Your Federal Quarterly Tax Payments are due April 15th Get Help Now >>

Chapter 12 Dna and Genes Worksheet - PowerPoint by bye21073

VIEWS: 0 PAGES: 63

Chapter 12 Dna and Genes Worksheet document sample

More Info
									         Chapter 12 DNA
Also known as deoxyribonucleic acid
History of DNA
• In the mid 1900‟s scientists started
  asking the question:
  – “How do genes work?”
  – Like many scientific stories, the
    discovery of DNA was an accident
    while a scientist was trying to find out
    something else
Frederick Griffith
• Griffith was working on what was
  causing the deadly disease
  pneumonia
• Griffith isolated two separate strains:
  – A disease causing strain
  – A harmless strain
       Figure 12–2 Griffith’s Experiment
                                                                             Heat-killed,
                                                                             disease-causing
                                                                             bacteria (smooth
                                                                             colonies)



Disease-causing Harmless bacteria Heat-killed, disease-   Control            Harmless bacteria
bacteria (smooth (rough colonies) causing bacteria      (no growth)          (rough colonies)
   colonies)                      (smooth colonies)




   Dies of pneumonia    Lives        Lives                                 Dies of pneumonia
                                                Live, disease-causing
                                              bacteria (smooth colonies)
Griffith’s Experiment
• He found that mice injected with the
  disease-causing strain died of
  pneumonia
• However, if he heated the disease-
  causing strain and injected the mice
  with it they did not die at all
• This suggested that the disease
  wasn‟t caused by a chemical toxin
  released by the bacteria
Griffith’s Experiment
• When he injected
  mice with the heat
  killed disease-
  causing bacteria
  they did not die
  – When he added
    the harmless
    bacteria to the
    heat killed bacteria
    they did develop
    pneumonia and
    die!
Griffith’s Experiment
• Somehow the heat killed bacteria
  passed on their ability to cause
  disease to the harmless strain!!

• Griffith called this process
  transformation – one strain of
  bacteria changing into another
Griffith’s Experiment
• Griffith hypothesized that some
  “factor” was transferred from the
  heat-killed bacteria to the live,
  harmless bacteria

• He hypothesized that this factor was
  a gene that the live bacteria
  obtained from the heat-killed
  bacteria
Oswald Avery’s Experiment

• In 1944 Avery repeated Griffith‟s
  experiment
  – He changed it by creating an extraction
    of the “combined” bacteria and treating
    it with enzymes
  – These enzymes destroyed all of the
    proteins, fats, carbs, and RNA
Oswald Avery’s Experiment

• After he destroyed most of the
  organic components, transformation
  still occurred!
• He performed it one more time:
  – This time he destroyed the DNA in the
    mixture
  – As he had guessed, the mice lived
  – He concluded that it was the DNA that
    was responsible for the disease
Oswald Avery’s Experiment

• Avery‟s Conclusion:
  – DNA is the nucleic acid that stores and
    transmits genetic information from one
    generation of organism to the next
Hershey-Chase Experiment

• Alfred Hershey and Martha Chase
  wanted to explain Avery‟s findings
  further
  – They worked with bacteriophages
     • “bacteria eater”
     • They attach to the outside of a bacterium
       and inject their DNA into the cell
     • The DNA instructs the cell to make copies
       of itself until the cell bursts with more
       bacteriophages
Hershey-Chase Experiment

• They put radioactive markers on the
  outside of the bacteriophage as well
  as on the DNA inside
• These markers can be seen or
  followed during an experiment to
  determine which is left “inside” the
  bacterium to “infect” it
Hershey-Chase Experiment


   Bacteriophage       Phage infects   Radioactivity inside
   with phosphorus-    bacterium       bacterium
   32 in DNA




   Bacteriophage       Phage infects   No radioactivity inside
   with sulfur-35 in   bacterium       bacterium
   protein coat
Hershey-Chase Experiment

• Hershey and Chase concluded that
  the genetic material of the
  bacteriophage was DNA and not
  protein
   The Structure of DNA
• DNA is a long
  molecule made up of
  nucleotides

• Each nucleotide is
  made up of three
  parts:
   – A 5-carbon sugar
     called deoxyribose
   – A phosphate group
   – And a nitrogenous
     base
 The Nitrogenous Bases
• There are 4 kinds of Nitrogenous
  Bases:
  – The Pyrimidines:
    • Cytosine
    • Thymine
  – The Purines:
    • Adenine
    • Guanine
    *the sugar phosphate forms the
      “backbone” of the molecule
 The Nucleotides

  Purines         Pyrimidines
Adenine Guanine
              Cytosine Thymine




Phosphate group      Deoxyribose
      Chargaff’s Rules
• According to Erwin Chargaff:
  – Adenine always pairs with Thymine

  – Cytosine always pairs with Guanine
      The Double Helix
• James Watson and Francis Crick
  – Using the X-ray taken by Rosalind
    Franklin
  – And compiling data and research over
    many years
  – Watson and Crick “unlocked” the secret
    structure of DNA in 1953
    • The building blocks of ALL life
          The Double Helix
          Nucleotide

                                     Hydrogen
                                     bonds




     Sugar-
 phosphate
  backbone                        Key
                                  Adenine (A)
                                  Thymine (T)
                                  Cytosine(C)
                                  Guanine (G)



• base pairing- hydrogen bonds forming only
  between certain “base pairs”
   Chromosomes and DNA
        Replication
• DNA is the genetic material for the
  cell and the organism
• It is found in the nucleus of
  Eukaryotic cells
  – If Prokaryote cells don‟t have a
    nucleus, then where is the DNA
    stored?
   Its time to check for understanding


• We will now go to a DNA • We will go thru two
  site:                     of the slides and
• www.dnaftb.org/dnaftb/    the activities that
                            are part of the
                            interactive then
• We will go thru the
  Molecules of Genetics     you will view the
                            rest on your own.
  portion of the site and
 view slides 15-23.
                          • A worksheet and
                            quiz will follow.
• Then go to DNA site:
• www.dnai.org/
   Chromosomes and DNA
        Replication
• This E. coli bacterium has DNA but, it is
  compacted into the cytoplasm of the cell
• Most bacteria have a single, circular DNA
  molecule
  – E. coli has 4,639,221 base pairs!!!




Chromosome


  E. coli bacterium          Bases on the chromosome
       Eukaryotic DNA
• Eukaryotic DNA has as many as
  1000 times more base pairs as
  Prokaryotic DNA
  – It exists in the nucleus of the cell in
    the form of chromosomes
  – How many chromosomes make up a
    diploid human cell?
      Eukaryotic DNA

• How does the nucleus of a cell
  contain more than 1 meter of
  DNA?

• Eukaryotic chromosomes contain
  DNA and protein in a substance
  called chromatin
             Eukaryotic DNA
   • Chromatin – DNA tightly coiled around
     proteins called histones
   • Nucleosome – DNA and histones forming
     a beadlike structure
Chromosome    Nucleosome

                                             DNA
                                             double
                       Coils                 helix
        Supercoils




                           Histones
      DNA Replication
• The way that DNA is constructed
  allows for exact duplication

• When DNA is separated one side
  can be “copied” because of base
  pairing
      DNA Replication
• If you had a strand of DNA, but only
  one half of the strand, how would
  you create a complimentary strand?

  – Suppose you had the base pairs:
     • ATGCCCGTAATGTAACCGTTGAA

     • What would be the complimentary
       strand?
      DNA Replication
• Replication – process by which DNA
  duplicates or “copies” itself
  – during replication the strand of DNA
    separates into two strands
  – While this is happening two new
    strands are being formed
    simultaneously
  – This occurs at the replication fork
       DNA Replication
• DNA is “unzipped” by a special
  enzyme called DNA polymerase

  – The polymerase adds new nucleotides
    to pair with the “old” strand
  – It also proofreads it before it finishes to
    make sure there are no mistakes
              DNA Replication
                                      Original
                                      strand
                       New strand
                                                     DNA polymerase




              DNA polymerase




Replication                                             Replication
fork                                                    fork Nitrogenous

                               New strand                    bases
                                                 Original
                                                 strand
        Chapter 12 – 3
    RNA and Protein Synthesis
• At this point we all know that DNA
  provides the genetic code for all life
  on the planet

• So, “how does it work?”

• The key is it‟s relationship with RNA
  – Ribonucleic acid
  RNA and Protein Synthesis
• DNA is like a “library” of information
  in every cell of an organism

• RNA would be the “person” reading
  the individual „books‟ in the library
  – The manufacture of proteins is
    ESSENTIAL for the life of the
    organism!
         Structure of RNA
• RNA is much like DNA in that it is a
  long chain of nucleotides

There are THREE main differences:
 > the sugar in RNA is ribose
 > RNA is single stranded
 > RNA has Uracil in place of
    Thymine
                Three Types of RNA
                                                   RNA


                                               can be

        Messenger                            Ribosomal                            Transfer
          RNA                                   RNA                                 RNA



also called     which functions to   also called    which functions to   also called which functions to

                                                         Combine                          Bring
 mRNA               Carry             rRNA                                tRNA         amino acids
                                                           with
                 instructions                                                               to
                                                         proteins
                                                                                        ribosome

              from              to                       to make
                                                            up

      DNA                Ribosome                        Ribosomes
        Transcription
• Transcription is the process of
  “making” RNA molecules by creating
  a complimentary strand to a section
  of DNA

• The enzyme responsible for
  “reading” the DNA code is RNA
  polymerase
        Transcription
• During transcription, RNA
  polymerase attaches to the DNA and
  separates the strands

• The RNA polymerase then uses one
  strand of DNA as a template to
  make complimentary nucleotides
  into a strand of RNA
             Transcription
Adenine (DNA and RNA)
Cystosine (DNA and RNA)
Guanine(DNA and RNA)
Thymine (DNA only)
Uracil (RNA only)




                            RNA
                            polymerase

                          RNA   DNA
        Transcription
• Promoters – specific sites where the
  RNA Polymerase binds to the strand
  of DNA to begin transcription
          RNA Editing
• The “finished” mRNA strand has
  been edited before it goes to work

• The pieces that are kept are called
  exons

• The pieces that are “cut” are called
  introns
       The Genetic Code
• Proteins are assembled in polypeptides
  – These are long chains of amino acids

  – There are 20 different types of amino
    acids

  – The properties of proteins are
    determined by which order these amino
    acids are joined
      The Genetic Code
• mRNA is the key to the genetic code
  and it provides for the manufacture
  of all proteins in the body

• A strand of mRNA is read three base
  pairs at a time
  – UCGAAGCUUACA would be …..
  – UCG-AAG-CUU-ACA
      The Genetic Code
•Each of these amino acids that
 mRNA ―codes‖ for recognizes the
 three base pair sequence

•A codon consists of three
 consecutive nucleotides that specify
 a single amino acid
      The Genetic Code
•Along with the twenty amino acids
 there are ―special‖ base pair
 sequences that ―code for‖ start and
 stop codons
•Stop codons are like the ―period at
 the end of a sentence‖.
  – They signify the end of a polypeptide
The Genetic Code
            Translation
• The decoding of a strand of mRNA into
  a protein is known as translation

• At this point we have taken a strand of
  DNA and created a strand of mRNA by
  the process of transcription
  – DNA  mRNA  polypeptide chain
  – Polypeptide chain  Protein

• The next step is to make proteins!!
           Figure 12–18 Translation
           Messenger RNA :                 Nucleus
           Messenger RNA is
           transcribed in the nucleus.



                         tRNA             Lysine   mRNA
      Phenylalanine
   Methionine

                                         Transfer RNA

Ribosome



mRNA                     Start codon
          Translation
• As a strand of DNA is read during
  transcription a complimentary strand of
  RNA is made
  –TACAAGTTT (DNA)
  –AUGUUCAAA (RNA)
             Translation
• That strand of RNA is known as mRNA
  and leaves the cell nucleus where it
  attaches to a ribosome
• AUGUUCAAA (mRNA)




  Ribosome


mRNA
                Start codon
          Translation
• Each strand of mRNA is separated
  into three base pairs called codons

•AUG —- UUC --- AAA (mRNA)

•This is where transfer RNA comes
 in (tRNA)
             Translation
  • tRNA is responsible for getting the right
    anticodon with each of the mRNA codons
  • An amino acid is attached to each
    anticodon




                              Lysine
                            tRNA
Ribosome




mRNA
               Figure 12–18 Translation
The Polypeptide “Assembly
                                                Growing polypeptide
Line” The ribosome joins the                    chain
two amino acids & breaks the
bond between the tRNA & it’s                                 Ribosome
amino acid                      tRNA
             Lysine      tRNA




                                    mRNA      Completing the
                                               Polypeptide
  mRNA                                   The process continues until the
         Ribosome
                      Translation      ribosome reaches one of the three
                      direction           stop codons. The result is a
                                           growing polypeptide chain.
        Translation
• The ribosome acts like an
  assembly line worker and attaches
  each amino acid to the next one.

• The ribosome also detaches the
  amino acid from it’s tRNA

• This happens until a stop codon is
  reached and there is a long chain
  of amino acids (a polypeptide)
              Mutations
• Mutations are changes
  in the DNA sequence
  that affect genetic
  information
• Genetic mutations
  result from changes in
  a single gene
• Chromosomal
  mutations involve
  changes in whole
  chromosomes
             Mutations
• Mutations that only affect one
  nucleotide are called point mutations
  – Point mutations generally only affect one
    amino acid in the sequence
  THE DOG BIT THE CAT
  THE DOG BIT THE CAR
  Normal: AUG-AAG-GGC-UAA
   Protein: Met - Lys - Gly - Stop
  Normal: AUG-AAG-AGC-UAA
   Protein: Met - Lys - Ser - Stop
              Mutations
• Frameshift mutations are much more
  dangerous to the genetic code!
• They occur when a nucleotide is added
  (inserted) or deleted
• This ―shifts‖ the reading frame of the
  gene
  THE DOG BIT THE CAT
    ** What happens if you remove the ―G‖ in DOG
  THE DOB ITT HEC AT
  **The same would happen if you added a letter
              Gene Mutations:
         Substitution, Insertion, and
                   Deletion


Substitution                      Deletion
                      Insertion




     Mutations can be very dangerous
          and VERY SCARY!!
            Mutations
• Chromosomal mutations involves the
  change in the number or structure of
  chromosomes
• There are Four Types:
  – Deletion – the loss of all or part of a
    chromosome
  – Duplication – when a segment of a
    chromosome is repeated
  – Inversion – When part of a chromosome
    becomes oriented in the reverse direction
  – Translocation – when part of a chromosome
    breaks off and attaches to another
Chromosomal Mutations

                         Deletion




                        Duplication




                        Inversion




        Translocation
THE END

								
To top