Supplementary Material and Methods miocardial infarction

							Supplementary Material and Methods



Transfection efficiency

       The efficiency of transgene expression was assessed in the rat hearts post

myocardial infarction by LAD ligation, followed by direct injection of beta–galactosidase

coding plasmid into border zone of the myocardium. The transfected hearts were

harvested 4 d after treatment and cryopreservation. For visualization of beta-galactosidase

activity 4 μm thickness heart tissue sections were incubated with X-Gal reagent (5-bromo-

4-chloro-3-indolyl-β–D-galactosidase, Sigma, St. Louis, MO) in 5 mM K3Fe(CN)6,

5mM K4Fe(CN)63H2O, 2 mM MgCl2 in PBS for 12 h at room temperature.

Transfection efficiency of myocardium was evaluated by counting beta-galactosidase

positive cardiomyocytes in 3 sections (10 randomly selected fields per section) taken from

basal, medial and apical regions of the infarct border zone.



Measurement of human uPA and VEGF gene expression

Expression of human VEGF165 and uPA were assessed by RT-PCR, Western blot and

immunohistochemistry.

RT-PCR: Hearts were rapidly removed from the animals and snap frozen in liquid nitrogen.

Before freezing, left ventricles from rats with MI were surgically separated into infarcted and

remaining non-infarcted portions which were easily distinguishable under the macroscope. For

evaluation of human uPA and VEGF mRNA expression samples of infarcted border region of

the left ventricle (approximately 2 mm around scar area) were obtained at 3, 7, 14 and 28 d after

operation/injection of corresponding plasmids (n=3/group). Total RNA was isolated utilizing



                                                                                               1
RNeasy kit (Qiagen, Valencia, CA) and levels of human uPA, VEGF and beta-actin expression

were analyzed by RT-PCR (Hostar Taq PCR, Qiagen, Valencia, CA). The following sets of

oligonucleotides were used as primers: uPA 5’ – primer (5’-GGGGGCTCTGTCAC-CTACG-3’)

and 3’ – primer (5’- GGCCCCAGCTCACAATTCCAGTC -3’); VEGF 5’ – primer (5’-

GGAGGA             GGGCAGAATCATCACGAA-3’)                     and            3’–primer       (5’-

GCCTTGCAACGCGAGTCTGT-3’);                    beta-actin:      5’         –       primer      (5’-

TCATGAAGTGTGACGTTGACATCCGTA-AAG-3’)                         and     3’       –     primer    (5’-

CCTAGAAGCATTTGCGGTGCACGATGGAGG – 3’). Thermal cycling parameters were 2

min at 940C for cDNA denaturation followed by 35 cycles of 30 sec at 94 0C for denaturation, 30

sec at 57.8С for anneal and 45 sec at 720C for extend. After final extend step (8 min at 720C)

PCR samples were analyzed on 0.8% agarose gel.

Western Blot: At 3, 7, and 14 d after plasmid injections, 3 hearts from each group were collected

to assess the VEGF and uPA protein levels. Isolated left ventricals were cut into small pieces,

immediately frozen in liquid nitrogen, and homogenized with a Polytron homogenizer at 10000

rpm for 30 sec in ice-cold PBS, followed by 30 sec sonication. The homogenates were

centrifuged at 35000g for 15 min. 30 μg of supernatant protein from each sample were loaded

onto a SDS 10% polyacrylamide gel for electrophoresis followed by transfer onto nitrocellulose

membrane. The membrane was incubated with anti-human VEGF monoclonal antibody (Abcam,

Cambridge, MA, USA; cat#ab119, dilution 1:1000) or anti-human uPA monoclonal antibody

(American diagnostic, Stamford, CT; cat#3689, dilution 1:1000) at 4 oC overnight, followed by

1 hour incubation with a HRP-conjugated secondary antibody (Sigma, St. Louis, MO; dilution

1:1000). Blots were visualized by chemiluminescence (Pierce).




                                                                                               2
Immunohistochemistry: The tissue sections were prepared from heart isolated on 7 d after MI and

plasmid injection for 3 groups: control plasmid, uPA and VEGF plasmid. Sections were stained

with human specific antibodies against VEGF (Abcam, Cambridge, MA, USA; cat#ab119,

dilution 1:1000) and uPA (American diagnostic, Stamdford, CT; cat# 3689, dilution 1:1000) for

1h. The rest of the staining steps were made similar to those for vessel density assessment (see

above).



Vascular density evaluation.

       At the end of the studies (for myocardial infarction at day 14 d and for hindlimb ischemia

at 20 d), animals were sacrificed and hearts (from rats) or tibialis anterior muscles (from mice)

were harvested, mounted into O.C.T. medium and snap-frozen in liquid N2. Frozen sections (6

μm) were used for vessel density assessment. Vessels were visualize by staining tissue sections

for von Willebrand factor (rat hearts), α-smooth muscle actin (α-SMA) (rat hearts), CD31

(mouse muscles).

    Formalin fixed sections of rat hearts were incubated in 3% H2O2 for 30 min followed by 30

min incubation with 10% goat serum/1%BSA in PBS to block endogenous peroxidase activity

and minimize non-specific binding of antibodies. Sections were incubated with rabbit anti-vWF

polyclonal antibodies (Sigma, St. Louis, MO; F-3520, dilution 1:800) or with murine anti-SMA

antibodies (Sigma, St. Louis, MO; А-2547, dilution 1:1000) for 1 hour. Nonimmune rabbit or

mouse IgGs were used to confirm specificity. Biotinylated anti-rabbit or anti-mouse IgGs

(Jackson Immunoresearch Laboratories INC, West Grove, PA; dilution 1:1000) were used as

secondary antibodies (30 min incubation). For antibody detection AB–HRP complex (Vector

Labs, Burlingame, CA) was applied on sections for 30 min. The number of the vWF- and SMA-




                                                                                               3
positive vessels was counted in the peri-infarcted, infarcted and in the remote non-infarcted areas

using a light microscope Zeiss Axiovert. Vessels were counted on 3 sections (obtained at 1.5 mm

intervals along the long axis of the LV) separately in all available: (1) border zone, (2) infarct

zone, (3) remote non-infarct myocardium. Data analysis was performed by “blinded” method and

represented as number of vessels per hpf at 20x objective. Capillaries were scored as vWF-

positive vascular structures without “visible” lumen. Larger vessels were scored as SMA-

staining vascular structures with clearly visible lumen.

     Four counting purposes, myofibroblasts were defined as α-SMA+ cells not associated with

vascular structures in the border zones of forming scar tissue. The number of myofibroblasts was

counted in hpf under a 40x objective. The results represented as the number of structures (vessels

or myofibroblasts) per hpf ± SEM.

     Acetone-fixed sections of mouse muscles were incubated in 0.3% H2O2 for 10 min to block

endogenous peroxidase activity followed by 30 min incubation with 5% rabbit serum/2% BSA in

PBS to minimize non-specific binding of antibodies. Sections were incubated with rat anti-

mouse CD31 monoclonal antibodies (BD Pharmingen, San Jose, CA; dilution 1:50). Nonimmune

rat IgGs were used to confirm specificity. Biotinylated anti-rat IgGs (Vector, Burlingame, CA;

dilution 1:1000) were used as secondary antibodies. AB–HRP complex (Vector Labs) was used

to detect antibodies. The capillary density represented as ratio of total CD31 positive cells to

total myoblasts in the muscle section ± SEM.




                                                                                                 4