Additional file 4 List of primers used for microarray

Document Sample
Additional file 4 List of primers used for microarray Powered By Docstoc
					Additional file 4: List of primers used for microarray validation. The primers
efficiency in real-time PCR was calculated according to a dilution curve prepared for
each primer.

                                                        Product       Efficiency in
   Gene                      Primers                                 real-time PCR
                                                          size
adh5           GTCCCAAAGCTGGTGAACGAC
                                                         111 bp          E=1.99
AF399909       AGCATGCATCAGGTCAAAGGC
adh8b          GTTCGGAGCCACAGATTTCC
                                                         113 bp          E=2
AY309075       GTTGCCCACACACTCCAGAGA
vtg1           ACTACCAACTGGCTGCTTAC
                                                         100 bp          E=2
NM_170767      ACCATCGGCACAGATCTTC
vtg3           CAGATGGCTTTATCGGCGTGAC
                                                         112 bp          E=2
 AF254638      CACGGCAGGCCCATTGAAAC
efia           AATCGGTGGTGCTGGCAAGGTC
                                                         101 bp          E=2
 L23807        AAGAACTCGCCGCAACCTTTG
cyp2k6         TGAGTGGGAAACGCCTGA
                                                         126 bp          E=2
AF283813       GCCAAACTCTCTCCAATGCA
raraa          ATGGATGACGCTGAGACGGGAC
                                                         147 bp          E=1.8
L03398         GTGTGGCCTTCTGTTCCTCACG
cyp1a          GCAGGTTTTGACACTATCAGT
                                                         160 bp          E=2
AF057713       GACTCCAGAAGCGGCAG
igf1           CCTCGAGATGTATTGTGCG
                                                         125 bp          E=1.8
AF268051       TACAGGAAGAGTGGCTATGC
esr1           TAGTTGACGCATGTGCCA
                                                         123 bp          E=1.9
AF349412       TAGGAGCGCTCACTCTGATC
rdh10          TTTGCCGTTTGATGCCATTGTG
                                                          92 bp          E=2
BI890056       TCGTCGACTCCTTGCGTTGAGC
rdh14          TCCTGGCCTGCAGAGACATGAG
                                                         110 bp          E=2
BF718032       CTGCAAAGAGGCCAGATCCAGC
dhrs10         CAGGGTATTGGCAGGGCTTTCG
                                                          91 bp          E=2
BI888372       TGCGCCACATCCTCAGCCTTTC
scd            GGATCACCGCGTGCATCACAAG
                                                         101 bp          E=1.9
BF717695       TTCGAACCAGCAGCCAGCCAAC
fads2          CAGCGGACACCTCAACTT
                                                         188 bp          E=1.8
AF309556       AGCCAGAGCTCGCCAGA
star           ACCTGTTTTCTGGCTGGGATG
                                                          81 bp          E=1.9
AF220435       GGGTCCATTCTCAGCCCTTAC