IP, the FDA, and the Startup by sir68701

VIEWS: 0 PAGES: 44

									IP, the FDA, and the Startup




                Vern Norviel
   Partner, Wilson Sonsini Goodrich & Rosati
The way to get good ideas is to get lots of
  ideas and throw the bad ones away –
              Linus Pauling
                     Agenda

• Objectives of an IP Program in a Startup Company
   – Financing
• Forms of IP Protection- Balancing FDA protection
 and patent protection
• How the idea gets into the company
• Cutting Edge IP Issues
• Changes coming up in US patent law
• Q/A
       Introduction

• Started at Chevron 1985
• Partner at Townsend and Townsend
 1985-1994
• Early employee and GC of Affymetrix
 1994-2002
• Early employee and GC of Perlegen
 2002-2003
• Partner at WSGR 2003
   – Leads the Patents and Innovation
     Strategies Group
       Objectives of an IP Program in a Startup

•   The FIRST objective should be to SET
    objectives
•   Possible priorities
      – Make sure others cannot patent your
        ideas
      – Develop a portfolio as a “trading card”
        when, e.g. Pfizer comes calling after
        you are successful
      – Stop others
          Two levels- clinical data vs the
             field
      – Simply ensure freedom to operate via
        FTO studies
      Typical Start-Up Biotech/Pharma Objectives
• GUARANTEE Freedom to
    operate vs the entire world
•   GURANTEE to stop competitors in the entire
    field
•   AT LEAST have patent protection sufficiently
    broad to protect against data certification
•   OR at a minimum have data exclusivity
•   Maybe or maybe NOT
     – Minimize cost
     – Develop a broad portfolio
       (not necessarily covering our
       products) as a trading card deck
• Secure Financing
 An editorial commentary: Current Startup Financing Market

• Worst IPO Market Ever? In the third quarter of 2008, venture-
 backed companies generated just $4.57 billion in liquidity through initial
 public offerings (IPOs) and mergers and acquisitions (M&As), down
 66% from the $13.4 billion generated in the third quarter of 2007.
 (www.venturecapital.dowjones.com)
• About $551 million raised via seven IPOs as of September 2008, thus
 on pace to be the worst year on record in terms of both number of IPOs
 and liquidity generated via IPO.
• Startup Funding Steady? A study by the Center for Venture
 Research at the University of New Hampshire put total angel investment
 in the first half of 2008 at $12.4 billion, 4.2 percent higher than the first
 half of 2007. (“Angel Investors Fly Steady,” Red Herring, October 10,
 2008)
    New Venture Capital Financing by Sector*




*Source: Venturedeal.com
So financing is still possible, and a key is to
          protect the inventions…
                Forms of Protection Used
• Most companies use ALL forms of protection, to some
    greater or lesser degree
•   The types are:
      – Patents
      – Copyrights
      – Trade Secrets
      – Trademark
      – FDA exclusivity
•   Patents are arguably the most important form of IP for a
    biotech/pharmaceutical company
                      What is a Patent?

• A patent conveys the right to exclude others from making,
 using or selling the claimed invention for the term of the
 patent
• Does not mean your are free of the patents of others
• Term: 20 years (roughly)
• Patents are issued by individual countries
      Enforcement is limited to within country’s borders
• A competitor can be stopped, even if they come up with
 the idea later, but independently
       In other words, we (the government)
                will make a “DEAL”
• In exchange for telling the world about your idea (rather
 than keeping it a secret), we (the government) will let
 you keep other people from using your idea it for a
 “brief” period of time
              What can you Patent?


• ANYTHING!    (well, almost...)
    Devices, compositions, methods, kits, software,
     business models
          Requirements for Patentability

• New
• Useful
• “Nonobvious”
      Obviousness is a function of time
      Early filing reduces the amount of prior art
• You must describe to the world how to make/use the
 invention
• You must tell the world the BEST way to make/use
 your invention
                      Obviousness
• General standard: To be obvious the references must
 have every element of an invention, plus some reasoned
 basis for combining the references
• SO
   – If one paper teaches glass bulbs
   – And another paper teaches inert gas
   – And another teaches wires
   – BUT there is no reasoned basis to combine
     them, you can patent the light bulb
                    Preserving Patent Rights

•   “Absolute” novelty required outside the U.S.
         You cannot publicly talk about something prior to patent filing-
          this ends up being the actual rule
•   But, even if you have, you have 1 year in the US
•   Get applications on file before public disclosures,
    publications, offers for sale
         Patents can be filed in
          a manner that will not
          hold you up
         Don’t forget that investors
          will not sign an NDA
                Elements of a Patent

• Background
• Summary of the Invention
• Specification: Enablement and Best Mode
   – Basically a decent scientific paper
• Drawings
• CLAIMS
• Abstract
 Another form of protection- FDA exclusivity

• IF the molecule has never been approved before,
 others cannot use your clinical data- they must run
 a new clinical trial, e.g for a new indication
• But,
   – The protection is only 5 yrs (10 years in EP)
   – Someone can use the SAME molecule absent a
     patent, but they must just run their own trial
• Note: IT’S FREE (compared to a patent)!
         One important thing to note
         about this complex process

• Lots of lawyers are involved.
• THEREFORE, it is expensive!!!!
Why do people spend the $$$$ on IP?
        Because it can be worth it.
Interaction of the FDA and the patent process

• Major fact: It normally costs huge huge sums of money to
  perform a clinical trial SO DEPENDING ON THE BUSINESS
  MODEL, there are three levels of protection for drugs/devices
    – FDA exclusivity for the molecule MAY be enough, i.e. the
      market allows for competitors that also have to run clinical
      trials
         Consequence: Narrower patents are acceptable, and
           “safer”
    – But even in these cases, a patent may have longer life, so
      they are often desirable
    – If the business model requires you must own the space-
      You must have a BROAD patent, eg. All regulation of a
      gene
                Possible Company types

• A “new” molecule that was known for a hundred years, but
    never was approved as a drug. No patents, 5 yrs of data
    exclusivity
      – Perhaps with a method patent to at least prevent approval
        for the SAME indication
•   A “new” molecule that has both patent and data exclusivity
      – Patent could be broad, and cover the whole class of
        molecules, or a silver bullet
•   A new target/indication that uses an old molecule and has a
    patent on the METHOD
      – Drug partners do not like this
      – If the molecule is not otherwise sold at generic prices it
        may in fact be ok however,
                    Where did the IP come from?

•   Be very careful of founders with former employers--- i.e. all founders need to
    be aware of their prior contracts
•   Obviously many companies start from a university license
     – Most “big” universities are “easy” to deal with
            Standard terms
            Quick turnaround
            Realistic about the world
      – Other academics can be tougher, largely by inexperience
•   Don’t try to avoid these issues. It is harder to solve prior employer issues
    later when you have a valuable business that when you have nothing
       – It is very uncomfortable to resolve this as part of a financing
       – Virtually all VCs and underwriters will probe this issue
                      Company Process Issues
•   During fund raising
     – File before you talk to VC’s; they will rarely sign an NDA
     – File provisionals before you talk with the VCs
     – Get consulting agreements, employment agreements with those involved


•   After fund raising, and early on
     –   No employee or consultant without an agreement
     –   Make invention disclosure process routine
     –   Patent committee at an early date
     –   NDAs with collaborators/suppliers........
     –   Review process for technical papers
     –   Lab notebooks and process around them
                 Freedom to Operate (FTO)
• A study to determine if you infringe the patents of others
• Tech
   – Usually just a check of direct competitor patents before the fund
     raising or as part of diligence
• Biotech
   –   You really must KNOW if there are issues
   –   If you don’t do it, the investors will
   –   Usually a very expensive process
   –   Involves looking at every patent in your area. As well as
       “background” technologies. Often thousands of patents to review
                 The Venture Capital Process

•   As part of a financing from Angels,
    diligence may be minimal
      – But, it is better to be prepared, and
        appear to know your field
•   As part of a larger Series A
      – The VC will often hire a diligence firm
      – They will look at
            Whether you can get good patents
            Documentation issues
            Whether you have freedom to operate
                – Often better to know where you stand before they
                  are involved
                – Sometimes this results in buying good patents
                          “Burning” Issues
• At their heart, all of the burning
  issues are asking the question
    – “Is society better off by
        giving a broad patent and allowing one
         company to control an area (but likely
         leaving it well funded), or
         better off allowing a lot of people in the
         area and allowing more (but perhaps
         not well funded) research”
• EG. Assume you invented aspirin and it was the
  first pain reliever. Should you be entitled to a
  patent on a) aspirin, or b) ALL pain relievers
                Some “Burning” Issues

• Genes- Utility
     – GATCTACCATGAAAGACTTGTGAATGCTGGTGCC
       CAGAGTGGGATTTCGGGATT
• Should someone be entitled to a patent on this
    string of letters after running a DNA sequencer???
•   Answer: No, UNLESS
     – You have discovered a credible, significant utility for
       this string of letters.
     – Let’s say, you discovered this is the gene that
       causes macular degeneration
        Let say you DO know what the
       function of this string of letters
• A little about the drug development process
   – Often people find a gene’s function, make mouse models
     of the gene, etc.
   – THEN, they do things like make antibodies to it, develop
     DNA tests, and SCREEN FOR SMALL MOLECULES
   – This is pretty darn hard
• What can you get a patent on?
   – In the US and EP, probably the dna, the diagnostics, the
     protein, antibody therapeutics, methods of conducting
     assays with the gene….
   – But what about small molecules that interact with this
     gene?????- Probably NOT
        But what about those methods of
              conducting assays?
• Lets say you get a claim like: “A small molecule drug
 discovered by the process of conducting assays on the
 above gene”
• That would probably be a really valuable thing.
• BUT, the courts are saying you can’t get that patent now,
 because you didn’t describe WHAT THOSE SMALL
 MOLECULES WERE
  – (University of Rochester v. Searle)
              Clinical Trial Exemption

• General law- You can use a patented compound in
 preparing data for a clinical trial
   – But, how far back does this go?
   – Merck v Integra- pretty far back! ANYTHING used in
     development of data for a clinical trial, eg small
     molecule libraries
      In this case, a patented molecule was being used with
       others to explore new molecules that might work in cancer
       (RGD peptides)
      But NOT research tools- at least for now
      This could have a huge impact on “tools” companies if a
       future decision goes the other way
          Changes in the US? - Big changes
                      coming?

• The outcome is VERY uncertain, but we may see the first
  major changes in the patent system since 1952
• First to file/first to invent
    – Now: whoever INVENTS first gets the patent (in theory). In
      Europe, whoever FILES first gets the patent
    – The US has been off base on this with respect to other countries
    – The law may be changed to provide for the first filing, much like
      Europe
    – May avoid long and expensive miniature lawsuits called an
      “interference”
                    Changes? (cont)

• Oppositions?
   – In Europe, after a patent is allowed it can be “opposed”
     based on art the examiner did not find
   – The theory is that it prevents bad patents from coming
     along
   – The US may develop a similar procedure
       May help overcome the recent tide of “bad” patents that
        have played heavily in the press
       But, remember all that money that was saved because
        interferences may not happen?
                  Changes? (cont)

• Other dramatic suggestions/changes
   – The possibility of obtaining an injunction has been
     reduced--such that actual harm must be shown and
     the public interest must be considered
   – Limiting the number of continuations?
   – Elimination of best mode requirement?
   – A new obviousness standard
                 A career in IP Law?

• You work with the cutting edge science in a number
 of technologies
   – Sometimes people find this stressful
• For those with high-demand PhD’s firms like WS
 will PAY FOR LAW SCHOOL
   – But.... It is hard work
WSGR PRACTICE
        So, A Typical Scenario: A Day In Our Life

•   A clever scientist at [Yale/JHU] comes up with a great new drug, diagnostic,
    or research tool
•   A few people see the vision, and come to WSGR to start a company
•   What do we do:
      – License in the IP from [Yale/JHU]
      – Help pitch them to our VC friends
      – Identify and license in technology from other universities that may be
         needed
      – Help in company formation
      – Defend in the due diligence of the VCs
      – Push their patents through the Patent office
      – Engage in reducing/eliminating IP that may be detrimental
      – Get the company GREAT patents throughout the world
      – Help partner the technology to move it rapidly to the market
                    Life Science Experience

•   More than 350 life sciences clients
•   Assisted life sciences clients in raising nearly $1 billion in more than 70
    rounds of venture financings in 2007
•   Assisted life sciences clients in more than 80 public offering transactions
    raising more than $8 billion since 1998
•   Assisted life sciences clients in more than 100 mergers and acquisitions
    valued over $10 billion since 1998
•   Dedicated Drug & Device Regulatory practice
•   Largest dedicated Life Sciences Partnering Transactions practice
•   Largest dedicated Life Sciences Patent Counseling and Prosecution practice
•   Dedicated Life Sciences Intellectual Property Litigation practice
World-Class IP Patents & Innovations Practice
• More than 85 Professionals
    – Dedicated attorneys, patent agents, and scientific advisors
    – More than half with PhDs in biotechnology related fields
• Exclusively focused on biotech and medical device companies
• Integrated with corporate, litigation, and transactional practices
• Attorneys with a track record of IP value creation
• Responsible for the development of the IP portfolios covering
  inventions such as IL-2, the DNA chip, cancer therapies,
  nanotechnology, stem cell technologies, and PCR
       PCR (Nobel Prize 1993) – patent drafted by Al Halluin
       GFP (Nobel Prize 2008) – patent drafted by Vern Norviel
       and John Storella
Life Sciences Practice


                Select Life Sciences Clients




                             Note: clients may have recently merged or been acquired
               Select Venture Capital Firm Clients
    Represent more than half of the top 100 most active venture capital firms with
    investments in the life sciences industry*, including:

•   Abingworth Management      •   Essex Woodlands Health                                  •       New Enterprise
                                   Ventures                                                        Associates
•   Alloy Ventures
                                                                                           •       Novartis Venture Fund
                               •   Flagship Ventures
•   Alta Partners
                               •   Frazier Healthcare Ventures                             •       Novo
•   Apax Partners              •   Hambrecht & Quist Capital                               •       Prospect Venture Partners
•   ARCH Venture Partners          Management                                              •       Rho Capital Partners
                               •                                                           •       Sanderling Ventures
•   Atlas Venture                  Highland Capital Partners
                                                                                           •       Skyline Ventures
•   Avalon Ventures            •   InterWest Partners                                      •       Sofinnova Partners
                               •   Kleiner Perkins Caufield & Byers                        •
•   Bay City Capital                                                                               SR One
                               •   Mayfield                                                •       SV Life Sciences
•   Burrill & Company                                                                      •       Three Arch Partners
                               •   Mohr Davidow
•   Canaan Partners
                               •   Morgenthaler                                            •       Venrock
•   De Novo Ventures                                                                       •       Versant Ventures
                               •   MPM Capital                                             •       Warburg Pincus
•   Delphi Ventures
•   Domain Associates
•   Draper Fisher Jurvetson


                                        *Source: VentureOne. Based on search of VC firms investing in companies from the following
                                        industry segments: Biopharmaceuticals, Healthcare Services, Medical Devices/Equipment, Medical
                                        Software & IS, Other Healthcare; investments made no earlier than 9/26/06
                          Our Partnering Practice
• Unequalled Scale
     – More than 50 attorneys fully dedicated to technology transactions
       including the following deal types:
         •   Strategic Alliances; Corporate Partnering Agreements
         •   Joint Ventures
         •   Collaborations and Co-Development Agreements
         •   Manufacturing, Supply and Distribution Agreements
         •   Strategic Technology Acquisitions; License Agreements
         •   Academic Collaborations
         •   Service Agreements (CRO, testing, other)
         •   Outsourcing Transactions
     – A collaborative cross-industry practice comprised of attorneys who are
       industry specialists
•   Unequalled Experience
     – Well over 200 major life sciences collaborations
     – Multiples more in other industries
          Life Sciences Expertise



                          Select Partnering Transactions


                                                                                          Bristol-Myers Squibb
  Ortho-McNeil-Janssen                                        Gilead Sciences            Agreement for the Global      Kyowa Hakko Kogyo Co Ltd
  Pharmaceuticals, Inc.             Santen                 Purchase Agreement for           Development and            Exclusive Licensing Agreement
   Licensing Agreement       Licensing Agreement             Cicletanine Assets        Commercialization of KAI-9803            of KW-0761
        July 2008                 June 2008                      May 2008                       May 2008                         May 2008




Human Genome Sciences               Tornier
Collaboration Agreement     Worldwide Collaboration             Medtronic                        Celgene                      Merck & Co
    Involving XmAb         Involving Synthetic Growth   Global Licensing Agreement        Strategic Global R&D              RCT Technology
      Technologies             Factor Technology               January 2008                   Collaboration                 Access Agreement
     February 2008               February 2008                                               September 2007                   August 2007




Penwest Pharmaceuticals         Kinetic Concepts             GlaxoSmithKline
 Research, Development,        Worldwide License            XP13512 Compound
                                   Agreement                  Development &                      Galderma                         Amgen
 Commercialization and
                             NeutroPhase Technology       Commercialization February     License Agreement January        Strategic Collaboration
   License Agreement
       July 2007                   June 2007                       2007                            2007                       January 2007

								
To top