Docstoc

meme

Document Sample
meme Powered By Docstoc
					Signal Finding Upstream and Downstream of Transcription Factor Binding Sites

Signal Finding Upstream and Downstream of Transcription Factor Coding Regions
in Saccharomyces cerevisiae

By Sarah Healy, Murtaza Mogri



Abstract

The regulation of gene expression is still a major unresolved issue of molecular biology.
Although it is known that transcription factors control gene expression, it is not clear how
the transcription factors themselves are controlled. It is quite likely that the control
mechanism is embedded into the DNA near the location of the transcription factors. To
determine if this is true in Saccharomyces cerevisiae, the 500 base pairs upstream and
downstream of several groups of transcription factors were studied. These groups of
transcription factors were related by their cell function, as suggested by the Proteome
Database. MEME was used to search for motifs in related sequences. The data collected
showed that overall, there are very few strong signals 500 base pairs from the
transcription factors. Most of the motifs found by MEME were patterns of AA, TT, and
AT. Nevertheless, a few groups had relatively strong motifs that correlated to the
function of the transcription factors. Not all cell functions were studied, but out of the
fifteen groups studied, only three groups – mating, DNA repair, and differentiation – had
an observable relationship between motif and function.


Introduction

One of the primary mechanisms for regulating gene expression occurs at the level of gene
transcription into RNA. A number of regulatory proteins contain domains capable of
binding to DNA and either inducing or repressing transcription (8). These transcription
factors are encoded elsewhere in the DNA sequence and their expression is also
controlled. Proteins or small molecules activate or deactivate transcription factors.
However, the underlying mechanisms of how these regulatory elements are themselves
regulated in order to produce an appropriate response to external or internal stimuli
remain to a large extent unresolved.

Numerous studies are underway to elucidate the links between signaling pathways and
regulatory functions. The number of cell types, developmental stages and complicated
inter- and intra-cellular reactions is so enormous that not all combinations can be
specifically investigated by experimental setups. This necessitates the use of in silico
methods for the identification of links in the complex cellular pathways.



                                                 1
Finding a cluster of numerous similar subsequences in a set of DNA sequences is
evidence that the subsequences occur not by chance but because they share some
biological function. In this project, we investigated the hypothesis that the mechanism
linking signaling pathways, gene transcription via transcription factors and the cellular
roles of the expressed genes involves specific signals in the DNA sequence near the
sequence of the transcription factor itself. These signals, that are undetermined a priori,
may then be used to uncover mechanisms of signaling crosstalk and responses to the
cellular environment.

The organism chosen for investigation was the yeast S.cerevisiae. The genome for
S.cerevisiae is easily available and the organism itself is well documented. Also, yeast
signaling pathways and genome are not as simple as bacteria, but not nearly as
complicated as in Homo sapien. Moreover, there are several recent studies on yeast
signaling pathways.

MEME and the MM algorithm

Many pattern finding programs have been developed to search for signals in a set of
inputted sequences. The software package MEME, developed at the Supercomputing
Center at UCSD is one such program that can locate conserved subsequences in a set of
sequences without prior information. In previous studies, MEME has been shown to
reveal DNA binding sites in studies of E.coli and S. cerevisiae genes known to be
regulated by the same transcription factors.

This program uses the MM algorithm, which takes as input a dataset of unaligned,
possibly related biopolymer sequences and estimates the parameters of a probabilistic
model that could have generated the dataset. One component of the model describes a set
of similar subsequences of fixed width (the motif) while another component describes all
other positions in the sequences (background). Fitting the model to the dataset includes
estimating the relative frequency of motif occurrences. This estimated frequency
determines the threshold for a Bayes-optimal classifier that can be used to find
occurrences of the motif in other databases.

The MM algorithm is an extension of the expectation maximization technique for fitting
finite mixture models developed by Aitken and Rubin (1985). What distinguishes the
MM algorithm is that it relaxes the assumption that each sequence in the dataset contains
exactly one occurrence of the motif. Sequences containing zero, one or many occurrences
of a motif can be modeled equally well.

If more than one signal is to be found, all occurrences of the previously discovered motifs
are erased and the algorithm repeated with this new dataset.




                                          Page 2
Methods

All the transcription factor coding sequences with 1kb up- and down-stream flanking
regions were downloaded from the Stanford Saccharomyces Genome Database (SGD)
(http://genome-www.stanford.edu/Saccharomyces). Perl scripts were written that
automatically downloaded the sequences, saved them as separate text files and generated
files of only the relevant sequence regions in a format that could be used as input to
MEME.

MEME was used as a motif-searching tool to locate signals up and down stream from the
transcription factor coding regions. Sets of sequences related by their cellular role were
used as input. The lists of related transcription factors were obtained from the Proteome
website (http://www.proteome.com/). The algorithm was run with both zoops and oops
options, on sequences of length 500 directly up and downstream from the transcription
factor coding region. Four sets of results were generated for each group of related
transcription factors. In most cases the maximum number of motifs was set to six.

MEME was also run with all 323 yeast transcription factors as input, with the zoops
option only, again both up and down-stream, but with sequence lengths of 100, 200 and
500.




                                          Page 3
Results

All the output from MEME is located at http://www-bioeng.ucsd.edu/~shealy. Due to the
magnitude of the output and the duration of this project, only some groups of results were
selected for analysis.

Mating

The transcription factors that play a role in the mating response in yeast are listed in
Table 1 with their function, internal motifs and chromosome location. More general
information on transcription factors is located in Appendix A.

 Name          Function                              Motifs                                 Chromosome

 ALPHA1        a positive regulator of STE3                                                     III
 ALPHA2        interacts with MCM1 to repress        Homeodomain box                            III
               STE6 and A1 to repress
               ALPHA1
 CCR4          affects transcription both            Leucine rich repeat                         I
               positively and negatively
 CHA4          required for CHA1 transcription       Zinc finger protein                       XII
 HMRA1         required together with Alpha2p        Homeodomain box                           III
               for repressing haploid-specific
               genes such as ALPHA1
 HMRA2         mating-type specific                  Homeodomain box                            III
               transcriptional control
 KAR4          May assist Ste12 in pheromone-                                                   III
               dependent expression of KAR3
               and CIK1
 MCM1          involved in repression of a-          SRF-type transcription factor             XIII
               specific genes and activation of
               alpha-specific genes
 MOT3          represses the pheromone               two tandem C2H2-type            zinc      XIII
               inducible genes                       fingers
  SIG1         involved in G protein mediated        RNA recognition motif                      V
               pheromone signal transduction         Zinc finger
 SPT3          activates mating pheromone                                                       IV
               genes
 STE12         transcriptional activator of genes    STE like transcription factor             VIII
               involved in the mating response
 TUP1          required for alpha2 repression of                                                III
               a-specific genes
 WTM1          WTM genes negatively regulate                                                   XV
               silencing at HMR
 YIL122W       promotes growth in the presence                                                  IX
               of alpha mating pheromone


Table 1: Mating transcription factors




                                                    Page 4
Normally Saccharomyces reproduce through asexual budding, but when the cells are
under stress, two cells of opposite mating type can fuse to from a diploid cell.
Saccharomyces are able to change their mating type from a1 or a2 to alpha1 or alpha2.
Cells that are a mating type secrete an a-factor pheromone while cells that are alpha
mating type secrete an alpha-factor pheromone.

The summary of motifs found in the regions up and downstream of these fifteen
transcription factors is presented in Appendix B with the combined block diagram.

An interesting result is the strong pattern of multiple motifs found both up and
downstream from Alpha1 and HMRA1 and downstream from Alpha2 and HMRA2. All
four of these transcription factors have coding regions on chromosome three and three of
them have a similar DNA binding domain (homeodomain box). What is also interesting
is that HMRA1 represses ALPHA1, yet they appear to have similar patterns of DNA
surrounding them.

In general there was no single motif that appeared in all mating response transcription
factors. This is probably due to the diversity of the functions of the transcription factors
and the fact that some may activate mating response genes while other repress them.

DNA Repair

The transcription factors involved in DNA repair, along with internal motifs and locus is
given in Table 2 below.
 Name      Function                           Motifs                               Chromosome

 GIS1      represses transcription of PHR1    • same number and arrangement            IV
           with RPH1                          of zinc finger domains as RPH1
 MET18 required for both Pol II               • an aspartokinase signature motif       IX
           transcription and DNA repair       • 15 tandem leucine-rich repeats
 RAD18 required for postreplication           • contains a potential nucleotide        III
           DNA repair                         and metal binding motifs
 RAD26 may be required for inhibiting         • has the seven motifs conserved         X
           transcription during DNA repair    among RNA and DNA helicases
 RFX1      normally represses transcription                                           XII
           of DNA repair genes, is itself
           repressed by DNA damage
 RPH1      represses transcription of PHR1    •contains two C2H2-type zinc             V
           with GIS1                          finger domains
 SET1      possibly involved in DNA repair    •SET domain                             VIII
 SPT4      modulates Rad26 requirement in     • contains a zinc-finger                VII
           DNA repair                         • contains several cysteines
 SSL1      one of the seven known subunits    • one zinc finger                       XII
           of TFIIH
 TFB1      one of the seven known subunits                                             IV
           of TFIIH
 TFB2      one of the seven known subunits                                            XVI
           of TFIIH
Table 2: DNA Repair transcription factors

                                               Page 5
A strong motif was found upstream of two transcription factors that are both damage-
responsive repressors of PHR1 (1). The PHR1 repair gene encodes a photolyase that
catalyzes the light-dependent repair of pyrimidine dimers. Both transcription factors
contain two putative zinc fingers that are identical throughout the DNA binding region,
and deletion of both RPH1 and GIS1 is required to fully derepress PHR1 in the absence
of damage.

Differentiation

During vegetative growth, Saccharomyces cerevisiae can change its shape and behavior
drastically depending on the environment. In a normal environment not lacking in
nutrients, yeast cells are uniformly ovoid in shape and dissociate from each other easily
(2). When there exists a lack of nitrogen, the cells begin pseudohypal growth. The cells
elongate and attach to each other creating an extended branched pattern, sometimes
called filamentous growth. The yeast colony forms filaments that extend outward from
the center of the colony. The change of growth seen in a nutrient rich environment to a
nutrient poor environment is called differentiation. These are the known transcription
factors involved in differentiation.
 Name          Function                               Motifs                          Chromosome

 ASH1          required for pseudohyphal              GATA zinc finger                XI
               growth
 FLO8          required for nitrogen starvation –                                     V
               induced diploid filamentous
               growth
 GLN3          positive nitrogen regulation;          GATA zinc finger                V
               induces nitrogen metabolizing
               genes
 HMS1          regulates pseudohyphal                 Helix-loop-helix DNA-binding    XV
               differentiation                        domain
 HMS2          transcription factor with probable     HSF-type DNA-binding domain     X
               role in pseudohyphal growth
 MSN1          transcriptional activator for genes                                    XV; X
               involved in nutrient limitation
 MSN2          Activator for genes involved in        Zinc finger, C2H2 type          XIII
               multistress response
 MSN4          activator for glucose control          Protein kinase domain           IV
               genes
 PHD1          Regulates filamentous growth           Yeast DNA-binding domain        XI
 RIM101        Induction of IME1 & 2                  Zinc finger, C2H2 type          VIII
               transcription
 SKN7          Controls oxidative stress              HSF-type DNA-binding domain;    VIII
               response and G1 cell cycle             Response regulator receiver
               control                                domain
 STE12         transcriptional activator of genes     STE like transcription factor   VIII
               involved in the mating response
 TEC1          transcriptional activator involved     TEA/ATTS domain family          II
               in pseuodhyphal formation
 YAP1          transcriptional activator of           bZIP transcription factor       XIII
               leucine zipper family
Table 3: Differentiation transcription factors
                                                     Page 6
In the set of differentiation transcription factors, there were no clear strong signals that
set a subset of the transcription factors apart. Nevertheless, there was one strong motif
upstream that was found in over half of the transcription factors. Another motif was
found in a group of five transcription factors. It was feasible to study the smaller group to
determine if the transcription factors in that group were related to each other more than
they were related to the other twelve transcription factors in the set.

The motif is 36 base pairs wide and has a high frequency of G and A. It includes the
transcription factors GLN3, FLO8, MDS3, HMRA2, and SDS3. Of these, three seem to
be related; the other two have very little information available; more research about the
function of those two would be needed to determine the relationship. GLN3 activates
PUT1, PUT2, and other nitrogen metabolizing genes when a good nitrogen source is not
available. The PUT genes use proline as a nitrogen source. FLO8 is required for
development of the diploid filamentous growth in nitrogen starved yeast. The HMRA2
gene when translocated can induce pseuodhyphal growth in yeast under nitrogen poor
conditions. Very little information is available about MDS3; it is only known that it is a
negative regulator of expression of early meiotic genes. Finally, SDS3 is weakly related
to HMRA2. Nevertheless, the relationship between the first three transcription factors
and nitrogen suggests that the motif could be used for signaling.


Discussion

From the data collected, it is plausible to suggest that there are no strong signals up- and
down-stream of all transcription factors. For some transcription factors, there are signals
which suggest similar function. The motifs found in mating, DNA repair, and
differentiation may be sites where a specific chemical or protein binds. For most of the
related transcription factors studied, the motifs found were very weak. This suggests that
not all transcription factors have signals up- and down-stream. More subsets need to be
studied to come to a proper conclusion.

There were plenty of difficulties in collecting and analyzing the data. Although a lot of
research has been completed to annotate the transcription factors, some of the research
produced contradicts research done by others. This makes it difficult to determine the
actual function of proteins. Even when there are no contradictions, it is not proper to
assume that the research is correct; much of the research done now is automated and
some errors have been propagated. Also, some of the proteins have very little information
about them. This made it difficult to determine how the protein was related to other
proteins. Initially, the Proteome website was used to determine the general function of
each of the proteins. When analyzing the data, it was noticed that some of the
transcription factors do not fall well into the category given to it by Proteome.

A few of the transcription factors affect almost all of the functions of the cell. These
transcription factors are general activators and repressors. It will likely provide cleaner
data if these transcription factors were thrown out before analyzing the data.

                                           Page 7
When MEME produces an e-value, it takes into consideration the number of sequences
the motif was found in. When the input data set is small, the motif can only be found in a
small number of the sequences. This produces a much larger expected value than when
MEME is used for sets with a size in the hundreds. So, it was difficult to determine which
of the signals were strong and which were weak. The e-value did give a good relative
description of the strength of the motif.

Because of a lack of knowledge of yeast transcription factors and a reliance on the
Proteome website, the MEME search was done on subsets of transcription factors that
were supposedly related. For future studies, it would be essential to confirm the
relationship between related transcription factors and that they are up-regulated and
down-regulated in similar environments. Then, MEME can be run using the oops setting.
This will ensure that MEME will look for a motif in all related sequences instead of
searching for motifs in a set of transcription factors, some which only up-regulate and
others which only down-regulate. Then, the e-values can be compared to the e-values
found in a set of unrelated transcription factors of the same size. This will ensure that the
e-values in both sets can be compared.




                                           Page 8
References
1     Jang YK, Wang L and Sancar GB (1999) RPH1 and GIS1 Are Damage-
Responsive Repressors of PHR1. Molecular and Cellular Biology 19(11) : 7630-7638.

2      Nicholas PE, Melissa JB, Bierwagen TA, Myers AM (1999) Control of
Saccharomyces cerevisiae filamentous growth by cyclin-dependent kinase Cdc28.
Molecular and Cellular Biology 19(2) : 1369-80.

3      Patel HJ (2001) Identification of Protein Binding Sites in Genes Sharing Similar
Expression Profiles using MEME and MAST. Univeristy of California, San Diego.

4       Sussel L, Vannier D, Shore D (1995) Suppressors of defective silencing in yeast:
effects on transcriptional repression at the HMR locus, cell growth and telomere
structure. Genetics 141(3) : 873-88.

5       Bailey T, Elkan C (1994) Fitting a mixture model by expectation maximization to
discover motifs in biopolymers. Proceedings of the Second International Conference on
Intelligent Systems for Molecular Biology : 28-36

6      Proteome (March 2002). (Online), Available: http://www.proteome.com

7       Stanford Saccharomyces Genome Database (March 2002). (Online), Available:
http://genome-www.stanford.edu/Saccharomyces/

8      Bruce Alberts, et. al. Molecular Biology of the Cell. New York: Garland Science
Publishing, 2001.




                                         Page 9
Appendix A: Transcription Factors

Transcription factors are proteins that bind to DNA and either induce or repress gene
transcription. They are translated in the cytoplasm, but they contain nuclear localization
signals so they are transported back into the nucleus.

Transcription factors may be composed of several functional domains, one of which must
be a DNA-binding domain. This may contain α helices that are oriented so that they lie in
the major groove of DNA where the atoms of the protein form specific hydrogen bonds
and van der Waals interactions with atoms in the DNA. Interactions with sugar-phosphate
backbone atoms and, in some cases, with atoms in the DNA minor groove also contribute
to binding.

Transcription factors are often classified according to the type of DNA-binding domain
they contain. These include homeodomains, zinc finger proteins, leucine zippers and
helix-loop-helix protein domains.




Figure (a) Zinc finger domain (8)
Figure (b) Homeodomain (8)




                                         Page 10
Appendix B: Motifs and Combined Block Diagrams

The following pages show a summary of motifs in each group of sequences and an optimized (non-overlapping) tiling of all of the
motifs.

Motif 1
GTACCAAAGCCAGCAAACACCTTTGGAAGCATACGAGAAAC
Motif 2
AAAAAGCAGATAAAGATATAGGATCAGATGGACTTATGA
Motif 3                                                                   Motif 4
GCGTAAGGGCCACAGATGTAG                                                CACTAGGCAGAGAGACAACT
Motif 5                                                                   Motif 6
GCTCAGTCGGCCGGC                                                        GGTTCGCCAGTTGT


        Combined
Name
         p-value        DNA Repair Downstream

GIS1     9.15e-05                                                                                                                                        4
MET18    2.89e-03                                                                                                                                        6
RAD18    4.86e-24                                                6                           3                       4                           1
RAD26    6.17e-21                                                                                  2                                   1
RFX1     4.75e-10                              2                         2
RPH1     2.13e-32                    6                5                                      1                           3                           4
SET1     3.94e-04                                                                                  3
SPT4     5.39e-17                                                                  6                       5                           1
SSL1     7.27e-15                        2                                                             3                          3                          5
TFB1     1.85e-21                    6                               2                             1
TFB2     1.05e-06                                                                                                            2
                    |      |    |         |    |     |     |     |           |         |     |     |           |     |           |         |     |           |     |     |
SCALE               1      25   50        75   100   125   150   175         200       225   250   275         300   325         350       375   400         425   450   475




                                                                         Page 11
       Motif 1
       AAAAAGTGGAAAAAAAAAAAA
       Motif 2
       AACCGCACCCCTCCTCCCCCC
       Motif 3
       GTTGTACTTTTTTTT
       Motif 4
       CAGTCACCTCCCATT
       Motif 5
       CCGCACAAACACACC
       Motif 6
       TTTAAGAGAATTGCAGATTCTGTACA


        Combined
Name
         p-value        DNA Repair Upstream

GIS1     6.01e-16                                     1                           2                        3                                        3                         1
MET18    2.13e-11                    4                                  3                                                           3                          6
RAD18    3.54e-07                    3                              3                                                      1                                        4
RAD26    7.65e-04                                                                                                                                                       1
RFX1     3.07e-16                    5                              6                                                           4                   3                         1
RPH1     3.07e-29                    5                          2                           3                          3                      6                     1                1
SET1     1.13e-15                    5                                            3                            1                              6
SPT4     5.89e-09                    4                                3                                1
SSL1     5.03e-08                                     4                               1                            5                                      3
TFB1     7.43e-09                                 3                           1                            4
TFB2     6.97e-05                        1                                                       1                                                        3
                    |      |    |            |            |     |           |         |         |      |           |           |        |     |     |         |         |     |     |     |
SCALE               1      25   50           75           100   125         150       175       200    225         250         275      300   325   350       375       400   425   450   475




                                                                                                      Page 12
        Motif 1
        AATCAACTCTATCCTTAGACTACACAAAGTTGTCAGTACTGCTAGACTAT
        Motif 2                               Motif 3
        CACTCCCCATCTTCTTGCTC             ACTAGAAAAAAAAAA
        Motif 4
        CAAGAAGCAAATGCTTGTGGATCAAGAGAATGCCCCCACGGCTAAAGA
        Motif 5                               Motif 6
        AGTGTGGTCGTGGCG                   GGCCTATGTCGGATAAAAAAAAGGAAGTACAATACTAAAAGGCAG

          Combined
 Name
           p-value        Mating Downstream

ALPHA1     3.17e-25   5        1                               2
ALPHA2     9.47e-39   3                          1                                 2                                                     4                       1
CCR4       6.08e-22                     2                                      2                                             3                                   4
CHA4       1.81e-20                                                            2                                 4                                                   3
HMRA1      1.44e-24                                                       5            1                               2
HMRA2      3.08e-20   3                              1                                 2
KAR4       3.48e-15                                                  3                                2                                  6
MCM1       3.17e-19                         3                                  6                                        2
MOT3       2.29e-01                                                                                                                          3
SIG1       5.12e-11                                  3                                           1
SPT3       3.01e-03                                                                                                                  6                       3
STE12      4.94e-02                                                                        3
TUP1       1.11e-04                                                            2                                                  3
WTM1       2.68e-25                                                                                                              6                                               1
YIL122W    1.99e-05                              3                                                           2
                      |      |     |        |            |     |         |         |           |       |         |     |         |       |       |     |     |           |     |     |
SCALE                 1      25    50       75           100   125       150       175         200     225       250   275       300     325     350   375   400         425   450   475



                                                                                                     Page 13
       Motif 1                                                     Motif 2
       AAAGTACAAAAAAAAAAAAAA                                 TTTTCTTCTTGATTTTTGTCTTTTTTTTC
       Motif 3
       TTGCAACAACTTCTTCTCCTCATCACTAATCTTACGGTTTTTGTTGGCCC
       Motif 4                                                     Motif 5
       CAACTTCTTCTTCTCTTGTTACACTCTCTGGTAACTTAGG          TTTTTGGAA
       Motif 6
       AGCTCGTCATCAAATACTCAGCAAAACG


          Combined
 Name
           p-value        Mating Upstream
ALPHA1     7.12e-50                        3                            4                         1                            2                                       3
ALPHA2     7.58e-14                                      6                              5                   2                                                                              1
CCR4       6.96e-12                                                         6                                              2                           1
CHA4       2.85e-07                    5                                                    2                     1                                                        1
HMRA1      3.77e-50                                                             3                           4                              1                           2
HMRA2      7.41e-06                                                                                5                           1                                                       3
KAR4       2.08e-19                                     5                           6                   1                              2                                   1
MCM1       3.59e-15                        6                            2                                5                                                   1
MOT3       2.84e-22                    4                        2                                 1                    1                           5                            1
SIG1       6.40e-07                                                                          2                         4                                               1
SPT3       7.09e-07                                 2                                                                                          1
STE12      1.14e-05                                      1                                                             2
TUP1       6.75e-09                    1                            5                                        1                                                         2
WTM1       1.61e-18                    5                            4                                                              2                         1
YIL122W    5.94e-06                                 5                           2                       1
                      |      |    |            |        |     |         |       |           |     |     |        |         |           |       |       |         |             |     |     |
SCALE
                      1      25   50           75       100   125       150     175         200   225   250      275       300         325     350     375       400           425   450   475




                                                                                             Page 14
   Motif 1                                                                                                             Motif 2
   GAAAAAAAAAATAAAAAAAAAAAAAGAAGATAATAAAAAAAAATACCT                                                    .
                                                                                                           C ATACAAAAGCAAGAGGAGCGCCG
   Motif 3                                                                                                             Motif 4
   TTTCTTTCCTTTTCTTCAGT                                                                                                CC GCCAGAACAACT
                                                                                                                             .




   Motif 5                                                                                                             Motif 6
   GGCCACGGAACCATTTTTGCAAAAG                                                                                     CTATATATATATATATAT
                                                                                                                        .




         Combined
Name
          p-value        Differentiation Downstream
ASH1      2.87e-02                     3
FLO8      2.51e-07                             1                             5                             3                                                              3
GLN3      5.25e-02                                                                                         3
HMRA2     6.65e-10                     6                           6                             5                                                            3
HMS1      8.68e-25                     6                                     3                             1                                     5                                  4
HMS2      1.81e-18                     3                               5                                                             2                                        1
MDS3      1.32e-05                     5                                                                                                 3                            4
MSN1      1.99e-16                                                           6                                         3                                           1
MSN2      1.53e-14                                 3                                                                             6                                2
MSN4      8.62e-09                     2                                               3                                3                                                     1
PHD1      9.38e-16                                 6                                                           3                                                          1
RIM101    1.66e-07                         2                                                 3
SDS3      2.87e-08                                                                                                  3                                     5
SKN7      3.13e-07                                                                               6                                                                        3
STE12     2.61e-19                                       1                                   1                                                                            5
TEC1      1.84e-09                     6                           6                                               4                                 3
YAP1      1.17e-09                             3                                                       6                                     4
                     |      |     |        |       |         |         |         |     |         |         |           |             |       |           |        |           |         |     |     |
SCALE                1      25    50       75      100       125       150       175   200       225       250         275           300     325         350      375         400       425   450   475


   Motif 1                                                                                       Motif 2
                                                                                           Page 15
       CTTTTTTTTCTTTGCTTTATTTTA                                                         . AGGGTCTGAAAGAACAAGAGAAGAGGAAGAACACAG
       Motif 3                                                                                  Motif 4
       AAACTCATAGAAAAAAGAATGAAAACGG                                                     . CCAGTCAGCGCAGGC
       Motif 5                                                                                   Motif 6
       AAAAAGCAGCTCCAGCT                                                                    .CCTTCTTG
         Combined
Name
          p-value        Differentiation Upstream
ASH1      1.87e-03                                                            1                                                                                                   6
FLO8      4.44e-15                                                                                    2                                   3                                            2
GLN3      4.66e-17                                        3                             6                                                     2                                             2
HMRA2     2.82e-13                                                                      6                                             1                                 2
HMS1      7.23e-07                                  1                                                         5
HMS2      6.82e-10                                                                  3                                 6                                                                         4
MDS3      2.21e-13                         1                                    2                                                                 6                                             5
MSN1      3.06e-04                                             5                                6
MSN2      3.07e-19                     3                      4                             6                             5                           3                           3                         11
MSN4      2.46e-14                                                            6                                        5                                      3                                 1
PHD1      4.58e-09                     4                                                                          1                                                                         1
RIM101    2.66e-13                                  4                       6                                                     3                               1                                3
SDS3      9.67e-19                     3                                4                                                  1                              1                                    2
SKN7      1.86e-05                              4                                                                                                                                          1
STE12     1.69e-09                                                      3                                                     1                           6
TEC1      3.20e-07                     4                                                                  5
YAP1      2.91e-03                                                  5
                     |      |     |            |        |     |         |           |           |         |           |           |       |           |           |         |         |             |     |      |
SCALE                1      25    50           75       100   125       150         175         200       225         250         275     300         325         350       375       400           425   450    475




                                                                                                 Page 16
       350       375       400          425   450    475




                                                                                                  Page 16

				
DOCUMENT INFO