Docstoc

Masters Final Thesis

Document Sample
Masters Final Thesis Powered By Docstoc
					    Single nucleotide polymorphism (SNP) -
      genotyping of Community Acquired
      Methicillin-Resistant Staphylococcus
    aureus, including the subtyping of PVL
     toxin producers using Real-Time PCR.

                      A Masters Thesis in Molecular Microbiology
                                          By


                           Mary-Ellen Clare Costello
                                 BAppSc (Microbiology)




Thesis submitted in partial fulfilment of the requirements for the degree for Masters of
Research (Life Science) of the Queensland University of Technology.

                                        May 2010
2
Abstract

Staphylococcus aureus is a common pathogen that causes a variety of infections including
soft tissue infections, impetigo, septicemia toxic shock and scalded skin syndrome.
Traditionally, Methicillin-Resistant Staphylococcus aureus (MRSA) was considered a
Hospital-Acquired (HA) infection. It is now recognised that the frequency of infections
with MRSA is increasing in the community, and that these infections are not originating
from hospital environments. A 2007 report by the Centers for Disease Control and
Prevention (CDC) stated that Staphylococcus aureus is the most important cause of
serious and fatal infections in the USA. Community-Acquired MRSA (CA-MRSA) are
genetically diverse and distinct, meaning they are able to be identified and tracked by way
of genotyping. Genotyping of MRSA using Single nucleotide polymorphisms (SNPs) is a
rapid and robust method for monitoring MRSA, specifically ST93 (Queensland Clone)
dissemination in the community. It has been shown that a large proportion of CA-MRSA
infections in Queensland and New South Wales are caused by ST93. The rationale for
this project was that SNP analysis of MLST genes is a rapid and cost-effective method for
genotyping and monitoring MRSA dissemination in the community. In this study, 16
different sequence types (ST) were identified with 41% of isolates identified as ST93
making it the predominate clone. Males and Females were infected equally with an
average patient age of 45yrs. Phenotypically, all of the ST93 had an identical
antimicrobial resistance pattern. They were resistant to the β-lactams – Penicillin,
Flu(di)cloxacillin and Cephalothin but sensitive to all other antibiotics tested. Virulence
factors play an important role in allowing S. aureus to cause disease by way of
colonising, replication and damage to the host. One virulence factor of particular interest
is the toxin Panton-Valentine leukocidin (PVL), which is composed of two separate
proteins encoded by two adjacent genes. PVL positive CA-MRSA are shown to cause
recurrent, chronic or severe skin and soft tissue infections. As a result, it is important that
PVL positive CA-MRSA is genotyped and tracked. Especially now that CA-MRSA
infections are more prevalent than HA-MRSA infections and are now deemed endemic in
Australia. 98% of all isolates in this study tested positive for the PVL toxin gene. This
study showed that PVL is present in many different community based ST, not just ST93,
which were all PVL positive. With this toxin becoming entrenched in CA-MRSA,
genotyping would provide more accurate data and a way of tracking the dissemination.


                                                                                            3
PVL gene can be sub-typed using an allele-specific Real-Time PCR (RT-PCR) followed
by High resolution meltanalysis. This allows the identification of PVL subtypes within
the CA-MRSA population and allow the tracking of these clones in the community.




                                                                                         4
Table of Contents
     Abstract……………………………………………………………………….3

     List of Tables………………………………………………………………….9

     List of Figures………………………………………………………………...10

     Abbreviations…………………………………………………………………11

     Declaration…………………………………………………………………...13

     Acknowledgements…………………………………………………………..15

  Chapter 1 Literature Review

     1.1 Introduction………………………………………………………………18

     1.2 Staphylococcus aureus……………………………………………………19

     1.3 Epidemiology……………………………………………………………..20

              1.3.1 Carriage…………………………………………………………20

              1.3.2 Transmission……………………………………………………21

              1.3.3 Risk Factors…………………………………………………….22

     1.4 Antibiotic Resistance in S. aureus.............................................................22

              1.4.1 Penicillin Resistance……………………………………………22

              1.4.2 Penicillin Binding Proteins……………………………………..23

              1.4.3 Plasmid Mediated Resistance…………………………………..24

              1.4.4 Methicillin Resistance………………………………………….24

              1.4.5 Vancomycin Resistance……………………………………….. 25

     1.5 The Staphylococcal Genome…………………………………………….26

     1.6 The Staphylococcal Accessory Genome…………………………………26

              1.6.1     The Staphylococcal Cassette Chromosome…………………..26

              1.6.2     The Staphylococcal Cassette Chromosome mec (SCCmec)…27

              1.6.3     The Cassette Chromosome Recombinase Complex (ccr)…….27


                                                                                                         5
            1.6.4   The Junkyard Regions…………………………………………..28

            1.6.5   Plasmids………………………………………………………....29

     1.7 The Arginine Catabolic Mobile Element (ACME)………………………...30

     1.8 Panton-Valentine leukocidin (PVL) gene…………………………………..31

            1.8.1 The H and R variants……………………………………………....32

            1.8.2 PVL and MRSA …………………………………………………...34

     1.9 Community-Acquired Methicillin-Resistant Staphylococcus aureus
            (CA-MRSA) in Australia……………………………………………….34

     1.10 Sequence Type 93 (ST93) The Queensland Clone…………………………36

     1.11 Molecular Techniques……………………………………………………....37

            1.11.1 Pulsed-field gel electrophoresis…………………………………...37

            1.11.2 Multilocus Sequence Typing……………………………………...38

            1.11.3 Spa Typing………………………………………………………..39

            1.11.4 SCCmec Typing………………………………………………….42

            1.11.5 High Resolution Melt Analysis………………………………......43

     1.12 single nucleotide polymorphisms (SNP)…………………………………..44

     1.13 Project Hypothesis and Specific Aims………………………………….….47

      1.14 Conclusion…………………………………………………………….…...48


Chapter 2 Materials and Methods

     2.1 Isolates……………………………………………………………………….50

     2.2 Phenotypic Identification…………………………………………………..50

     2.3 Bacterial Growth…………………………………………………………....50

     2.4 DNA Extraction……………………………………………………………..51

     2.5 Amplification and Analysis…………………………………………………..51

          2.5.1     Identification of isolates as S. aureus…………………………….51



                                                                          6
            2.5.2     Characterisation of isolates as MRSA…………………………...52

            2.5.3     Detection of PVL………………………………………………...52

            2.5.4     Single Nucleotide Polymorphism Primer Set (SNP)……………53

            2.5.5     PVL Sub-typing using SNP analysis…………………………….55


Chapter 3 Genotyping of Community-Acquired Methicillin-Resistant
          S. aureus, using Real-Time PCR.
      3.1 Introduction………………………………………………………………….58

      3.2 Aim………………………………………………………………………….60

      3.3 Methods……………………………………………………………………..60

      3.4 Results………………………………………………………………………60

              3.4.1   Phenotypic Results………………………………………………60

              3.4.2   SNP typing and PVL detection………………………………….61

              3.4.3   Prevalence of ST93 the Queensland Clone……………………...62

              3.4.4   Geographical and Age distribution ……………………………..63

      3.5     Other CA-MRSA detected………………………………………………66

      3.6 Isolates from Nursing Home Residents…………………………………….68

      3.7 Discussion…………………………………………………………………..68



Chapter 4 Sub-typing of the Panton-Valentine leukocidin (PVL) toxin gene.

      4.1 Introduction…………………………………………………………………72

      4.2 Aim………………………………………………………………………….74

      4.3 Materials ……………………………………………………………………74

      4.4 Results ……………………………………………………………………..74

              4.4.1   PVL Screening…………………………………………………..74

              4.4.2   PVL Sub-typing………………………………………………...74



                                                                         7
     4.5 Discussion……………………………………………………………….…..76


Chapter 5 General Conclusions and Future Directions…………………….80


     Appendix 1          Antibiotic Susceptibility Testing by the CDS Method –
     Staphylococcus aureus...........................................................................................83

     Appendix 2          Patient Antibiogram, SNP Profiles and PVL Screening………...89

     Literature Cited………………………………………………………………….91




                                                                                                                          8
List of Tables


Table 1: Sequence variation at the seven MLST loci…………………………………….39


Table 2: Clonal complexes identified from genotyping of S. aureus isolates…………...45


Table 3: Primer Sequences for characterisation of isolates……………………………....52


Table 4: Primer sequences used in screening PCR and SNPs…………………………...54


Table 5: Embodiment for S. aureus genotyping using SNPs: distribution of primers into
eight tubes…………………………………………………………….……….................54


Table 6: PVL Genotyping Primer Set……………………………………………………55


Table 7: ST93 Pattern of Resistance to Antimicrobials (%)…………………………......61


Table 8: Other CA-MRSA ST Detected…………………………………………………67




                                                                                   9
List of Figures

Figure 1: How the blaZ gene encodes for penicillin resistance………………………….23

Figure 2: The chemical structures of β-lactam antibiotics Penicillin and Methicillin…...25

Figure 3: The structure of three types of SCCmec……………………………………....28

Figure 4: SCCmec types I-IV……………………………………………………………29

Figure 5: Precise excision of the Arginine Catabolic Mobile Element (ACME)………..31

Figure 6: Model for how PVL might mediate tissue necrosis…………………………...32

Figure 7: lukSF-PV phylogenetic diagram………………………………………………33


Figure 8: Analysis of the X region with PCR……………………………………………41

Figure 9: Protein A gene map…………………………………………………………...41

Figure 10: MRSA Isolate cultured on HBA……………………………………………..51


Figure11: The lukSF-PV sequence variants found across 174 clinical isolates………….56

Figure 12: SNP arcC162 (S1U8)………………………………………………………...62

Figure 13: Map of Queensland courtesy of Google Maps……………………………….63


Figure 14: Map of Southeast Queensland (SEQ) courtesy of Google Maps ……………64


Figure 15: Map of NSW courtesy of Google Maps……………………………………...65


Figure 16: Map of the Sydney Region courtesy of World Guides………………………65


Figure 17: HRM analysis of multiple ST93 isolates for SNP 663 T/G showing clear
discrimination between melt curves…………………………………………………...…75




                                                                                             10
List of Abbreviations

ACME         Arginine Catabolic Mobile Element
Agr          Accessory genome regulator
arcA         Arginine catabolism gene cluster
arc          Carbamate kinase gene
AT           Ancestral type
bp           Base pair(s)
CA-MRSA      Community-Acquired Methicillin-resistant Staphylococcus aureus
CC           Clonal complex
CDC          Centers for Disease Control and Prevention
Ct           Cycle threshold
DNA          Deoxyribomucleic acid
DLV          Double locus variant
GC           Guanine-Cytosine
glp          Glycerol kinase gene
gmk          Guanylate kinase gene
HA-MRSA      Hospital-Acquired Methicillin-resistant Staphylococcus aureus
HBA          Horse Blood Agar
HRM          High resolution melt
ICU          Intensive Care Units
Kb           Kilobase(s)
KDa          Kilo Dalton(s)
Mb           Megabase(s)
ml           Millilitre(s)
MLST         Multi-locus sequence typing
mm           Millimetre(s)
mMRSA        Multi-resistant MRSA
MRSA         Methicillin-resistant Staphylococcus aureus
nmMRSA       Non multi-resistant MRSA
opp3         Oligopeptide permease
PBP          Penicillin binding protein
PBP2a        Penicillin binding protein 2a



                                                                              11
PCR       Polymerase chain reaction
PFGE      Pulsed-field gel electrophoresis
PMN       Polymorphonuclear neutrophils
pta       Phosphate acetyltransferase gene
RT-PCR    Real-time polymerase chain reaction
PVL       Panton-Valentine leukocidin
SCCmec    Staphylococcal Cassette Chromosome mec
SEQ       Southeast Queensland
SNP       Single nucleotide polymorphism
spa       Staphylococcal protein A
SSRs      Short Sequence Repeats
SSTI      Skin and soft tissue infections
ST        Sequence type
SLV       Single locus variant
SWP       Southwest Pacific Clone
tpi       Triosephosphate isomerise gene
TSST-1    Toxin shock syndrome toxin
VRSA      Vancomycin-resistant Staphylococcus aureus
WA-MRSA   Western Australian Methicillin-resistant Staphylococcus aureus
yqiL      Acetyl coenzyme A acetyltransferase gene
μl        Microlitre(s)




                                                                           12
Declaration




The work contained in this thesis has not been previously submitted to meet requirements
for an award at this or any other higher education institution. To the best of my
knowledge and belief, this thesis contains no material previously published or written by
another person except where due reference is made.




Mary-Ellen Clare Costello
BAppSc(Microbiology)




Signed:




Date:




                                                                                      13
14
Acknowledgements


The completion of this thesis would not have been possible without the support and
guidance of many people. First I would like thank to my supervisor Dr. Flavia Huygens
for her vision for this project and her ongoing support and guidance throughout my
Masters.


I am indebted to QML Pathology, especially Dr Renu Vohra, Peter O‟Loughlin and Ian
Cooper for allowing me to complete my Masters while working at QML and for the
resources and support provided. I must also thank Brooke Robinson who was a terrific
help with my MRSA, looking after my plates when I could not and sub-culturing when
needed. I am grateful for her frankness as well as her finding my spelling mistakes in my
thesis and pointing out when some sentences “just don‟t make sense”. I am tremendously
grateful, more than she knows.


I could not have survived without Jo Platell and her enduring patience and support, as
well as the cups of coffee and chats that kept me going. Her friendship and mentoring
throughout this process has been invaluable.


Finally, I am grateful to my friends and family who endured the good and the bad. I like
to thank Stephanie Huxley who listened to me vent at every stage, distracted me when
required, and reminded me about life outside research. I would especially like to thank
my Mum and Dad who have been through every up and every down and have earned this
Masters with me. Who also now know what PCR and HRM are, and who always listened
even when they didn‟t understand. Thanks for pretending you understand.




                                                                                         15
16
 Chapter One:


Literature review




                    17
   1.1     Introduction

Community-Acquired MRSA (CA-MRSA) are a genetically diverse and distinct group
(Huygens et al., 2006; O‟Hara et al., 2008), meaning they are able to be identified and
tracked by way of genotyping. PVL positive CA-MRSA, are shown to cause recurrent,
chronic or severe skin and soft tissue infections. Pneumonia caused by CA-MRSA is an
infection that is aggressive and difficult to treat, and with the acquisition of PVL
complicates the infection. PVL positive CA-MRSA associated pneumonia portends a
grim prognosis (Ebert et al., 20009; Kahl and Peters, 2007). As a result, it is important
that PVL positive CA-MRSA is genotyped and tracked especially now that CA-MRSA is
more prevalent than HA-MRSA. Diversity of PVL positive strains can be attributed to the
PVL genes being localised on phages (Kaneko and Kamio, 2004), as this facilitates the
spread of genes throughout the S. aureus population by way of clonal expansion and
horizontal gene transfer. PVL has been subtyped into the H variant and R variant, as
described by O‟Hara et al. (2008). The H variant can be broken down further in to
subgroups of H1, H2 and H3. The H1 and H2 variants are commonly found in South
Africa and India, and the H3 variant is most common in Europe. The R variant is strongly
associated with the presence of the mecA gene, which causes resistance to Methicillin as
well as all other β-lactam antibiotics; whereas the H variant is not commonly associated
with the presence of mecA (O‟Hara et al. 2008).

Single nucleotide polymorphisms (SNPs) used in combination with binary markers is a
new technique that can be used to genotype MRSA as described by Huygens et al.,
(2006). The SNPs are derived from Multilocus Sequence Typing (MLST) databases.
Using Real-Time Polymerase Chain Reaction (RT-PCR) it is possible to genotype CA-
MRSA using SNPs, enabling the specific identification of MRSA clones. This has already
been demonstrated by Huygens et al. (2006) when the SNP based method was used for
the identification of S. aureus, more specifically ST93 (Queensland clone). It has been
shown that a large proportion of CA-MRSA infections in Australia are caused by ST93
(Nimmo and Coombs, 2008). ST93 is highly virulent, and is of particular importance in
terms of Public Health. Genotyping has shown that ST93 is a singleton not related to any
other ST in the MLST database. According to the MLST system, a distinct allele is
assigned to each of the seven housekeeping genes analysed which defines the sequence
types; therefore, a singleton is an ST that does not share homology to any other sequence


                                                                                            18
types, such as ST1 (WA-MRSA) and ST30 (Southwest Pacific Clone) (O‟Hara et al.
2008).

By using SNPs derived from ST93, it will be possible to screen for the singleton, its
prevalence in the community, and determine whether it carries the PVL gene. If the CA-
MRSA does carry the PVL gene, it can then be sub-typed using allele-specific Real-Time
PCR (RT-PCR). This will allow for the identification of CA-MRSA and tracking of
clones in the community. The rationale for this project is that SNP analysis of CA-MRSA
and the PVL toxin is a rapid and robust genotyping method for monitoring its
dissemination in the community. This method is non-gel based, non-sequence based,
using a single, closed tube test on a generic instrument. The high resolving power of this
method is possibly equal to or better than current “gold standard” genotyping methods.
Furthermore, this genotyping method is consistent with the population structure of CA-
MRSA.


1.2      Staphylococcus aureus

The organism S. aureus is a Gram-positive, catalase-positive coccus. They are 0.5 to
1.5µm in diameter that occur in irregular “grape-like” clusters (Stapleton and Taylor,
2002). They are non-spore forming and non-motile. They do not form gas from
carbohydrates and are facultative anaerobes. The S. aureus genome has a guanine-plus-
cytosine (G+C) content of about 32%, and is composed of a single chromosome of
around 2.8Mb which is thought to carry about 2,500 genes. S. aureus is normal flora on
skin and mucosal surfaces including the anterior nasal nares and nasopharynx (Kluytmans
et al. 1997). Colonisation with S. aureus is common, infections are caused by the
colonising strain gaining entrance to a normally sterile site due to trauma or an abrasion
to the skin or mucosal surface. Over time S. aureus has also acquired and developed
many virulence factors. These factors are responsible for the production and secretion of
toxins and enzymes such as alpha, beta, gamma and delta toxins that act on host cell
membranes and mediate cell destruction. Some species have also been found to carry the
PVL toxin that mediates destruction of phagocytes. Potent exotoxins secreted by the
organism include exfoliatins and toxic shock syndrome toxin, as well as enterotoxins and
the production of biofilm (Kluytmans et al., 1997).




                                                                                         19
S. aureus is a clinically significant classical pathogen that causes a range of community
acquired diseases and is also a leading nosocomial pathogen. The diseases that are caused
by S. aureus can be divided into several categories:

        Toxin-mediated diseases – food poisoning, scalded skin syndrome, toxic shock
         syndrome (TSS)
        Infection of the skin and soft tissue – furuncles, boils, cellulitis and impetigo
        Infection of deep sites – bone, joins, heart valves, spleen and liver
        Infection of the lungs and urinary tract – pneumonia, urinary infection due to
         catheterisation.

Toxin-mediated infections including scalded skin syndrome and toxic shock can remain
relatively localised, but the toxin produced causes systemic or widespread effects. In the
case of scaled skin syndrome, the exfoliatin toxins cause the extensive sloughing of
epidermis that produces the burn-like effect on the patient. Toxic shock syndrome toxin
(TSST-1) causes several systemic effects that include fever and hypotension that can
potentially lead to shock and death (Kluytmans et al. 1997).

Despite the origin of the infection, like a simple skin infection, the invasive nature of S.
aureus presents a threat for deeper and life threatening complications. One of the most
important complications of an S .aureus infection is bacteraemia (Chamers 2005). This is
the dissemination of the organism to one of more distant sites within the body. This may
be due to an initial wound infection, surgical infection, ventilator-associated pneumonia,
as well as infection associated with intravenous devices or catheters (Kluytmans et al.
1997).


1.3      Epidemiology

1.3.1    Carriage

To understand S. aureus and how it causes infection, it is important to understand the
bacteriums mode of transmission, colonisation and its preferred environment. S. aureus is
considered skin normal flora but also a classical pathogen that has the ability to cause
infection in both compromised and immunocompetent hosts. Staphylococcus spp. are
classically skin inhabitors and can be cultured from many sites throughout the body. It is


                                                                                               20
the nasal nares or vestibulum nasi that are the primary reservoir (Williams, 1963). The
anterior nares are fully lined with keratinised epidermis with hairs and sebaceous glands
as well as sweat glands. The vestibule is limited above and behind by a ridge, the lumen
nasi, over which the skin becomes continuous with the nasal mucous membrane
(Kluytmans et al. 1997). It is in this environment that S. aureus flourishes, in the
supposed absence of human defenses. To establish themselves in this environment the
bacteria needs to form interactions with human cell surfaces to prevent their elimination.
In order to successfully colonise, the staphylococcal cells must interact with
complementary components on the host cell membrane (Kluytmans et al. 1997).


Carriage rates of S. aureus in humans are generally divided into three states: persistent
carriage, intermittent carriage and non-carriage (Williams 1963). Nasal carriage is linked
to increased clinical infection, but there is a lack of data of rates of S. aureus carriage in
the adult population. A study by Munckhof et al. (2008) showed that the nasal carriage
rates of CA-MRSA and CA-MSSA, in a community based study in Brisbane, was 28%.
In contrast, general rates of carriage of CA-MRSA have been document as low as 0.7% as
was described by Munckhof et al. (2008) even though it is a significant cause of
morbidity and mortality.


1.3.2 Transmission


Since S. aureus is skin normal flora and is found almost all over the human body,
infection can occur when the colonising strain enters a normally sterile site as a result of
trauma to the skin or mucosal surface. Sometimes this trauma may be so small it is not
noticed. Staphylococci can also be transmitted from person to person as well as through
fomites and unwashed hands (McLaws et al. 2009). As the organism is transmitted, it
may become established as the recipients normal flora and later be introduced to a sterile
site. Person to person spread of staphylococci infections in hospitals as well as in the
community presents challenges. Community based infections are increasing and it is the
transmission of these organisms that have acquired antibiotic resistance that are of most
concern (Munckhof et al. 2008).




                                                                                            21
1.3.3 Risk Factors


An opportunistic bacterial infection occurs when there is a breakdown in the body‟s
defenses. The likelihood of infection increases when there are increased risks of tears,
cuts and/or grazes in the skin, or if the host is immunocompromised. It is when these
factors are combined with nasal carriage or hospitalisation that the chance of infection
with S. aureus greatly increases (Kluytmans et al. 1997). The risk of infection or
colonisation is even greater for those patients in high risk environments such as nursing
homes and hospitals, in particular intensive care units. A study by McLaws et al. (2009)
in hospitals in New South Wales, including Intensive Care Units (ICU), set out to
investigate the impact of hand washing on infection rates. The study showed that
increased hand washing compliance may reduce the likelihood of infection.


Any invasive procedure that causes damage to the skin or mucosal surface, such as
indwelling catheters, is opening the doorway for infections. These include surgery,
haemodialysis, men who have sex with men, and those in close contact sports such as
footballers as well as those who live in close proximity to each other such as prisoners
(Kluytmans et al. 1997). CA-MRSA outbreaks amongst footballers, especially
professional, are of great concern in the USA. The infections are transmitting easily
between team members and outbreaks are increasing. Surveillance, nasal cultures as well
as decolonisation are all strategies being implemented to try and curb infection rates
(Garza et al. 2009). An outcome of this study was the finding that the measures
implemented to attempt to control infections failed in the community setting.


1.4    Antibiotic Resistance in S. aureus

1.4.1 Penicillin Resistance

S. aureus has been evolving and developing resistance to antibiotics since penicillin was
first introduced for medical use in 1940. Before this time, infections caused by S. aureus
were only treated with basic wound care and patients that developed bacteraemia due to
S. aureus, were more likely to die of their infection. Penicillin works by inhibiting the
penicillin binding protein (PBP) within the cell wall, thus preventing the PBP from cross



                                                                                             22
linking the peptidoglycan, leading to a weakened cell wall. Inhibiting the PBP means the
bacteria then dies from osmosis (Fleming 1929). The discovery of Penicillin and its
ability to cure disease was widely touted as the magic cure for infection. However,
Penicillin was not the magic bullet that medicine hoped it would be. Soon after its
implementation as a routine antibiotic, Penicillin resistance emerged in the hospitals and
later on in the community (Rammelkamp and Maxon, 1942). Penicillin resistance is due
to the blaZ, gene (Figure 1) which encodes β-lactamase. It is an extracellular enzyme that
is synthesized when staphylococci are exposed to β-lactam antibiotics, such as
Amoxicillin. The blaZ, gene hydrolyses the β-lactam ring, rendering the β-lactam
inactive. This inactivation renders Penicillin-based antibiotics such Cephalosporins and
Carbapenems ineffective (Lowry 2003).




Figure 1: Diagrammatical Illustration of the blaZ gene encoding for Penicillin resistance
(Boyle-Vavra and Daum, 2007)

1.4.2 Penicillin Binding Proteins

The cell of staphylococcus is surrounded by a mesh-like structure that is 20-40 nm thick
called peptidoglycan. The peptidoglycan is composed of a series of short glycan chains,
and these chains are targeted by antibiotics such as Penicillin and Methicillin in the β-
lactamase class. The cross-linking takes place on the external surface of the cytoplasmic



                                                                                            23
membrane in a reaction catalysed by PBP. S. aureus has four PBPs: PBP1, PBP2, PBP3
and PBP4. The PBPs have two protein domains: one is involved in the cross-linking
(transpeptidation) and the other is involved in extending of the glycan chain
(transglycosylation). The β-lactam antibiotics, which resemble the bond of the stem
peptide for cross-linking, inhibit the transpepetidation of the domain of the PBP‟s which
interfere with the cross-linking reaction, causing the cell wall to become weak and the
cells consequently ruptures due to osmosis (Stapleton and Taylor 2008; Geisbrech et al.
1998).

1.4.3 Plasmid Mediated Resistance

Plasmids are extra-chromosomal DNA molecules that are capable of replicating
independently of the chromosome. They are non-essential for cell survival, and are
capable of integrating into the host cell. The plasmids that are subsequently acquired by
CA-MRSA carry with them an increase in antibiotic resistance. Erythromycin resistance,
for example, was found to be accompanied by a 2kb plasmid. Further analysis
demonstrated that a 41kb large plasmid not only encoded for β-lactamase resistance, but
had also acquired Tetracycline, Mupirocin, Trimethoprim, and Cadmium resistance.
Resistance to Tetracycline is due to the integration of a pT181-type plasmid, and
Trimethoprim resistance is due to the acquisition of Tn4003 (O‟Brien et al. 2004).

1.4.4 Methicillin Resistance

The spread of β-lactam resistance amongst S. aureus prompted the introduction of the
semi-synthetic penicillinase-resistant Penicillin called Methicillin. Methicillin differs
from Penicillin due to the addition of a phenol group with a methoxy group (Figure 2).
Methicillin acts by inhibiting the PBP that are involved in peptidoglycan synthesis. This
is a similar mechanism to Penicillin, except for the extra methoxy group that also
produces an enzyme which reduces the affinity for staphylococcal β-lactamase (Stapleton
and Taylor 2008).

Shortly after its introduction for clinical use in the 1960‟s, resistance began to develop.
Methicillin resistance occurs due to the expression of a methicillin-hydrolysing β-
lactamase and the expression of the 76KDa PBP2a. PBP2a is a foreign PBP that is
resistant to the action of Methicillin, and can take over the transpeptidation reactions. The



                                                                                                24
PBP2a is encoded by a large stretch of foreign DNA (40-60Kb) termed mecA. S. aureus
acquired the mecA gene, which expresses PBP2, allegedly from Staphylococcus scurii
(Wu et al. 2001). The mecA gene is carried by a novel genetic element Staphylococcal
Cassette Chromosome (SCC), which facilitates β-lactamase resistance and may even have
served as the carrier of the mecA gene across the Staphylococcal spp. (Ito et al. 2001).




Figure 2: The chemical structures of β-lactam antibiotics Penicillin and Methicillin
(Stapleton and Taylor 2008)




1.4.5 Vancomycin Resistance

Vancomycin is a glycopeptide frequently used to combat MRSA, and as a result
resistance has followed. Vancomycin resistance was first described in enterococci in
1988, but the first clinical isolate of S. aureus found to be resistant to Vancomycin was
not reported until 2002. Resistance in Staphylococcus spp. has developed as a result of the
genetic exchange of antimicrobial resistance determinants between enterococci and
staphylococci. These genes are also frequently found on plasmids and transposons. In
2002, the first Vancomycin resistant Staphylococcus aureus (VRSA) was characterised,


                                                                                           25
with the DNA sequence analysed in Michigan, USA (Weigel et al. 2003). This analysis
revealed a composite plasmid that required two genetic events to occur. First, the transfer
of the enterococcal plasmid to a recipient strain of S. aureus, and second, a transposition
event that results in a composite plasmid, which is composed of the staphylococcal
plasmid and the enterococcal transposon (Weigel et al. 2007)


1.5      The Staphylococcal Genome

The S. aureus genome is composed of a complex mixture of genes. These genes seem to
have been acquired by lateral gene transfer (Kuroda et al. 2001). The genome displays an
overall conservation of both sequence and structure, although this consistency is disrupted
with small pockets of heterogeneity (Lindsay and Holden 2006). The conserved part of
the genome contains the genes that are responsible for everyday and common functions,
and are generally referred to as the “core” genome. The non essential sequences and
mobile genetic elements found within the genome are referred to as the “accessory
genome”. It is these differences and inclusions in the genome that account for the
variation both phenotypically and genotypically (Kuroda et al, 2001).


1.6      The Staphylococcal Accessory Genome

The accessory genome accounts for the majority of the genetic variation across the
species. It has been shown that the accessory genome is composed of exogenous mobile
genetic elements, whose horizontal transmission is fundamental to the evolution of S.
aureus. Elements described to date include bacteriophages, genomic islands,
pathogenicity islands, transposons, plasmids and insertion sequences (Kuroda et al.
2001).

1.6.1    The Staphylococcal Cassette Chromosome

The SCC is a DNA mobile genetic element on the MRSA chromosome. There are five
distinct known members of the SCC family (Figure 4). They vary in length, structure and
content however each SCC shares an exact genomic insertion site and associated inverted
and direct repeats which allow for the SCC to serve as a carrier for the mecA gene (Ito et
al. 2001). Types I-III are associated with HA-MRSA for example ST250-MRSA-I which
is the original MRSA that was reported in Australia in the 1960‟s, and ST239-MRSA-III


                                                                                              26
which is a hospital associated MRSA that was prevalent on the East Coast of Australia in
the early 1990‟s (Nimmo and Coombs 2008). SCC types IV and V are frequently
associated with CA-MRSA and type IV particularly with the carriage of the PVL gene
(Monecke et al. 2006).

1.6.2   The Staphylococcal Cassette Chromosome mec (SCCmec)

β-lactam resistance in MRSA is determined by PBP2a. This resistance is encoded by the
Methicillin resistance gene mecA. The mecA gene is carried by a mobile genetic element
designated SCC (Figure 3) which is inserted into the chromosome. The location of the
mecA gene was first suggested in the 1970‟s and was indicated early on, that it may be
located on the chromosome (Sjostrom et al. 1975). The mec gene complex is composed of
IS431mec, mecA as well as the intact or truncated sets of regulatory genes mecR1 and
mecI.

The diversity of CA-MRSA clones does not extend to the SCCmec allotypes that they
carry. It has been shown that the clones that have been identified to date are remarkably
uniform. This suggests that SCCmec IV and V are well suited, and have adapted well to
the community environment (Nimmo and Coombs 2008). The carriage of SCCmec IV in
community acquired infections is reportedly due to the lack of antibiotic pressure outside
of the hospital environment as well as the lack of resistance plasmids or transposons
downstream of mecA (Figure 4). It is believed that the community strains acquired the
SCCmec IV from a Methicillin-susceptible S. aureus rather than an evolution of a
healthcare associated isolate that had been carried into the community (Huygens et al.
2004; Zang et al. 2005).

1.6.3 The Cassette Chromosome Recombinase Complex (ccr)

The ccr complex facilitates the site-specific excision as well as the integration of the
SCCmec into the conserved orfX located near the origin of replication (Ito et al. 1999).
The first three SCCmec elements were found to carry different ccr complex types that
featured allelic variants of two adjacent ccr genes designated ccrA1-3 and ccrB1-3 (Ito et
al. 2001). Originally two ccr genes were considered essential for mobility and integration
until a CA-MRSA SCCmec was found with only a single and functional ccr gene (Ito et
al. 2004). The ccr encodes proteins that share N-terminal domain homology with site-



                                                                                           27
specific recombinases from the invertase-recombinase family which are thought to
facilitate strand-exchange during recombination (Ito et al. 1999). Even though the exact
mechanism for SCCmec transmission has not been detailed, the ccr genes are crucial in
converting MSSA to MRSA through the movement and integration of SCC into the S.
aureus chromosome (Ito et al. 1999).

1.6.4 The Junkyard Regions

The remainder of the SCCmec gene complex is comprised of J regions, or junkyard
regions (J1, J2 and J3) that are located between and around the mec and ccr complexes.
The J regions contain various genes or pseudogenes that seem to house auxiliary genes
such as resistance to antimicrobials, resistant plasmids as well as transposons and
insertions sequences. One such transposon found to reside within the J region is the
transposon-mediated resistance genes for non β-lactam antibiotics. However, many other
genes found within this region appear to be non-essential or even useful. (Ito et al. 2001;
Zhang et al. 2005).




   Figure 3: The structure of three types of SCCmec (Ito et al. 2001).




                                                                                              28
   Figure 4: SCCmec types I-IV (Zhang et al. 2005)

1.6.5 Plasmids

Plasmids are another important mobile genetic element. They are extra-chromosomal
DNA molecules that are capable of replicating independently of the chromosome.
Plasmids are non-essential for cell survival and are capable of integrating into a host cell
and are frequently found to harbour antibiotic resistance for example Erythromycin
resistance was found to be accompanied by a 2Kb plasmid. The plasmids carried by S.
aureus can be classified into three classes based on their size and their ability to conjugate
(Paulsen 1997). The class I plasmids are the smallest in size typically <5Kb and include
pT181 and pUB110. pT181 encodes resistance to Tetracycline and is found integrated
within particular SCCmec variants and also in free form (Ito et al. 2001).

Class II plasmids are larger, up to 40Kb and are generally characterised by carrying
resistance to one or more antimicrobials such as β-lactams and Aminoglycosides (Lindsay
and Holden 2006). The Class III plasmids are the largest of the three classes up to 60Kb
and share many of the same features of the Class II plasmids. The difference between the
last two classes is the carriage of transfer genes that mediate conjugation (Kuroda et al.
2001).




                                                                                         29
1.7    The Arginine Catabolic Mobile Element (ACME)

The Arginine Catabolic Mobile Element (ACME) is a proposed virulence gene and strain
survival factor that is highly mobile and currently only found in ST8, colloquially known
as USA300. It has been suggested by Diep et al. (2008) that this gene was acquired
through the mechanism of horizontal gene transfer from Staphylococcus epidermidis. The
element has a structure similar to the SCC (Figure 5) but does not encode the ccr-like
recombinase and is found to have inserted itself into the orfX gene found adjacent to the
SCCmecIVa cassette (Ellington et al. 2008). Diep et al. (2008) showed that the ACME
can be mobilised both co-ordinately and independently of the SCCmec by the same
mechanism used for the mobilisation of SCCmec. The ACME encodes an extra copy of
the house keeping gene Arginine catabolism gene cluster (arcA), as well as an additional
gene cluster oligopeptide permease (opp3). Together the gene clusters encode for an
Arginine deiminase pathway and oligo peptide permease system respectively. The
ACME-encoded arcA gene is distinct from the housekeeping arcA and currently can be
detected by way of PCR. Recently, ACME has been reported by Monecke et al. (2009)
in 84% of the PVL positive Western Australia MRSA (WA-MRSA/USA300)
investigated in the study. Diep et al. (2006) suggests that ACME is involved with altering
the local pH of the skin so that it is easier for USA300 to persist on intact skin.
Consequently, this facilitates the spread by skin contact for this epidemic-prone clone.




                                                                                             30
   Figure 5: Precise excision of the ACME Precise excision of the ACME and/or
   staphylococcal chromosomal cassette mec (SCCmec) mediated by ccrA/B (Diep et al.
   2008).


1.8    Panton-Valentine leukocidin (PVL) gene

One of the factors responsible for the rapid spread and increased virulence of MRSA is
the PVLgene. Van deVelde, (1894) was the first to describe PVL, but it was not until
1932 that Sir Phillip Panton and Francis Valentine linked the PVL gene in S. aureus to
skin and soft tissue infections (Panton and Valentine, 1932). The PVL gene encodes a
cytotoxin that has many functions including causing concentration-dependent necrosis,
and apoptosis of human monocytes and macrophages (PMN). This gene also causes
activation of calcium channels as well as changes in gene transcription (O‟Hara et al.
2008). The spread of PVL positive strains carrying mecA is becoming more common, and
exhibiting resistance to almost all β-lactam antibiotics. This development has been
paralleled by the emergence of two new SCCmec type IV and typeV, which are smaller
than SCCmec I-III and seem to be associated only with community acquired infections
(Zang et al. 2005).




                                                                                         31
PVL is a virulence factor that is comprised of two distinct protein components (lukF-PV
and lukS-PV), which together form heptameric pores that disrupt leukocyte membranes,
leading to increased virulence particularly in CA-MRSA (Monecke et al. 2006) (Figure
6). This allows PVL positive strains to cause recurrent, chronic or particularly severe soft-
tissue and skin infections in immunocompetent individuals. PVL positive strains have
also been linked with rapidly fatal pneumonia (Schievert 2009).


The lukSF-PV genes are carried on a prophage, and it has been shown that the genes may
be transferred from one strain to another via a phage transduction. This means that the
PVL gene may be transmitted not only vertically but horizontally among clones (O‟Hara
et al., 2008). The lukSF-PV sequences are highly conserved at the nucleotide level, which
indicates they all share a recent common ancestor.




Figure 6: Model for how PVL might mediate tissue necrosis (Boyle-Vavra and Daum,
2007).

1.8.1 The H and R variants


PVL has been subtyped into the H variant and R variant as described by O'Hara et al.
(2008). What denotes an R variant or H variant is the mutation of an amino acid within
the 1726bp sequence, and the variation at positions 527, 663 and 1396 of the nucleotide


                                                                                            32
sequence. If a G is at position 527, then this results in an arginine (R) at aa 176 for the R
variant, and an A at 527 aa 176 results in a histidine (H) for the H variant. The H variant
is broken down further in to sub-types H1, H2, and H3. The H1 and H2 variants are
commonly found in South Africa and India, and the H3 variant is most common in
Europe. The R variant is strongly associated with the presence of mecA, whereas the H
variant is not commonly associated with the presence of mecA. This also indicates that
the relationship among the individual PVL alleles is fully resolved. The H variant has
been reported to be the ancestor of the R variant (O‟Hara et al. 2008).


The H variant has a broader geographic distribution and is spread amongst several clonal
complexes. It contains more genetic variation with 11 variant genotypes vs 2 variant
genotypes for the R variant. The H2 variant, which is commonly found in South Africa
and India, is the most likely ancestral allele that gave rise to the other H variants (O‟Hara
et al. 2008). Through the combination of clonal expansion and horizontal exchange, the
H2 variant spread and gave rise to the H3 and H1 variants. It is only a single-nucleotide
substitution that separates the H3 variant from the R variant.




Figure 7: lukSF-PV phylogenetic diagram (O‟Hara et al., 2008)




                                                                                          33
1.8.2 PVL and MRSA


The evolution of PVL, in relation to PVL positive MRSA, is a recent and sometimes
contentious one. Reconstruction of the history of the PVL genes has shown that there has
not been a substantial amount of variation, haplotypes or deletion events, meaning that all
PVL sequences are connected at a 99% confidence interval. H1 and H3 variants are found
in most PVL positive isolates around the world including ST 93-MRSA-IV in Australia,
with the R variant found in the USA 300 strain, which is the predominant CA-MRSA
strain in the USA (Nimmo and Coombs 2008; O‟Hara et al 2008). The exchange of
mobile genetic elements, especially those associated with virulence and resistance
determinants, is a significant driving force of the evolution of the accessory genome.


1.9    Community Acquired Methicillin-Resistant Staphylococcus
       aureus (CA-MRSA) in Australia

CA-MRSA is a global problem. It was first reported in Australia in 1968, and became a
notifiable disease in Western Australia (WA) in 1982. Australia was in a unique position
in that the first epidemic in WA was identified and documented much earlier than in most
countries (Nimmo and Coombs 2008). Originally due to a PVL negative clone, varieties
soon developed to include some PVL positive strains. All over the country, epidemics
occurred independently with distinct clones. The development of resistance to multiple
antibiotics including Methicillin is associated with virulence factors including PVL which
gives CA-MRSA the ability to cause severe infections in otherwise healthy individuals.
The phage-borne gene is composed of two separate proteins encoded by two adjacent
genes (Monecke et al. 2006). The molecules form heptameric pores that selectively
disrupt leukocyte membranes. They also cause concentration-dependent necrosis and
apoptosis of human PMNs and lysis of human monocytes and macrophages (O‟Hara et al.
2008).The PVL plasmid encodes determinants for β-lactamase production and Cadmium
resistance to Mupirocin, Tetracycline, Trimethoprim and Cadmium, and a smaller
plasmid that encodes erythromycin resistance (Coombs et al. 2004).

In WA, the epidemiology of MRSA has always been different to that of the rest of the
country. CA-MRSA was first observed in the 1990‟s. This non multi-resistant MRSA
(nmMRSA) was isolated initially from indigenous people in remote communities.


                                                                                              34
Colloquially known as „WA-MRSA‟ (ST1-MRSA-IV), this CA-MRSA has now been
identified throughout the State and now accounts for up to 10% of infections (Nimmo and
Coombs 2008).

In the Northern Territory (NT), nmMRSA causing infections outside the healthcare
setting appeared not long after initial observations in WA. Like WA, the NT has a large
proportion of indigenous Australians. Throughout the early 1990‟s infection rates grew
rapidly from 0 in 1991 to 3.7 per 1000 admissions in June of 1995 (Nimmo and Coombs
2008). Molecular investigation in 2001 of the epidemic in the NT between 1991-1995
showed that all isolates contained SCCmec type IV (Murray et al. 2004). Typing of the
NT CA-MRSA strains showed that a large proportion of infections were caused by ST1-
MRSA-IV (WA-MRSA), and ST75-MRSA-IV, which is a unique strain to the NT that
has been classified WA MRSA-8, as well as ST30-MRSA-IV the Southwest Pacific
Clone (SWP). Interestingly, ST93-MRSA-IV the Queensland clone only appeared in
2000, and had spread throughout QLD and NSW by 2003 (Nimmo and Coombs 2008;
Turnidge et al. 2009).

Eastern Australia first started reporting MRSA infections that were not associated with
healthcare settings in the mid 1990‟s. During this time a healthcare associated multi-
resistant MRSA, ST239-MRSA-III, was endemic (Collingnon et al. 1998). It was the
association between Polynesian ethnicity and the frequency of CA-MRSA infections that
drew attention in the late 1990‟s. This was first noted in Brisbane, Sydney, Canberra and
Melbourne. Across the Tasman, infection rates in the Polynesian population were also
being noted. Subsequent studies were done and it was found that Polynesian people were
being over-represented, but the strain in Australia and New Zealand could not be
distinguished using pulse field gel electropheresis (PFGE) and phage typing (Nimmo et
al. 2000). The clone responsible turned out to be ST30 and PVL positive. Infection in the
Caucasian population increased in the city of Ipswich in Southeast Queensland (SEQ) in
2000. Studies using PFGE showed a unique pulsotype, which later came to be known as
ST93-MRSA-IV the “Queensland Clone” (Munckhof et al. 2003). This PVL positive
clone soon became very important on the east coast as it is the predominant CA-MRSA
clone in Queensland and New South Wales and has spread throughout the rest of
Australia. ST93 is a particularly virulent clone causing necrotising pneumonia and deep
abscesses as well as osteomyelitis and bacteraemia.



                                                                                         35
1.10 Sequence Type 93 (ST93) The Queensland Clone

There are many different strains of CA-MRSA that cause infection all around the world.
Research has shown that one of the most prominent clones on the East Coast of Australia
is ST93 (Nimmo and Coombs 2008). This clone is highly virulent, and is of particular
importance in terms of Public Health. It was against the background of virulent, endemic
ST239-MRSA-III which was the major multi-resistant clone that community acquired
infections started becoming more common. Originally in the Polynesian community both
in Australia and New Zealand, the causative strain was identified as ST30. This ST had
acquired SCC mecA type IV and was PVL positive, making it particularly virulent. From
1998, the numbers of cases presenting with CA-MRSA infection seen in the Caucasian
population was increasing in Ipswich. The strain isolated had a unique PFGE pulsotype. It
was later shown that the causative sequence type was unique and ST93-MRSA-IV
(Nimmo and Coombs 2008). ST93 is PVL positive and particularly virulent, causing a
range of conditions including necrotising pneumonia, osteomyelitis and bacteraemia
(Peleg et al. 2005). ST93 is unique to Queensland and a singleton, meaning that it does
not share homology to any other sequence types that are known. ST93 has only recently
acquired SCCmec which was shown by Huygens et al. (2006). A collection of isolates
from SEQ were studied in 2004 using the single nucleotide polymorphisms (SNPs) and
five binary genes. This study showed that sixteen Methicillin-sensitive isolates with a
SNP profile unique to ST93 were divided into six different binary types, four of which
were PVL positive. Whereas thirty isolates with the ST93 profile all belonged to only one
of the PVL positive binary types, demonstrating that the current dominant ST93 PVL
positive clone belongs to a single cluster (Nimmo and Coombs 2008).




                                                                                            36
1.11 Molecular techniques

1.11.1 Pulsed-field gel electrophoresis

Pulsed-field gel electrophoresis (PFGE) is considered as the gold standard to investigate
clonality of MRSA especially in hospitals. The set-up for a PFGE is similar to standard
gel electrophoresis. This involves the growth of the organisms of choice overnight in
broth, and the cultures are embedded in agarose, followed by the lysing of the cells in situ.
The DNA is digested using a restriction enzyme, and is loaded as agarose plugs into the
agarose gel. Finally the fragments are separated by pulsed-field electrophoresis. The gel
images are scanned electronically, and several commercial systems are available to
compare the isolates. This is not uniform and is still problematic. The whole procedure
requires 2 to 5 days to perform making it a complicated and time consuming procedure
(Tang et al. 2000). In addition, the standardisation of PFGE profiles between different
laboratories is extremely difficult.


PFGE analysis in S. aureus uses the SmaI restriction enzyme followed by agarose gel
electrophoresis in an electric field with an alternating voltage gradient (Enright et al.
2000). One voltage gradient runs through the central axis of the gel and two run at an
angle of 120 degrees either side. The pulse times are equal for each direction resulting in
a net forward migration of the DNA. Since bacterial chromosomes are typically circular
molecules, the digestion gives several linear molecules of DNA. The interpretation of the
banding patterns of the gel is by comparison of the site at which the restriction enzyme
acted as well as the length of the fragment. While PFGE is a highly discriminatory
method for genotyping MRSA isolates and is excellent for typing localised outbreaks
over a short period of time, there are a few issues. PFGE is a costly method that is
technically complex and there is a lack of centralised criteria for interpreting the banding
patterns. The insufficient standardisation of PFGE means that inter-laboratory comparison
is difficult even if procedure and reagents are standardised (Tang et al. 2000). PFGE is
also not suited for the screening of large numbers of isolates simultaneously. Therefore
there is a need for a rapid and definitive genotyping method that can be applied in clinical
laboratories, and has the capacity for inter-laboratory comparison (Deurenberg and
Stobbering 2008). When dealing with large outbreaks or long-term outbreaks PFGE
would not be effective. Individual loci or uncharacterised regions of the genome may be


                                                                                            37
highly variable or mutating within the bacterial population being typed. As a
consequence, variation observed may be due to a variety of genetic mechanisms which
can be misleading for long-term outbreaks.

1.11.2 Multilocus Sequence Typing

Multilocus sequence typing (MLST) is a genotyping method based on the sequence of a
~450-bp internal fragments of seven house-keeping genes to characterise bacterial
isolates. These housekeeping genes are arc, aroE, glpF, gmk, pta, tpi, yqiL as outlined in
Table 1 below.. Each gene fragments different sequences are assigned as distinct alleles.
Each isolate is then defined by the alleles at each of the seven housekeeping loci (Table
2). There are many alleles at each of the seven loci, so isolates are unlikely to have the
identical allelic profiles by chance. Isolates that do have the same allelic profile can be
considered members of the same clone. (Enright et al. 2000). One of the advantages of
MLST is the ability to readily compare data with other laboratories. This has led to the
exchange of data collected over the internet through such websites as NCBI and the
creation of the MLST database. The datasets can then be utilised using a BURST (based
upon related sequence types) (http://linux.mlst.net/burst.htm). BURST is an algorithm
that is used to discern groups of isolates among large MLST datasets that have some
defined level of similarity in allelic profile. MLST divides strains into ST by counting the
greatest number of single locus variants (SLV). By assigning ST this way, the method
takes into account the way in which clones emerge and diversify by identifiying the most
likely ancestral type (AT) of each clone. If two ST have the same number of SLV, then it
is the ST with the greatest number of double locus variants (DLV) that is selected as the
founding ST. This allows the identification of the founding ST, or AT, from which clonal
variants have descended.

Major clonal groups, that have been established using MLST, are distributed all over the
world. Clones causing epidemics within North America are USA 300 (ST8-MRSA-IV)
and USA 400 (ST1-MRSA-IV) which is also known as MW2. USA 400 has the same
allelic profile as WA-MRSA. ST1 has also been reported in Europe, which is an
indication of just how successful it is (Diep et al. 2004). Originally, it was USA400 that
was the most prevalent CA-MRSA until the emergence of USA 300. Both are PVL
positive, are spread throughout Canada and the USA, and have quickly surpassed the
traditional HA-MRSA strains (Li et al. 2009).


                                                                                               38
In Europe, the predominant clone is the PVL positive ST80-MRSA-IV. ST80 is found
throughout Europe, from the UK, Greece, Italy and Scandinavia and even in The
Netherlands. ST80 was first reported in The Netherlands in 1998 and quickly became the
dominant CA-MRSA strain throughout the country (Stam-Bolink et al. 2007). What is
interesting about the quick spread of ST80 through the community in the Netherlands is
the fact that the Netherlands has a very low prevalence of HA-MRSA due to its restrictive
use of antibiotics.

CA-MRSA has successfully spread across the country with unique clones becoming
established along the way. In the Northern Territory ST75 is prevalent, which is a strain
unique to the NT that has been classified WA MRSA-8. On the Eastern seaboard, ST30
has established its self in the community, along with one of the most invasive and virulent
clones ST93, which only appeared in Southeast Queensland in 2005 (Nimmo and
Coombs 2008).




               Table 1: Sequence variation at the seven MLST loci
                                                                 No. of
                           Sequence length      No. of
               Gene                                          polymorphic
                                 (bp)           alleles
                                                                  sites
               arcC              456              17                19
               aroE              456              17                23
               glpF              465              11                14
               gmk               429              11                13
               pta               474              15                18
               tpi               402              14                18
               yqiL              516              16                19

              (Enright, et al., 2000)

1.11.3 Spa Typing

The single-locus sequence typing of the S. aureus protein A (spa) locus as developed by
Frenay et al. (1994) is an effective and rapid method for typing MRSA. It determines the



                                                                                       39
sequence variation of the polymorphic region X spa gene (Figure 8). Spa typing has the
discriminatory power between that of PFGE and MLST making it an excellent method for
the study of outbreaks as well as molecular evolution. This is due to only a single locus
requiring sequencing, as opposed to MLST which requires the sequencing of 7
housekeeping genes and PFGE which randomly samples the entire genome. Spa typing is
less expensive, less time consuming and spa types correspond to a single ST, but remain
within an assigned clonal cluster allowing for the typing of rapidly evolving bacteria, as
opposed to PFGE which does not allow for variation or uncharacterised gene regions
(Enright et al. 2002). Spa typing utilises a software package (StaphType) for
interpretation that is used not only in local laboratories but reference laboratories
worldwide making comparison between laboratories easier.


The polymorphic X region (Figure 9) consists of a variable number of tandem 24-bp
repeats and is located immediately upstream of the region encoding the C-terminal cell
wall. The diversity of the Short Sequence Repeat (SSR) region seems to come from the
deletion as well and the duplication of the tandem repeat units as well as by point
mutation. The protein A domain encoded by the X region may serve to extend the N-
terminal immunoglobulin G binding portion of the protein through the cell wall (Von
Heijne and Uhlen 1987). The existence of well-conserved regions flanking the X region
coding sequence in spa allows the use of primers for PCR amplification and direct
sequence typing (Figure 9). The sequencing of the spa SSR region combines many of the
advantages of a sequencing-based system such as MLST but may be more rapid and
convenient for outbreak investigation in the hospital setting since spa typing involves a
single locus. The protein A X region has a high degree of polymorphism and it may have
a variation rate that provides suitable discrimination for outbreak investigation. Spa
typing therefore is a fast, effective technique for typing outbreaks as it provides high
resolution in a short time frame (Shopsin et al. 1999).


The disadvantage of this DNA based typing method is that there has been a lack of
consensus on assignment of new spa repeats and spa types. In the past spa typing has not
been portable as there has not been a centralised nomenclature. One free on-line software
package that has been developed to try to combat this is the Ridom StaphType
(spaserver.ridom.de). This software centralises access via the internet or email and the
SpaServer functions as an operative source for all the new spa repeats and types codes.


                                                                                             40
The Ridom SpaServer is able to be used to collate data from regions around the world,
and establishes a numerical repeat code in order to simplify the spa type nomenclature.
There are currently 4443 spa types registered on the web site, and 72, 026 strains
recorded.




Figure 8: Analysis of the X region with PCR from Frenay et al.,(1994). After PCR, DNA
was cleaved with RsaI. Molecular weight standards are indicated on the left (Marker V;
Boehringer).




Figure 9: Protein A gene map. Boxes indicate segments of the gene coding for the signal
sequence (S), the immunoglobulin G-binding regions (A-D), a region homologous to A-D
(E), and the COOH terminus (X), which includes the SSRs (Xr) and the cell wall
attachment sequence (Xc). Primers are numbered from the 5' end of the primer on the
forward strand of S. aureus (Shopsin et al. 1999)




                                                                                      41
1.11.4 SCCmec Typing

To understand the molecular epidemiology of MRSA, typing the Staphylococcal Cassette
Chromosome mec is important. Currently, SCCmec are classified into types I to V based
on the nature of the mec and ccr gene complexes. The further classification is according
to the junkyard region DNA segments as described by Zhang et al. (2005) As mentions
previously, the nomenclature of SCCmec is based on the ccr genes as well as the mec
complex, as well as the J1 region and the J2-3regions (type IVb). Finally, the ccr genes
and the J regions are numbered in chronological order according to their time of
discovery.

CA-MRSA has emerged and evolved to carry the small, novel mobile SCCmec type IV
and V. These genetic elements contain the mecA gene with or without additional
antibiotic resistance genes. Typing of the SCCmec becomes important to classify and
genotype MRSA. The SCCmec is a mobile genetic element that is characterised by a set
of direct repeats and inverted site specific recombinase genes ccrA, ccrB and the mecA
gene complex. ccrA and ccrB genes are required for the movement and integration of
SCC in the S. aureus chromosome. This then allows the SCC to serve as a carrier for the
mecA gene

There are three classes (A, B and C) of mec complex and four allotypes (1, 2, 3 and 5) of
ccr complex. It is the different combinations of these above complex classes and allotypes
that generate the various SCCmec types present in both hospital settings as well and in the
community. SCCmec elements are currently classified into types I, II, III, IV and V based
on the nature of the mec and ccr gene complexes. They can then be further sub-classified
into types according to differences in their J region DNA. (Zhang et al. 2005; Ito et al.
2001). (Figure 3).

The classification of the SCCmec is not uniform and has been based on many different
methods. The structure of the SCCmec can be determined using a number of PCR based
methods. Ito et al. (2001) used several PCR assays to determine the structure of the mec
complex as well as the presence of the different ccr genes. Ito et al. (2001) was able to
identify and characterise SCCmec types I-III by cloning and nucleotide sequence
determination of the DNA region surrounding the mecA gene using two representative
strains, one from England and the other from New Zealand, then applying that to other


                                                                                            42
strains from Japan and around the world. Zhang et al. (2005) developed an easy to use
multiplex PCR assay for the determination of the structure of SCCmec types I to V.
SCCmec IV-V were found to be smaller than SCCmec I-III and contained the mecA gene.
This method was much easier to use than Ito et al. (2001) although not as discriminatory
as it only focused on a single locus (Figure 4).

1.11.5 High Resolution Melt Analysis

HRM is a closed tube, post-amplification method that utilises simple and inexpensive
dye such as SybrGreen® on specialised instrumentation such as the Rotor-Gene 6000
instrument (Corbett Life Science). HRM analysis is similar to conventional melt analysis
in that it monitors the strand dissociation behaviour, but HRM analysis takes it one step
further in its ability to capture much more detail, and has an increased resolving power as
melting curves from different amplicons may be differentiated on the basis of the shape of
the melt curve even when the melt temperature values are the same. This means that
HRM analysis can differentiate a single base- pair mutation and facilitate the detection of
SNPs (Price et al. 2007; Liew et al. 2004). HRM has the ability to characterise nucleic
acid samples according to their sequence, length, GC content or strand complementarity.
HRM analysis works by heating the sample to high temperatures, this is where the DNA
denatures and the fluorescent colour fades away as the double stranded DNA separates.
This generates a melting curve and because the different genetic sequences melt at
slightly different rates, they can be viewed, compared, and detected using these curves.
Even a single base change will cause differences in the melting curve (Reed et al. 2007;
Stephens et al. 2008)

The advent of HRM has renewed interest in melt analysis for a range of uses including
gene scanning, sequence matching, genotyping (including SNPs) quantitative
allelotyping, quantitative DNA methylation and genetic linkage mapping. High-resolution
DNA melting is becoming more popular due to its accuracy and simplicity (Price et al.
2007; Liew et al. (2004). It can also be used to scan large genes for variation and in many
cases greatly reduces or eliminates the need for sequencing, which makes HRM an
attractive option. The HRM curves are also completely portable, and Stephens et al.
(2008) found that comparing data from different real-time PCR runs did not cause any
loss in the ability to differentiate different spa alleles. In regards to genotyping, the HRM



                                                                                         43
method is a far less expensive and streamlined, single step closed tube method that is
robust and easier to use and compare data, than other methods.


1.12 Single nucleotide polymorphisms (SNPs)

One of the emerging approaches to microbial genotyping is by using sets of single-
nucleotide polymorphisms or SNPs, in combination with binary markers. SNPs are
derived from the MLST database, and can assign isolates of S. aureus to major clonal
complexes. The S. aureus genome consists of a backbone which is composed of genes
that are essentially common to all variants within the species. These genes are ancient in
origin, and so have had time to be re-sorted by horizontal gene transfer and
recombination. Usually, seven fragments are defined. A ST consists of variations of these
fragments that are found in a particular isolate, (Table 3) (Robertson et al. 2004). These
sets of SNPs are identified using the computer program previously described by
Robertson et al. (2004) called “Minimum SNPs”. This program is designed to provide
highly informative sets of SNPs based on the MLST database. The SNPs that are
provided by the database give a high Simpson‟s index of diversity (D) values with respect
to the databases. A set of eight SNPs have been identified that provide a D of 0.95 with
respect to the S. aureus MLST database, meaning that there is a 95% probability that two
randomly selected STs would be called different (Robertson et al. 2004). The "high D
SNP" set reported by Robertons et al. (2004) showed considerable efficacy, although
there was very little detail reported in relation to the S. aureus population structure. The
Minimum SNPs method has proved useful at identifying highly efficient combinations
of MLST genotyping SNPs. These are relevant to the entire population as opposed to
SNPs that are simply genotype specific.




                                                                                               44
Table 2: Clonal complexes identified from genotyping S. aureus (Huygens et al. 2006
                                                        Number of isolates
Clonal Complex         SNP Profile            MSSA (pvl+)            MRSA (pvl+)
1                      CGATAACT               11(2)                  19 (1)
5                      CGATTACA               36 (3)                 9 (0)
8                      TGATACCA               10 (0)                 20 (0)
9                      TGATAACT               6 (0)                  0 (0)
509 (or 12)            CGGTTCCA               10 (0)                 2 (1)
15                     CGATAACA               17 (0)                 0 (0)
20                     CGATTACT               13 (1)                 1 (0)
22                     CGGTTACA               3 (1)                  4 (0)
25                     CGGTAACA               4 (0                   1 (0)
30                     TGGATCCA               17 (6)                 17 (14)
45                     CGGATCCA               10 (0)                 1 (1)
72                     CGATTCCA               1 (0)                  0 (0)
78                     TGATTACA               21 (1)                 4 (0)
93                     TGGTTCTA (aroE252G)    16 (12)                30 (30)
Non-93/None            TGGTTCTA               1 (1)                  2 (0)
                       (aroE252A/T)
97                     TGGTAACT               2 (1)                  0 (0)
239                    TGAAACCA               1 (0)                  72 (1)
CC1 outliers           TGATTACT               5 (0)                  0 (0)
None                   TGATTCCA               5 (0)                  2 (1)
None                   CGGATCTA               1 (1)                  0 (0)
None                   TGGTACCA               0 (0)                  1 (0)
None                   TGGTTCCA               4 (1)                  7 (6)
None                   TGAATCCA               0 (0)                  3 (0)
Not analysed           TGAATACA               1 (0)                  0 (0)
Not analysed           TGGAACCA               1 (0)                  0 (0)




                                                                                      45
The functions of the Minimum SNP database as described in Robertson et al. (2004) are
as follows.


   1. Minimum SNPs can either carry out SNP searches on alignments that are derived
       from individual MLST loci or convert an MLST database into a single-linked
       alignment that can be searched in a single operation.
   2. The highly informative sets of SNPs are identified by an approximation that has
       been termed the „anchored method‟. This method entails initial identification of
       the most informative SNP, which is then termed SNP1, then the next SNP2. SNP1
       in conjunction with SNP2 then form the most informative pair. This process
       continues progressively forming larger combinations until a preset target, based
       on either informative power or number of SNPs is reached to form a set. If two or
       more sets of SNPs exhibit equal informative power, then the program will provide
       all these sets as output. Cumulative informative power for each SNP identified is
       included in the output.
   3. This then allows the minimum number of loci required to define any given ST to
       be calculated.
   4. The information provided by the sets of SNPs can be calculated by two different
       methods. The „specified variant‟ algorithm identifies SNPs that are diagnostic for
       a user-specified variant. Such SNPs are most useful for efficient determination of
       whether or not an unknown isolate is a variant of particular interest. The
       „generalised‟ algorithm identifies sets for SNPs that are suitable for the efficient
       determination of whether two isolates are likely to be the same or different.
       Informative power of sets of SNPs can be assessed by calculating Simpson‟s
       index of diversity (D).




                                                                                              46
1.13 Project Hypothesis and Specific Aims

Aim 1: Genotyping of Community-Acquired Methicillin-Resistant S. aureus (CA-
MRSA), using Real-Time PCR.


Hypothesis: Genotyping of MRSA using SNPs is a rapid and robust method for
monitoring MRSA, specifically ST93 (Queensland Clone) dissemination in the
community.

Significance: CA-MRSA is increasing in prevalence and virility, they are also
genetically diverse and district with increasing antibiotic resistance. By using SNPs in
combination with binary markers, it is possible to genotype MRSA allowing for the
determination and specific identification of MRSA clones. The rationale for this project is
that SNP analysis of MLST genes is a rapid and cost-effective method for genotyping and
monitoring MRSA dissemination in the community. This method is non-gel based, non-
sequence based, using a single, closed tube test on a generic instrument. The high
resolving power of this method is possibly equal to or better than current “gold standard”
genotyping methods. Furthermore, this genotyping method is consistent with the
population structure of CA-MRSA.

Aim 2: Detection and sub-typing of the PVL gene found in CA-MRSA, using Real-Time
PCR.


Hypothesis: PVL gene can be subtyped using an allele-specific RT-PCR followed by
HRM analysis. This will allow the identification of PVL subtypes within the CA-MRSA
population and allow the tracking of these clones in the community.
.
Significance: PVL positive CA-MRSA is shown to cause recurrent, chronic or severe
skin and soft tissue infections. As a result, it is important that PVL positive CA-MRSA is
genotyped and tracked especially as CA-MRSA is more prevalent than HA-MRSA as the
causation of new infections and has been deemed endemic in Australia. SNP analysis of
PVL through RT-PCR, is a rapid and robust genotyping method for monitoring MRSA
dissemination in the community. This method is non-gel based, non-sequence based,
using a single, closed tube test on a generic instrument.


                                                                                           47
1.14 Conclusion
S. aureus is a common pathogen that causes a variety of infections including soft-tissue
infections, impetigo, septicaemia, toxic shock and scalded skin syndrome. MRSA has
traditionally been thought of as a Hospital Acquired (HA) infection. It is now recognised
that the frequency of infections with MRSA is in the community, not originating from a
hospital environment, is increasing (Rossney et al. 2007). What is most concerning is the
development of resistance to multiple antibiotics including Methicillin, which is
associated with virulence factors including PVL. PVL has been subtyped into variants as
described by O‟Hara et al. (2008) into H variant and R variant. The R variant is strongly
associated with the presence of mecA, whereas the H variant is not commonly associated
with the presence of mecA which is the gene that encodes for Methicillin resistance.

CA-MRSA are genetically diverse and distinct (Huygens et al. 2006; O‟Hara et al. 2008),
this means that they can be identified and tracked by way of genotyping. PVL positive
CA-MRSA is shown to cause recurrent, chronic or severe skin and soft tissue infections.
As a result, it is important that PVL positive CA-MRSA is genotyped and tracked
especially as CA-MRSA is more prevalent than HA-MRSA. Diversity of PVL positive
strains can be attributed to the fact that the PVL genes are localized on phages (Kaneko
and Kamio 2004). This has already been demonstrated by Huygens et al. (2006) when the
SNP-based method was used for the identification of S. aureus, more specifically ST93.




                                                                                            48
    Chapter Two:



Methods and Materials




                        49
2.1 Isolates


S. aureus isolates with antibograms consistent with nmMRSA were obtained from routine
diagnostic specimens from the Microbiology department of Queensland Medical
Laboratory (QML) from May 2008 until May 2009. All nmMRSA isolates selected for
the study were obtained from community patients. No hospital patients were included in
this study. Only swab specimens taken from skin and soft tissue infections including
wound and abscess swabs, pus swabs and general skin swabs were included in this study
There were no geographical restrictions and all of the isolates were from Queensland and
Northern New South Wales.



2.2 Phenotypic Identification

Isolates were identified as S. aureus by the standard laboratory phenotypic methods.
Susceptibility testing was performed in accordance with CDS guidelines. The antibiotics
that were tested included Penicillin, Flu(di)cloxacillin, Cepalothin, Ciprofloxacin,
Erthryomycin, Co-trimoxazole, Tetracycline, Clindamycin, Rifampicin, Fusdic Acid and
Vancomycin. The isolate was defined as MRSA based on oxacillin resistance. The isolate
was defined as nmMRSA if it was resistant to less than three classes of non-betalactam
antibiotics. In the routine laboratory the majority of CA-MRSA demonstrate a non multi-
resistant profile.


2.3 Bacterial Growth

Bacterial growth for the purpose of DNA extraction was performed as follows. The
isolates collected from the specimens tested at QML were stored on nutrient agar slopes
(Biomérieux, Australia) and kept at 4°C. When required they were plated onto Horse
Blood Agar (HBA) (Biomérieux, Australia) using the 16 streak method (Figure 10). The
plates where incubated overnight at 35°C in CO2. Following overnight incubation, 12 to
15 single isolated colonies were collected and suspended into 200μl of ddH2O solution
containing 40 µg of lysostaphin ready for extraction.




                                                                                           50
Figure 10: MRSA Isolate culture on HBA after overnight incubation at 35°C in CO2.


2.4 DNA Extraction


All S. aureus DNA extractions were done using an automated system for S. aureus
extractions based on the Corbett-X tractor Gene automated DNA extraction system
(Corbett Robotics Australia) as described by Stephens et al.( 2007).


2.5 Amplification and Analysis

2.5.1 Identification of isolates as S. aureus


Identification of S. aureus isolates were performed using Real Time-PCR (RT-PCR) to
confirm all isolates as S. aureus by testing for the presence of the nuc gene (Table 3).
Each 10μl RT-PCR reaction was conducted in duplicate and contained5μl of platinum
quantitative PCR SuperMix-UDG master mix (Invitrogen Life Technologies), 1μl of both
forward and reverse primer (0.5µM), 1μl of ddH20 and 2μl of DNA template. Each
isolate was then amplified using a three step temperature cycling procedure as follows:


                                                                                           51
Hold 95°C for 2min, then 40 cycles of 90°C for 2s, 60°C for 45s and then melting
between 50°C and 90°C rising by 1°C. All standard Real-Time PCR (RT-PCR)
amplification and detection was performed on a Rotor-Gene 6000 instrument (Corbett
Life Science, Brisbane Australia).


2.5.2 Characterisation of isolates as MRSA


Once all isolates were identified as S. aureus, the next step was to determine if they were
MRSA by conducting RT-PCR for the presence of the mecA gene (Table 3). Each 10μl
RT-PCR reaction was conducted in duplicate and contained 5μl of platinum quantitative
PCR SuperMix-UDG master mix (Invitrogen Life Technologies), 1μl of both forward and
reverse primer (0.5µM), 1μl of ddH20 and 2μl of DNA template. Each isolate was then
amplified using a three step temperature cycling procedure as follows: Hold 95°C for
2min, followed by 40 cycles of 90°C for 2s, 60°C for 45s and then melting between 50°C
and 90°C rising by 1°C


2.5.3 Detection of PVL


All isolates identified as MRSA subsequently screened for the PVL gene (Table 3). Each
10μl RT-PCR reaction was conducted in duplicate and contained 5μl of platinum
quantitative PCR SuperMix-UDG master mix (Invitrogen Life Technologies), 1μl of both
forward and reverse primer (final concentration of 0.5µM), 1μl of ddH20 and 2μl of DNA
template. Each isolate was then amplified using a three step temperature cycling
procedure as follows: Hold 95°C for 2min, followed by 40 cycles of 90°C for 2s, 60°C
for 45s and then melting between 50°C and 90°C rising by 1°C.


Table 3: Primer Sequences for characterisation of isolates.
nuc F         GCGATTGATGGTGATACGGTT
nuc R         AGCCAAGCCTTGACGAACTAAAG
mecA F        GATCGCAACGTTCAATTTAATTT
mecA R        GCTTTGGTCTTTCTGCATTCCT
PVL F         TATCTCTAACGGCTTGTCAGGT
PVL R         TGCTTCAACATCCCAACC



                                                                                              52
2.5.4   Single nucleotide polymorphism primer set (SNP)


The SNPs used to genotype the MRSA isolates have been previously described by
Huygens et al. (2006) (Table 4 and 5). The SNPs were also used to determine the
prevalence of the ST93 (Queensland Clone) within the community. Each 10μl RT-PCR
reaction was conducted in duplicate and contained 5μl of platinum quantitative PCR
SuperMix-UDG master mix (Invitrogen Life Technologies), 1μl of both forward and
reverse primer (0.5µM), 1μl of ddH20 and 2μl of DNA template. Each sample was
amplified using a three step temperature cycling procedure as follows: 50°C for 2min,
95°C for 10min, followed by 40 cycles of 95°C for 15s, 52°C for 20s and 72°C for 35s.




                                                                                        53
Table 4: Primer sequences used in screening PCR and SNPs



Primer name                                                            Sequences

U1 .............................................................CGTATAAAAAGGACCAATTGGTCTG*
U6 .............................................................GTAAATCATCAACATCTGAAGATGTA
U8 ........................................................... GATCATCTTTATCTACTTCCACACGTGCT*
U9 .............................................................ACCTACTAATCGCTCTCTCAAGTAA*
U11 ...........................................................TGCAGCACATTCAACAGAA
U14 ...........................................................GATGAAGAAATTAACAAAAAAGCGCCT
U15 ...........................................................GATGAAGAAATTAACAAAAAAGCGCCC
U16 ...........................................................TTGCACAATCACCAAAGATGTATTATA*
S1 ..............................................................CAGGGTATGATAGGCTATTGGTTG
S2 ..............................................................GCCCCATCAATATCAGTTTGTG
S3 ............................................................. ACGTCAAATGCGTGAAGGTG
S4 ..............................................................CCTTGTGAATCAAGTTCTGGATTG
S5 ..............................................................TTGATGATTTACCAGTTCCGATTG
S6 ..............................................................CTGCGACAAGTGAATTGAAAGCTG

(Huygens et al., 2006)
Note: Sequences with * denote that SNP is in the reverse primer. The “U” primers are
Allele specific primes, while “S” primers are common primers.
Table 5: Embodiment for S. aureus genotyping using
SNPs: distribution of primers into eight tubes
Tube                      Possible             Polymorph          Primer
        Locus
no.                       polymorphs            for STKP       combination
1       arcC210           C,T                       C             S1, U1
2       tpi241 243        GA,GG,AG                 GA             S2, U6
3       arcC162           A,T                       A             S1, U8
4       gmk318            A,T                       T             S3, U9
5       pta294            A,C                       A            S4, U11
6       pta383            A,T                       T            S6, U16
7       tpi36*            C,T                       C            S5, U15
8       tpi36*            C,T                       T            S5, U14
(Huygens et al., 2006)


                                                                                                54
2.5.5 PVL Sub-typing using SNP analysis


Novel SNPs, based on the lukSF-PV sequence variants previously described by O‟Hara et
al. (2008) (Table 6 and Figure 11) were used for PVL sub-typing. All PVL positive
MRSA isolates were tested. Each 10μl RT-PCR reaction was conducted in duplicate and
contained 5μl of platinum quantitative PCR SuperMix-UDG master mix (Invitrogen Life
Technologies, 1μl of both forward and reverse primer (0.5µM), 1μl of ddH20 and 2μl of
DNA template. Each SNP was then amplified using a three step temperature cycling
procedure as follows: 95°C for 5min, followed by 40 cycles of 95°C for 10s, 66°C for
20s, Melt 50-99°C rising by 1° then HRM 65-95°C rising by 0.05°C. All HRM
amplification and detection was performed on a Rotor-Gene 6000 instrument (Corbett
Life Science, Brisbane Australia).




Table6: PVL Genotyping Primer Set.
SNP 663 F              5‟TCCAAATTTATTTGTTGGATATAAACC 3‟
SNP 663 R              5‟TGAAGGATTGAAACCACTGTGT 3‟
SNP 1396 F             5‟TTTCAACTACAACAAACGGTAGG 3‟
SNP 1396 R             5‟TCTCTGAAAAAGATTTTGAACCA 3‟
SNP 1729 F             5‟TCCAGTGAAGTTGATTCCAAAA 3‟
SNP 1729 R             5‟TTGGTGTCCTATCTCGAAAACA 3‟
SNP 527 & 470 F        5‟GTGGTCCATCCATCAACAGGAGGT 3‟
SNP 527 & 470 R        5‟ TTCCCCATTGAACACTTTTTGG 3‟




                                                                                       55
Figure 11: The lukSF-PV sequence variants found across 174 clinical isolates of S. aureus
(Adapted from O‟Hara et al. 2008). Shown is the variation of nucleotides observed
among lukSF-PV sequences from MSSA and MRSA and compared with the reported
USA 300 lukSF-PV sequence. The thick line at the top shows the USA300 genome. The
other short vertical lines above and below indicates relative positions of variable sites.
PVL sub-types are bracketed according to how they are grouped into one of four major
groups.




                                                                                             56
                                 Chapter 3:


       Genotyping of Community-Acquired
       Methicillin-Resistant Staphylococcus
             aureus, using Real-Time PCR.

Manuscript submitted: Community-Acquired MRSA in Queensland and New South

Wales, Australia – Prevalence of PVL-Positive ST93 Strains Causing Skin Infections,

Journal of Clinical Microbiology, May 2010



Authors: M. Costello and F. Huygens




                                                                                      57
Due to copyright restrictions, this
article is not available here.
Please consult the hardcopy thesis
available from QUT Library




                                      58
                                 Chapter 4:


         Sub-typing of the Panton-Valentine
               leukocidin (PVL) toxin gene.

Manuscript submitted: Prevalence of the Panton-Valentine leukocidin gene in Australian

Community-Acquired Methicillin-Resistant Staphylococcus aureus, Clinical

Microbiology and Infection, May 2010



Authors: M. Costello and F. Huygnes




                                                                                   71
4.1 Introduction


The recent emergence of CA-MRSA marks a major change in the epidemiology of S.
aureus. Recently a number of virulence genes unique to CA-MRSA have been
discovered, and the Panton-Valentine leukocidin gene (PVL) in particular has been linked
to increased virulence. The role that PVL plays in CA-MRSA‟s pathogenesis is the cause
of much debate. What we do know is that it is widely disseminating not only in Australia
but also in Europe. The genetically diverse CA-MRSA, and the strains that carry the PVL
toxin, are resistant to almost all β-lactam antibiotics. Recently, PVL has been interrogated
in animal models to assess its virulence (Diep, et al. 2008; Voyich, et al. 2006). These
studies indicated that whether PVL was present or not, the strains of CA-MRSA were as
virulent if not more posing the question whether PVL alone plays a significant role in the
pathogenesis and virulence of CA-MRSA or not.


Van deVelde in 1894 first described PVL, but it wasn‟t until 1932 that Sir Phillip Panton
and Francis Valentine linked the PVL gene in S. aureus to skin and soft tissue infections
(Panton and Valentine 1932). The PVL gene encodes a cytotoxin that has many functions
including causing concentration-dependent necrosis and apoptosis of human monocytes
and macrophages. This gene also causes activation of calcium channels as well as
changes in gene transcription (O‟Hara et al. 2008). The spread of PVL positive strains
carrying mecA is becoming more common, and exhibiting resistance to almost all β-
lactam antibiotics. It is this development that has been paralleled by the emergence of two
new SCCmec type IV and typeV, which are smaller than SCCmec I-III, and seem to only
be associated with community-acquired infections (Zang et al. 2005; Huygens et al,
2004)


PVL is comprised of two distinct protein components (lukF-PV and lukS-PV), which
together form heptameric pores that disrupt leukocyte membranes, leading to increased
virulence particularly in CA-MRSA (Monecke et al. 2006). The lukSF-PV genes are
carried on a prophage, and it has been shown that the genes may be transferred from one
strain to another via phage transduction. This means that the PVL gene may be
transmitted not only vertically but horizontally amongst clones (O‟Hara et al. 2008). The




                                                                                               72
lukSF-PV sequences are highly conserved at the nucleotide level. This indicates that they
all share a recent common ancestor.


The evolution of PVL, in relation to PVL positive MRSA, is a recent and sometimes
contentious one. Reconstruction of the history of the PVL genes has shown that there has
not been a substantial amount of variation, haplotypes or deletion events, meaning that all
PVL sequences are connected at 99% confidence interval. H1 and H3 variants are found
in most PVL positive isolates around the world including ST93-MRSA IV in Australia,
with the R variant found in the USA 300 strain, which is the predominant CA-MRSA
strain in the USA (Nimmo and Coombs 2008; O‟Hara et al 2008). The exchange of
mobile genetic elements, especially those associated with virulence and resistance
determinants, is a significant driving force of the evolution of the accessory genome.


HRM analysis is a closed tube, post-amplification method that utilises simple and
inexpensive dye such as SybrGreen® and on specialised instrumentation such as the
Rotor-Gene 6000 instrument (Corbett Life Science). HRM analysis is similar to
conventional melt analysis in that it monitors the strand dissociation behaviour of DNA,
but HRM analysis takes it one step further in its ability to capture much more detail by
melting at 0.02°C increments. This gives an increased resolving power as melting curves
from different amplicons may be differentiated on the basis of the shape of the melt curve
even when the melt temperature values are the same (Price et al. 2007; Liew et al. 2004),.
This means that HRM analysis can detect a single base-pair mutation and making it
amenable for SNP genotyping analysis (Huygens et al. 2006) HRM has the ability to
characterise nucleic acid samples according to their sequence, length, GC content, or
strand complementarity which makes it an ideal platform for PVL genotyping.




                                                                                         73
4.2 Aim

The aim of this section of my project was to sub-type the Panton-Valentine leukocidin
gene within the 245 of 249 (98%) PVL positive community S. aureus isolates.


4.3 Materials

The method for general PVL screening and subsequent genotyping using HRM analysis is
described in Chapter 2.


4.4 Results

4.4.1 PVL Screening


All isolates were screened for the presence of PVL using the method described in Chapter
2. Of the 249 isolates screened, 245 tested positive for the toxin gene and the four isolates
that were PVL negative were from nursing homes and HA-MRSA.


4.4.2   PVL Sub-typing


This novel sub-typing method using SNP analysis was carried out on all PVL positive
ST93 isolates. As previously described in Chapter 2, these isolates were tested in
duplicate for all four SNPs – 663, 1396, 1729 and 527/470. These SNPs were
subsequently interrogated using RT-PCR followed by HRM analysis. Good amplification
of the target amplicon and was demonstrated and reproducible. This method also shows
clear discrimination of melt curves of each respective polymorphism. The increased
resolving power of HRM means that amplicons can be differentiated on the basis of shape
of the melting curves and similarity based on the normalised melt-curve of the amplified
DNA product (Figure 17).




                                                                                                74
                                           G Polymorphism
           T Polymorphism




Figure 17: HRM analysis of multiple ST93 isolates for SNP 663 T/G showing clear
discrimination between DNA melt curves.




                                                                                  75
4.5 Discussion


With the dramatic emergence of CA-MRSA over the last 10yrs, much research into why
MRSA has become so virulent has led to the discovery of virulence factors not seen
before in HA-MRSA. One such virulence factor that has emerged is PVL, and has been
touted as the cause of increased virulence in CA-MRSA. What is driving this assumption
is the recent data showing that all CA-MRSA have this PVL toxin from USA300 to ST80
(Voyich et al. 2006), and there is a distinct absence of PVL in HA-MRSA strains. With
the widespread increase in the severity of CA-MRSA disease, the correlation with the
presence of PVL suggests that it does in fact play a role. To date, the toxin is strongly
associated with severe skin and soft tissue infections and necrotising pneumonia. The
ability of CA-MRSA to cause infections in immunocompetent hosts seems to be due in
part to CA-MRSA strain causing necrosis which has been linked to the lysis of
neutrophils, which are the primary target of PVL (O‟Hara et al. 2008). Neutrophils are
the main cellular defense against bacterial infections, and the destruction of these cells by
CA-MRSA is likely a key component to the disease. A recent study by Voyich et al.
(2006) provides strong support for this idea. The evidence supporting the involvement of
PVL in the pathogenicity of CA-MRSA is largely circumstantial and the cause of much
debate. It has been suggested that PVL in combination with other virulence factors is
what is causing increased CA-MRSA infections. A study by Diep et al. (2008) used a
mouse model to investigate this and found that only purified PVL at high concentrations
or over-expression of a particular operon caused lung inflammation and necrosis. It was
suggested that notwithstanding the strong epidemiological linkage between the two, PVL
may yet harm other human cells than leucocytes in a yet to be understood interaction
(Diep et al. 2008). Deip et al. (2008) went on to say that it is not PVL alone but in
conjunction with other determinants that may indeed be the driving force behind the
increased virulence of CA-MRSA. However, it is still widely accepted that PVL does
play a role in the causation of disease by CA-MRSA and is a toxin that should be taken
seriously.


The 249 isolates collected were tested for the presence of the PVL gene and it was found
that all but five (98%) tested positive for the virulence factor. Moreover the isolates that
originated from nursing homes were PVL negative, strengthening the argument that PVL


                                                                                                76
is a virulence factor associated with CA-MRSA. Also, it was surprising that PVL was
widely disseminated across so many different CA-MRSA STs. The isolates collected
were from QLD and Northern NSW and were randomly selected. This study clearly
demonstrated that PVL is distributed throughout the community and not limited to QLD.
All of the isolates that genotyped for ST93 were PVL positive making it an indicator for
this ST in particular, and it is possible that this ST could be responsible for the
dissemination of PVL in CA-MRSA. Nimmo and Coombs (2008), have reported low
carriage rates in proportion to clinical isolates within the Brisbane area which in 2004 was
only 13%. They also reported that the virulent clones of CA-MRSA were not yet
spreading in the community. Five years later and the data from this study suggests that
CA-MRSA is on the increase and is now widely found in the community from Mt Isa
through to Lismore and Byron Bay with a wide range of strains causing skin and soft
tissue infections. More importantly all of these strains harbor the PVL toxin. This is a
significant finding that warrants further investigation. This is the first time that an
extensive investigation of CA-MRSA has been conducted on isolates collected from
patients in the community along the Eastern seaboard of Australia.


Sub-typing of the PVL gene in CA-MRSA could be a useful tool for the identification
and monitoring of the dissemination of this virulence trait in CA-MRSA. To date, only
one study has investigated this (O‟Hara et al., 2008). The HRM method shows great
promise with good amplification of the target amplicon and discrimination of melt curves
of each respective polymorphism (Figure 17). This preliminary sub-typing of the PVL
gene using HRM analysis can be used as an “add-on” to the SNP and binary typing
method. The high resolving power of HRM makes it an ideal platform to sub-type the
PVL toxin. This method is non-gel based, non-sequence based, using a single, closed tube
test on a generic instrument.

PVL genotyping by way of HRM shows a lot of promise and more work is required for
further validation of the method. The preliminary PVL sub-typing results of this study
indicate that HRM analysis of the PVL gene could be used as an epidemiological tool for
the monitoring of PVL-positive CA-MRSA.




                                                                                           77
78
               Chapter 5:


General Conclusions and Future Directions




                                       79
General Conclusions and Future Directions


S. aureus is a common pathogen that causes a variety of infections including soft tissue
infections, impetigo, septicemia toxic shock and scalded skin syndrome. Traditionally,
MRSA was considered an infection that was acquired from the hospital environment.
MRSA infections in the community setting are increasing in frequency. One of the most
worrying developments is the increased resistance to multiple antibiotics. Recently one
particular virulence factor has emerged as a possible driving force, the PVL gene.


CA-MRSA is now firmly entrenched in the community setting, infecting indiscriminately.
In this study all 249 isolates were from routine diagnostic specimens from Queensland
and New South Wales. All isolates were form the community setting, there were no
isolates from hospital patients included and only a few isolates were from patients in
nursing homes. By using the SNP genotyping method, 16 different sequence types were
identified, which is double the amount that was documented by Nimmo and Coombs
(2008). The hypothesis of this study was that SNP genotyping is a rapid and robust
method for monitoring MRSA and its dissemination in the community, specifically
ST93. This is imperative as the predominant S. aureus clone in this study was found to
be ST93, with 41% of all the isolates testing positive for the clone Until recently, the
dominant clones in QLD were documented to be ST239 and ST30. This shows the rapid
dissemination of CA-MRSA in just a few short years and ST93 establishing itself as the
dominant clone throughout QLD and parts of NSW. One possible driving force behind
the rapid spread of this infection is the virulence factor PVL. The isolates in this study
were 98% positive for PVL. This is a challenge for doctors, as S. aureus infections were
to be considered innocuous with the standard treatment being Penicillin. Unfortunately
now, many skin and soft tissue infections are MRSA, and Penicillin is ineffective. This
leaves the patient with possible multiple courses of antibiotics until the pus / wound
swabs are sent to the laboratory for testing. MRSA is not a notifiable disease in
Queensland, so there is no real data with regards to the number of MRSA infections in the
community or the clones/sequence types that are causing them. By genotyping the MRSA
by way of SNP analysis, as was done in this study, we have a better understanding of the
types of MRSA causing infection. By routinely using SNP analysis in the diagnostic




                                                                                             80
laboratory in parallel with traditional techniques, it would possible to decrease result
turnaround times from days to a matter of hours.


Sub-typing of the PVL toxin genes shows promise as a tool for the identification and
monitoring of PVL dissemination in CA-MRSA. This study is the first time that PVL
sub-typing has been done on Australian isolates, specifically ST93. To date the PVL
variants circulating within the community in Australia are unknown. As there is still
much debate surrounding PVL and its exact role in the virulence of CA-MRSA, sub-
typing PVL positive S. aureus isolates may prove useful. The HRM method used in this
study shows great promise with good amplification of the target amplicon and
discrimination of DNA melt curves. The high resolving power of this method makes it an
ideal platform to sub-type the PVL toxin gene. The results of this study indicate that this
method should be further validated as an epidemiological tool.




                                                                                           81
82
                Appendix 1


Antibiotic Susceptibility Testing by the CDS
     Method – Staphylococcus aureus




                                          83
 ANTIBIOTIC SUSCEPTIBILITY
TESTING BY THE CDS METHOD




    A MANUAL FOR MEDICAL AND
   VETERINARY LABORATORIES 2009
                Fifth Edition

       S. M. Bell, J. N. Pham, G. T. Fisher




   ANTIBIOTIC SUSCEPTIBILITY TESTING


                                              84
Due to copyright restrictions, this
appendix is not available here.
Please consult the hardcopy thesis
available from QUT Library




                                      85
               Appendix 2


Patient antibiograms, SNP profiles and PVL
              screening results




                                        89
90
Literature Cited




                   91
Berglud, C., Prevost, G., Laventie, B., Keller, D., Söderquist, B. 2008, The genes for Panton-Valentine
leukocidin (PVL) are conserved in diverse lines of methicillin-resistant and methicillin-susceptible
Staphylococcus aureus, Microbes and Infect. 10: 878-884

Bhattacharya, D., Carelton, H., Tsai, C., Baron, E., Perdreu-Reminton,F. 2007, Differences in Clinical
and Molecular Characteristics of Skins and Soft Tissue Methicillin-Resistant Staphylococcus aureus
Isolates between Two Hospitals in Northern California, J. Clin. Microbiol.45:1798-1803

Boyle-Vavra, S., Daum, RS. 2007 Community-acquired methicillin-resistant
Staphylococcus aureus: the role of Panton–Valentine leukocidin, Labo Invest87:3-9

Chambers, HF. 2005, Community-Associated MRSA-Resistance and Virulence Converge, N. Engl. J.
Med. 352: 1485-1487

Chambers, HF. 2001, The changing epidemiology of Staphylococcus aureus? Emerg. Infect. Dis., 7:178-
182

Chambers, HF. 1997, Methicillin resistance in staphylococci: molecular and biochemical basis and clinical
implications, Clin. Microbiol. Rev 10: 781-791

Coombs GW., Nimmo GR., Pearson JC., Christiansen KJ., Bell JM., Collignon PJ., McLaws
ML;Australian Group for Antimicrobial Resistance, 2009, Prevalence of MRSA strains among
Staphylococcus aureus isolated from outpatients, 2006, Commun. Dis. Intell. 1:10-20.

Coombs, G., Nimmo, G., Bell, J., Huygens, F., O’Brien, F., Malkowski, M., Pearson, J., Stephens, A.,
Giffard, P. 2004, Genetic Diversity among Community Methicillin-Resistant Staphylococcus aureus
strains causing Outpatient Infections in Australia, J. Clin. Microbiol. 42: 4735-4743

Collignon P., Gosbell I., Vickeery A., Nimmo G., Stylianopoulos T., Gottlieb T; Austrlaian Group on
Antimicrobial Resistance, 1998, Community-acuqired methicillin-resistant Staphylococcus aureus in
Australia, Lancet 352: 145-146

David, M., Gilkman, D., Crawford, S., Peng, J., King, K., Hostetler, M., Boyle-Vavra, S., Daum, R.
2008, What is Community-Associated Methicillin-Resistant Staphylococcus aureus? J. Infect. Dis. 197:
1235-1243

Davis, SL., Perri, MB., Donabedian, SM., Manierski, C., Sigh, A., Vager,D., Haque, NZ., Speirs, K.,
Muder, RR., Tobinson-Dunn, B., Hayden, MK., Zervos, MJ. 2007, Epidemiology and outcomes of
Community-Associated Methicillin-Resistant Staphylococcus aureus Infection, J. Clinl. Micro. 45: 1705-
1711

Deurenberg, RH., Stobberingh, EE. 2008, The evolution of Staphylococcus aureus, Infect. Genet. Evol.
468:1348-1367

Diep BA., Stone, GG., Basuino, L., Graber, CJ., Miller, A., des Etages, SA., Jones, A., Palazzolo-
Balance, AM., Perdreau-Remington, F., Sensabaugh, GF., DeLeo, FR., Chambers, HF 2008, The
Arginine Catabolic Mobile Element and Staphylococcal Chromosomal Cassette mec Linkage: Convergence
of Virulence and Resistance in the USA300 Clone of Methicillin-Resistant Staphylococcus aureus, J.
Infect. Dis. 197: 1523-1530

Diep, BA., Otto, M. 2008, The role of virulence determinants in community-associated MRSA
pathogenesis, Trends in Microbiol. 16: 361-369

Diep, BA., Gill, SR., Change RF., Phan, TH., Chen, JH., Davidson, MG., Lin, F., Lin, J., Carleton,
HA., Mongodin, EF., Sensabaugh GF., Perdreau-Remington F. 2006, Complete genome sequence of
USA300, an epidemic clone of community-acquired methicillin-resistant Staphylococcus aureus, Lancet,
367: 731-739




                                                                                                          92
Diep, BA., Carleton, HA., Chang, RF., Sensabaugh GF., Perdreau-Remington, F. 2006, Roles of 34
Virulence Genes in the Evolution of Hospital-and Community-Associated Strains of Methicillin-Resistant
Staphylococcus aureus, J. Infect. Dis. 193: 1495-1503

Diep, BA., Gill, SR., Chang, RF., HaiVan Phan, T., Chen, JH., Davidson, MG., Lin, F., Lin, J.,
Carleton, HA., Mongodin, EF., Sensabaugh, GF., Perdreau-Remington, F. 2006, Complete genome
sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus
aureus, Lancet. 367: 731-739

Diep, BA., Sensabaugh, GF., Somboona, NS., Carleton, HA., Perdreau-Remington, F. 2004,
Widespread Skin and Soft-Tissue Infections Due to Two Methicillin-Resistant Staphylococcus aureus
Strains Harboring the Genes for Panton-Valentine Leucocidin, J. Clin. Microbiol. 42: 2080-2084

Dufour, P., Gillet, Y., Bes, M., Lina, G., Vandenesch, F., Floret, D., Etienne, J., Richet, H. 2002,
Community-Aquired Methicillin-Resistant Staphylococcus aureus Infections I France: Emergence of a
Single Clone That Produces Panton-Valentine Leukocidin, Clin. Infect. Dis. 35: 819-824

Ebert, MD., Sheth, S., Fishman, EK. 2009, Necrotizing pneumonia caused by community-acquired
methicillin-resistant Staphylococcus aureus: an increasing cause of “mayhem in the lung”, Emer. Radiol.
16:159-162

Elasri, MO., Thomas, JR., Skinner, RA., Blevins, JS., Beenken, KE., Nelson, CL., Smeltzer, MS.
2002, Staphylococcus aureus Collagen Adhesin Contributes to the Pathogenesis of Osteomyelitis, Bone.
30: 275-280

Ellington, MJ., Yearwood, L., Ganner, M., East, C., Kearns, AM. 2008, Distribution of the ACME-
arcA gene among methicillin-resistant Staphylococcus aureus from England and Wales, J. Antimicrobiol,
Chemother. 61: 73-77

Enright, MC., Robinson, DA., Randle, G., Feil, EJ., Grundmann, H., Spratt, B. 2002, The evolutionary
history of methicillin-resistant Staphylococcus aureus (MRSA), Proc. Natl. Acad. Sci. USA. 99: 7687-7692

Fleming, A., 1929, On the Antibacterial Cultures on a Penicillium, with special reference to their use in the
isolation of B. influenzae, Brit. J. of Experimental Pathology, 10:226-236

Frénay, HM., Theelen, JP., Schouls, LM., Vandenbroucke-Grauls, CM., Verhoef, J., van Leeuwen,
WJ., Mooi, FR. 1994, Discrimination of epidemic and nonepidemic methicillin-resistant Staphylococcus
aureus strains on the basis of protein A gene polymorphism, J. Clin. Microbiol. 32:846-7

Frenay, HM., Bunschoten, AE., Schouls, LM., van Leeuwen WJ., Vandenbroucke-Grauls, CM.,
Verhoef, J., Mooi, FR. 1996, Molecular typing of methicillin-resistant Staphylococcus aureus on the basis
of protein Agene polymorphism, Eur. J. Clin. Microbiol. Infect. Dis. 15: 60-64

Garza D., Sungar G., Johnston T., Rolston B., Ferguson JD., Matheson GO. 2009, Ineffectiveness of
surveillance to control community-acquired methicillin-resistant Staphylococcus aureus in a professional
football team, Clin. J. Sport Med. 19:498-501

Geiesbrecht P., Kersten T. Maidhof H., Wecke, J. 1998, Staphylococcal cell wall: Morphogenesis and
fatal variations in the presence of penicillin, Microbiol. Mol. Biol. Rev. 62:1371-1414

Huygens, F., Inman-Bamber, J., Nimmo, G., Munckhof, W., Schooneveldt, J., Harrison, B.,
McMahon, J., Giffard, P. 2006, Staphyloccus aureus Genotyping Using Novel Real-Time PCR Formats ,
J. Clin. Microbiol. 44: 3712-3719

Huygens, F., Stephens, AJ., Nimmo, GR., Giffard, PM. 2004, mecA Locus Diversity in Methicillin-
Resistant Staphylococcus aureus Isolates in Brisbane, Australia, and the Development of a Noel Diagnostic
Procedure for the Western Samoan Phage Patter Clone, J. Clin. Mircobiol. 42: 1947-1955




                                                                                                         93
Ito, T., Katayama, Y., Asad, K., Mori, N., Tsutsuminoto, K., Tiensasitorn, C., Hiramatsu, K. 2001,
Sturctural Comparison of Three Types of Staphylococcal Cassette Chromosome mec Integrated in the
Chromosome in Methicillin-Resistant Staphylococcus aureus Antimicrob. Agents and Chemother. 45:
1323-1336

John, JF. and Lindsay JA. 2008, Clone and Drones: Do Variants of Panton-Valentine Leukocidin Extend
the Reach of Community-Associated Methicillin-Resistant Staphylococcus aureus, J. Infect. Dis. 197: 175-
178

Kahl, BC., Peters, G. 2007, Microbiology: Mayhem in the lung, Science. 315: 1082-1083

Kaneko, J., Kamio, Y. 2004, Bacterial two-component and hetero-heptameric pore-forming cytolytic
toxins: structures, pore-forming mechanism, and organization of the genes, Biosci. Biotechnol. Biochem.
68: 981-1003

Kaneko, J., Kimura, T., Kawakami, Y. 1997, Panton-Valentine leukocidin genes in a phage-like particle
isolated from mitomycin C-treated Staphyloccus aureus V8 (ATCC 49775), Biosci. Biotechnol. Biochem.
61: 1960-1962

Kluytmans, J., van Belkum, A., Verbrugh, H. 1997, Nasal Carriage of Staphylococcus aureus:
Epideemiology, Underlying Mechanisms, and Associated Risks, Clin. Micro, Rev. 10: 505-520

Kuroda, M., Ohta, T., Uchiyama, I., Baba, T., Yuzawa, H., Kobayashi, I., Cui, L., Oguchi, A., Aoki,
K., Nagai, Y., Lian, J., Ito, T., Kanamori, M., Matsumaru, H., Maruyama, A., Murakami, H.,
Hosoyama, A., Mizutani-Ui, Y., Takahashi, N., Sawano, T., Inoue, R., Kaito, C., Sekimizu, K.,
Hirakawa, H., Kuhara, S., Goto, S., Yabuzaki, J., Kanehisa, M., Yamashita, A., Oshima, K., Furuya,
K., Yoshino, C., Shiba, T., Hattori, M., AOgasawara, N., Hayashi, H., Kiramatsu, K. 2001, Whole
genome sequencing of methicillin-resistant Staphylococcus aureus, Lancet,357: 1225-1240

Li, M., Diep, BA., Villaruz, AE., Braughton, KR., Jiang, X., DeLeo, FR., Chambers, HF., Lu, Y.,
Otto, M. 2009, Evolution of virulence in epidemic community-associated methicillin-resistant
Staphylococcus aureus, Proc. Natl. Acad. Sci. USA 106: 5883-5888

Liew, M., Pryor, R., Palais, R., Meadows, C., Erall, M., Lyon, Elaine., Wittwer, C. 2004, Genotyping
of Single-Nucleotide Polymorphisms by High-Resolution Melting of Small Amplicons, Clin. Chem. 50:
1156-1164

Lindsay, J. 2010, Genomic variation and evolution of Staphlococcus aureus, Int. J. Med. Microbiol. 2-3:
98-103

Lowy, FD. 2003, Antimicrobial resistance: the example of Staphylococcus aureus, J.Clin. Invest. 111:
1265–1273

Ma, X., Ito, T., Kondo, Y., Cho, M., Yoshizawa, Y., Kaneko, J., Katai, A., Higashiide, M., Li, S.,
Hiramatsu, K. 2008, Two Different Panton-Valentine Leukocidin Phage Lineages Predominate in Japan, J.
Clin. Micrbiol. 46: 3246-3258

Makgotlho, PE., Kock, MM., Hoosen, A., Lekalakala, R., Omar, S., Dove, M., Ehlers, MM. 2009,
Moleculare identification and genotyping of MRSA isolates, Immunol. Med. Microbiol. 57: 104-115

Massey, RC., Horsburgh, MJ., Lina, G., Höök, M., Recker, M. 2006, The evolution and maintenance of
virulence in Staphylococcus aureus: a role for host-to-host transmission? Nature Rev. 4: 953-958

McClure, J., Conly, J., Lau, V., Elsayed, S., Louise, T., Hutchins, W., Zhang, W. 2006, Novel
Multiplex PCR Assay for Detection of the Staphylococcal Virulence Marker Panton-Valentine Leukocidin
genes and Simultaneous Discriminatio of Methicillin-Susceptible from-Resistant Staphylocco, J. Clin.
Micrbiol. 44: 1141-1144




                                                                                                           94
McDonald, M., Dougall, A., Holt, D., Huygens, F., Oppedisano, F., Giffard, P., Inman-Bamber, J.,
Stephens, A., Towers, R., Carapetis, J., Currie, B. 2006, Use of a Single-Nucleotide Polymorphism
Genotyping System To Demonstrate the Unique Epidemiology of Methicillin-Resistant Staphylococcus
aureus in Remote Aboriginal Communities, J. Clin. Micro. 44: 3720-3727

McLaws ML., Pantle AC., Fitzpatrick KR., Hughes CF. 2009, More than hand hygiene is needed to
affect methicillin-resistant Staphylococcus aureus clinical indicator rates: clean hands save lives, part IV.
Med. J. Aust. 191:(8 Suppl):S26-31.

Monecke, S., Ehricht, R., Slickers, P., Tan, H-L., Coombs, G. 2009, The molecular epidemiology and
evolution of the Paton-Valentine leukocidin-positive, methicillin-resistant Staphylococcus aureus strain
USA300 in Western Australia, Clin. Microbiol. Infect. 15:770-775

Monecke, S., Slickers, P., Ellington, N., Kearns, A., Ehricht, R. 2007, High diversity of Panton-
Valentine leukocidin-positive, methicillin-susceptible isolate of Staphylcoccus aureus and implications for
the evolution of community-associated methicillin-resistaant S. aureus, Clin. Microbiol. Infect. 13: 1157-
1164

Monecke, S., Berger-Bachi, B., Coombs, G., Holmes, A., Kay, I., Kearns, A., Linde, HJ., O’Brien, F.,
Slickers, P., Ehricht, R. 2006, Comparative genomics and DNA array-based genotyping of pandemic
Staphylococcus aureus strains encoding Panton-Valentine leukocidin, Clin. Microbiol. Infect. 13: 236-249

Munckhof,WJ., Nimmo, GR., Schooneveldt, JM., Schlebusch, S., Stephens, AJ., Willians, G.,
Huygens, F., Giffard, P. 2009, Nasal carriage of Staphylococcus aureus, including community-associated
methicillin-resistant strains, in Queensland adults, Clin. Microbiol. Infect. 15: 149-155

Munckhof, WJ., Krishnan, A., Kruger, P., Looke, L. 2008, Cavernous sinus thrombosis and meningitis
from community-acquired methicillin-resistant Staphylococcus aureus infection, Intern. Med. J. 283-287

Munckhof, WJ., Schooneveldt, J., Coombs, GW., Hoare, J., Nimmo, GR. 2003, Emergence of
community-acquired methicillin-resistant Staphylococcus aureus (MRSA) infection in Queensland,
Australia, Int. J. Infect. Dis. 7: 259-267

Munckhof, WJ., Nimmo, GR., Caney, J., Schooneveldt, JM., Huygens, F., Inman-bamber, J., Tong,
E., Morton, A., Giffard, P. 2008, Methicillin-susceptible, non-multiresistant methicillin-resistant and
mulitresistant methicillin-resistant Staphylococcus aureus infections: a clinical, epidemiological and
microbiological comparative study, Eur. J. Clin. Micro. 27: 355-364

Murray, RJ., Lim, TT., Pearson, JC., Grubb, WB., Lum, GD. 2004, Community-onset methicillin-
resistant Staphlycoccus aureus bacteremia in Northern Australia, Int. J. Infect. Dis. 8:275-283

Nimmo, GR., Coombs, GW. 2008, Community-associated methicillin-resistant Staphylococcus aureus
(MRSA) in Australia, Int. J. Antimicro. Agents. 31: 401-410

Nimmo GR., Coombs GW., Pearson JC., O'Brien FG., Christiansen KJ., Turnidge JD., Gosbell IB.,
Collignon P., McLaws ML. 2006, Methicillin-resistant Staphylococcus aureus in the Australian
community: an evolving epidemic, Med. J. Aust, 184:384-8.

Nimmo, GR., Schooneveldt, J., O’Kane, G., McCall, B., Vickery, A. 2000, Community Acquisition of
Gentamicin-Sensitive Mthicillin-Resistant Staphylococcus aureus in Southeast Queensland Australia, J.
Clin. Microbiol. 38: 3926-3931

O’Brien, FG., Lim, TT., Chong, FN., Coombs, GW., Enright, MC., Robinson, DS., Monk, A., Said-
Salim, B., Kreiswirth, BN., Grubb, WB. 2004, Diversity among Community Isolates of Methicillin-
Resistant Staphylococcus aureus in Australia, J. Clin. Micro. 42: 3185-3190

O’Hara, F., Guex, N., Word, J., Miller, L., Becker, J., Walsh, S., Scangarella, N., West, J., Shawar,
R., Amrine-Madsen, H. 2008, A Geographic Variant of the Staphyloccus aureus Panton-Valentine
Leukocidin Toxin and the Origin of Community-Associated Methicillin-Resistant S. aureus USA300, J.
Infect. Dis. 197: 187-94



                                                                                                           95
Otter, JA., Kearns, AM., French, GL., Ellington, MJ. 2010, Panton-Valentine leukocidin-encoding
bacteriophages and gene sequence variation in community-associated methicillin-resistant Staphylococcus
aureus, Clin. Microbiol. Infect. 1: 68-73

Patel AH, Nowlan P, Weavers ED, Foster T. 1987, Virulence of protein A-deficient and alpha-toxin-
deficient mutants of Staphylococcus aureus isolated by allele replacement, Infect. Immun. 55 : 3103–3110.

Panton, P., Valentine, F. 1932, Staphylococcal Toxin, Lancet. 219: 506-508

Peleg, AY., Munckhof, WJ., Kleinschmidt, SL., Stephens, AJ., Huygens, F. 2005, Life-threatening
community-acquired mthicillin-resistant Staphylococcus aureus infection in Australia, Eur. J. Clin.
Microbiol. Infect. Dis. 24: 384-387

Price, E., Smith, H., Huygens, F., Giffard, P. 2007, High-Resolution DNA Melt Curve Analysis of the
Clustered, Regularly Interspaced Short-Palindromic-Repeat Locus of Campylobacter jejuni, App. Environ.
Microbiol. 73: 3431-3436

Rammelkamp, C. H, Maxon, T. 1942, Resistance of Staphylococcus aureus to the action of penicillin,
Proc. Royal. Soc. Exper. Biol. Med. 51:386-389

Reed, GH., Kent,JO., Wittwer, CT. 2007, High-resolution DNA melting analysis for simple and efficient
molecular diagnostics, Pharmacogenomics 8:597-608.

Renwick, L., Hardie, A., Girvan, EK., Smith, M., Leadbetter, G.,Claas, E., Morrison, D., Gibb, AP.,
Dave, J., Templeton, KE. 2008, Detection of meticillin-resistant Staphylococcus aureus and Panton-
Valentine leukocidin directly from clinical samples and the development of a multiplex assay using real-
time polymerase chain reaction, Eur. J. Clin. Microbiol. Infect. Dis [Epup ahead of print]

Reva, I., Higuchi, W., Takano, T., Singur, O., Ozaki, K., Isobe, H., Yabe, S., Saito, K., Baranovich, T.,
Enany, S., Otsuka, T., Potapov, V., Nishiyama, A., Yamamoto, T. 2009, A rapid screening method for
Panton-Valentine leukocidin-positive community-acquired methicillin-resistant Staphylococcus aureus
belonging to Multilocus sequence type 30 and its related clone using a combination of multiplex PCR and
pulsed-field gel electrophoresis, J. Infect. Chemother. 15: 75-83

Roberston, G.A., Thiruvenkataswamy, V., Shilling H., Prince, EP., Huygens, F., Henskens, F.,
Giffard, PM. 2004, Indentification and interrogation of highly informative single nucleotide polymorphism
sets defined by bacterial multilocus sequence typing databases, J. of Med. Microbiol. 53: 35-45

Robinson, JO., Pearson, JC., Christiansen, KJ., Coombs, GW., Murrary, RJ. 2008, Community-
associated versus healthcare-associated methicillin-resistant Staphylococcus aureus bacteraemia: a 10-year
retrospective review, Eur. J. Clin. Microbioal. Infect. Dis. [Epub ahead of print]

Rossney, A., Shore, A., Morgan, P., Fitzgibbon, M., O’Connell, B., Coleman, D. 2007, The Emergence
and Importation of Diverse Genotypes of Methicillin-Resistant Staphyloccus aureus (MRSA) Harboring
the Panton-Valentine Leukocidin Gene (pvl) Reveal that pvl is a Poor Marker of Community-Acquired
MRSA Strains in Ireland, J. Clin. Microbiol 45: 2554-2563

Schlievert, PM. 2009, Cytolysins, Superantigens, and Pneumonia Due to Community-Associated
Methicillin-Resistant Staphylococcus aureus, J. Infect. Dis. 200: 676-678

Stam-Bolink, EM., Mithoe, D., Baas, WH., Arends JP., Möller, AVM. 2007, Spread of a methicillin-
resistant Staphylococcus aureus ST80 strain in the community of the northern Netherlands, Eur. J. Clin.
Microbiol. Infect. Dis. 26:723–727

Stapleton, PD., Taylor, PW. 2002, Methicillin resistance in Staphylococcus aureus: mechanisms and
modulation, Sci. Prog. 85: 57-72

Stephens, AJ., Inman-Bamber, J., Giffard, PM., Huygens, F. 2008, High-Resolution Melting Analysis of
the spa Repeat Region of Staphylococcus aureus, Clin. Chem, 54: 432-436



                                                                                                             96
Stephens, A., Huygens, F., Giffard, P. 2007, Systematic Derivation of Marker Sets for Staphyloccoal
Cassette Chromosome mec Typing, Antimicrob. Agents and Chemother . 51: 2954-2964

Stephens, A., Huygens, F., Inman-bamber, J., Price, EP., Nimmo, GR., Schooneveldt, J., Munckhof,
W., Giffard, P. 2006, Methicillin-resistant Staphylococcus aureus genotyping using a small set of
polymorphisms, J. Med. Micro. 55: 43-51

Shopsin, B., Gomez, M., Montgomery, MO., Smith, DH., Waddington, M., Dodge, DE., Bost, DA.,
Riehman, M., Naidich, S., Kreiswirth, BN. 1999, Evaluation of Protein A Gene Polymorphic Region
DNA Sequencing for Typing of Staphylococcus aureus Strains, J. Clin. Micro. 37: 3556-3563

Tang, YW., Waddington, MG., Smith, DH., Manahan, JM., Kohner, PC., Highsmith, LM., Li, H.,
Cockerill, FR 3rd., Thompson, RL., Montgomery, SO., Persing, DH. 2000, Comparison of Protein A
Gene Sequencing with Pulsed-Field Gel Electrophoresis and Epidemiologic Data for Molecular Typing of
Methicillin-Resistant Staphylococcus aureus, J. Clin. Microbiol. 38:1347-51.

Turnidge JD., Kotsanas D., Munckhof W., Roberts S., Bennett CM., Nimmo GR., Coombs GW.,
Murray RJ., Howden B., Johnson PD., Dowling K; Australia New Zealand Cooperative on Outcomes
in Staphylococcal Sepsis, 2009, Staphylococcus aureus bacteraemia: a major cause of mortality in
Australia and New Zealand, Med. J. Aust. 191:368-73.

Vaugh, CP., Elenitoba-Johnson, KSJ. 2004, High-Resolution Melting Analysis for Detection of Internal
Tandem Duplications, J. Molec. Diag. 6: vol 3

Van deVelde, H. 1894, Etude sur le Mécanisme de la virulence du Staphylocoque pyogène, La Cellule. 10:
401-410

von Heijne, G., and M. Uhlen. 1987. Homology to region X from staphylococcal protein A is not unique
to cell surface proteins, J. Theor. Biol. 127:373–376.

Vorobieva, V., Bazhukova, T., Hanssen, AM., Caugant, DA., Semenova, N., Haldorsen, BC.,
Simonsen, GS., Sundsfjord, A. 20018, Clinical isolates of Staphylococcus aureus from the Arkhangelsk
region, Russia: antimicrobial susceptibility, molecular epidemiology, and distribution of Panton-Vanelntine
leukocidin genes, APMIS 116: 877-887


Voyich, JM., Otto, M., Mathema, B., Braughton, KR., Whitney, AR., Welty, D., Long, RD., Dorward,
DW., Gardner, DJ., Lina, G., Kreiswirth, BN., DeLeo, FR. 2006, Is Panton-Valentine Leukocidin the
Major Virulence Determinant in Community-Associated Methicillin-Resistant Staphylococcus aureus
Disease? J. Infect. Dis. 194: 1761-1770

Weigel, LM., Clewell, DB., Gill, SR., Clark, NC., McDougal, LK., Flannagan, SE., Kolonay, JF.,
Shetty, J., Killgore, GE., Tenover, FC. 2003, Genetic analysis of a high-level vancomycin-resistant
isolate of Staphylococcus aureus, Science. 302:1569–1571.

Weigel, LM., Donlan, RM., Shin, DH., Jensen, B., Clark, NC., McDougal, LK., Zhu, W., Musser,
KA., Thompson, J., Kohlerschmidt, D., Dumas, N., Limberger, RJ., Patel, JB. 2007, High-Level
Vancomycin-Resistant Staphylococcus aureus Isolates Associated with a Polymicrobial Biofilm,
Antimicrob. Agent. Chemother. 51:231-238

Witte, W., Braulke, C., Cuny, C., Strommenger, B., Werner, G., Heuck, D., Jappe, U., Wendt, C.,
Linde, HJ., Harmsen, D. 2005, Emergence of methicillin-resistant Staphylococcus aureus with Panton-
Valentine leukocidin genes in central Europe, Eur. J. Clin. Micrbiol. Infect. Dis. 24: 1-5

Wu, SW., Lencastre, H., Tomaz A. 2001, Recruitment of the mecA gene homologue of Staphylococcus
sciuri into a resistance determinant and expression of the resistant phenotype in Staphylococcus aureus, J.
Bacteriol 183:2417-2424

Wu, SB., Wirthesohn, MG., Hunt, P., Gibson, JP., Sedgley, M. 2008, High resolution melting analysis
of almond SNPs derived from ESTs, Theor. Appl. Genet. 118: 1-14


                                                                                                        97
Zhang, K., McClure, J., Elsayed, S., Louie, T., Conly, JM. 2005, Novel Mulitplex PCR Assay for
Characteriszation and Concomitant Subtyping of the Staphylococcal Cassette Chromosome mec Types I to
V in Methicillin-Resistant Staphylococcus aureus, J. Clin. Micro. 43: 5026-5033




                                                                                                       98

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:93
posted:2/15/2011
language:English
pages:83