Gateway Cloning vectors (pentr pdonr pdest) by zez16524

VIEWS: 1,264 PAGES: 17

									                                                               We want to
                                                              hear from you!
Tip:
1. To search the note, press CTRL-F keys in combination        Click here
2. To navigate the note, use the links.


Gateway® Cloning Technology
TABLE OF CONTENT

PRODUCT DESCRIPTION
SHIPPING CONDITIONS
STORAGE CONDITIONS
STABILITY
QC SPECIFICATIONS
PROTOCOL & APPLICATION NOTES
      Gateway Donor Vectors
      Gateway Entry Vectors
      Gateway Destination Vectors
      Gateway Vector Conversion cassettes
      Sequences of the Att Sites
      The BP Recombination Reaction
      PCR product recombination into the DONOR vector
      Amount of DNA to be used in a BP reaction
      The BP Clonase and reaction conditions
      Information on pEXP7-Tet
      The LR Recombination Reaction
      The LR Clonase and reaction conditions
      Information on pENTR-gus
      Primers for sequencing Entry Clones
      Sequencing the shRNA from pENTR/U6 or pENTR/H1/TO
      Primers for sequencing Expression Clones
ALTERNATE PRODUCTS & COMPATIBILITY
PRODUCT DOCUMENTATION
REFERENCES
PRODUCT NAME & CATALOG NUMBER
COMPONENTS
      Enzymes needed
      Competent E. coli
      Donor vectors
      Entry vectors
      Destination vectors
ASSOCIATED PRODUCTS




                                                          1
PRODUCT DESCRIPTION
(back to Table of Contents)

How Gateway Technology Works
      Gateway Technology uses lambda phage-based site-specific recombination instead of restriction endonuclease and ligase
      to insert a gene of interest into an expression vector. The DNA recombination sequences (attL, attR, attB, and attP) and
      the Clonase enzyme mixtures (i.e. LR or BP Clonase) mediate the lambda recombination reactions.

General Gateway Cloning Recombination Notes
        The Gateway Cloning Technology takes advantage of the well-characterized bacteriophage lambda-based site-specific
        recombination instead of restriction enzymes and ligase. The power of the Gateway Cloning Technology is that genes
        cloned into Entry vectors can be subcloned in parallel into one or more Destination Vectors in a simple, 60-minute
        reaction. Moreover, a high percentage (> 95%) of the colonies obtained carry the Expression Clone in the desired
        orientation and reading frame.
        Illegitimate recombination does not occur since Gateway Cloning does not operate by homologous recombination and
        recombination with genomic sequence is predicted to be a rare event.
        The nomenclature for the att sites used by Invitrogen is consistent with the lambda nomenclature. The only deviations are
        in the attB1 or attB2 sites since these are mutant versions of the attB site that do not exist in lambda.
        The recombination sites used in Gateway Cloning are not wild-type sites. Several point mutations were engineered into
        the wild type att sites to generate novel specificities. For example attB1 only recombines with attP1 and not with wild
        type attP or attP2. As these sites differ by only a few nucleotides, the specificities of the att sites for the paring partners is
        extremely high.
        There are certain limitations with regards to Gateway Cloning, both imposed by biology. The gene-of-interest will
        always be connected to att sites, either attL (100 bp) in an Entry clone, or attB (25 bp) in Expression clones. Therefore it
        needs to be decided initially whether elements such as eukaryotic or prokaryotic translation signals, or a 3' stop codon
        need to be included before proceeding with the generation of the Entry clone. It is best to construct two Entry Clones;
        one with the stop codon after the coding sequence for N-terminal fusions, and one without the stop codon for C-terminal
        fusions.
        The exact minimum size limit that can be used in a Gateway reaction is not known. There will be a minimal size limit,
        probably constrained by the topology of the recombination reaction. Early data suggests that 100 bps between the att
        sites may be sufficient.

Recombination Enzymes involved in the Gateway recombination reactions
Lambda recombination is catalyzed by a mixture of enzymes that bind to specific sequences (att sites), bring together the target
sites, cleave them, and covalently attach the DNA. The Clonase enzyme mixtures utilize a combination of the bacteriophage λ
Integrase (Int) and Excisionase (Xis) proteins and E. coli Integration Host Factor (IHF) proteins.

Int:
         Has type I topoisomerase activity. Cuts and reseals the att sites via covalent Int-DNA intermediate
         Binds specifically to 2 different families of DNA sequences:
             1. core: CAACTTNNT
             2. arm: C/AAGTCACTAT
         Required for both excision (LR reaction) and integration (BP reaction) of phage
Xis
         Required for excision (LR) but not integration (BP) of phage.
         Inhibits integration (BP) at physiological conditions
         Relatively stable in vitro but rapidly degraded in cells
         Promotes efficient LR recombination in presence of Int and IHF
         No enzymatic function but rather sequence-specific cooperative binding to adjacent sites in the P arm thus introducing
         sharp bend in the DNA.
         Also associated with cooperative interactions with DNA-bound Int .
IHF
         E. coli-derived protein as opposed to phage-derived (Xis & Int)
         Essential for both excision and integration (LR and BP reactions respectively)
         Heterodimer composed of alpha and beta subunits
         Similar to other type II DNA binding proteins such as histones



                                                                    2
No known enzymatic function but it binds to and bends DNA at specific sites

SHIPPING CONDITIONS
(back to Table of Contents)

        Gateway Donor, Entry, and Destination vectors are shipped in a supercoiled and lyophilized format with a few
        exceptions. The pENTR-Gus positive control is supplied supercoiled in TE buffer whereas pEXP7-tet is supplied
        linearized in TE buffer. The Yeast two-hybrid vectors, pDEST22 and pDEST32 are supplied as linearized vectors in TE
        buffer. The adenoviral destination vectors are shipped supercoiled in TE buffer.
        All lyophilized vectors are shipped at room temperature and all the vectors in solution are shipped on dry ice. The
        competent E. coli, and enzymes are shipped on dry ice.

STORAGE CONDITIONS
(back to Table of Contents)

       Store all Gateway vectors at –20oC.
       BP and LR enzyme mix must be stored at –80o C.
       5X BP or LR Reaction buffer and the Proteinase K solution can be stored at –80oC or –20oC.
BP Clonase II and LR Clonase II enzyme mixes can be stored at –20oC or –80oC.

STABILITY
(back to Table of Contents)

All reagents are guaranteed stable for 6 months when properly stored.

Both BP, and LR Clonase enzyme mixes are stable for at least 6 month from date of purchase.
        When used in a reaction, the mix is first thawed on ice for two minutes, mixed gently by tapping or vortexed very briefly.
        After taking the desired aliquot out, the mix should be returned to –80oC promptly.
        The enzyme mix retains 50% activity after 15 cycles of freeze-thaw. It is also stable (100 % activity) overnight at 4oC or
        one week at –20oC. It is not recommended to aliquot the mix since this can lead to loss of activity.

Proteinase K is stable for 12 months at 4°C as a powder and up to 2 weeks at room temperature as a powder or solution.

QC SPECIFICATIONS
(back to Table of Contents)

Gateway Vector Conversion cassettes: The cassettes functionally tested with the ccdB assay as part of the QC procedure.

Gateway BP Clonase Enzyme Mix: Functionally tested in a 1 hour recombination reaction followed by gel electrophoresis
analysis and a transformation assay.

All pDONR vectors:
A BP cloning reaction, and the ccdB assay is done as part of the QC procedure.

pENTR D-TOPO Vector:
TOPO Cloning with pENTR/D-TOPO and a directional test PCR product must yield the following results when tested using the
control conditions listed in the manual:
         (1) pENTR/D-TOPO and directional PCR product ligation: cloning efficiency must be > 85% as based on colony counts
         from plus insert plates and vector only plates.
         (2) Directional PCR to confirm directional cloning of product: > 36 out of 40 transformants analyzed from plus insert
         plates must contain the test PCR product cloned in the correct orientation.

PROTOCOL AND APPLICATION NOTES
(back to Table of Contents)

        Gateway Donor Vectors


                                                                3
        Gateway Entry Vectors
        Gateway Destination Vectors
        Gateway Vector Conversion cassettes
        Sequences of the Att Sites
        The BP Recombination Reaction
        PCR product recombination into the DONOR vector
        Amount of DNA to be used in a BP reaction
        The BP Clonase and reaction conditions
        Information on pEXP7-Tet
        The LR Recombination Reaction
        The LR Clonase and reaction conditions
        Information on pENTR-gus
        Primers for sequencing Entry Clones
        Sequencing the shRNA from pENTR/U6 or pENTR/H1/TO
        Primers for sequencing Expression Clones

Gateway Donor Vectors
(back to Table of Contents)
(back to Protocol and Application Notes)

        Inserts can be released from all pDONR vectors with BsrG1, which cuts in both attL sites and whose recognition
        sequence is TGTACA. An exception is pDONR P4/P1R that is part of the MultiSite Gateway System and has an attL4
        site whose sequence is different from attL1 and attL2.
        Donor vectors contain two transcription termination sequences (rrnB T1 and T2) upstream from attP1. This prevents
        transcription of genes cloned into pDONR vectors from other vector-encoded promoters thereby reducing possible toxic
        effects.
        The minimum insert successfully cloned into a pDONR vector in-house was 70bp and largest was 12 Kb. Although,
        successful cloning of small inserts from 50-200 bp is sequence dependent.
        Although pDONR201 and pDONR207 contain a pUC ori, they replicate less efficiently resulting in lower plasmid yields.
        In contrast pDONR221 acts as a high-copy number plasmid typically yielding 0.5 - 1.0 mg of DNA per liter.

Gateway Entry Vectors
(back to Table of Contents)
(back to Protocol and Application Notes)

           Inserts can be released from all pENTR vectors with BsrG1, which cuts in both the attL sites and whose recognition
           sequence is TGTACA.
           The Entry vectors 1A, 2B, 3C, 4, 11 contain the same vector backbone (outside the attL sites) and differ only in the
           sequences and cloning sites provided between the attL sites. They contain a modified pUC origin of replication and
           are low- to mid-copy number plasmids. In terms of DNA yield, these vectors are more like those with pBR322 ori.
           All Entry vectors contain two transcription termination sequences (rrnB T1 and T2) upstream from attL1. This
           prevents read-through transcription from other vector-encoded promoters, thereby reducing possible toxic effects.
           The Shine-Dalgarno sequence in pENTR/SD/D-TOPO does not adversely affect mammalian expression when used
           in an appropriate mammalian DEST vector. Hence this vector may be substituted for pENTR/D-TOPO.
           When cloning into any of the Directional TOPO Entry vectors it is recommended to use molar ratios of 0.5-2:1 of
           insert: vector. Too much PCR product will inhibit the cloning reaction; hence the PCR product may need to be
           diluted 10 fold before cloning. Use 1-5ng of a 1 Kb product or 5-10ng of a 2 Kb product.
        When cloning into pENTR/U6 or pENTR/H1/TO, the two synthesized DNA oligos do not need phosphate groups at the
           5’ end since both these vectors have the 5’ phosphate groups.
           The pCR8/GW/TOPO entry vector uses spectinomycin for selection; hence the entry clone generated can be used
           with any destination vector. Most destination vectors are ampicillin-resistant, but there may be some that are
           kanamycin or zeocin-resistant.
           pCR8/GW/TOPO vector can be used to TA clone a PCR product amplified with any Taq DNA polymerase or
           Invitrogen’s Platinum Taq DNA polymerase High Fidelity (catalog #11304-011).

Gateway Destination Vectors


                                                               4
(back to Table of Contents)
(back to Protocol and Application Notes)

             Inserts can be released from all DEST vectors with BsrG1, which cuts in both attB sites and whose recognition
             sequence is TGTACA.
             All the destination vectors have a pUC ori (for prokaryotic), SV40 ori (for mammalian), and 2µ ori (for yeast).
             When propagating pDONR, pENTR, and pDEST vectors with the ccdB gene, the E. coli can be grown at 30oC to
             prevent random deletions of the gene. If this happens, the amount of background colonies will increase since the
             selection method has been eliminated. It is recommended to verify the functionality of the ccdB gene by propagating
             the Gateway vectors using selection on 20-30 ug/ml chloramphenicol plates.

Restriction enzymes used to linearize Destination vectors

Linearized Destination Vector can be obtained by cleaving at a restriction site within the region of the GATEWAY Cassette,
taking care to avoid the ccdB gene. All Destination Vectors from Invitrogen used to be provided linearized in this manner.
Although Invitrogen previously recommend using a linearized destination vector for more efficient recombination, further testing
at Invitrogen has found that linearization is NOT required to obtain optimal results for downstream application.

 Vector                       Restriction Enzyme Used to Linearize It
 pDEST 14                     Mlu I
 pDEST 15                     BssH II
 pDEST 17                     BssH II
 pDEST 8                      Mlu I
 pDEST 10                     Mlu I
 pDEST 20                     EcoR I
 pDEST 12.2                   Mlu I
 pDEST 22                     BssH II
 pDEST 26                     EcoR I
 pDEST 27                     EcoR I
 pDEST 32                     BssH II
 pET-DEST42                   NcoI
 pT-Rex-DEST30                EcoRI
 pT-Rex-DEST31                EcoRI
 pcDNA-DEST40                 EcoRI
 pcDNA-DEST47                 EcoRI
 pMT-DEST48                   EcoRI
 pYES-DEST52                  EcoRI
 pBAD-DEST49                  EcoRI
 pEF-DEST51                   EcoRI
 pcDNA-DEST53                 EcoRI

Gateway Vector Conversion cassettes
(back to Table of Contents)
(back to Protocol and Application Notes)

        All the Conversion cassettes are blunt-ended and 5’-phosphorylated.
        Each reading frame cassette has a different unique restriction site between the chloramphenicol resistance and ccdB genes
        (Mlu I for the reading frame A cassette, Bgl II for the reading frame B cassette, and Xba I for the reading frame C
        cassette).
        The reading frame of the fusion protein domain must be in frame with the core region of the attR1 site for an N-terminal
        fusion (e.g. the six As are translated into two lysine codons). For a C-terminal fusion protein, translation through the core
        region of the attR2 site should be in frame with –TAC-AAA-, encoding -Tyr-Lys-. For native proteins, any of the three
        Gateway Cassettes may be used since there will be no translation through the att sites. Therefore reading frame issues
        through the att sites are not relevant.




                                                                 5
          For sequencing from within an attR1 region the GW3 priming site primer can be used. The primer sequence is 5’-TTA
          ATA TAT TGA TAT TTA TAT CAT TTT ACG-3’. The primer anneals about 30 bp downstream of the 5’ end of the
          attR1 site.
          When sequencing, as long as the attR sites are intact, a restriction enzyme with a site very close to attR sites can be used
          to linearize the Gateway-converted vector.

Sequences of the Att Sites
(back to Table of Contents)
(back to Protocol and Application Notes)

Of the 4-att sites, attP is the most complex and attB is the simplest. The prophage sites attL and attR are hybrids of attP and attB.
Contribution of attL to attP is in blue.
Contribution of attR to attP is in green.
Contribution of attL and attR to attB is in yellow.

 attL1: 100bp     CAAATAATGA TTTTATTTTG A CTG ATA GTG ACC TGT TCG TTG CAA CAA ATT GAT
                  AAG CAA TGC TTT TTT ATA ATG CCA ACT TTG TAC AAA AAA GCA GGC T
 attL2:           AC CCA GCT TTC TTG TAC AAA GTT GGC ATT ATA AGA AAG CAT TGC TTA TCA ATT
 100bp            TGT TGC AAC GAA CAG GTC ACT ATC AGT CAA AAT AAA ATC ATT ATT TG
 attR1:           ACA AGT TTG TAC AAA AAA GCT GAA CGA GAA ACG TAA AAT G ATA TAA ATA TCA
 125 bp           ATA TAT TAA ATT AGA TTT TGCATAAAAA ACAGACTACA TAATACTGTA
                  AAACACAACA TATCCAGTCA CTATG
 attR2:           CAT AGT GAC TGG ATA TGT TGT GTT TTA CAG TAT TAT GTA GTC TGT TTT TTA TGC
 125 bp           AAA ATC TAA TTT AAT ATA TTG ATA TTT ATA TCA TTT TAC GTT TCT CGT TCA GCT
                  TTC TTG TAC AAA GTG GT
 attP1:           CAAATAATGA TT TTA TTT TGA CTG ATA GTG ACC TGT TCG TTG CAA CAA ATT GAT
 233 bp           GAG CAA TGC TTT TTT ATA ATG CCA ACT TTG TAC AAA AAA GCT GAA CGA GAA
                  ACG TAA AAT GAT ATA AAT ATC AAT ATA TTA AAT TAG ATT TTG CAT AAA AAA
                  CAG ACT ACA TAA TAC TGT AAA ACA CAA CAT ATC CAG TCA CTA TGA ATC AAC
                  TAC TTA GAT GGT ATT AGT GAC CTG TA
 attP2:           TA CAG GTC ACT AAT ACC ATC TAA GTA GTT GAT TCA TAG TGA CTG GAT ATG TTG
 233 bp           TGT TTT ACA GTA TTA TGT AGT CTG TTT TTT ATG CAA AAT CTA ATT TAA TAT ATT
                  GAT ATT TAT ATC ATT TTA CGT TTC TCG TTC AGC TTT CTT GTA CAA AGT TGG CAT
                  TAT AAG AAA GCA TTG CTT ATC AAT TTG TTG CAA CGA ACA GGT CAC TAT CAG
                  TCA AAA TAA AATCAT TAT TTG
 attB1            ACA AGT TTG TAC AAA AAA GCA GGC T
 attB2            AC CCA GCT TTC TTG TAC AAA GTG GT
                  Note: Not all att sequences are conserved in every vector; att sites have been modified in various
                  vectors to increase efficiency, minimize secondary structure, etc. Thus, an attB1 site in one vector
                  may not be identical to an attB1 site in another vector (but we still call them both attB1 sites). Only
                  the 21-bp consensus sequence between all att sites is crucial for recombination.
                  For attB1 the essential sequence is: 5’- CNNNTTTGTACAAAAAANNNG.
                  For attB2 the essential sequence is: 5’- CNNNTTTCTTGTACAAANNNG.
                  Changes to other base pairs do not affect recombination.

          The attB amino acid sequence does not interfere with transcription or translation. No effect of the attB sites on
          expression levels in E. coli, insect and mammalian cells have been observed.
          Simpson et al. EMBO Reports 11(31): 287-292, 2000 demonstrated that GFP fusions localized to the proper intracellular
          compartment. The proteins contained the attB1 or attB2 sequences.
          It is believed that there may be certain mutation-prone hotspots within the attL sites that happen in E.coli. However some
          of these hotspots do not interfere with the recombination reaction nor do they cause a shift in the reading frame of the
          GOI if recombined into a N-terminal tagged destination vector. It is not known why these hotspots occur; when it does, it
          does not get transferred into the destination vector but remains within the backbone of the Entry clone.
          An article that describes the specificity of att sites is Sasaki et al. J. Biotechnol. 2004; 107(3):233-43. Evidence for high
          specificity and efficiency of multiple recombination signals in mixed DNA cloning by the Multisite Gateway system.



                                                                   6
Schematic of the creation of attB sites after LR recombination




           Contribution of attR to attB is in green.
           Contribution of attL to attB is in blue.
           Integrase (Int) produces a seven-base staggered cut during the recombination reactions indicated by the arrows in the
           figure.
           There are 8 amino acids (letters above triplet codons) contributed by the attB site, which get added to the 5’ or 3’ end of
           the gene of interest depending on the location of the fusion tag in the destination vector.

The BP Recombination Reaction
(back to Table of Contents)
(back to Protocol and Application Notes)

           Recombination reaction between an Expression Clone or PCR product (containing a “gene” flanked by attB1 and attB2
           sites) and pDONR (containing attP1 and attP2 sites) to generate an Entry clone that now contains the “gene” of interest
           flanked by attL1 and attL2 sites.
           Our studies have shown that the BP recombination reaction is approximately 5-10 fold more efficient than a ligation
           reaction to clone a piece of DNA. Approximately 5-10% of the starting material is converted into product during a BP
           reaction.
           The largest PCR fragment cloned in-house is 10 Kb (see Table below). In theory a much larger fragment can be cloned.
           A Gateway Cloning reaction is essentially swapping one fragment out of a plasmid and replacing it with another where
           the reaction cannot discriminate between the "vector" and the "insert". Gateway reactions have been performed in-house,
           using a Destination Vector that was approximately 130 Kb, so in theory large inserts of that size can be transferred via
           Gateway technology.

    High-efficiency cloning of large genes using pDONR donor vector
    PCR products (0.26 Kb to 10.1 Kb) were cloned into the pDONR donor vector. Random colonies were selected and screened
    for the presence of insert and orientation. The range of PCR fragments demonstrated >90% cloning.

     Size (Kb)             PCR DNA (fmol)          PCR DNA (ng)             Colonies/ml               Correct clones/Total
                                                                            Transformation*           clones examined
     0.26                  15                      3                        1223                      10/10#
                           38                      7.5                      2815
     1.0                   15                      10                       507                       49/50
                           38                      25                       1447
     1.4                   15                      14                       271                       48/50
                           38                      35                       683
     3.4                   15                      34                       478                       9/10#
                           38                      85                       976
     4.6                   15                      46                       190                       10/10#
                           38                      115                      195
     6.9                   15                      69                       30 (235†)                 47/50
                           38                      173                      54 (463†)



                                                                    7
     10.1               7.5                     50.5                     16 (112†)                 15/16
                        37.5                    252.5                    42 (201†)
   * pUC+ 108 CFU/ml
   † After overnight incubation
   # DNA mini-prep analysis

PCR product recombination into the pDONR vector
(back to Table of Contents)
(back to Protocol and Application Notes)

       The best place to include a protease cleavage site or any other N-term tag is between the attB1 sequence and the first gene
       specific codon (in most cases, ATG). An example of adding a TEV Protease site:
       5'-ACA-AGT-TTG-TAC-AAA-AAA-GCA-GGC-TNN-GAA-AAC-CTG-TAT-TTT-CAG-GGC-ATG-forward gene
       specific sequence-3'
       The sequence as describe above would generate a protein with one additional amino acid (glycine) on the N-terminus
       after cleavage with TEV. An alternative would be to replace the ATG with the GGC codon. This would generate a
       protein with a glycine residue in place of the methionine residue after cleavage with TEV protease.
       For purity of the attB-containing primers, 50 nmol of standard purity oligos are adequate for most applications. For
       cloning smaller products, purifying the oligos by Cartridge or PAGE doesn't significantly increase colony output (not
       more than 2-3 fold). However, for cloning large PCR products (> 5kb), colony output can be increased if the oligos
       (when >65 bases) are further purified (i.e. Cartridge or PAGE). The oligos should be dissolved to a concentration of 20-
       50 µM.
       The 4-G’s at the 5’ end of the attB primer sequences are necessary for the BP reaction and cannot be replaced by
       analogous sequences. It is believed that this stretch of Gs serve as a substrate in the BP reaction by allowing more of an
       area for protein binding; although this has not been directly demonstrated. Addition of more than 4Gs inhibits the BP
       recombination reaction due to the formation of an inhibitory secondary structure. The next two bases after the G cannot
       be AA, AG or GA since this would form a stop codon.
       Typically the attB sequences on PCR primers are not a problem during PCR amplification. Hence there is no need to
       change the PCR reaction conditions when primers have the attB sequence compared to reactions using gene specific
       primers alone. It is recommended that the attB-PCR product be cleaned up with a PEG precipitation step. This removes
       PCR buffer, unincorporated dNTPs, and primer dimers. Small primer-dimers clone very efficiently and decrease the
       number of correct clones whereas leftover PCR buffer may inhibit the BP reaction.
       One-Step Adapter PCR method for HTP Gateway cloning: For detailed protocol see Quest 1.2; pg 53-55. One can add
       the att B adaptors by using the 4 primers all in one tube. The best ratio of the first gene specific and the second attB
       primers is 1:10. The protocol is:
                 Template DNA                         50ng
                 10x Pfxb amplification buffer        1ul
                 10x PCRx enhancer solution           1ul
                 Gene specific primers                2 pmol each
                 attB primers                         20 pmol each
                 Platinum Pfx                         1unit
                 Total volume                         10ul
                 PCR product can be used in BP reaction without any purification, and around 90% clones were converted
                 Gateway entry clones.

Amount of DNA to be used in a BP reaction
(back to Table of Contents)
(back to Protocol and Application Notes)

       For the most efficient reaction, it is best to not have attB sites in molar excess of attP sites. For a 20 µl reaction, 300 ng
       (no more than 500 ng) of the donor vector is recommended. Using too much of the donor vector in the reaction tube will
       inhibit the BP reaction and also result in intact donor vector being co-transformed with the Entry Clones. This will
       reduce the amount of colonies on the plate by killing the transformed E. coli due the presence of the ccdB gene.
       For PCR products > 4 Kb, the number of colonies obtained per fmol of PCR DNA added decreases with increasing size.
       Thus for larger PCR products it is recommended to increase the amount of DNA to at least 100 fmol of PCR product per



                                                                 8
        20 µl reaction, and using incubations longer than one hour (i.e. 6 hours or overnight). The largest PCR-amplified DNA
        cloned in-house was 10.1 Kb.
        The standard BP Reaction uses 300 ng of pDONR Vector and 30-300 ng attB-flanked PCR product or Expression Clone
        for 1 hour at 25oC. Longer incubation times of up to 24 h can be used to convert a higher percentage of starting attB-DNA
        to product. Longer incubations are recommended for PCR products ≥5 Kb; however in these cases the number of
        colonies will be decreased . Increasing the incubation to 4-6 h will typically increase colony output 2-3 fold and 16-24 h
        will typically increase colony output 5-10 fold (Focus 18.1: pg 27).

The BP Clonase and reaction conditions
(back to Table of Contents)
(back to Protocol and Application Notes)

        The BP clonase mix contains Int (Integrase), and IHF (Integration Host Factor).
        BP Clonase II contains enzymes and buffer in a single mix to enable convenient ten-microliter reaction set up with fewer
        pipetting steps whereas the original BP Clonase requires addition of enzyme and buffer.
        If Proteinase K is not added after the BP reaction, there could be a 10-fold decrease in efficiency.
        The one-tube protocol with the new BP, and LR Clonase II Enzyme mix is slightly different from the original one-tube
        protocol since the enzymes and buffer are in same enzyme mix. Refer to the Gateway Technology with Clonase II
        manual.

Information on pEXP7-Tet
(back to Table of Contents)
(back to Protocol and Application Notes)

        This is the positive control for the BP recombination reaction, which permits a tet-resistance cassette (1.4 kb) to be cloned
        into the donor vector. It is an approximately 5.76 Kb linearized plasmid DNA that has a 1.4 kb segment containing attB
        sites flanking the tet-resistance gene and its promoter.

The LR Recombination Reaction
(back to Table of Contents)
(back to Protocol and Application Notes)

        Recombination reaction between an Entry clone (containing a “gene” flanked by attL1 and attL2 sites) and a DEST
        vector (containing attR1 and attR2 sites) to generate an Expression clone that now contains the “gene” of interest flanked
        by attB1 and attB2 sites. The recombination requires the LR Clonase Enzyme.
        Up to 30% of the starting material is converted to product during an LR reaction.
        The possibility of generating PCR products with attL sites on either side of the product will work in theory. However the
        attL sites are > 100 bases and hence very long PCR primers will need to be ordered. The oligos would probably have
        greater propensity towards secondary structure, synthesis failure, etc. Hence such a strategy to generate an Expression
        clone is not recommended.
        Biologically an optimal LR reaction substrate is supercoiled attL with linear attR sites since helical density of the DNA is
        important in lambda recombination. However, the LR reaction is a more effective reaction than the BP reaction it enables
        the reaction to be done in a less than favorable condition and still achieves an acceptable amount of colonies. Hence both
        the Entry clone and the destination vector can be present as supercoiled during the LR reaction. This will result in 2-5
        fold less colonies than if the LR reaction was done with a supercoiled Entry clone and linear DEST vector.

The LR Clonase and reaction conditions
(back to Table of Contents)
(back to Protocol and Application Notes)

        LR clonase mix contains lambda recombination proteins Int (Integrase), Xis (Excisionase), and IHF (Integration Host
        Factor).
        The addition of Proteinase K is not necessary when doing an LR reaction. A typical LR reaction with Proteinase K
        treatment yields about 35000 to 150000 colonies per 20 µl reaction. Without the Proteinase K treatment there is an
        approximate 10-fold reduction.



                                                                 9
        The success of the LR recombination reaction is very dependent on the molar ratio of the Entry clone and DEST vector.
        If the ratio is not equimolar, the co-integrate may react with the DEST vector and Entry clone resulting in a higher
        background.
        Do not use too much DNA during transformation of E. coli after the LR reaction because the Entry clone (even if is
        Kanamycin-resistant) may outgrow the DEST expression clone. The expression clone is usually in a pBR322-based ori,
        which has a lower copy number for expression whereas the Entry clone has the high copy pUC ori.

Information on pENTR-gus
(back to Table of Contents)
(back to Protocol and Application Notes)

        This is the positive control for the LR recombination reaction.
        The Gus protein has 603 amino acids; MW: 68.4 kDa. Gus refers to beta-Glucuronidase, a protein that can be detected
        either with a fluorescent or blue substrate in the cells.
    An LR reaction with pENTR-gus and a destination vector typically yields hundreds of colonies. The Gus gene has a Shine-
        Dalgarno and Kozak sequence in frame with the attL1 site so this gene can be expressed either as native or fusion protein
        in prokaryotic and eukaryotic cells.

Primers for sequencing Entry Clones:
(back to Table of Contents)
(back to Protocol and Application Notes)

Clones derived from              Sequence
                                 SeqL-A (proximal to attL1) 5’TCGCGTTAACGCTAGCATGGATCTC3’ (reads about
pDONR201, and pDONR207
                                 60 bp of vector sequence)
                                 SeqL-B (proximal to attL2) 5’GTAACATCAGAGATTTTGAGACAC3’ (reads about
                                 60 bp of vector sequence)
pDONR221                         M13 Forward (-20): 5’GTAAAACGACGGCCAG-3’
                                 M13 Reverse: 5’-CAGGAAACAGCTATGAC-3’

Entry Vectors pENTR1a, 2b,       SeqL-C (proximal to attL1) 5’GGATAACCGTATTACCGCTAG3’ (reads about 300
3c, 4, and 11                    bp of vector sequence)

                                 Modified GW1 Forward primer: 5’GTTGCAACAAATTGATAAGCAATGC3’ (reads
                                 about 81 bp of vector sequence)

                                 SeqL-B (proximal to attL2) 5’GTAACATCAGAGATTTTGAGACAC3’ (reads about
                                 70 bp of vector sequence)
                                 SeqL-D (proximal to attL2) 5’TCTTGTGCAATGTAACATCAG3’ (reads about 90 bp
                                 of vector sequence)
                                 SeqL-E (proximal to attL2) 5’GTTGAATATGGCTCATAACAC3’ (reads about 170 bp
                                 of vector sequence)
pCR8/GW/TOPO                     GW1 Forward: 5´-GTTGCAACAAATTGATGAGCAATGC-3´ (This primer can
                                 anneal to attL1 sites except from pENTR1a, 2b, 3c, 4, and 11)
                                 GW2 Reverse: 5’- GTTGCAACAAATTGATGAGCAATTA-3’ (This primer can only
                                 be used for pCR8/GW/TOPO since the TA in bold is unique to this vector)
pENTR/D-TOPO                     M13 Forward (-20): 5’GTAAAACGACGGCCAG-3’
                                 M13 Reverse: 5’-CAGGAAACAGCTATGAC-3’
pENTR/U6                         U6 Forward: 5’GGACTATCATATGCTTACCG3’
                                 M13 Reverse: 5’CAGGAAACAGCTATGAC3’

Sequencing the shRNA from pENTR/U6 or pENTR/H1/TO
(back to Table of Contents)
(back to Protocol and Application Notes)




                                                               10
The hairpin sequences are inverted repeats that form structures during sequencing. A drop in the sequencing signal has been
observed when entering the hairpin.
Suggestions:
    1. Include more template and primer in the reaction (up to double the recommended amounts).
    2. Longer hairpins or those with higher GC content tend to be more difficult to sequence. In situations like this it may help
        to add up to 5-10% DMSO in the reaction.
    3. Try different sequencing reaction enhancers; for example those which are used on high GC content
    4. Use high quality template DNA; we use either Invitrogen's SNAP midiprep (Cat # K191001) or PureLink HQ miniprep
        (Cat # K210001) kits to purify the DNA.
    5. Work with the sequencing facility to get the right electronic file output. In our experience we often see a drop-off in
        signal sequence after the start of the shRNA sequence (from either direction). There is often clear sequence there but
        because the file output is calibrated to the stronger signals at the beginning of the read, the rest of the shRNA sequence is
        compressed on the vertical axis. If the output is recalibrated to enhance the signals from the end of the shRNA, there may
        be very good sequence information there (the signals from the beginning of the shRNA end up off the chart, so it may
        require two different files to read the entire sequence). Hence the problem may not be bad sequence, but rather that there
        are two distinct signal levels present, which cannot both be displayed in the same file.
    6. If no other solution is possible, re-design the shRNAs to be more sequencing-friendly without a significant impact on
        their potency. This strategy works well but should be a last resort, as it requires ordering new insert oligos. It can be
        achieved in 2 ways:
                  Make 2-3 well-spaced base changes in the sense strand sequence. Changing an A to a G or a C to a T will break
                  up the inverted repeat in the DNA and will allow G:U basepairing in the shRNA. The shRNA will still form a
                  hairpin and the antisense strand will still perfectly match the target sequence. A good reference that describes
                  this strategy is Paddison et al. (2002). Genes Dev. 16(8): 948-58.
                  Change the loop to include a restriction enzyme site. Digest and purify the template at that site prior to
                  sequencing (e.g. on a PCR cleanup column such as the PureLink PCR purification kit; K310001) then use
                  forward and reverse primer reactions for each template. When the two parts of the shRNA-inverted repeat are
                  released from each other, the sequence data obtained is very good right up to the restriction cleavage site.

Primers for sequencing Expression Clones
(back to Table of Contents)
(back to Protocol and Application Notes)

Clones derived from                            Sequence
pDEST14 and pDEST17                            ACG ATG CGT CCG GCG TAG AGG AT
pET-DEST42, pcDNA-DEST47, pcDNA-               TAA TAC GAC TCA CTA TAG GG (Cat# N56002)
DEST53, pcDNA-DEST40, pEF-DEST51

pYES-DEST52                                    AAT ATA CCT CTA TAC TTT AAC GTC

pDEST8 and pDEST10                             GTT CTA GTG GTT GGC TAC GTA TA (Note: This primer binds
                                               before the polyhedrin promoter. For analyzing recombinant bacmid, this
                                               primer along with a 3’ gene specific primer can be used)
pMT-DEST48                                     CAT CTC AGT GCA ACT AAA

pDEST 26                                       TGA ACC GTC AGA TCG CCT GGA GA
pT-REx-DEST30, pT-REx-DEST31                   CGC AAA TGG GCG GTA GGC GTG
pDEST15, pDEST20, pDEST 27                     GTG ATC ATG TAA CCC ATC CTG AC
pEF-DEST51                                     TCA AGC CTC AGA CAG TGG TTC


Sequencing the Destination vector after insertion of the Gateway Vector Conversion cassettes:
            For cycle sequencing, it is best if the attR sites are on separate DNA fragments. DNA can digested to give two
            fragments, each carrying one attR site. One of the restriction enzymes that can be used is AlwN I that cuts once in
            the cassette upstream of the ccdB gene and usually cuts one or more times in the vector backbone. It does not matter
            if more than two fragments are generated, as long as attR1 and attR2 are on separate DNA fragments. Following



                                                                 11
             digestion, phenol extract, ethanol precipitate, and resuspend the DNA to ~200 ng/ul. Use 2.5 µl in a 20 µl Big Dye
             sequencing reaction.

PRODUCT DOCUMENTATION
(back to Table of Contents)

            Brochures                            Cell lines                 Citations

            COA                                  FAQ                        Licensing

            Manuals                              MSDS                       Newsletters

            Vector Data

COMPONENTS

Gateway Clonase Enzymes
(back to Table of Contents)
(back to Components)

 Name                                                         Size          Catalog Number
 Gateway™ BP Clonase™ Enzyme Mix                              20 rxns       11789013
                                                              100 rxns      11789021
 BP clonase II enzyme mix (pre-mixed ready-to-use             20 rxns       11789020
 solution of clonase and reaction buffer)                     100 rxns      11789100
 Gateway™ LR Clonase™ Enzyme Mix                              20 rxns       11791019
                                                              100 rxns      11791043
 Gateway™ LR Clonase™ Plus Enzyme Mix                         20 rxns       12538013
 LR Clonase II Enzyme Mix (pre-mixed ready-to-use             20 rxns       11791020
 solution of clonase and reaction buffer)                     100 rxns      11791100

Competent E. coli
(back to Table of Contents)
(back to Components)

 Name                                                         Size          Catalog Number
 One Shot ccdB Survival T1 Phage-Resistant Cells              10 x 50 ul    C751003

Donor vectors
(back to Table of Contents)
(back to Components)

 Name                         Features                                      Catalog Number
 pDONR201                     Kanamycin resistant                           11798014
 pDONR221                     Kanamycin resistant                           12536017
 pDONR/Zeo                    Zeocin resistant                              12535035
 pDONR P2R-P3                 Part of the MultiSite gateway 3-fragment      12537023
                              vector construction kit.
 pDONR P4-P1R                 Part of the MultiSite gateway 3-fragment      12537023
                              vector construction kit.



                                                                     12
 pDONR 222                    Part of the CloneMiner cDNA library              18249029
                              construction kit. Kanamycin resistant.

 Name                         Components                                                        Catalog Number
 Gateway PCR Cloning          BP Clonase, BP Clonase Rxn Buffer, pDONR221 Vector ,
 system with                  pEXP7-tet Positive Control, LE DH5αcells, M13 primers.           12535019
 pDONR221 vector
 Gateway PCR Cloning          BP Clonase, BP Clonase Rxn Buffer, pDONR/Zeo Vector ,
 system with                  pEXP7-tet Positive Control, LE DH5αcells, M13 primers, Zeocin    12535027
 pDONR/Zeo vector
 Gateway PCR Cloning
                              BP clonase II, pDONR221, M13 sequencing primers, OneShot
 System with clonase II                                                                         12535029
                              OmniMAX 2-T1 competent cells.
 and pDONR221 vector
 Gateway PCR Cloning
                              BP clonase II, pDONR/Zeo, M13 sequencing primers, OneShot
 System with clonase II                                                                         12535037
                              OmniMAX 2-T1 competent cells.
 and pDONR/Zeo vector

Entry vectors
(back to Table of Contents)
(back to Components)

 Name                         Features                                         Catalog Number
 pENTR 1A                     N- and C-terminal fusions in E. coli or          11813011
                              eukaryotic cells
 pENTR 2B                     N- and C-terminal fusions in E. coli or          11816014
                              eukaryotic cells
 pENTR 3C                     N- and C-terminal fusions in E. coli or          11817012
                              eukaryotic cells
 pENTR 4                      N- or C-terminal fusions in E. coli. Native in   11818010
                              eukaryotic cells
 pENTR 11                     Native expression in E. coli or eukaryotic       11819018
                              cells.
 pENTR/U6                     RNAi studies using Lentiviral expression.        K494500
 pENTR/H1/TO                  Inducible RNAi studies using Lentiviral          K492000
                              expression
 pENTR221                     Vector containing Ultimate ORF clone             HORF01/MORF01
 pENTR/GeneBLAzer             Entry vector for the GeneBLAzer system           12578118
 pCR8/GW/TOPO                 TA cloning vector, Spectinomycin selection       K250020/
                                                                               K252020
 pENTR 5’ TOPO                Entry vector for 5’ element in the MultiSite     K59120
                              Gateway system
 pENTR/D-TOPO                 Directional TOPO entry vector                    K240020
 pENTR/SD/D-TOPO              Directional TOPO entry vector with gene 10,      K242020
                              and Shine-Dalgarno sequence
 pENTR/TEV/D-TOPO             Directional TOPO entry vector with 5’ TEV        K252520
                              protease cleavage site

Destination vectors
(back to Table of Contents)
(back to Components)

Cell-free Expression



                                                                   13
 Name                      Features                                       Catalog Number
 Expressway Plus In        No vector (K990010), pEXP1-DEST                K990010/
 Vitro Protein Synthesis   (K990020), or pEXP2-DEST (K990030)             K990020/
 System                                                                   K990030
 Expressway Plus           No vector (K990060) or pEXP3-DEST              K990060/
 Expression System with    (K990070)                                      K990070
 Lumio Technology
 pEXP1-DEST                N-terminal 6xHis, Xpress epitope, EK           V96001
                           cleavage
 pEXP2-DEST                C-terminal V5-6xHis tag                        V96002
 pEXP3-DEST                N-terminal lumio, 6xHis tag, TEV,              V96003

Prokaryotic Expression
 Name                      Features                                       Catalog Number
 E. coli Expression        Includes pDEST14, pDEST15, pDEST17,            11824026
 System                    pDEST24, DH5a, BL21-AI, LR clonase
 pET104.1-DEST.            T7/lac promoter, N-term BioEase tag for in     K10401
                           vivo biotinylation, EK cleavage
 pET-DEST42                T7/lac promoter, C-term V5-6xHis.              12276010
 pDEST14                   T7 promoter, no tag                            11801016
 pDEST15                   T7 promoter, N-terminal GST                    11802014
 pDEST17                   T7 promoter, N-terminal 6xHis                  11803012
 pDEST24                   T7 promoter, C-term GST                        12216016
 pET160-DEST               T7/lac promoter N-terminal Lumio, 6xHis,       12583035
                           TEV site
 pET161-DEST               T7/lac promoter, C-term Lumio, 6xHis           12583043
 pET160/GW/D-TOPO          T7/lac promoter, N-term Lumio, 6xHis, TEV      K16001
                           site
 pET161/GW/D-TOPO          T7/lac promoter, C-term Lumio, 6xHis           K16101
 pBAD-DEST49               N-term Thioredoxin, C-term V5-6xHis,           12283016
                           araBAD promoter

Yeast Expression
 Name                      Features                                       Catalog Number
 pYES2-DEST52              GAL1 promoter, C-term V5-6xHis                 12286019
 pDEST22*                  Prey vector with the Gal4 AD in the            10835031
                           ProQuest two-hybrid system
 pDEST32*                  Bait vector with the Gal4 BD in the ProQuest   10835031
                           two-hybrid system

Insect Expression
 Name                      Features                                       Catalog Number
 Baculovirus Expression    Baculovirus pDEST 8, 10, 20 set, LR            11827011
 System with               Clonase Enzyme Mix, pENTR-GUS Library
 GATEWAY™                  Efficiency DH5α cells
 Technology
 pDEST 8                   Polyhedrin promoter, Native expression         11804010




                                                               14
 pDEST 10                Polyhedrin promoter, N-terminal 6X his         11806015
 pDEST 20                Polyhedrin promoter, N-terminal GST            11807013
 BaculoDirect N-Term     Polyhedrin promoter, N-term 6xHis-V5, TEV      12562054/
 linear DNA              site                                           12562062
 BaculoDirect C-Term     Polyhedrin promoter, C-term V5-6xHis           12562013/
 linear DNA                                                             12562039
 BaculoDirect Secreted   Polyhedrin promoter, N-term honeybee           12562021/
 linear DNA              melittin (HBM) secretion signal, 6xHis-V5,     12562047
                         TEV site
 pMT-DEST48              DES Metallothionein (MT) promoter, C-term      12282018
                         V5-6xHis
 pMT/BioEase-DEST        DES N-term BioEase tag for in vivo             V414020
                         biotinylation, MT promoter, EK site,
 pIB/V5-His-DEST         OpIE2 promoter, C-term V5-6xHis, non-viral     12550018
                         stable insect expression

Mammalian Expression
 Name                    Features                                       Catalog Number
 pcDNA3.1/nV5-DEST       CMV promoter, N-terminal V5, Geneticin         12290010
                         selection
 pcDNA3.2-DEST           CMV promoter, C-terminal V5, Geneticin         12489019
                         selection
 pcDNA6.2/V5-DEST        CMV promoter, C-terminal V5, Blasticidin       12489027/
                         selection (Tag-on-demand technology)           K42001
 pcDNA6.2/GFP-DEST       CMV promoter, C-terminal GFP, Blasticidin      K41001
                         selection (Tag-on-demand technology)
 pcDNA6/BioEase-         CMV promoter, N-term BioEase tag, EK site      K98001
 DEST
 pcDNA-DEST40            CMV promoter, C-term V5-6xHis, Geneticin       12274015
                         selection
 pcDNA-DEST47            CMV promoter, C-term GFP, Geneticin            12281010
                         selection
 pcDNA-DEST53            CMV promoter, N-term GFP, Geneticin            12288015
                         selection
 pDEST26                 CMV promoter, N-terminal 6xHis, Geneticin      11809019
                         selection
 pDEST27                 CMV promoter, N-term GST, Geneticin            11812013
                         selection
 pT-REx-DEST30           CMV promoter, no tag, tetracycline inducible   12301016
                         system
 pT-REx-DEST31           CMV promoter, N-term 6xhis, tetracycline       12302014
                         inducible system
 pEF-DEST51              EF-1a promoter, C-term V5-6xHis, Geneticin     12285011
                         selection
 pEF5/FRT/V5-dest        Flp-In expression vector, EF-1a promoter, V-   V602020
                         term V5, Hygromycin selection
 Mammalian Expression    With three destination vectors pcDNA3.2-       11826021
 System with             DEST™, pDEST™26, pDEST™27 and
 Gateway™                Library Efficiency DH5a, LR clonase,
                         pENTR-Gus, and Proteinase K.
 pcDNA6.2/GW-V5/D-       CMV promoter, C-term V5, Blasticidin           K246020
 TOPO                    selection




                                                           15
 pcDNA3.2/GW-V5/D-    CMV promoter, C-term V5, Geneticin              K244020
 TOPO                 selection
 pcDNA6.2/nLumio-     CMV promoter, N-term Lumio, Blasticidin         12589032
 DEST                 selection, Dual In-Cell Labeling kit
 pcDNA6.2/cLumio      CMV promoter, C-term Lumio, Blasticidin         12589016
 DEST                 selection, Green In-Cell Labeling kit
 pcDNA6.2/cLumio      CMV promoter, C-term Lumio, Blasticidin         12589024
 DEST                 selection, Red In-Cell Labeling kit.
 pcDNA6.2/cGeneBLAz   CMV promoter, C-term bla(M) tag,                12578043 in vivo
 er-DEST              Blasticidin selection, in vitro or in vivo      12578035 in vitro
                      detection kit
 pcDNA6.2/nGeneBLAz   CMV promoter; N-term bla(M) tag;                12578068 in vivo
 er-DEST              Blasticidin selection, in vitro or in vivo      12578050 in vitro
                      detection kit
 pcDNA6.2/cGeneBLAz   CMV promoter; C-term bla(M) tag;                12578084 in vivo
 er-GW/D-TOPO         Blasticidin selection, in vitro or in vivo      12578076 in vitro
                      detection kit
 pcDNA6.2/nGeneBLAz   CMV promoter; N-term bla(M) tag;                12578100 in vivo
 er-GW/D-TOPO         Blasticidin selection, in vitro or in vivo      12578092 in vitro
                      detection kit

Viral Expression
 Name                 Features                                        Catalog Number
 pAd/CMV/V5-DEST      Adenoviral expression, CMV promoter, C-         V49320/
                      term V5, TK polyA                               K493000
 pAd/PL-DEST          Adenoviral expression, promoter-less, no        V49420/
                      tags                                            K4940-00
 pAd/BLOCK-iT/V5-     Adenoviral expression, promoter-less, use       V49220
 DEST                 with pENTR/U6 or pENTR/H1/TO entry
                      vectors.
 pLenti 6/V5-DEST     Lentiviral expression, CMV promoter, C-         V49610/
                      term V5, Blasticidin selection                  K496000
 pLenti4/V5-Dest      Lentiviral expression, CMV promoter, C-         V49810/
                      term V5, Zeocin selection                       K498000
 pLenti 6/UbC/V5-     Lentiviral expression, UbC promoter, C-term     V49910/
 DEST                 V5, Blasticidin selection                       K499010
 pLenti4/TO/V5-DEST   Lentiviral expression, CMV/TO tetracycline-     K496700
                      inducible promoter, C-term V5, Zeocin
                      selection
 pLenti 6/BLOCK-iT-   Lentiviral expression for RNAi studies, use     K494300/
 DEST                 with pENTR/U6 or pENTR/H1/TO entry              K494400
                      vectors, C-term V5, Blasticidin selection
 pLenti 4/BLOCK-iT-   Lentiviral expression for RNAi studies, use     V48820
 DEST                 with pENTR/U6 or pENTR/H1/TO entry
                      vectors, C-term V5, Zeocin selection
 pLenti6/R4R2/V5-     Promoter-less lentiviral expression, use with   K591000/
 DEST                 pENTR5’-TOPO, no tags, Blasticidin              K59110
                      selection.

Specialized vectors
 Name                 Features                                        Catalog Number
 Gateway Vector       Reading frame A, B and C.1 with one-shot        11828029
 Conversion system    ccdB survival T1 cells
 pDEST R4-R3          Destination vector to be used in MultiSite      12537023
                      Gateway system


                                                         16
                          Gateway system
 pCMVSPORT6 Not           For mammalian library construction using    12209011
 I/Sal I cut              Superscript Plasmid
 pBLOCK-iT 3 DEST         Promoter-less vector for RNAi studies, no   V48620
                          tags, use with pENTR/U6 or pENTR/H1/TO,
                          Geneticin selection
 pBLOCK-iT 6 DEST         Promoter-less vector for RNAi studies, no   V48720
                          tags, use with pENTR/U6 or pENTR/H1/TO,
                          Blasticidin selection
 pVAX200-DEST             CMV promoter, designed for vaccine          12727010/
                          research, Kanamycin selection in E. coli    12727015/
                                                                      12727023
 pSCREEN-iT/lacZ-         CMV promoter, N-terminal lacZ gene,         V47020/
 DEST                     reporter vector for screening RNAi          K491500/
                                                                      K491600

ASSOCIATED PRODUCTS
(back to Table of Contents)

 Product                                                     Size                 Catalog Number
 One Shot OmniMAX 2-T1R Chemically Competent E. coli         20 x 50 ul           C854003
 One Shot TOP10 Chemically Competent E. coli                 20 x 50 ul           C404003
 Library Efficiency DH5alpha Chemically Competent E. coli    5 x 0.2 ml           11782018
 One Shot ccdB Survival T1R Chemically Competent E. coli     10 x 50 ul           C751003
 S.N.A.P. MidiPrep Kit                                       20 reactions         K191001
 PureLink HQ Mini Plasmid Purification Kit                   100 reactions        K210001
 PureLink PCR Purification Kit                               50 reactions         K310001
 Ampicillin                                                  20 ml (10 mg/ml)     11593019
 Kanamycin Sulfate                                           100 ml (10 mg/ml)    15160054
 Zeocin                                                      1g                   R25001
                                                             5g                   R25005
 AccuPrime Pfx DNA Polymerase                                200 rxns             12344024
                                                             1000 rxns            12344032
 AccuPrime Pfx SuperMix                                      200 rxns             12344040



                                Need more help? Please email us by clicking here.




                                                            17

								
To top