Artemia authentication by RFLP of mitochondrial rDNA and HSP26-cDNA

Document Sample
Artemia authentication by RFLP of mitochondrial rDNA and HSP26-cDNA Powered By Docstoc
					Artemia authentication by
 RFLP of mitochondrial
rDNA and HSP26-cDNA
     W. Xiaomei1,2, F.
  Catania1,2, F. Dooms1,2,
     G. Van Stappen2,
      E. Naessens3,
     P. Sorgeloos2, P.
         Bossier1
   CLO- Sea Fisheries Department 1
     Lab Aquaculture and ARC2
         INVE Technologies3


    Artemia INCO workshop, Beijing
           September 2002
         Introduction
• Diversification of commercial
  Artemia cyst supply
• Broader spectrum of cyst
  samples and characteristics,
  e.g.
  – Cyst size
  – Nauplii size
  – HUFA
  – Vitamine C


• Hence need for the possibility
  to authenticate cyst samples.
          Aim

Develop a database(s) of
   DNA fingerprinting
patterns that could serve
       as a tool for
     authentication
  commercial Artemia
        samples
    Methodology on
       mt-rDNA
DNA extraction from a batch of
             cysts


  PCR amplification of rDNA


       RFLP analysis


       Data processing
  Methodology on mt-
     rDNA (cont)
• Isolation of DNA from cysts

  – Pretreatment
     • Suspension of 10 mg cyst in 50 µl
       for 2h
     • Crushing with sterile pestil
  – DNA extraction by
     • Promega kit (requiring mostly extra
       Ph/Chl purification)
     • CTAB extraction
     • Chelex (works also on single cysts)
 Methodology on mt-
    rDNA (cont)
DNA extraction from a batch of
             cysts


  PCR amplification of rDNA


       RFLP analysis


       Data processing
Methodology (cont)
PCR amplification of rDNA
       Methodology (cont)
       PCR amplification of rDNA
Homo sapiens   Gadus morhua   Penaeus monodon Artemia franciscana

cox1           cox1           cox1              cox1
cox2           cox2           cox2              cox2
atp8           atp8           atp8              atp8
atp6           atp6           atp6              atp6
cox3           cox3           cox3              cox3
nad3           nad3           nad3              nad3
nad4L          nad4L          nad5              nad5
nad4           nad4L          nad4              nad4
nad5           nad5           nad4L             nad4L
nad6           nad6           nad6              nad6
cob            cob            cob               cob
UNK            UNK            nad1              nad1
12s rRNA       12s rRNA       16s rRNA          16s rRNA
16s rRNA       16s rRNA       12s rRNA          12s rRNA
nad1           nad1           UNK               UNK
nad2           nad2           nad2              nad2
Methodology on mt-
   rDNA (cont)
PCR amplification of rDNA

 16S rRNA              12S rRNA




             1500 bp
UNIVERSAL PRIMER 12S rDNA
      AAACTGGGATTAGATACCCCACTAT
          CTAGGATTAGATACCCTA
Artemia 12S-SP primer

UNIVERSAL PRIMER 16S rDNA
       CCGGTCTGAACTCAGATCACGTAG
       CCGGTCTGAACTCAGATCA
Artemia 16S SP primer
 Methodology on mt-
    rDNA (cont)
  PCR amplification of rDNA
• PCR amplification conditions

    • 94°C, 2 min
    • (94°C 75s, 52°C 45sec, 72°C 2 min) x 34
    • 72°C 2 min

• Mg Cl2: 2.5 mM

• dNTPs 0.2 mM

• DNA polymerase: 1.75 U

• primers: 0.5 µM

• Target DNA: 50 –100 ng DNA
 Methodology on mt-
       rDNA
DNA extraction from a batch of
             cysts


  PCR amplification of rDNA


       RFLP analysis


       Data processing
   Methodology on mt-
      rDNA (cont)
     RFLP analysis
• Purification of the fragment
  using Promega kit
• RFLP analysis using
  – MseI
  – Tsp509I
  – HpaII
  – NdeII
  – TaqI
  – HaeIII
  – HinfI
  – DdeI
 Methodology on mt-
    rDNA (cont)
DNA extraction from a batch of
             cysts


  PCR amplification of rDNA


       RFLP analysis


       Data processing
Methodology mt-rDNA
       (cont)
  Data processing
   • Gelcompar software



    • Band assignment



  • Matrix of Dice index of
   similarity: 2nAB/(nA + nB)

  • UPGMA dendrogram
RFLP HaeIII+RFLP mseI+RFLP HpaII+RFLP NdeII+RFLP TaqI+RFLP Tsp509I+RFLP HinfI+RFLP DdeI
8RFLPs



                                                              UPGMA dendrogram




                                                                                                    100
 25


        30


               35


                      40


                             45


                                    50


                                           55


                                                  60


                                                         65


                                                                70


                                                                       75


                                                                              80


                                                                                     85


                                                                                          90


                                                                                               95
                                                                                                          unidentified Artemia      Karabogaz-Gol, Turkmenistan                         1374
                                                                                                          parthenogenetic Artemia   Karabogaz-Gol, Turkmenistan                         1322
                                                                                                          unidentified Artemia      Gahai, Qinghai Province, P.R. China                 1265
                                                                                                          unidentified Artemia      Karabogaz-Gol, Turkmenistan                         1380
                                                                                                          unidentified Artemia      Sayten, Kazakhstan                                  1367
                                                                                                          unidentified Artemia      Uzbeksitan                                          1162
                                                                                                          unidentified Artemia      Bolshoe Yarovoe, Russia                             1553
                                                                                                          unidentified Artemia      Kazakhstan                                          1016
                                                                                                          unidentified Artemia      Bolshoe Yarovoe, Russia                             1552
                                                                                                          unidentified Artemia      Pavlodar, Kazakhstan                                1518
                                                                                                          unidentified Artemia      Jingyu (Whale Lake), Xinjiang, P.R. China           1524
                                                                                                          parthenogenetic Artemia   Tanggu, Tianjin Province, P.R. China)               1187
                                                                                                          parthenogenetic Artemia   Wu Shen Qi County,Inner Mongolia, P.R.China         1242
                                                                                                          parthenogenetic Artemia   Bameng, Inner-Mongolia Province, P.R. China (id.)   1317
                                                                                                          parthenogenetic Artemia   Karabogaz-Gol (RHI), Turkmenistan                   1407
                                                                                                          unidentified Artemia      Karabogaz-Gol, Turkmenistan                         1504
                                                                                                          parthenogenetic Artemia   Ankiembe, Madagascar                                1314
                                                                                                          unidentified Artemia      Sorkaidak, Kazakhstan                               1523
                                                                                                          parthenogenetic Artemia   Vineta Swakopmund, Namibia                          1186
                                                                                                          unidentified Artemia      Medvezhe (Bear) Lake, Kurgan, Russia                1507
                                                                                                          unidentified Artemia      Urmia Lake, Iran                                    1505
                                                                                                          unidentified Artemia      Urmia Lake, Iran                                    1229
                                                                                                          unidentified Artemia      Urmia lake, Iran                                    1444
                                                                                                          unidentified Artemia      Urmia Lake, Iran                                    1226
                                                                                                          parthenogenetic Artemia   Aibi Lake, Xinjiang Province, P.R. China            1236
                                                                                                          unidentified Artemia      Coqen Lake, Tibet, P.R.China                        1526
                                                                                                          unidentified Artemia      Tibet, P.R. China                                   1329
                                                                                                          unidentified Artemia      Bozi Co, Tibet, P.R. China                          1461
                                                                                                          unidentified Artemia      Tibet, P.R. China                                   1346
                                                                                                          A. tibetiana              Laggor Co, Tibet, P.R. China                        1347
                                                                                                          A.franciscana             Vinh Chau, Vietnam                                  1301
                                                                                                          A. franciscana            San Francisco Bay, USA                              1258
                                                                                                          A. franciscana            Vinh Chau, Vietnam                                  1456
                                                                                                          A. franciscana            Vinh Chau, Vietnam                                  1455
                                                                                                          A. franciscana            Vinh Chau, Vietnam                                  1457
                                                                                                          A. franciscana            Vinh Chau, Vietnam                                  1454
                                                                                                          A. franciscana            San Francisco Bay (location 3), USA                 1470
                                                                                                          A. franciscana            San Francisco Bay (location 5) USA                  1472
                                                                                                          A. franciscana            Great Salt Lake, USA                                1287
                                                                                                          unidentified Artemia      Blenheim, New Zealand                               1422
                                                                                                          A. franciscana            GSL '00 ( N.A.) DOUG 11038                          1509
                                                                                                          A. franciscana            GSL '99 ( N.A.) >90%                                1508
                                                                                                          A. franciscana            Great Salt Lake, USA                                1320
                                                                                                          A.franciscana             Great Salt Lake,South Arm, USA                      1520
                                                                                                          unidentified Artemia      Estuario de Virrila, Peru                           479
                                                                                                          A. franciscana            Macau, Brazil                                       1300
                                                                                                          A. monica                 Mono Lake, USA                                      1277
                                                                                                          unidentified Artemia      Bonaire Duinmeer, Neth. Antilles                    28
                                                                                                          A. franciscana            Porto Arraya, Venezuela                             554
                                                                                                          unidentified Artemia      Curacao Fuik, Neth.Antilles                         502
                                                                                                          A. persimilis             Argentina                                           1321
                                                                                                          parthenogenetic Artemia   Wu Shen qi County, Inner Mongolia, P.R. China       1243
                                                                                                          unidentified Artemia      Xiechi Lake, Yuncheng, PR China                     1434
                                                                                                          unidentified Artemia      Yuncheng, P.R. China                                1206
                                                                                                          unidentified Artemia      Tuhum lake, Mongolia                                1463
                                                                                                          parthenogenetic Artemia   Megalon Embolon, Greece                             1420
                                                                                                          parthenogenetic Artemia   Citros, Pieria, Greece                              1280
                                                                                                          Artemia sinica            Yuncheng, Shanxi Province, P.R. China               1218
                                                                                                          unidentified Artemia      Yimeng, Inner Mongolia, P.R. China                  1188
                                                                                                          unidentified Artemia      Haolebaoji, Inner Mongolia, PR China, A. sinica     1415
                                                                                                          A. urmiana                Urmia Lake, Iran                                    1230
                                                                                                          A. salina                 Megrine, Tunisia                                    1268
                                                                                                          A. salina                 Wadi Natron, Egypt                                  1290
                                                                                                          A.salina                  Sfax, Tunisia                                       1269
                                                                                                          A. salina                 Larnaca, Cyprus                                     1011
                                                                                                          A. salina                 Larnaca, Cyprus                                     1148
Detail on the UPGMA dendrogram
RFLP HaeIII+RFLP mseI+RFLP HpaII+RFLP NdeII+RFLP TaqI+RFLP Tsp509I+RFLP HinfI+RFLP DdeI
8RFLPs




                       100
     60



              80
                             unidentified Artemia Karabogaz-Gol, Turkmenistan             1374
                             parthenogenetic Art. Karabogaz-Gol, Turkmenistan             1322
                             unidentified Artemia Gahai, Qinghai Province, P.R. Ch. 1265
                             unidentified Artemia Karabogaz-Gol, Turkmenistan             1380
                             unidentified Artemia Sayten, Kazakhstan                      1367
                             unidentified Artemia Uzbeksitan                              1162
                             unidentified Artemia Bolshoe Yarovoe, Russia                 1553
                             unidentified Artemia Kazakhstan                              1016
                             unidentified Artemia Bolshoe Yarovoe, Russia                 1552
                             unidentified Artemia Pavlodar, Kazakhstan                    1518
                             unidentified Artemia Jingyu (Whale Lake), Xinjiang, P. 1524
                             parthenogenetic Art. Tanggu, Tianjin Province, P.R. C. 1187
                             parthenogenetic Art. Wu Shen Qi County,Inner Mongol. 1242
                             parthenogenetic Art. Bameng, Inner-Mongolia Provinc. 1317
                             parthenogenetic Art. Karabogaz-Gol (RHI), Turkmenis. 1407
                             unidentified Artemia Karabogaz-Gol, Turkmenistan             1504
                             parthenogenetic Art. Ankiembe, Madagascar                    1314
                             unidentified Artemia Sorkaidak, Kazakhstan                   1523
                             parthenogenetic Art. Vineta Swakopmund, Namibia              1186
                             unidentified Artemia Medvezhe (Bear) Lake, Kurgan, . 1507
                             unidentified Artemia Urmia Lake, Iran                        1505
                             unidentified Artemia Urmia Lake, Iran                        1229
                             unidentified Artemia Urmia lake, Iran                        1444
                             unidentified Artemia Urmia Lake, Iran                        1226
                             parthenogenetic Art. Aibi Lake, Xinjiang Province, P.R.. 1236
                             unidentified Artemia Coqen Lake, Tibet, P.R.China            1526
                             unidentified Artemia Tibet, P.R. China                       1329
                             unidentified Artemia Bozi Co, Tibet, P.R. China              1461
                             unidentified Artemia Tibet, P.R. China                       1346
                             A. tibetiana             Laggor Co, Tibet, P.R. China        1347
                     Detail on the UPGMA
                         dendrogram
RFLP HaeIII+RFLP mseI+RFLP HpaII+RFLP NdeII+RFLP TaqI+RFLP Tsp509I+RFLP HinfI+RFLP DdeI
8RFLPs

                       100
  40


         60


                80




                             A.franciscana            Vinh Chau, Vietnam                  1301
                             A. franciscana           San Francisco Bay, USA              1258
                             A. franciscana           Vinh Chau, Vietnam                  1456
                             A. franciscana           Vinh Chau, Vietnam                  1455
                             A. franciscana           Vinh Chau, Vietnam                  1457
                             A. franciscana           Vinh Chau, Vietnam                  1454
                             A. franciscana           San Francisco Bay (location 3), . 1470
                             A. franciscana           San Francisco Bay (location 5) U. 1472
                             A. franciscana           Great Salt Lake, USA                1287
                             unidentified Artemia Blenheim, New Zealand                   1422
                             A. franciscana           GSL '00 ( N.A.) DOUG 11038          1509
                             A. franciscana           GSL '99 ( N.A.) >90%                1508
                             A. franciscana           Great Salt Lake, USA                1320
                             A.franciscana            Great Salt Lake,South Arm, USA 1520
                             unidentified Artemia Estuario de Virrila, Peru               479
                             A. franciscana           Macau, Brazil                       1300
                             A. monica                Mono Lake, USA                      1277
                             unidentified Artemia Bonaire Duinmeer, Neth. Antilles 28
                             A. franciscana           Porto Arraya, Venezuela             554
                             unidentified Artemia Curacao Fuik, Neth.Antilles             502
                             A. persimilis            Argentina                           1321
Detail on the UPGMA dendrogram
RFLP HaeIII+RFLP mseI+RFLP HpaII+RFLP NdeII+RFLP TaqI+RFLP Tsp509I+RFLP HinfI+RFLP DdeI
8RFLPs
                       100
20


      40


            60


                  80




                             parthenogenetic Art. Wu Shen qi County, Inner Mongol.1243
                             unidentified Artemia Xiechi Lake, Yuncheng, PR China 1434
                             unidentified Artemia Yuncheng, P.R. China                    1206
                             unidentified Artemia Tuhum lake, Mongolia                    1463
                             parthenogenetic Art. Megalon Embolon, Greece                 1420
                             parthenogenetic Art. Citros, Pieria, Greece                  1280
                             Artemia sinica           Yuncheng, Shanxi Province, P.R.. 1218
                             unidentified Artemia Yimeng, Inner Mongolia, P.R. Ch. 1188
                             unidentified Artemia Haolebaoji, Inner Mongolia, PR . 1415
                             A. urmiana               Urmia Lake, Iran                    1230
                             A. salina                Megrine, Tunisia                    1268
                             A. salina                Wadi Natron, Egypt                  1290
                             A.salina                 Sfax, Tunisia                       1269
                             A. salina                Larnaca, Cyprus                     1011
                             A. salina                Larnaca, Cyprus                     1148
  First analysis

There are seven major clusters

  •A. tibetiana
  •Parthenogenetic Artemia
  •A. franciscana
  •A. sinica
  •A. salina
  •A. persimilis
  •A. urmiana
         Techical problems:
       RFLP analysis on single
               cysts

                                                1500

                                                1000


                                                 500




                                                 100




RFLP analysis of mitochondrial rDNA on 1 cyst with Nde II
                  on strain ARC1154

      • more than one haplotype in a batch of cysts
    •In a single cyst: heteroplasmy or pseudo-genes
      Techical problems

• In most of cyst samples these
  technical problems only occur
  with one to two enzymes
• If a real mixture of two species
  is present in a cyst sample,
  double restriction patterns are
  found with all enzymes.
• In the previously shown
  dendrogram only samples
  without apparent technical
  problems are included.
  Robustness of the mt-
    rDNA technique
Sample     Biological ID   origin                 RFLP ID


ARC 1264   p               Yimeng, China          p
ARC 1315   p               Yimeng, China          p
ARC 1243   p               Wu Shen Qi, China      p
ARC 1154   p               InnerMongolia, China   p
ARC 1387   p               Karasjuk; Karakhstan   p
ARC 1388   p               Altai, Karakhstan      p
ARC 1389   p               Kuchuckshkoe, Russia   p
ARC 1406   f               Ingebright, Canada     f




  These samples, all
  containing double restriction
  patterns with one or more
  enzymes, were identified
  against the database
 Conclusions on the
  rDNA database
• The RFLP technique on a batch of
  cysts is able to differentiate easily
  between species.

• Within each species a lot a
  diversity can be found. Using 8
  restriction enzymes only 8x4
  nucleotides are probed with this
  RFLP experimental design, while
  the fragment is 1500 bp long (so
  only 2.1%). It is clear that the
  actual DNA sequence of this
  fragment would unvail much more
  variability.
 Conclusions on the
rDNA database (cont)
• The mitochondrial rDNA is normally
  used to differentiate families or even
  species within a genus. Here, using 8
  R.E. below-species diversity is very
  high. This is an indication for high
  genetic isolation of Artemia habitats.


• Probably depending on the local
  geographical conditions, the 8xRFLP
  technique might be able to
  differentiate Artemia samples at a
  local-salt-lake complex level. This
  would need more validation.
Methodology for HSP26
        RFLP
Total RNA extraction from a batch of
                cysts


 RT-PCR amplification of HSP26,
    yielding a 650 bp fragment


 RFLP analysis using 7 restriction
            enzymes


         Data processing
                    UPGMA dendrogram
                     Using HSP26 data


RFLP Hae III+RFLP Nde II+RFLP Hinf I+RFLP Hpa II+RFLP Tru9 I(Mse I)+RFLP Taq I+RFLP Tsp509 I
RFLP (7. R.E)
                                                             100
50




            60




                        70




                                    80




                                                 90




                                                                   A. franciscana          SFB                  1258
                                                                   A. franciscana          Vietnam              1454
                                                                   A. franciscana          Vietnam              1456
                                                                   A. franciscana          Vietnam              1457
                                                                   A. franciscana          Vietnam              1455
                                                                   A. franciscana          South Arm GSL 2001   1520
                                                                   A. parthenogen. Karabogaz-Gol                1407
                                                                   A. persimilis           Argerntina           1321

     Conclusion:
     • HSP26 is suppossed to be involved in the
       indogenous stress resistance of cysts. Hence,
       polymorphism might reflect local adaptation
       (non-neutral mutations). This needs further
       study.
     • By studying only the cDNA, the putative non-
       neutral polymorphism can be studied in detail.
     • HSP26 cDNA can be isolated from cysts. So
       stored samples can be used as well in such a
       study.
  General conclusions

• RFLP of the rDNA with eight
  restriction enzymes reveals a lot of
  polymorphism
• Within a species, and probably
  even within a lake, different rDNA
  haplotypes can be found.
• Commercial samples can be
  identified at the species level, even
  if technical problems like double
  restriction       patterns,       are
  complicating the analysis.
• For phylogenetic and population
  genetic studies, RFLP analysis on
  single cysts or even cloned rDNA
  fragment are necessary.

				
DOCUMENT INFO
Shared By:
Categories:
Stats:
views:75
posted:8/30/2010
language:Afrikaans
pages:27