primer designing tools by SBMirza

VIEWS: 23 PAGES: 5

									  Primer Desighning
  Tools (practicle)
                           S B Mirza 1314




    SUBMITTED TO:Ma’m
           Asma Ashraf

BS(hons)Bioinformatics;7
                 th(a.n)

SUBJECT:BIOIFORMATICS3

             11/21/2010
                         Primer Desighning Tools (practicle)


DNA Template and oligonucleotide primers must be considered in greater detail (Linz et al., 1990).
Efficacy and sensitivity of PCR largely depend on the efficiency of primers (He et al., 1994).

There are many tools for primer designing and doing different tasks related to primer:




S b mirza1314                                                                                    Page 1
                        Primer Desighning Tools (practicle)




There will be described two tools of them

   1. Primo Degenerate 3.4
   2. Primer Design (PRIDE 2.0)

Primo Degenerate 3.4:

Primo Degenerate 3.4 designs PCR primers based on a single peptide sequence or multiple alignments of
proteins or nucleotides.

                http://www.changbioscience.com/primo/primod.html

   1. first take protein name and search for neucleotide sequence of it.on its home page
       http://www.ncbi.nlm.nih.gov/guide/
   2. then select a mRna sequence
       http://www.ncbi.nlm.nih.gov/nuccore/AY890601.1

       ACCESSION: AY890601

Synthetic construct Homo sapiens clone FLH134844.01X chemokine (C-C motif) ligand 20 (CCL20) mRNA,
complete cds


S b mirza1314                                                                                 Page 2
                        Primer Desighning Tools (practicle)
         ATGTGCTGTACCAAGAGTTTGCTCCTGGCTGCTTTGATGTCAGTGCTGCTACTCCACCTCTGCGGCGAAT
         CAGAAGCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTATTGTGGG
         CTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTG
         TCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGGCAAGA
         ACATGTAG
   3. then open the link paste sequence in input spacethen press go button belowthere on the screen




   4. Result will be shown there in next blank space to the input space.

Primer Design (PRIDE 2.0):

PRIDE is a primer design program that automatically designs primers in single contigs or whole
sequencing projects to extend the already known sequence and to double strand single-stranded
regions.

                http://ibios.dkfz.de/tbi_old/services/Pride/search_primer

   1. Put sequence in input bar and then press submit.
   2. Result will be shown in next window with link

                http://ibios.dkfz.de/tbi_old/services/Pride/nph-search_primer




S b mirza1314                                                                                    Page 3
                   Primer Desighning Tools (practicle)




         Result




S b mirza1314                                            Page 4

								
To top