Docstoc

CHICKEN INFECTIOUS ANEMIA IN YOUNG BROILER FLOCKS IN ISRAEL

Document Sample
CHICKEN INFECTIOUS ANEMIA IN YOUNG BROILER FLOCKS IN ISRAEL Powered By Docstoc
					 ISRAEL JOURNAL OF


 VETERINARY MEDICINE
                    Case Report
                    CHICKEN INFECTIOUS ANEMIA IN YOUNG BROILER
                    FLOCKS IN ISRAEL

                 Davidson I.1*, Shkoda I.1, Elkin N.2, Ayali, G3., Hamzani E.3, Kass N.3, Smith
                 B.4, Borochovitch H.4, Gilat G.5,
Vol. 59 (4) 2003 Krispin H.6, Kedem M.7 and Perk S.1
                 1. Division of Avian Diseases, Kimron Veterinary Institute, Bet Dagan, Israel, 2.
                 Or Yehuda, Neve Savion, Israel
                 3. Tzfat, Regional Poultry Disease Laboratory, Veterinary Services, Israel
                 4. Afula, Regional Poultry Disease Laboratory, Veterinary Services, Israel
                 5. Kiryat Tivon, Israel, 6. Yavne, Israel
                 7. Akko Regional Poultry Disease Laboratory, Veterinary Services, Israel
       Summary

    An outbreak of chicken infectious anemia virus-related clinical signs in broiler
 flocks is described. The flocks were derived from three broiler breeder flocks. The
 presence of CIAV sequences was determined by PCR in the progeny, broiler
 flocks, and CIAV-antibody levels in the parent broiler breeder flocks were
 determined by ELISA. These levels were low and inconsistent,. The progeny
 broiler flocks showed typical clinical signs of CIAV-infection and were PCR
 positive. The survey also included three control unaffected broiler flocks, that
 originated from breeder flocks of similar ages and genetic lines, and reared on
 other breeding farms. These differed in the maternal antibody levels transmitted to
 their progeny. Moreover the progeny flocks were negative clinically and by CIAV-
 PCR.

    The data illustrate the necessity of adequate levels of immunity of the parent
 flock to prevent the acute disease in their progeny.



Introduction

    Chicken infectious anemia virus (CIAV) was first described in 1979 by
Yuasa in Japan (1) as a circovirus with exceptional characteristics. Since
then, CIAV has been detected by isolation or serology in many countries in
both laying and broiler chickens (2). The disease prevalence in commercial
flocks      in     Israel     has     recently      been       reported      (5).
Infections with CIAV are considered to be economically significant because
clinical disease is associated with both vertical and horizontal transmission.
CIAV infections are manifested by either clinical or subclinical signs. In young
chicks of less than 3 weeks without CIAV maternal antibodies, infection
results in stunting, runting, increased mortality, anemia, depletion of bone
marrow cells and thymocytes, subcutaneous hemorrhages, and a decreased
resistance to secondary bacterial diseases such as gangrenous dermatitis
and campylobacter colonization. These effects are caused because CIAV
infects stem cells of both the hematopoietic and lymphocyte cell lineages in
the bone marrow and thymus. In older chickens the virus decreases the cell-
mediated immune responses resulting in increased morbidity caused by
various                   pathogens                      (3,                   4).
Most commercial flocks have been exposed to CIAV either by vaccination or
natural exposure and develop antibodies which are transferred to their
offspring. As a consequence, acute disease in young birds is rare. Once
neutralizing antibodies develop, active viremia is curtailed and infectious CIAV
is eliminated thereby preventing vertical transmission (6, 7). Several
outbreaks of infectious anemia have been correlated with the absence of anti-
CIAV antibodies in the respective parent flocks (3, 8, 9, 10). Recently, a
number of young broiler flocks in Israel experienced outbreaks of clinical
disease compatible with CIAV infection. In the present note we describe the
epidemiology of the disease outbreaks, determine the presence of CIAV in the
affected birds, and the relation to the level of immunity to CIAV in the parent
broiler                              breeder                               flocks.



Materials and Methods

Chicken                                                                    flocks
   Three broiler breeder flocks were the source of the broiler flocks included in
the survey. The flock type, age and clinical signs were detailed in the results
section for each flock mentioned. In each flock 3 to 5 birds were examined.
DNA was obtained from the spleen, liver and feather tips of each bird (11).

DNA amplification

   Genomic DNA was used to amplify a 480 bp fragment of CIAV using
primers     C1     (CCAAGAAGATACTCCACCCG)             and      C2
(TACGATACCGCTGTCTCCTC) as described (12).

ELISA for CIAV antibodies

   CIAV antibodies were measured using the FlockChekR CAV (IDEXX, USA)
according to the manufacturer recommendations at a 1:10 serum dilution. The
ELISA results are expressed as the ratio between the samples assayed and
the negative control (S/N). The quantity of antibodies is inversely proportional
to     the      absorbance       A(650        nm),       and       the      S/N.



Results and Discussion

   The broiler flocks detailed in Tables 2 and 3 with the progeny flocks of three
breeder broiler flocks, A, B and C (Table 1). All the progeny broiler flocks were
affected with typical clinical signs, such as stunting, runting, hemorrhages,
increased mortality, gangrenous dermatitis and increased susceptibility to
various diseases, possibly due to CIAV. Table 1 presents the CIAV-antibody
levels of the parent flocks. The blood samples were obtained during 1 to 2
weeks preceding egg production of the broiler flocks described in Tables 2
and 3. The genetic line of the parent flocks B and C was the same, and the
same grandparent flock produced flocks B and C at a 4 days interval. As
shown in Table 1, the three parent flocks were of a similar age and their
serological response to CIAV was low and inconsistent. From 22 to 23 sera
from each flock were tested, the CIAV-antibody levels were low or negative,
with a high variation in antibody titers. Flock A was re-examined two months
afterwards and showed that a seroconversion had occurred about the same
time that the eggs for the progeny broiler flocks were laid.

   The major clinical signs were recorded in young broilers at the age when
the flocks were sampled (Tables 2 and 3) included a generalized weakness,
depression, stunting, growth retardation, ruffled feathers, gangrenous
dermatitis and increased mortality. At necropsy the carcasses, bone marrow
and liver were pale and internal and external hemorrhages were observed.

    Another part of the CIAV-infection related losses were indirect, and
consisted of aggravation of other, unrelated diseases that affected these
flocks at the same time. These included the increased expenses of
medications and decreased profitability. Because the variety of losses
observed in the affected flocks, and the difficulties in their quantitative
assessment, they were categorized by three parameters in Tables 2 and 3;
gangrenous dermatitis when it appeared to any extent was indicative,
morbidity refers to all the above findings, while mortality refers to increased
mortality, as high as 40-50%. Table 2 summarizes the findings in the progeny
broiler flocks derived from the parent broiler flock A from the eggs laid within 1
to 2 weeks preceding the first blood sample (Table 1).

   The present survey also includes three unrelated broiler flocks, (D-F), as
controls for the affected broiler flocks. Flocks D-F originated from other
breeder flocks of similar ages and genetic origin, which were reared on other
breeding farms. While all broiler flocks that originated from breeder flock A
showed typical clinical signs of CIAV and were CIAV-PCR positive, the three
control flocks (D, E, and F) were negative clinically and by CIAV-PCR. Tables
3a and 3b summarize the broiler flocks derived from breeder flocks B and C,
whose CIAV-antibody status was detailed in Table 1. On several farms, such
as farms I, VI and VII (Table 2) and farms I, II and III (Table 3a) the broiler
flocks were the progeny of other breeder flocks of the same genetic line. The
disease did not affect these three broiler flocks, and the PCR assays were
negative for CIAV. Altogether, we demonstrate now the close association
between the clinical signs and the positive CIAV-PCR in young broiler flocks.

   In summary, the CIAV-related conditions were investigated in view of the
acute outbreaks reported in broilers and an awareness of the CIAV impact on
poultry productivity. The present communication presents data that strengthen
the necessity for providing adequate immunity of breeder flocks as a means of
avoiding       the        acute      disease      in       their     progeny.
Table 1. CIAV antibody status of the three broiler breeder flocks


Flock    Genetic Age                   No. at              Arithmetic
                                                           Positive/    Standard    CV*
         strain  bleeding (days)       Total tested        mean (Amn)   Deviation

A        I         169                 3/23                 0.895       0.323       36.1
                   230                 21/22                0.318       0.156       49.2
                   257                 22/22                0.252       0.2         79.4

B        II        182                 24/24                0.911       0.279       30.6
                   244                 24/24                0.082       0.016       19.5

C        II          189                  21/23             0.319       0.166       52.0
                     256                  23/23             0.084       0.033       39.2
* Coefficient of variation = Standard deviationX100/Amn
Table 2. CIAV presence in the progeny flocks of broiler breeder flock A hatched from eggs laid
within 1-2 weeks after bleeding at 169 days.

Farm Line        Broiler flock Clinical signs                         CIAV-PCR
                 age at sampling
                  (days)


                                                                      No.
                                                    Morbidity Mortality birds tested Organ
                                Gangrenous dermatitis                                          PCR
I      A         16             +                       +     +       3             liver      +

                                                                      3             spleen     +
                                                                      3             feathers   +
                 19             +                       +     +       3             liver      +
                                                                      3             spleen     +
                                                                      3             feathers   +

I      D         18             -                       -     -       3             liver      -
                                                                      3             spleen     -
                                                                      3             feathers   -

II     A         19             +                       +     +       3             liver      +
                                                                      3             spleen     +
                                                                      3             feathers   +

III    A         42             +                       +     +       4             liver      +
                                                                      4             spleen     +
                                                                      4             feathers   +

IV     A         22             +                       +     +       3             liver      +
                                                                      3             spleen     +
                                                                      3             feathers   +

V      A         18             +                       +     +       4             liver      +
                                                                      4             spleen     +
                                                                      4             feathers   +

VI     E         18             -                       -     -       5             liver      -
                                                                      5             spleen     -
                                                                      5             feathers   -

VII    F         30             -                       -     -       4             liver      -
                                                                      4             spleen     -
                                                                      4             feathers   -




 Table 3a: CIAV presence in progeny flocks of broiler breeder flock B hatched from
eggs laid within
1 week after bleeding at 182 days


Farm       Line Broiler flock age at   Clinical signs                       CIAV-PCR
                  sampling (days)        Gangrenous   Morbidity   Mortality   No. birds     Organ          PCR
                                         dermatitis
                                                                              tested
I         B       16                     +            +           +           3             liver          +
                                                                              3             spleen         +
                                                                              3             feathers       +
          D       16                     -            -           -           4             liver          -
                                                                              4             spleen         -
                                                                              4             feathers       -
II        B       16                     +            +           +           3             liver          +
                                                                              3             spleen         +
                                                                              3             feathers       +
          E       13                     -            -           -           3             liver          -
                                                                              3             spleen         -
                                                                              3             feathers       -
III       B       17                     +            +           +           4             liver          +
                                                                              4             spleen         +
                                                                              4             feathers       +
                  22                     +            +           +           4             liver          +
                                                                              4             spleen         +
                                                                              4             feathers       +
          F       22                     -            -           -           5             liver          -
                                                                              5             spleen         -



 Table 3b: CIAV presence in progeny flocks of broiler breeder flock C, hatched from
eggs laid 4 weeks after bleeding at 189 days.

FarmLine Eggs laid at no.    Broiler flockClinical signs                CIAV-PCR
         weeks post bleeding age at event GangrenousMorbidity Mortality No.
                                                       dermatitis               Organ                  PCR birds
                                                                        tested
I     C       1                     16         +          +       +           6           liver        +
                                                                              6           spleen       +
                                                                              6           feathers     +
II    C       1                     17         +          +       +           5           liver        +
                                                                              5           spleen       +
                                                                              5           feathers     +
III   C       2                     15         +          +       +           3           liver        +
                                                                              3           spleen       +
                                                                              3           feathers     +
IV    C       3                     38         +          +       +           5           liver        +
                                                                              5           spleen       +
                                                                              5           feathers     +
V     C       4                     3          -          -       -           10          liver        -
                                                                              10          spleen       -
Acknowledgement
This study was supported by Grant US-3535-04R from the USA-Israel
Agricultural  Research    and     Development    Fund    (BARD).


LINKS TO OTHER ARTICLES IN THIS ISSUE




References
1. Yuasa, N., Taniguchi, T. & Yoshida I. (1979). Isolation and some
characteristics of an agent inducing anemia in chicks. Avian Dis. 23, 366-385.
2. Schat, K.A. (2003). Circovirus infections, Chicken infectious anemia. In:
Y.M. Saif, H.J. Barnes, A.M. Fadly, J. R. Glisson, L.R. McDougald, and D.E.
Swayne (eds) Diseases of Poultry, 11th edition, Iowa State Press, Ames,
Iowa,                                                               pp182-202.
3. Fehler, F., & Winter, C. (2001). CIAV infection in older chickens: An
apathogenic infection? The International Symposium on infectious bursal
disease and chicken infectious anaemia, Rauischholzhausen, Germany, pp.
391-394.
4. Markowski-Grimsrud, C.J., & K.A. Schat. (2003). Infection with chicken
anemia virus impairs the generation of pathogen-specific cytotoxic T
lymphocytes.                 Immunology               109,            283-294.
5. Davidson I., Kedem, M., Borochovitz, H., Kass, N., Ayali, G., Hamzani, E.,
Perelman, B., Smith, B. & Perk. S. (2004). Chicken Infectious Anemia virus
infection in Israeli commercial flocks; Virus amplification, clinical signs,
performance and antibody status. Avian Diseases, 48, 113-123.
6. Otaki Y., Saito, K., Tajima, M. & Nomura, Y. (1992) Persistance of maternal
antibody to chicken anemia agent and its effect on the susceptibility of young
chickens.             Avian            Pathol.           21,          147-151.
7. Yuasa N., Noguchi, T., Furuta K. & Yoshida, I. (1980). Maternal antibody
and its effect on the susceptibility of chicks to chicken anemia agent. Avian
Dis.                                 24,                              197-201.
8. Chettle, N.J., Eddy, R. K., Weyth, P.J. & Lister, S.A. (1989) An outbreak of
disease due to chicken anemia agent in broiler chickens in England. Vet Rec.
124,                                                                  211-215.
9. Vielitz E. & Landgraf, H. (1988). Anemia-dermatitis of broilers: Field
observations on its occurrence, transmission and prevention. Avian Pathol.
17,                                                                   113-120.
10. Yuasa N., Imai, K., Watanabe, K., Saito, F., Abe M. & Komi, K., (1987).
Aetiological examination of an outbreak of haemorrhagic syndrome in a broiler
flock       in       Japan.        Avian       Pathol.       16,      521-526.
11. Davidson, I., Kedem, M., Borochovitz,, H., Borenshtain, R., Hamzani, E.,
& Smith. B. (2003). Detection and environmental monitoring of DNA viruses
using the feathers of commercial chickens. Annual Meeting WPSA/AAAP
Denver,                                  Co,                              USA.
12. Imai, K., Mase, M., Yamaguchi S., & Yuasa, N. (1998). Detection of
     chicken anemia virus DNA from formalin-fixed tissues by polymerase chain
     reaction.     Res.      In       Vet.       Sci.       64,      205-208.


1.