defol-
those described in previous studies (7, 15, 16, 37, 38, 42; hu,         liculated stage V-VI oocytes were injected with 25 nl H2O or
rb, rt, and ms are human, rabbit, rat, and mouse, respec-                 5–25 ng cRNA diluted in 25 nl H2O. Functional expression
tively). The cDNA for huKCC3B was obtained by RT-PCR.                   was assessed 3–4 days after injection; oocytes were main-
Briefly, the entire coding region was amplified as three over-            tained at 18°C in Barth’s medium (medium l; see Table
lapping fragments from human kidney polyA-selected RNA                  1) 125 M furosemide.
using three pairs of primers1; here, the most 5 -primer was
capped with the BamHI restriction site and the most 3 -                 Flux Protocol
primer with the XbaI site. Each fragment was then subcloned
in the vector PCR2.1 (Invitrogen) using the BamHI-SphI (for                All experiments were carried out at 22°C and, unless
the 5 -fragment), SphI-HindIII (middle fragment), and                   specified, pH of media was pH 7.2–7.4. When necessary,
HindIII-XbaI (3 -fragment) sites. The resulting constructs              replacement of cations (Na , Rb ) was done with N-methyl-
were called yo1, yo2, and yo3, respectively, and the identity of        D-glucamine and of anions (Cl ) with gluconate. For each
their inserts was verified by automated sequencing.                      experiment, H2O-injected oocytes were tested (along with
                                                                        CCC-expressing oocytes) to determine changes in flux due to
Expression in Xenopus Laevis Oocytes                                    endogenous cotransport activity. In our studies, furosemide
   We used the cDNAs of huNKCC1, rbNKCC2A, rbKCC1,                      (125–250 M) was used to block KCC and bumetanide (250
and rtKCC2 subcloned in the oocyte expression vector Pol1                 M) to block NKCC; at concentrations 125 M, we previ-
(7, 15, 16) and that of huKCC3A and msKCC4 subcloned in                 ously observed that furosemide inhibits both types of K -
the oocyte expression vector pGE-MHE (37, 38); rtKCC2                   CCCs efficiently, but that bumetanide has an incomplete
(originally in the vector pBF) was a gift from Dr. Eric Delpire         inhibitory effect (results not shown). Hence, apparent Ki
(Vanderbilt University, Nashville, TN), and huKCC3A and                 values are somewhat lower than those reported by Mercado
msKCC4 in pGE-MHE were a gift from Dr. David B. Mount                   et al. (37) perhaps due to differences in flux protocols.
(Harvard University, Boston, MA). Both Pol1 and pGE-MHE                    Unidirectional flux measurements were determined by us-
contain (5 to 3 ) the T7 promoter, the X. laevis -globin                ing our routine “flux protocol” that includes the following four
5 -untranslated region, a multiple cloning site, the X. laevis          steps: 1) activation of CCCs by 1-h incubation in tracer-free
  -globin 3 -untranslated region, a polyA tract, and a linear-          hyposmolar low-Cl medium (for KCCs) or tracer-free hyper-
izing site. To obtain an expression construct containing                osmolar medium (NKCCs); the composition of the activating
                                                                        media (medium a and medium b) is given in Table 1; 2)
                                                                        45-min incubation in various influx media (see below) sup-
 1
   The oligonucleotides used in the PCR reactions were 1) GG-           plemented with 2 Ci/ml 86Rb , 10 M ouabain, and 250
GATCCCAGAAAGAGCAAAGTATTATCTAAC and CTTGATGAA-                             M furosemide (KCC-expressing oocytes) or 250 M bu-
AGGGTGCGG (5 -fragment), where bold characters indicate the
BamHI site; 2) TGCTCCTCCACACTTCCC and CACCAGCTGGCA-                     metanide (NKCC-expressing oocytes); 3) termination of in-
GAATCC (middle fragment); and 3) GGTCTCACTATTGTGGGC and                 fluxes with washes in a basic medium (medium j; Table 1)
GTCTAGAGGCACTTCCATGGAGGACGTAGGCC (3 -fragment),                         containing 250 M furosemide or bumetanide and 10 M
where bold characters indicate the XbaI site.                           ouabain; and 4) solubilization of cells in 2% SDS and detec-
                                        AJP-Renal Physiol • VOL   285 • JULY 2003 •   www.ajprenal.org
F70                                    CATION-CL COTRANSPORTERS AND NH4 TRANSPORT

tion of 86Rb by liquid -scintillation using the TopCount-               trodes were calibrated in medium kpH 7.4 as well as in two
NXT microplate counter (Packard).                                       other buffers (medium kpH 6.4 and medium kpH 6.9); for over
   Different measurements were obtained by varying step 2 of            30 electrodes used, the slope of the voltage-pH curve aver-
the flux protocol.                                                       aged 47 4 (SD) mV/pH unit.
   Basal 86Rb transport by heterologous CCCs. Here, two                    In these studies, noninjected vs. CCC-injected oocytes
types of influx media (medium c5 mM and medium d5 mM;                    were incubated first in medium a or medium b for at least 1 h.
Table 1) were used. Medium c5 mM is a basic solution that               They were then transferred to an experiment chamber and
contains 5 mM Rb , whereas medium d5 mM contains 5 mM                   impaled with a conventional electrode connected to a voltage-
NH4 instead of 5 mM Rb . These experiments were devised                 clamp amplifier (model OC-725B, Warner Instrument, Ham-
to determine whether KCCs are able to transport NH4 in the              den, CT) and with a pH-sensitive electrode connected to a
absence of K or Rb in the external medium.                              high-impedance electrometer (model FD-234, WPI). In each
   Dependence of 86Rb transport on Rb concentration and                 experiment, the starting bathing solution was medium
[NH4 ]i. Sixteen types of influx media were employed; eight of           d0 mM. After a 1- to 2-min stabilization period, this solution
these (medium c0.1-20 mM) are NH4 free and differ in Rb                 was replaced by medium d5 mM or medium d20 mM to which
concentration ([Rb ]; from 0.1 to 20 mM), whereas the eight             oocytes were exposed for an additional 1.5–3.0 min before
others (medium d0.1-20 mM) are Rb free and differ in [NH4 ]             being returned to medium d0 mM. Signals were digitized at 10
(also from 0.1 to 20 mM). These experiments were conducted              Hz to obtain pHi and recorded with a data-acquisition system
to determine apparent affinities of various CCCs for both                (pClamp8 and clampfit8, Axon Instrument, Union City, CA).
Rb and NH4 .                                                            NH4 acidification rates (dpHi/dt) were measured by perform-
   Effect of changes in pHi or pHo on CCC-mediated 86Rb                 ing a linear fit to the pHi data once a steady-state acidifica-
influx. For these measurements, we used two types of media               tion rate was observed (usually between t 20 s and t        80




                                                                                                                                         Downloaded from ajprenal.physiology.org on February 2, 2011
titrated at different pH with HCl or NaOH; one medium                   s after the switch to the NH4 -containing solution).
(media e) contains 60 mM Na acetate (medium epH x.x) and
the other (media f) 60 mM Na gluconate (medium fpH x.x).2
                                                                        Calculations and Statistics
Here, an intermediate 10-min equilibration step was added
between steps 1 and 2 of the flux protocol using medium e or                Transport rates are expressed per hour as total counts in
medium f without the tracer or the inhibitors.2 In some of the          the sample (cpm)      nonradioactive Rb or NH4 (in some
studies, Rb in medium e was replaced by NH4 (medium                     experiments) (nmol/ l)     normalization factor (in some ex-
gpH x.x). These measurements were obtained to determine the             periments)/counts in the influx medium (cpm/ l). In each
pH sensitivity of various CCC isoforms and the topology of              study, transport rates among 2–12 oocytes (usually, from 4 to
the pH effect (intra- vs. extracellular).                               7 oocytes) were averaged; for studies in which the ion depen-
   Effect of glycerol vs. sucrose on CCC-mediated 86Rb in-              dence of the 86Rb influx was assessed, these averaged rates
flux. These experiments were conducted as above, except that             were also normalized to the value measured at the highest
60 mM Na acetate in medium epH x.x was replaced by 60 mM                ion concentration. Flux values (absolute or normalized) from
glycerol 30 mM Na gluconate (medium hpH x.x), and 30 mM                 1 to 11 experiments (usually, from 3 to 4 experiments) were
Na gluconate in medium FpH x.x was replaced by 60 mM                    subsequently reaveraged to obtain the means SE. Affinity
sucrose (medium ipH x.x). Here, the effect of a permeable               constant (Km) values were obtained by nonlinear least
osmole on CCC activity is compared with that of an imper-               squares analysis using the Michaelis-Menten equation (1-
meable osmole, independently of changes in pHi or pHo.                  binding-site model). For pHi measurements, dpH/dt values
                                                                        were obtained at 5 or 20 mM NH4 , and values among 4–11
pHi Measurements                                                        oocytes were averaged. When appropriate, differences be-
   These studies were carried out in oocytes using conven-              tween groups of variables were analyzed by Student’s two-
tional and pH-sensitive microelectrodes. Conventional elec-             tailed t-tests, and the null hypothesis was rejected for P
trodes were filled with a 1 M KCl solution; their resistances            values 0.05.
were 4–6 M . The pH-sensitive electrodes were silanized in
0.5% dichlorophenylsilane (dissolved in ultrapure acetone)              RESULTS
and baked overnight. Subsequently, the tips of the electrodes
were filled with a pH-sensitive liquid ion exchanger (WPI,               Functional Expression
Sarasota, FL), and the remainder were backfilled with a
calibration solution titrated at a pH of 7.4 (medium kpH 7.4;             In oocytes, each of the wild-type CCCs (rbNKCC2A,
see Table 1). After each experiment, the pH-sensitive elec-             rbKCC1, huKCC3A, and msKCC4) induces 86Rb in-
                                                                        flux (Fig. 1A, filled bars) well above that of the endog-
  2
                                                                        enous NKCC (27-, 4-, 11-, and 6-fold, respectively);
    When oocytes are bathed in an influx medium that contains 60         after correction for specific activity, 86Rb influx is 8.3,
mM Na acetate, changes in pHo are accompanied by predictable
changes in pHi because H acetate diffuses freely across plasma          1.3, 3.4, and 1.7 nmol oocyte 1 h 1, respectively, com-
membranes (8, 9, 48). Under such circumstances, steady-state pHi        pared with 0.3 nmol oocyte 1 h 1 for controls. In
values are observed after a 20-min incubation. When, on the other       these experiments, flux assays were performed after
hand, the influx medium contains 60 mM Na gluconate, changes in          incubation of oocytes in hyposmolar medium to acti-
pHo are not accompanied by appreciable changes in pHi because the
oocyte’s membrane has low permeability to H or Cl (6). In the           vate KCCs (17, 20, 35, 38) or hyperosmolar medium to
experiments described here, incubation in Na acetate or Na glu-         activate NKCC2 (15, 16, 25). The assays were also
conate was limited to 55 min: 10 min in tracer-free medium followed     performed in the presence of 10 M ouabain to block
by 45 min in tracer-supplemented medium. Under such circum-             the Na pump. Over 90% of the 86Rb influx measured
stances, pHi values are probably stable for most of the period during
which unidirectional fluxes are monitored. Longer incubations were
                                                                        under such conditions was bumetanide sensitive (re-
avoided to limit potential damage to the oocytes in the lower pH        sults not shown). Even if all CCC-expressing oocytes
solutions.                                                              are found to have significantly higher transport rates
                                        AJP-Renal Physiol • VOL   285 • JULY 2003 •   www.ajprenal.org
                                        CATION-CL COTRANSPORTERS AND NH4 TRANSPORT                                                     F71

                                                                          ternatively, the procedure used to activate KCCs may
                                                                          have been suboptimal compared with NKCCs.

                                                                          NH4 Transport
                                                                             To determine whether KCCs can transport NH4 (as
                                                                          shown previously for NKCCs; see Refs. 13, 23, 24, 30,
                                                                          31, 50, 51), the aforementioned measurements were
                                                                          repeated using a similar flux medium, except that Rb
                                                                          was replaced by NH4 (Fig. 1A, open bars). In fact, this
                                                                          medium still contains 3 M Rb from the addition of
                                                                          86
                                                                            Rb ; at this [Rb ], however, neither NKCCs nor
                                                                          KCCs can support measurable ion transport rates be-
                                                                          cause the Km for Rb (and K ) is in the millimolar
                                                                          range (see below). As illustrated in Fig. 1A for the three
                                                                          KCCs studied here (and for rbNKCC2A), 86Rb influx
                                                                          in the NH4 -containing medium is not significantly
                                                                          different from that measured in the Rb -containing
                                                                          medium. These results suggest that all K -CCCs are
                                                                          able to support ion transport by using NH4 as a sur-




                                                                                                                                               Downloaded from ajprenal.physiology.org on February 2, 2011
                                                                          rogate of Rb (or of K ).
                                                                             More direct proof that NH4 is actually transported
                                                                          across the membrane, and does not merely interfere
                                                                          with the normal operation of KCCs (and NKCCs) or
                                                                          with the binding of 86Rb at the K site, can be ob-
                                                                          tained through pHi measurements. Indeed, an increase
                                                                          in NH4 influx due to an increase in CCC activity at the
                                                                          oocyte surface should lead to acidification of the cytosol
                                                                          as NH4 accumulates in the cell and dissociates into
                                                                          NH3 H . Importantly, the concentration of free NH3
                                                                          does not increase in the cytosol of noninjected oocytes
                                                                          after NH4Cl loading (4, 5, 11). Figure 2 shows typical
                                                                          time courses of pHi changes obtained at two different
                                                                          [NH4 ] (medium d5 mM or medium d20 mM) for nonin-
Fig. 1. 86Rb influx by Xenopus laevis oocytes injected with rabbit         jected oocytes (Fig. 2A) and for rbNKCC2A-, rbKCC1-,
(rb) Na -K Cl cotransporter (rbNKCC2A), K -Cl cotransporter
(rbKCC1), human (hu)KCC3A, huNKCC3B, mouse (ms)KCC4, and
                                                                          huKCC3A-, and msKCC4-expressing oocytes (Fig. 2,
H2O. Oocytes were incubated for 45 min in hyposmolar medium               B–E), and Table 2 presents averaged dpHi/dt values
(KCC; water controls3) or hyperosmolar medium (NKCC). A: pH of            derived from several of these experiments.
the external medium        7.3–7.4. After the 1-h incubation, oocytes        As demonstrated previously (4, 11), the cytosol of
were assayed for 86Rb influx in a basic medium containing 5 mM
Rb and 0 mM NH4 (medium c5 mM, pH 7.5) 10 M ouabain (filled
                                                                          noninjected oocytes becomes weakly acidic at 5 mM
bars) or in a basic medium containing 5 mM NH4 and 0 mM Rb                NH4 (Table 2). In our studies, changes in dpHi/dt
(medium d5 mM, pH 7.5) 10 M ouabain (open bars). The composition          values are statistically significant at 20 mM NH4 but
of media is shown in Table 1. B: pH of the external medium         6.5.   are still relatively small (Table 2, Fig. 2A). It is note-
After the 1-h incubation, oocytes were preequilibrated for 10 min in      worthy that dpHi/dt for noninjected oocytes are not
medium epH 6.5 or gpH 6.5 (without the tracer); these media contain 60
mM Na acetate, 5 mM Rb (medium e, filled bars), or 5 mM NH4                influenced by the type of media used (medium a vs.
(medium g, open bars) and 10 M ouabain. After the preequilibra-           medium b) to activate CCCs (Table 2).
tion, oocytes were assayed for 86Rb influx in medium e or g (with the         For oocytes expressing rbNKCC2A or huNKCC1,
tracer). The composition of these various media is also shown in          dpHi/dt are much larger compared with noninjected
Table 1. Values are averages      SE of 2–12 oocytes (generally, 5–8
oocytes) from 1–8 experiments (generally, 3–4 experiments); in each
                                                                          oocytes (Fig. 2B and/or Table 2). These results confirm
experiment, mean 86Rb or ion transport rates were normalized to           that NKCCs are able to transport NH4 (see Refs. 13,
the concentration of counts (cpm/ l) in the influx medium and are          23, 24, 30, 31, 50, 51), most likely by using the K site.
therefore expressed in relative units     SE. Based on these calcula-
tions, it is noteworthy that flux data for KCCs are slightly lower in B
(compared with A), probably because the preincubation solution is           3
                                                                              In these studies (Fig. 1), flux measurements for H2O controls
slightly more hypertonic, and because msKCC4 becomes the most             were obtained after preincubation in hyposmolor medium only.
active KCC at lower intracellular pH (pHi).                               When H2O controls are preincubated in hyperosmolar medium, a
                                                                          30–40% increase in influx rates is generally observed (unpublished
                                                                          observations; see also Ref. 16). Hence, the difference shown here
than controls3, it is clear from Fig. 1A that KCCs                        between NKCC-injected oocytes, which were preincubated in hyper-
                                                                          osmolar medium, and H2O-injected oocytes is probably overesti-
exhibit lower rates compared with NKCC2. These dif-                       mated. However, because absolute flux rates in H2O controls are
ferences in activity could be due to differences in cell-                 very small, subtracted flux rates (CCC-injected minus H2O-injected)
surface expression or maximal transport capacity; al-                     are still significantly lower in the KCC group.

                                         AJP-Renal Physiol • VOL    285 • JULY 2003 •   www.ajprenal.org
F72                                    CATION-CL COTRANSPORTERS AND NH4 TRANSPORT


                                                                         reported here are unlikely to be accounted for (to an
                                                                         appreciable extent) by pH-dependent changes in buff-
                                                                         ering power.

                                                                         Rb Influx as a Function of [Rb ] and [NH4 ]
                                                                            The principle of competitive inhibition (e.g., influx
                                                                         rates measured at fixed, or radioactive [86Rb ] but
                                                                         various, or cold [85Rb ]) is often used to determine
                                                                         apparent ion affinities of a transport protein (fluxes are
                                                                         then corrected for specific activity). Km(Rb ) values
                                                                         shown in Fig. 3 were obtained using this principle. To
                                                                         determine affinities of K -CCCs for NH4 and facilitate
                                                                         comparisons between kinetic parameters, 86Rb was
                                                                         also employed as the fixed substrate when [NH4 ] was
                                                                         varied, and 86Rb influx as a measure of NH4 trans-
                                                                         port. Here, correction for specific activity is also made
                                                                         assuming a simple model in which analogous sub-
                                                                         strates (NH4 and Rb have the same ionic radius once
                                                                         hydrated) (30, 32) compete for the same translocation




                                                                                                                                       Downloaded from ajprenal.physiology.org on February 2, 2011
                                                                         site. Previous studies for NKCCs and the results
                                                                         shown in Fig. 2 suggest these assumptions are correct.
                                                                            As illustrated in Fig. 3, the dependence of 86Rb
                                                                         influx on [Rb ] for NKCC2 and for the KCCs obeys a
Fig. 2. Changes in pHi after incubation of oocytes expressing various    single-ligand-binding-site model (Fig. 3, A–D). Inter-
K -dependent cation-Cl cotransporters (K -CCCs) in NH4 -con-             estingly, Km(Rb ) values derived from these measure-
taining media. Acidification rates were recorded in noninjected oo-       ments are similar among KCCs, varying between 12
cytes (A) and in oocytes expressing rbNKCC2A (B), rbKCC1 (C),
huNKCC3A (D), and msKCC4 (E); here, noninjected oocytes and
                                                                         and 17 mM, and are close to those reported by other
rbNKCC2A-expressing oocytes were preincubated in hyperosmolar            groups (37, 45). The dependence of 86Rb influx on
medium, whereas KCC-expressing oocytes were preincubated in              [NH4 ] for each CCC examined in this work is also best
hyposmolar medium. The recording shown in each panel is from a           fit with a one-binding-site model (Fig. 3, E–H); notice-
typical experiment among 4–11 oocytes. pHi values at 5 mM NH4            ably, the influx-concentration relationships translate
were 7.55 (A), 7.77 (B), 7.78 (C), 7.48 (D), and 7.42 (E) and at 20 mM
NH4 were 7.52 (A), 7.50 (B), 7.80 (C), 7.33 (D), and 7.27 (E).           into Km(NH4 ) values that are very close to those for
                                                                         Km(Rb ) and that are in agreement with the order
                                                                         estimated from acidification rate measurements.
                                                                         Taken together, the results presented here suggest
Interestingly, the rates are similar in amplitude at 5
                                                                         that NH4 is a very good surrogate of K or Rb for all
vs. 20 mM NH4 , suggesting that the Km(NH4 ) values
                                                                         carriers belonging to the K -CCC family.
for NKCCs examined in this study are 5 mM.
   For KCC-expressing oocytes, substantial decreases                     pHi and CCC Activity
in pHi are also seen. In the presence of 20 mM NH4 ,
e.g., dpHi/dt for KCC1, huKCC3A, and KCC4 (Fig. 2,                          Changes in pH can affect the operation of NKCCs
C–E, Table 2) are more than twice those for nonin-                       and of KCC1; hence, they could affect that of the other
jected oocytes (Fig. 2A, Table 2); noticeably for KCC4,                  KCCs, which are also K dependent and similar to one
rates are also comparable at 5 vs. 20 mM NH4 . Hence,                    another. The mechanisms of the interaction between
similar to NKCCs, KCCs can mediate NH4 transport                         pH and CCC-mediated transport are ill defined. If they
at appreciable rates. Based on these results, Km(NH4 )                   involve titration of intracellular residues, the implica-
values for different CCCs are probably as follows:                       tion could be that K -CCC-mediated NH4 transport is
rbKCC1 huNKCC3A msKCC4 rbNKCC2A.                                         regulated by pHi and that Km values derived from the
   In principle, the rate of NH4 entry into cells is equal               measurements shown above represent a possibly inac-
to measured dpHi/dt        intracellular buffering power                 curate estimate of Km values derived from more direct
(33). Thus the interpretation of measurements shown                      measurements, e.g., true dissociation constants (Kd).
in Fig. 2 could be affected by systematic changes in                     The following experiments were devised to examine
initial pHi values. Table 2 shows that for several con-                  the effect of changes in pH on K -CCCs and to deter-
ditions tested, however, initial pHi values are not sta-                 mine the sideness of the effect. Results are shown in
tistically different from, or are relatively close to, one               Fig. 4 and discussed below.
another. Based on previous studies, in addition, the                        When oocytes are bathed in a medium containing 60
intracellular buffering power of X. laevis oocytes was                   mM acetate, a change in pHo will lead to a proportional
shown to be similar at pHi values ranging between 6.85                   change in pHi (slope 0.64) so that pHi will be rela-
and 7.45 (10) and was estimated at 23.8 mM/pH unit                       tively close to (but smaller than) pHo (8, 9, 48).2 In such
when the average pHi was 7.69 (48). Taken together,                      a medium, interestingly, the activity of all K -CCCs
these results indicate that differences in dpHi/dt values                examined is shown to vary as a function of pH (see Fig.
                                         AJP-Renal Physiol • VOL   285 • JULY 2003 •   www.ajprenal.org
                                     CATION-CL COTRANSPORTERS AND NH4 TRANSPORT                                                   F73

Table 2. pHi measurements obtained for noninjected oocytes and rbNKCC2A-, huNKCC1-, rbKCC1-,
huNKCC3A-, and msKCC4-expressing oocytes
                                                                      5 mM NH4                                        20 mM NH4

                                               Hyperosmolar preincubation (medium a)
Noninjected (starting pHi)                                   8.07     0.11 (n        6)                        8.04   0.13 (n     6)
Noninjected (dpHi/dt in NH4 )                               0.019     0.005                                   0.052   0.013
rbNKCC2A (starting pHi)                                      7.72     0.09 (n        6)†                       7.48   11    (n    6)†
rbNKCC2A (dpH/dt in NH4 )                                   0.094     0.022‡                                  0.125   0.017‡
rbNKCC2A-spec. (dpHi/dt in NH4 )                            0.075     0.027                                   0.073   0.030
huNKCC1 (starting pHi)                                       7.65     0.16 (n        4)†                       7.28   0.11 (n     4)†
huNKCC1 (dpH/dt in NH4 )                                    0.126     0.065*                                  0.181   0.097*
huNKCC1-spec. (dpH/dt in NH4 )                              0.107     0.070                                   0.129   0.110
                                               Hyposmolar preincubation (medium b)
Noninjected (starting pHi)                                   7.55     0.05 (n        10)                       7.57   0.07 (n     10)
Noninjected (dpH/dt in NH4 )                                0.020     0.006                                   0.054   0.010
rbKCC1 (starting pHi)                                        7.69     0.09 (n        11)*                      7.68   0.08 (n     11)*
rbKCC1 (dpH/dt in NH4 )                                     0.028     0.011*                                  0.097   0.017†
rbKCC1-spec. (dpHi/dt in NH4 )                              0.008     0.017                                   0.043   0.027




                                                                                                                                         Downloaded from ajprenal.physiology.org on February 2, 2011
huNKCC3A (starting pHi)                                      7.38     0.04 (n        7)†                       7.25   0.05 (n     7)†
huNKCC3A ( NH4 )                                            0.041     0.011†                                  0.116   0.026†
huNKCC3A-spec. (dpH/dt in NH4 )                             0.029     0.017                                   0.066   0.036
msKCC4 (starting pHi)                                        7.70     0.14 (n        6)*                       7.60   0.22 (n     6)*
msKCC4 (dpHi/dt in NH4 )                                    0.092     0.022‡                                  0.131   0.025‡
msKCC4-spec. (dpHi/dt in NH4 )                              0.076     0.028                                   0.081   0.035
  Values are average SE of 4–11 oocytes expressed as pH/min. rb, hu, and ms; Rabbit, human, and mouse, respectively; NKCC, Na -K
Cl cotransporter; KCC, K -Cl cotransporter; dpHi/dt, NH4 acidification rate; spec, specific. dpH/dt measurements were obtained after
sequential incubation of oocytes in an activating medium (medium a or b) and in a flux medium containing NH4 (medium d5 mM or d20 mM).
Composition of media used for these studies is shown in Table 1. * P, nonsignificant differences. † P   0.05, ‡ P 0.01 compared with
noninjected controls.



4, A–E). For example, huKCC3B (results not shown),                    assuming that estimated pHi is close to measured pHi.
rbKCC1, and huKCC3A exhibit low activity at pH 7.0                    Results of these calculations (Fig. 4, K–O) show that
or 7.5, whereas rtKCC2 and rbNKCC2A exhibit low                       for four of the K -CCCs examined, the shape of the
activity only at pH 7.5, and msKCC4 only at pH                        curve is similar to those in corresponding top panels
  7.5. These studies show for the first time that the                  (Fig. 4, A–E); for rbKCC1, the curve is only changed at
K -CCC isoforms are all sensitive to changes in pH                    higher pHs.
and that they are differentially affected by such                        Because cell membranes are more permeable to ac-
changes.                                                              etate than to gluconate, medium e could have reduced
   When the influx medium contains gluconate instead                   effective osmolality compared with medium f, leading
of acetate, changes in pHo are not accompanied by                     to overestimated 86Rb fluxes. Hence, values reported
changes in pHi (6).2 In such a medium (Fig. 4, F–J), the              in Fig. 4, K–O, could also be overestimated. However,
effect of changes in pH on CCCs is much smaller                       because osmolalities of medium e or f do not change at
(except for rbKCC1, which is still inhibited at higher                different pH values, the look of the curves in Fig. 4,
pHo). These results indicate that, to a large extent,                 I–L, are probably not determined by differences in
intracellular domains within K -CCCs mediate the pH                   effective osmolality. Similar experiments wherein the
effect described in our study. They also suggest that                 permeant anion is replaced by glycerol, and a fraction
cellular accumulation of NH4 can lead to a change in                  of the impermeant anion by sucrose (Table 1, media h
K -CCC activity as the ion dissociates into H and                     and i), confirm that this is the case. In such experi-
NH3. Accordingly, the Km values reported here could                   ments, the effect of changes in pHo (6.0 vs. 7.5) on two
be underestimated (rbNKCC2A, rbKCC1, rtKCC2,                          different CCCs was found to be the same in either
huKCC3A) or overestimated (msKCC4).                                   medium. Indeed, 86Rb influx rates were all between
   The formula [Vn at pHi o x.x] [Vn at pHo x.x Vn                    0.5 and 0.7     0.1 nmol oocyte 1 h 1 (n      7–8/condi-
at pHo 7.2], where Vn 86Rb influx normalized to the                    tion) and were not statistically different from one an-
highest flux values and x.x pH values, can be used to                  other.
estimate CCC activity resulting from changes in pHi
alone. By using this formula, the effect of changing pHo              Effect of pHi on Estimated Rb vs. NH4 Transport
from 7.2 to another value is subtracted, assuming that
the relationship between pHo and CCC activity is in-                    Although both Rb and NH4 share the same ionic
dependent of that between pHi and CCC activity, and                   radii once hydrated (as mentioned), and although esti-
                                      AJP-Renal Physiol • VOL   285 • JULY 2003 •   www.ajprenal.org
F74                                   CATION-CL COTRANSPORTERS AND NH4 TRANSPORT




                                                                                                                                   Downloaded from ajprenal.physiology.org on February 2, 2011
Fig. 3. Dependence of 86Rb influx on Rb ([Rb ]) or NH4 concentration ([NH4 ]) for rbNKCC2A, rbKCC1,
huKCC3A, and msKCC4. After a 1-h incubation in hyposmolar (KCC) or hyperosmolar medium (NKCC), oocytes
were assayed for 86Rb influx in different media c, which have [Rb ] varying from 0.1 to 20.0 mM (A–D) or in
different media d, which have [NH4 ] varying from 0.1 to 20.0 mM (E–H); composition of the flux media is shown
in Table 1. The data are shown as averages of 2–9 oocytes (generally, 3–6 oocytes) from 2–8 experiments
(generally, from 3 to 4 experiments). In each experiment, mean 86Rb or ion transport rates among oocytes were
normalized to the value obtained at the highest ion concentration. Averages of normalized values among different
experiments were then calculated and are shown here as transport rates in relative units SE. Km values SE
were obtained by fitting the average data points with the Michaelis-Menten equation using a model of ion binding
at a single site; here, SE corresponds to the closeness of the fit based on iterative estimates obtained with the
program SigmaPlot 4.00 for Windows.



mated Km(NH4 ) and Km(Rb ) are quite similar for any                   significantly faster than that of noninjected oocytes
given CCCs, the pH effect reported in this work indi-                  after incubations in NH4 -containing media (Fig. 2).
cates that the relationship between Km(NH4 ) and                         In mammals, the physiological importance of NKCC-
Kd(NH4 ) may differ from that between Km(Rb ) and                      mediated NH4 transport has been documented previ-
Kd(Rb ). Accordingly, changes in pHi could have al-                    ously (2, 12, 19, 50, 51). Results presented here provide
tered the preference for one substrate vs. the other. To               evidence that NH4 transport by KCCs may also be
test this possibility, we measured CCC activity in an                  relevant physiologically. Indeed, estimated Km(NH4 )
Na acetate influx solution (pH 6.5) containing either 5                 values for these carriers are in the millimolar range,
mM Rb (medium epH 6.5) or 5 mM NH4 (medium                             only 0.5–1 order of magnitude lower than those re-
gpH 6.5). The results of these studies are illustrated in              ported for NKCCs (see Fig. 3 and Refs. 26, 31, 51). It is
Fig. 1B. They show that for any given CCCs, 86Rb                       noteworthy that these values are also close to [NH4 ]
influx is the same whether measurements are obtained                    found in various tissues (13, 23, 44, 51). Hence, K -
in medium e or f. Hence, changes in pHi do not appear                  CCCs may be important accessory pathways for NH4
to alter substrate specificity at the K site (at least                  transport in a number of cell types.
when these substrates are used at a concentration of 5                   An interesting issue regarding K -CCC-mediated
mM).                                                                   NH4 transport is “net direction of flux.” In theory, this
                                                                       direction should depend on the K -CCCs involved, the
DISCUSSION
                                                                       intra- and extracellular concentration of transported
  In this study, we used an expression system to de-                   ions (Cl , K , NH4 , Na ), and on pHi and pHo, which
termine whether KCCs, similar to NKCCs (24, 30, 31,                    will also influence [NH4 ]i and [NH4 ]o. Because the
50, 51), are directly involved in NH4 transport. Based                 intracellular-to-extracellular concentration gradient of
on various studies, we were able to conclude 1) that the               NH4 is much less than that of K in most cell types
K site of K -CCCs can interact with NH4 and 2) that                    and because pHi is usually close to pHo, the direction of
these carriers can promote NH4 translocation. The                      NH4 fluxes could differ from that of Rb fluxes, espe-
first conclusion is supported by the findings that KCC-                  cially when [NH4 ]o is high or pHi is low. During our
mediated 86Rb influx decreases in the presence of                       transport studies, e.g., the direction of 86Rb flux in
NH4 and that estimated Km(NH4 ) is similar to                          KCC-expressing oocytes is inward at [NH4 ]o 1 mM,
Km(Rb ) for any given CCC. The second conclusion is                    pHo 7.3, and pHi 7.8.
supported by the finding that the cytosol of KCC-                         Other cell types that may display inwardly di-
expressing oocytes becomes acidic at a rate that is                    rected NH4 transport via KCCs (and also via
                                       AJP-Renal Physiol • VOL   285 • JULY 2003 •   www.ajprenal.org
                                                     CATION-CL COTRANSPORTERS AND NH4 TRANSPORT                                                          F75




                                                                                                                                                               Downloaded from ajprenal.physiology.org on February 2, 2011
Fig. 4. Effect of changes in pH on K -CCC-mediated transport. Oocytes expressing rbNKCC2A, rbKCC1, rtKCC2,
huKCC3A, or msKCC4 were preincubated 1 h in hyposmolar (KCCs) or hyperosmolar medium (NKCC). They were
then assayed for 86Rb influx in different media (medium epH 5.5-8.5 or fpH 5.5-8.5) after a 10-min preequilibration
period with no tracer. The composition of the various media used in these studies is shown in Table 1. Top: media
e, which were used for these experiments (A–E), are titrated at different pH (from 5.5 to 8.5); because they contain
60 mM Na acetate, changes in extracellular pH (pHo) are accompanied by proportional changes in pHi. Middle:
media f, which were used for these experiments (F–J), are also titrated at different pH (from 5.5 to 8.5); because
they contain 60 mM Na gluconate instead of Na acetate, changes in pHo are not accompanied by changes in pHi.
Both media e and f are supplemented with inhibitors (10 M ouabain 250 M bumetanide or furosemide). The
data are shown as averages of inhibitor-sensitive fluxes       SE from 1–5 experiments (generally, from 3 to 4
experiments); in each experiment, 4–12 oocytes (generally, 8–10) were assayed. Bottom: data (K–O) correspond to
estimated flux values when the effect of a change in pHo from 7.2 to another value is subtracted. They were
obtained with the following equation: estimated flux values at different pHi [Vn at pHi o x.x] [Vn at pHo x.x
Vn at pHo 7.2], where Vn 86Rb influx rates normalized to the highest flux values and x.x pH values. Numbers
on the x-axis represent pH values that were measured in the incubating medium and are not identical to pHi. In
the presence of acetate, however, pHi can be estimated from pHo; indeed, this value will be smaller than, and vary
proportionally with, pHo (slope of 0.64).


NKCC1) include the periportal hepatocytes. Indeed,                                                 NH4 uptake by the liver parenchyma, and via the
the concentration of NH4 in portal blood is usually                                                Kreb-Henseleit-urea cycle, promote metabolic elimi-
very high (up to 20-fold higher than that in systemic                                              nation of this product, which is toxic to the brain (40,
blood) because urea-derived products are absorbed in                                               44) and several other tissues. Members within the
large quantities from the gut (44, 49). Hence, baso-                                               CCC family would then collaborate with other sys-
lateral K -CCCs in hepatocytes could contribute to                                                 tems (enzymes and carrier molecules) to maintain

Table 3. Alignments of the second transmembrane domain region of various K -CCCs
             Q   A   L   L   I   V   L   I   C   C   C   C   T   L L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   rbKCC1
             Q   A   L   L   I   V   L   I   C   C   C   C   T   L L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   msKCC1
             Q   A   L   L   I   V   L   I   C   C   C   C   T   L L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   huKCC1
             E   S   F   C   M   V   F   I   C   C   S   C   T   M L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   rtKCC2
             Q   A   F   A   I   V   L   I   C   C   C   C   T   M L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   huKCC3A
             Q   A   F   A   I   V   L   I   C   C   C   C   T   M L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   huKCC3B
             E   S   F   L   I   V   A   M   C   C   T   C   T   M L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   msKCC3
             E   S   F   L   I   V   A   M   C   C   T   C   T   M L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   huKCC4
             E   S   F   L   I   V   A   M   C   C   T   C   T   M L   T   A   I S   M S   A   I    A   T   N   G    V   V   P   A   G    :   msKCC4
             L   G   I   I   V   I   G   L   S   V   V   V   T   T L   T   G   I S   M S   A   I    C   T   N   G    V   V   R   G   G    :   rbNKCC2F
             L   G   V   V   I   I   L   L   S   T   M   V   T   S I   T   G   L S   T S   A   I    A   T   N   G    F   V   R   G   G    :   rbNKCC2A
             1       3       5               9                    15           18    20                                              32
   K -CCC, K -dependent cation-Cl cotransporters. Boxes highlight residues that are identical among 9 KCCs (top alignments) or between
2 NKCCs (bottom alignments). Residues in bold are associated with lower affinities for cations. Position 1 is attributed to the first residue
of the second transmembrane helix and position 18 to the last residue of the helix.

                                                     AJP-Renal Physiol • VOL           285 • JULY 2003 •            www.ajprenal.org
F76                            CATION-CL COTRANSPORTERS AND NH4 TRANSPORT


NH4 /NH3 in systemic blood (and in the cerebrospinal            motes NH4 efflux below a certain pHi). In certain cell
fluid) at very low levels.                                       types, those of the TAL for instance, pHi-mediated
   Based on kinetic measurements reported in this               regulation of K -CCCs may be important in prevent-
work (and in other studies; see Refs. 13, 23, 50, 51),          ing excessive cellular acidification resulting from the
KCC- and NKCC1-mediated NH4 transport in various                transepithelial movement of NH4 .
renal cells is probably inward (as in hepatocytes) be-             Because several K -CCCs exhibit similar NH4 and
cause [NH4 ] is increased throughout the interstitium           Rb affinities [as shown in Fig. 3, estimated Km(NH4 )
(23, 51), reaching 15 mM in certain regions (46). This          and Km(Rb ) for rbNKCC2A are 1.7 and 3.7 mM], we
concentration is close to, or even above, the estimated         can predict Km(NH4 ) values for other K -CCCs not
Km(NH4 ) values for various K -CCCs (Fig. 3), indicat-          included in the present analysis (rbNKCC2F and B)
ing, in addition, that intracellular accumulation of            but for which Km(Rb ) values are already known (15,
NH4 across basolaterally disposed renal K -CCCs may             21, 43). Based on previous measurements, hence,
be physiologically important. For example, NH4 up-              Km(NH4 ) values for these “F” and “B” variants should
take in -intercalated cells, which were recently shown          be 8 and 3 mM, respectively; recent studies by us
to express NKCC1 and KCC4 (3, 22), would contribute             have shown that this was actually the case (results not
to distal acidification by promoting secondary NH3               shown). Because the NKCC2s are distributed differen-
secretion. On the other hand, KCC-mediated NH4 up-              tially along the TAL (28, 41), i.e., F is in the inner
take in the thick ascending limb of Henle’s loop (TAL),         medulla, A in the outer medulla, and B in the cortex,
a nephron segment that expresses several KCCs (39),             the affinity of these carriers for NH4 should increase
would serve an undetermined role as it would in fact




                                                                                                                                     Downloaded from ajprenal.physiology.org on February 2, 2011
                                                                progressively along the TAL, leading to optimized
limit net NH4 reabsorption (at least when pHi is 7.0            transport throughout the nephron segment. In the
and pHo 7.4; see below).                                        cortex, efficient NH4 transport may be important for
   The presence of NH4 pathways in the CD may                   NH3 recycling by the proximal tubule and NH3 secre-
seem difficult to reconcile with an observation by               tion along the proximal CD.
Flessner et al. (14) that transcellular movement of                The Km(Rb ) values reported here for KCC1, KCC3,
NH4 across this nephron segment is low and with                 and KCC4 were found to be relatively similar to one
the fact that NH4 formed in the lumen (from buffer-             another (12, 17, and 12 mM, respectively) and similar
ing of secreted H by NH3) must not be reabsorbed                to those reported for low-affinity NKCC2 splice vari-
for net H excretion to occur. However, the observa-             ants (15, 21, 43). These results are interesting with
tion above does not rule out the possibility that only          respect to structure-function relationships. Indeed, we
the apical membrane of the CD has low NH4 perme-                have shown that NKCC2 splice variants with the se-
ability; in such a case, appreciable back-leak from             quence I, L, T at positions 13, 16, and 18 of the second
the lumen would still be prevented. The possibility             transmembrane -helix (I13, L16, and T18) had higher
entertained herein needs to be confirmed through                 cation affinities than splice variants with the sequence
additional microperfusion studies, as data obtained             L13, I16, M18 (see Ref. 14, Fig. 3, Table 3). For all of the
in heterologous systems may not compare with those              KCCs, remarkably, the sequence is also L13, I16, M18,
obtained in more complex systems.                               similar to that of the low-affinity NKCC2 splice vari-
   Previous studies have demonstrated that the func-            ants. Thus, for both the NKCCs and KCCs, residues
tion of NKCC1, NKCC2, and KCC1 decreases when                   at positions 13, 16, and 18 of the second transmem-
pHo is 7.0 (Isenring and Forbush, unpublished obser-            brane domain may play an important role in ion
vations; see also Refs. 26 and 34). The results pre-            transport by modulating ion affinity within the
sented in this study show that this effect probably             translocation pocket.
results to a large extent from secondary changes in pHi            In conclusion, we have shown that the KCCs, similar
and that all KCCs are affected by such changes. Inter-          to the NKCCs, are able to transport NH4 probably at
estingly, KCC4 was shown to be more active at low pHi,          the K site and that they are sensitive to changes in
whereas all other K -CCCs were less active. This find-           pHi. In certain cell types, the dependence of KCC
ing suggests that certain isoforms may be specialized           activity on pHi may be important for regulation of
to operate in acidic environments, e.g., in -interca-           K -CCC-mediated NH4 transport. In other cell types,
lated cells.                                                    e.g., the CD, KCC-mediated NH4 transport may play
   The interdependence observed between pH and                  an important role in distal renal acidification.
transport, for example, our finding that K -CCCs are
pH sensitive (Fig. 4) and that they can also affect pHi            The authors thank Luc Caron and Valerie Montminy for technical
                                                                assistance.
by regulating NH4 transport (Fig. 2), points to the                This work was supported by grants from the Kidney Foundation of
possibility that these transporters are involved in             Canada and the Canadian Institute of Health and Research (MT-
regulation of intracellular [H ]; in this regard,               15405). P. Isenring is a Canadian Institutes of Health Research
changes in pHi could correspond to an important                 Clinician Scientist II.
signaling intermediately involved in the autoregula-
tion of K -CCC-mediated NH4 transport. Here, re-                REFERENCES
markably, we have shown that low pHi led to the                  1. Amlal H, Paillard M, and Bichara M. Cl -dependent NH4
inhibition of NKCC2 (a carrier that promotes NH4                    transport mechanisms in medullary thick ascending limb cells.
influx) and activation of KCC4 (a carrier that pro-                  Am J Physiol Cell Physiol 267: C1607–C1615, 1994.

                                AJP-Renal Physiol • VOL   285 • JULY 2003 •   www.ajprenal.org
                                      CATION-CL COTRANSPORTERS AND NH4 TRANSPORT                                                         F77

 2. Attmane-Elakeb A, Amlal H, and Bichara M. Ammonium                       tory isoform of Na -K -Cl cotransporter in rat renal interca-
    carriers in medullary thick ascending limb. Am J Physiol Renal           lated cells. J Am Soc Nephrol 7: 2533–2542, 1996.
    Physiol 280: F1–F9, 2001.                                          23.   Glanville M, Kingscote S, Thwaites DT, and Simmons NL.
 3. Boettger T, Hubner CA, Maier H, Rust MB, Beck FX, and                    Expression and role of sodium, potassium, chloride cotransport
    Jentsch TJ. Deafness and renal tubular acidosis in mice lacking          (NKCC1) in mouse inner medullary collecting duct (mIMCD-K2)
    the K -Cl cotransporter KCC4. Nature 416: 874–878, 2002.                                     ¨
                                                                             epithelial cells. Pflugers Arch 443: 123–131, 2001.
 4. Burckhardt BC and Burckhardt G. NH4 conductance in                 24.   Good DW. Ammonium transport by the thick ascending limb of
                                                    ¨
    Xenopus laevis oocytes. Basic observations. Pflugers Arch 434:            Henle’s loop. Annu Rev Physiol 56: 623–647, 1994.
    306–312, 1997.                                                     25.   Haas M and Forbush B. The Na-Cl cotransporters. J Bioen-
 5. Burckhardt BC and Fromter E. Pathways of NH3/NH4 per-                    erg Biomembr 30: 161–172, 1998.
    meation across Xenopus laevis oocyte cell membrane. Pflugers¨       26.   Hegde RS and Palfrey HC. Ionic effects on bumetanide bind-
    Arch 420: 83–86, 1992.                                                   ing to the activated Na -K -2Cl cotransporter: selectivity and
                                         ¨
 6. Burckhardt BC, Kroll B, and Fromter E. Proton transport                  kinetic properties of ion binding sites. J Membr Biol 126: 27–37,
    mechanism in the cell membrane of Xenopus laevis oocytes.                1992.
       ¨
    Pflugers Arch 420: 78–82, 1992.                                     27.   Hiki K, D’Andrea RJ, Furze J, Crawford J, Woollatt E,
 7. Caron L, Rousseau F, Gagnon E, and Isenring P. Cloning                   Sutherland GR, Vadas MA, and Gamble JR. Cloning, char-
    and functional characterization of a cation-Cl cotransporter-            acterization, and chromosomal location of a novel human K -Cl
    interacting protein. J Biol Chem 275: 32027–32036, 2000.                 cotransporter. J Biol Chem 274: 10661–10667, 1999.
 8. Chalfant ML, Denton JS, Berdiev BK, Ismailov II, Benos             28.   Igarashi P, Vanden Heuvel GB, Payne JA, and Forbush B.
    DJ, and Stanton BA. Intracellular H regulates the -subunit of            Cloning, embryonic expression, and alternative splicing of a
    ENaC, the epithelial Na channel. Am J Physiol Cell Physiol               murine kidney-specific Na -K -Cl cotransporter. Am J Physiol
    276: C477–C486, 1999.                                                    Renal Fluid Electrolyte Physiol 269: F405–F418, 1995.
 9. Choe H, Zhou H, Palmer LG, and Sackin H. A conserved               29.   Isenring P and Forbush B. Ion and bumetanide binding by the




                                                                                                                                                 Downloaded from ajprenal.physiology.org on February 2, 2011
    cytoplasmic region of ROMK modulates pH sensitivity, conduc-             Na -K -Cl cotransporter. Importance of transmembrane do-
    tance, and gating. Am J Physiol Renal Physiol 273: F516–F529,            mains. J Biol Chem 272: 24556–24562, 1997.
    1997.                                                              30.   Kikeri D, Sun A, Zeidel ML, and Hebert SC. Cell membranes
10. Cougnon M, Benammou S, Brouillard F, Hulin P, and                        impermeable to NH3. Nature 339: 478–480, 1989.
    Planelles G. Effect of reactive oxygen species on NH4 perme-       31.   Kinne R, Kinne-Saffran E, Schutz H, and Scholermann B.
    ation in Xenopus laevis oocytes. Am J Physiol Cell Physiol 282:          Ammonium transport in medullary thick ascending limb of rab-
    C1445–C1453, 2002.                                                       bit kidney: involvement of the Na -K -Cl cotransporter. J
11. Cougnon M, Bouyer P, Hulin P, Anagnostopoulos T, and                     Membr Biol 94: 279–284, 1986.
    Planelles G. Further investigation of ionic diffusive properties   32.   Knepper MA, Packer R, and Good DW. Ammonium trans-
    and of NH4 pathways in Xenopus laevis oocyte cell membrane.              port in the kidney. Physiol Rev 69: 179–249, 1989.
       ¨
    Pflugers Arch 431: 658–667, 1996.                                   33.   Laamarti MA and Lapointe JY. Determination of NH4 /NH3
12. DuBose TD Jr, Good DW, Hamm LL, and Wall SM. Ammo-                       fluxes across apical membrane of macula densa cells: a quanti-
    nium transport in the kidney: new physiological concepts and             tative analysis. Am J Physiol Renal Physiol 273: F817–F824,
    their clinical implications. J Am Soc Nephrol 1: 1193–1203,              1997.
    1991.                                                              34.   Lauf PK and Adragna NC. K -Cl cotransport: properties and
13. Evans RL and Turner RJ. Evidence for a physiological role of             molecular mechanism. Cell Physiol Biochem 10: 341–354, 2000.
    NH4 transport on the secretory Na -K -2Cl cotransporter.           35.   Lauf PK, Bauer J, Adragna NC, Fujise H, Zade-Oppen AM,
    Biochem Biophys Res Commun 245: 301–306, 1998.                           Ryu KH, and Delpire E. Erythrocyte K -Cl cotransport:
14. Flessner MF, Wall SM, and Knepper MA. Permeabilities of                  properties and regulation. Am J Physiol Cell Physiol 263: C917–
    rat collecting duct segments to NH3 and NH4 . Am J Physiol               C932, 1992.
    Renal Fluid Electrolyte Physiol 260: F264–F272, 1991.              36.   Lytle C, Xu JC, Biemesderfer D, and Forbush B. Distribu-
15. Gagnon E, Forbush B, Caron L, and Isenring P. Functional                 tion and diversity of Na -K -Cl cotransport proteins: a study
    comparison of renal Na-K-Cl cotransporters between distant               with monoclonal antibodies. Am J Physiol Cell Physiol 269:
    species. Am J Physiol Cell Physiol 284: C365–C370, 2003.                 C1496–C1505, 1995.
16. Gagnon E, Forbush B, Flemmer A, Gimenez I, Caron L,                37.   Mercado A, Song L, Vazquez N, Mount DB, and Gamba G.
    and Isenring P. Functional and molecular characterization of             Functional comparison of the K -Cl cotransporters KCC1 and
    the shark renal Na-K-Cl cotransporter: novel aspects. Am J               KCC4. J Biol Chem 275: 30326–30334, 2000.
    Physiol Renal Physiol 283: F1046–F1055, 2002.                      38.   Mount DB, Mercado A, Song L, Xu J, George AL Jr,
17. Gagnon E and Isenring P. Implication of KCC in ammonium                  Delpire E, and Gamba G. Cloning and characterization of
    recycling (Abstract). J Am Soc Nephrol 12: 30A, 2001.                    KCC3 and KCC4, new members of the cation-chloride cotrans-
18. Gamba G, Miyanoshita A, Lombardi M, Lytton J, Lee WS,                    porter gene family. J Biol Chem 274: 16355–16362, 1999.
    Hediger MA, and Hebert SC. Molecular cloning, primary              39.   Mount DB, Song L, Mercado A, Gamba G, and Delpire E.
    structure, and characterization of two members of the mamma-             Basolateral localization of renal tubular K -Cl cotransporters
    lian electroneutral sodium-(potassium)-chloride cotransporter            (Abstract). J Am Soc Nephrol 11: 35A, 2000.
    family expressed in kidney. J Biol Chem 269: 17713–17722,          40.   Nagaraja TN and Brookes N. Intracellular acidification in-
    1994.                                                                    duced by passive and active transport of ammonium ions in
19. Garvin JL, Burg MB, and Knepper MA. Active NH4 absorp-                   astrocytes. Am J Physiol Cell Physiol 274: C883–C891, 1998.
    tion by the thick ascending limb. Am J Physiol Renal Fluid         41.   Payne JA and Forbush B. Alternatively spliced isoforms of the
    Electrolyte Physiol 255: F57–F65, 1988.                                  putative renal Na -K -Cl cotransporter are differentially dis-
20. Gillen CM, Brill S, Payne JA, and Forbush B. Molecular                   tributed within the rabbit kidney. Proc Natl Acad Sci USA 91:
    cloning and functional expression of the K -Cl cotransporter             4544–4548, 1994.
    from rabbit, rat, and human. A new member of the cation-           42.   Payne JA, Stevenson TJ, and Donaldson LF. Molecular
    chloride cotransporter family. J Biol Chem 271: 16237–16244,             characterization of a putative K -Cl cotransporter in rat brain.
    1996.                                                                    A neuronal-specific isoform. J Biol Chem 271: 16245–16252,
21. Gimenez I, Isenring P, and Forbush B. Spatially distributed              1996.
    alternative splice variants of the renal Na -K -Cl cotrans-        43.   Plata C, Meade P, Vazquez N, Hebert SC, and Gamba G.
    porter exhibit dramatically different affinities for the trans-           Functional properties of the apical Na -K -2Cl cotransporter
    ported ions. J Biol Chem 277: 8767–8770, 2002.                           isoforms. J Biol Chem 277: 11004–11012, 2002.
22. Ginns SM, Knepper MA, Ecelbarger CA, Terris J, He X,               44.   Prosser CL. Comparative Animal Physiology. Philadelphia, PA:
    Coleman RA, and Wade JB. Immunolocalization of the secre-                Saunders, 1973.

                                       AJP-Renal Physiol • VOL   285 • JULY 2003 •   www.ajprenal.org
F78                                  CATION-CL COTRANSPORTERS AND NH4 TRANSPORT

45. Race JE, Makhlouf FN, Logue PJ, Wilson FH, Dunham PB,             50. Wall SM and Fischer MP. Contribution of the Na -K -2Cl
    and Holtzman EJ. Molecular cloning and functional character-          cotransporter (NKCC1) to transepithelial transport of H , NH4 ,
    ization of KCC3, a new K -Cl cotransporter. Am J Physiol Cell         K , and Na in rat outer medullary collecting duct. J Am Soc
    Physiol 277: C1210–C1219, 1999.                                       Nephrol 13: 827–835, 2002.
46. Robinson RR and Owen EE. Intrarenal distribution of ammo-         51. Wall SM, Trinh HN, and Woodward KE. Heterogeneity of
    nium during diuresis and antidiuresis. Am J Physiol 208: 1129–        NH4 transport in mouse inner medullary collecting duct cells.
    1134, 1965.                                                           Am J Physiol Renal Fluid Electrolyte Physiol 269: F536–F544,
47. Sasaki S, Ishibashi K, Nagai T, and Marumo F. Regulation              1995.
                                                                      52. Wright PA, Packer RK, Garcia-Perez A, and Knepper MA.
    mechanisms of intracellular pH of Xenopus laevis oocyte. Bio-
                                                                          Time course of renal glutamate dehydrogenase induction during
    chim Biophys Acta 1137: 45–51, 1992.
                                                                          NH4Cl loading in rats. Am J Physiol Renal Fluid Electrolyte
48. Tsai TD, Shuck ME, Thompson DP, Bienkowski MJ, and                    Physiol 262: F999–F1006, 1992.
    Lee KS. Intracellular H inhibits a cloned rat kidney outer        53. Xu JC, Lytle C, Zhu TT, Payne JA, Benz E Jr, and Forbush
    medulla K channel expressed in Xenopus oocytes. Am J Physiol          B. Molecular cloning and functional expression of the bumet-
    Cell Physiol 268: C1173–C1178, 1995.                                  anide-sensitive Na -K -Cl cotransporter. Proc Natl Acad Sci
49. Tuchman M, Lichtenstein GR, Rajagopal BS, McCann MT,                  USA 91: 2201–2205, 1994.
    Furth EE, Bavaria J, Kaplan PB, Gibson JB, and Berry              54. Yip KP and Kurtz I. NH3 permeability of principal cells and
    GT. Hepatic glutamine synthetase deficiency in fatal hyperam-          intercalated cells measured by confocal fluorescence imaging.
    monemia after lung transplantation. Ann Intern Med 127: 446–          Am J Physiol Renal Fluid Electrolyte Physiol 269: F545–F550,
    449, 1997.                                                            1995.




                                                                                                                                            Downloaded from ajprenal.physiology.org on February 2, 2011




                                      AJP-Renal Physiol • VOL   285 • JULY 2003 •   www.ajprenal.org

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:11
posted:3/8/2011
language:English
pages:12
zhaonedx zhaonedx http://
About