Infections and Psychiatric Diseases Lecture Online

Infections and Psychiatric Diseases Lecture Outline Clinical and Epidemiologic Features of Schizophrenia and Bipolar Disorder  Biology of Endogenous Retroviruses  Role of Herpesviruses in Retroviral Transcription  Clinical Epidemiology of Herpesvirus Infections and Psychiatric Diseases  Clinical Trials of Antimicrobial Agents  Schizophrenia and the Clinical Laboratory Opportunities and Challenges Opportunities Common Disease (1% of American Population) Availability of more easily tolerated medications Challenges Rudimentary knowledge of disease pathogenesis No relevant animal models or cell lines No laboratory tests Minimal prediction of response to medication Schizophrenia and Bipolar Disorder Clinical Features  Schizophrenia  Positive Symptoms  Hallucinations, Delusions, Disordered Thinking  Negative Symptoms  Withdrawal, Amotivation, Restricted Expressiveness  Impairment in Cognitive and Social Functioning  Lifetime prevalence ~ 1% worldwide  Bipolar Disorder  Mania  Depression  Variable degree of positive and negative symptoms  Variable degree of cognitive impairment  Lifetime prevalence ~0.5% worldwide A Beautiful Mind Hollywood or Reality A Beautiful Mind Hollywood vs Reality? Reality Onset of schizophrenia without clear cause Attractiveness of delusions Role of medication Disease “burn out” at later age Hollywood Delusions coinciding with creativity  Shock therapy used at “high class” hospital Family support Schizophrenia and Bipolar Disorder Biological and Epidemiological Features  Lifelong illness with peak onset in early adulthood.  Range of structural and functional brain abnormalities visible on fMRI and PET scans.  Abnormal expression of brain receptors Dopamine Glutamate  Massive social and economic consequences  Available medications Control symptoms in many patients Have a high rate of side effects Do not appreciably alter the course of disease Microbial Agents and Schizophrenia Epidemiological Findings  Specific Infectious Agent  Perinatal Rubella (Brown et al, 2001; OR~3.5)  Neonatal Enterovirus (Jones et al, 1998 OR~4)  Maternal Herpesvirus (Buka 2001; OR~4)  Possible Infectious Exposure  Seasonality of Birth (Torrey at al, 1998; OR~2)  Urban Birth (Mortenson et at, 1999, OR~2.5)  Fever in Pregnancy (Torrey et al 2000, OR~3)  Pre-eclampsia ( Dalman et al, 1999, OR~2.5)  Case Reports  HIV  Herpes Simplex Virus 1/2  Toxoplasma gondii Genetics Of Schizophrenia and Bipolar Disorder • Increased Incidence in Biological First Degree Relatives • General Population  1% • First Degree Relatives 7-9% • Monozygotic Twins  30% • Most individuals with schizophrenia do not have a first • • degree relative with this disease. Genetic factors have a large relative risk but a small risk in the overall population (5%) Intensive search for genes using molecular methods • Multiple chromosomal regions of linkage • Single nucleotide polymorphisms of minor effect in selected populations (OR~2) • No genes of major effect in different populations Complex Human Diseases Beyond Koch and Mendel Mendel-Human traits are determined by individual genes which function independently of other genes and of environmental influences Koch-Many human diseases are caused by microbes which exert their effect independently of other microbes, environmental factors and genes Microbial Agents and Human Disease Koch’s Postulates Principles Specific infectious agents cause clearly delineated disease states The diseases cannot exist without the specific agent Etiologic agents cause disease in animal models Limitations Shared pathways of response to infection Genetic determinants of response Individual variation in response to infection Limited animal models of complex human diseases Complex Human Diseases Beyond Koch’s Postulates  Most common human diseases are caused by the interaction of environmental insults and susceptibility genes.  Many of the susceptibility genes are diverse determinants of human response to environmental factors to infection.  Informative laboratory methods for complex disorders have to address both genetic and environmental factors.  Prevention or treatment of the infections may result in the effective treatment of complex disorders: Helicobacter-Peptic Ulcer HPV-Genital Cancer Chlamydia-Cardiac Disease? Etiology of Complex Human Diseases Relative vs. Attributable Risk  Relative Risk-Chance of an individual with an exposure acquiring a disease relative to the general population  Population Attributable Risk-Percentage of the population with a disease which can be attributed to a specific factor  Diseases of single or limited etiologies-High relative and attributable risks  CFTR gene-Cystic Fibrosis  HIV-Acquired Immunodeficiency Syndrome  Complex Human Diseases Factors with high relative risk may have low attributable risks if exposures are rare  Apoliprotein genes-Alzheimer’s Disease  Maternal alcohol-Fetal malformations  M tuberculosis-Lung Disease Epidemiology of Schizophrenia Relative vs. Attributable Risk Factor Relative Risk Affected Father 7.2 Affected Mother 9.3 Affected Sibling 7.0 Urban Birth 2.4 Winter Birth 1.1 No Factor 1.0 Mortenson et al, NEJM 340:603, 1999 Epidemiology of Schizophrenia Relative vs. Attributable Risk Factor Relative Risk Affected Father 7.2 Affected Mother 9.3 (No affected parent) Affected Sibling 7.0 (No affected sibling) Urban Birth 2.4 Winter Birth 1.1 % Cases In Population 1.2% 2.4% 88.8% 2.2% 97.8% 32.9% 25% Mortenson et al, NEJM 340:603, 1999 Epidemiology of Schizophrenia Relative vs. Attributable Risk Risk Factor Population Attributable Risk Affected Parent 3.8% Affected Sibling 1.9% Affected Parent or Sibling 5.5% Place of Birth 34.6% Season of Birth 10.5% Place and Season of Birth 41.4% All Variables 46.6% Mortenson et al, NEJM 340:603, 1999 Schizophrenia Working Hypotheses Most cases of schizophrenia are the result of infections and other environmental insults occurring in genetically susceptible individuals before the onset of clinically apparent symptoms.  Distinct gene-environmental interactions may be operant in different populations.  Interactions do not follow Koch’s postulates.  The role of specific infectious agents can be defined by clinical trials of anti-microbial chemotherapy.  Identification of Infections in Schizophrenia Methods-Old and New  Analytic Methods      Differential Display PCR Library screening Microarrays Two-dimensional electrophoresis Enzyme immunoassays  Samples for Analysis  Brains collected by the Stanley Neuropathology Consortium  Cerebrospinal fluids (CSF’s) from individuals with recent onset schizophrenia  Blood samples from mothers of infants who developed schizophrenia in adult life. Differential Display PCR Brain from Individual with Schizophrenia (S) and Unaffected Control(U) M S U S U S U M HIV Human Endogenous Retrovirus HERV-W Endogenous Retroviruses Borderland Between Viruses and Genes  Integrated Genomic Elements with Homology to Retroviruses Arising from Germ Line Integration of infectious viruses during evolution      All Primates Old World Monkeys Apes Humans Individuals Endogenous Retroviruses Borderland Between Viruses and Genes II Dynamic Effects on Gene Function  Promoter control of adjacent genes- PLA2; Placental Genes  Interaction with infectious agents- Herpesviruses, Toxoplasma  Interaction with soluble mediators-Hormones; Cytokines  Functionality of viral proteins-Syncytin; amino acid transporters Role in Human Disease  Diabetes- Superantigen activation  Multiple Sclerosis- Glial cell function  Autoimmune Arthritis- T cell activity  Pre-Eclampsia- Aberrant Fusion of Trophoblasts Endogenous Retroviruses Activation and Transcription Microbe Hormone Mediator DNA 5’LTR Viral Proteins 3’LTR Endogenous Retroviruses Borderland Between Viruses and Genes  Integrated Genomic Elements with Homology to Retroviruses Arising from Germ Line Integration of infectious viruses during evolution      All Primates Old World Monkeys Apes Humans Individuals K113 Herv-W Endogenous Retroviral PCR CSFs:Schizophrenia and Controls Scz DNA Ctr Herv-W HERVw C1 A1 A2 A3 A4 A5 A6 GTTCAGGGATAGCCCCCATCTATTTGGCCAGGCATTAGCCCAAGACTTGAGTCAATTCTCATACCTGGACACTCTTGTCCTTCAG ---------------------------------------------------C--------------------------------------------------------------A---------------------------------------------------TG------------------------------A---------------------------------------------------TG----------------------------------C----------------C--G----------------------------G-----------A----------------------------T----------C--G---------------------------TG-----A------------------------------------------------------------------------------------------T------------CA---TA-------------------C--G---------------------------TG- Herv-W Envelope Chromosomal Distribution Herv-W and Amino Acid Transporters Lavillette et al, J Virol Jul;76(13):6442-52. ASCT1 HERV-W Receptor Brains of Cases and Controls Schi zophr eni a B pol ar D sor der i i C r ol ont Co n te n tra ti o n o f ASCT 1 Re c e p to r 5 P<.02 4 P<.005 3 P<.009 2 1 0 Ne u ro n In te r-Ne u ro n W h ite M a tte r Cingulate Gyrus Human Endogenous Retroviruses Activation by HSV-1Perron et al J Gen Virol. 1993 Jan;74 ( Pt 1):65-72 . Retrovirus HSV-1 Reverse Transcriptase Activity Cognitive Functioning and Antibodies to Infectious Agents Individuals with Schizophrenia (N=229) Antibody Positive 80 Cognitive Score (RBANS Total) Antibody Negative ** 75 * 70 65 60 **p<.00001 *p<.009 HSV-1 Toxo CMV HSV-2 EBV HHV-6 Infectious Agent (IgG Antibodies) Cognitive Deficits In Individuals with Schizophrenia Relationship with Antibodies to HSV-1 HSV-1 Pos N=101 HSV-1 Neg N=128 Immediate Memory Concentration Language *** * Attention Delayed Memory RBANS Total 50 *** p<.0001 **p<.001 * p<.009 ** * *** 55 60 65 70 75 80 85 90 Score(Mean+/-95% Confidence) Cognitive Functioning Association with HSV-1 Serostatus HSV-1 Se ro p o s itiv e HSV-1 Se ro n e g a ti v e 1 00 RBANS T o ta l Sc o re 9 5 9 0 8 5 8 0 7 5 7 0 6 5 6 0 Sc h iz o p h re n ia Bi p o l a r Dis o rd e r N= 2 2 9 Pr = 4 4 . 1 % N= 1 1 7 Pr = 4 1 . 9 % Co n tro l N= 6 7 Pr = 4 1 . 8 % Cognitive Function in Schizophrenia and Bipolar Disorder HSV-1 Antibodies and Quintile of Total Score Sc h i z o p h re n i a Bi p o l a r Di s o rd e r N= 1 1 7 N= 2 2 9 Pro p o rtio n HSV-1 Se ro re a c tiv e 0. 0 8 0. 0 7 0. 0 6 0. 0 5 0. 0 4 0. 0 3 0. 0 2 0. 0 1 0. 0 0 < 2 0 th 2 0 -4 0 4 0 -6 0 6 0 -8 0 > 8 0 th Percentile- Total Cognitive Score Collaborative Perinatal Study Study Design      65,000 healthy mothers enrolled from 1957-1964 from 11 geographically diverse sites. Mothers followed closely during pregnancy. Neurocognitive and developmental testing during first 7 years of life. Primary outcomes cerebral palsy and mental retardation. Serum samples obtained from mothers during pregnancy and infants at birth (cord). Offspring identified with psychiatric diseases in 1990’s and matched to maternal and cord blood serum specimens.  Unselected offspring evaluated for abnormalities of pregnancy, birth, and child development. Schizophrenia in Adult Life Infection During Fetal Development 6.00 4.80 Odds Ratio 3.60 2.40 1.20 0.00 CMV CMV Rub IgG IgM IgG Rub Toxo Toxo HSV1 HSV2 Herv IgM IgG IgM IgG IgG W Effect of HERV-K and HSV-1 on Eclampsia and Mental Illness Un a d ju s te d Ad j s d f r ut o e Ra c e , SES 1 0 9 8 Odds Ratio 7 6 5 4 3 2 1 0 H v- K er H 1 SVH ERV- K HSV- 1 / . H v- K er H 1 SVH ERV- K HSV- 1 / Ec l m i a ps a M en t al I l ess n Effect of Maternal HSV-2 on Pregnancy and Child Development Unadjusted Adjusted for Race, SES 4.50 4.00 Odds Ratio 3.50 3.00 2.50 2.00 1.50 1.00 0.50 0.00 Abnormal Speech Low IQ Abnormal Vision Any Fetal Deaths Complication Age 7-8 Perinatal Valacyclovir Clinical Trial Individuals with Schizophrenia Enrollment of 66 patients with stable schizophrenia on standard medication given Valacyclovir 2 gm/day for 16 weeks  Evaluation by the positive and negative symptom score (PANSS)  Change in score correlated with viral antibody status at start of study   HSV1/2  CMV  Other herpesviruses Response to Valacyclovir HSV-1 Antibody Status HSV-1 Seropositive 20 HSV-1 Seronegative Per cen tag e Imp r o vem en t 20 15 10 5 0 -5 -1 0 Percentage Improvement 10 0 -1 0 2 4 8 12 16 2 4 8 12 16 Week of Valacyclovir Week of Valacyclovir Positive Symptoms Total Symptoms Response to Valacyclovir by CMV Status Percentage Improvement Positive Scale 30 20 Negative Scale P<.006 20 10 10 0 0 -10 -10 2 4 8 12 16 2 4 8 12 16 Percentage Improvement General Scale 20 20 Total Score P<.02 10 10 P<.0005 0 0 -10 2 4 8 12 16 -10 2 4 8 12 16 CMV Seropositive CMV Seronegative Prevalence of Cytomegalovirus Populations with Schizophrenia Cologne-Untreated Cologne-Recent Onset- Treated Cologne-Control Heidelberg-Recent Onset- Treated Heidelberg-Control Baltimore-Stable Treated Baltimore-Control 0 10 20 30 40 50 60 70 80 Prevalence (%) Effect of Valacyclovir on Schizophrenia Possible Explanations     Statistical artifact ?  p<.0005 with covariance for multiple factors Placebo effect?  Improvement only in CMV seropositive subjects  Improvement persists throughout treatment Non-viral effect of valacyclovir/acyclovir?  Effect only in CMV seropositive individuals The replication of CMV contributes to the symptoms of schizophrenia in some individuals  Possible role of an antigenically related herpesvirus? Valacyclovir Treatment of Schizophrenia-Planned Trials  Placebo-control trials using encapsulated valacyclovir and placebo  Stable patients with schizophrenia  Recent onset patients with schizophrenia  Patients with bipolar disorder  High-risk individuals with prodromal symptoms  Study supported by the Stanley Medical Research Institute, without support from the pharmaceutical industry. Infections and Schizophrenia Conclusions  Recent onset schizophrenia is associated with: Increased transcription of HERV-W Increased levels of antibodies to CMV  Past infection with HSV-1 is associated with cognitive impairment in individuals with stable schizophrenia and bipolar disorder, but not in unaffected controls.  Maternal exposure to infectious agents is associated with an increased rate of schizophrenia in the offspring.  The administration of valacyclovir can reduce symptoms in some individuals with stable schizophrenia.  The continued evaluation of the role of the prevention and treatment of infection in the management of psychiatric diseases remains a high priority. Microbial Agents and Schizophrenia Acknowledgements  Johns Hopkins University  Harvard University  Loraine Brando  Frances Yee  Vern Caruthers  Inna Ruslanova  Bogdana Krivogorsky  Steve Buka  Ming Tsuang  University of Heidelberg  Silke Bachmann  Johannes Schroeder  Stanley Medical Research Institute  Michael Knable  Maree Webster  Karolinska Institute  Håkan Karlsson  University of Cologne  F Markus Leweke  Sheppard Pratt Hospital  John Boronow  Catherine Stallings