NAT standards for clinical virology by sammyc2007

VIEWS: 94 PAGES: 17

									NAT Standards for Clinical Virology
Sally Baylis, NIBSC SoGAT XX, Warsaw 12-13 June 2007

Standardisation – Clinical Virology


NIBSC is working with the UK Clinical Virology Network (CVN) & the Health Protection Agency (HPA) to develop a standardisation programme to provide run controls for diagnostic laboratories

Initial Studies


Panels of viruses have been distributed to participating laboratories to select suitable run control formulations, these have included:
    

Influenza A (H1N1, H3N2) Influenza B Herpes simplex virus (HSV-1 & HSV-2) Cytomegalovirus Norovirus GII

Initial Studies contd.
Viruses diluted into virus transport medium & distributed to the participating laboratories Participants requested to test materials using routine extraction & amplification/detection procedures Data is returned electronically to NIBSC for analysis Returned data is used to make decisions on suitable formulations for further evaluation

HCVM Stock Material Used in Phase I Studies


Human cytomegalovirus (HCMV), Towne strain was cultured in vitro at the West of Scotland Specialist Virology Centre, Glasgow

Analysis of HCMV Results - Phase I
Virus Dilution
Lab B HCMV 10-4 22.79 Lab C 32.65

Ct Value (copies/ml)
Lab D 26.23 (1.9 x 106 copies/ml) Lab E 6.8 x 105 copies/ml Lab F -ve**

10-5

26.37

35.78

30.33 (1.1 x 105 copies/ml)

-ve** 4.4 x copies/ml 104

10-6

30.00

39.27

34.15 (7.5 x 103 copies/ml)

-ve** 3.5 x 103 copies/ml

Extraction Amplification/Detection Equiv. vol. of sample amplified ** Run controls as expected

MDx Probe 16 μl

MagNA Probe 20 μl

MDx Probe 26.5 μl

MDx Probe ?

Qiagen manual Probe ?

Results


Laboratory F failed to generate Ct values for HCMV distributed in Phase I of the study
Extensive follow up was performed to identify why this and another laboratory using the same assay had unexpected results Analysis of reactions on agarose gels revealed that product of the expected size was being amplified





Alignment of Towne Strain with TaqMan Probe
 



Assay targets glycoprotein gene of HCMV Analysis of the primer sequences revealed a mismatch in the middle of the reverse primer Analysis of sequence of probe vs Towne strain of HCMV revealed 2 mismatches:

GAGCGCCATCTGTTCCTTGTCGAGCAACATACGACGCACAGGGTCTTGAC TGTCGAGCAGCATACGGCGCA

Evaluation of Candidate Run Controls for Norovirus GII

+

Evaluation of Candidate Run Controls for Norovirus GII


Norovirus (previously known as the Norwalk-like viruses) is a common cause of gastroenteritis




Detection has traditionally relied upon EM
Two genetic clusters of NoV occur; GI and GII



l

Phase I of a study identified a suitable concentration of NoV GII isolate to use as a candidate run control


Faecal norovirus (GII) sample was obtained



Sample was disrupted using glass beads in 10 mM Tris-HCl, pH 7.4 containing 2% FCS, & treatment with chloroform, from which a virus stock was prepared

Norovirus GII Results Phase I
Virus Dilution
Lab A NoV GII 10-3 10-4 10-5 Extraction Amplification/Detection 30.97 34.80 38.23 MagNA Probe 80 μl

Ct Value
Lab B 22.70 25.98 28.68* MDx SYBR 16 μl Lab C 35.20 37.30* -ve MagNA Probe 10 μl Lab D 30.10 36.37 -ve MDx Probe 26.5 μl

Equiv. vol. of sample amplified

* One or more replicate tested negative

Evaluation of Candidate Run Controls for Norovirus GII



This has been distributed to 15 laboratories for on going analysis Standards will eventually be -marked



Norovirus GII Phase II
Norovirus Results
40 35 30

Lab H failed to detect NoV GII

Crossing point (Ct)

25 20 15 10 5 0 0 5 10 15

Lab A Lab B (16.9l) Lab G (5l) Lab H (40l) Lab J (13.9l) Lab K (12l) Lab M (10l) Lab N (20l) Lab O (40l)

20

25

Assay number

Future Work
Clinical panels have been proposed that include: CSF Transplant Genital (ulcer) HSV-1, HSV-2, HCMV, EBV, VZV enterovirus, paraenterovirus HCMV, EBV, adenovirus HSV-1, HSV-2, Treponema

Eye swabs

HSV-1, HSV-2, VZV, adenovirus,

Chlamydia

Future Work cont.
Gastroenteritis Respiratory Vaginal swabs Urethritis NoV, astrovirus Influenza A (H1, H3), influenza B, parainfluenza, RSV…… HSV-1, HSV-2, N. gonorrhoea, M. genitalis, C. trachomatis

N. gonorrhoea, M. genitalis, C. trachomatis

Proposal Prepare International Standards for HCMV and EBV


								
To top