Application of Zinc Finger Nuclease Gene Disruption Technology to Manufacture Genetically Modified T Cells for HIV Therapy Bruce Levine, Ph.D. Department of Pathology and Laboratory Medicine University of Pennsylvania Background and Hypothesis •The development of more than two dozen anti-HIV drugs has resulted in a dramatic decrease in morbidity and mortality associated with AIDS. But . . . •There are significant costs in $ and toxicity to a lifetime of antiviral drug chemotherapy •Drug access and compliance issues have contributed to an increase in drug-resistant viral strains •Hypothesis: Could zinc finger nucleases be used to introduce a disease resistance gene by disruption of CCR5? What are Zinc Finger Proteins? -specific DNA binding proteins, e.g transcription factors and other regulatory proteins Zinc Finger-DNA Recognition Paveltich and Pabo, Science 252:809 (1991) Linkage of Zinc Finger Proteins to Nucleases: Targeted Gene Repair or Disruption ZFN Mediated Cleavage DSB Donor DNA HR: deletion insertion Gene Disruption via Non-Homologous End Joining Gene Repair via Homologous Recombination Combinatorial Strategy with ZFNs To Achieve Genome Specific Targeting Fok1 nuclease domain Fok1 nuclease domain Porteus, Nat Biotech 2005 Zinc-finger protein-targeted gene regulation: Genomewide single-gene specificity ZFN Target Region 1 600 1056bp CCR5 ∆ 32 mutation • To disrupt CCR5 and prevent HIV entry, ZFN pairs were targeted to the region upstream of where the ∆32 mutation occurs CCR5 Is a Validated Therapeutic Target § CCR5 is the major coreceptor used for initial HIV infection § Patients homozygous for the CCR5 ∆32 mutation are resistant to HIV infection (1% caucasians) § Validated target for small molecule inhibitors, siRNA, intrabodies, and ZFP TFs § Most developing therapies aim at reducing the levels of CCR5 expression and require the active agent to be present continuously § “Hit-and-Run” or transient delivery of engineered ZFNs in vitro can permanently disrupt CCR5 to generate CCR5negative immune cells that are permanently protected against R5-tropic HIV. Analysis of Top 15 Predicted Off-Target Sites in CCR5-ZFN Transduced CD4 T-cells Chrom. 3 3 4 14 17 16 1 21 8 5 18 8 X 7 X 2 ZFN-L Target Mismatch ZFN-R Target Mismatch Gene Intron/Exon NHEJ% GATGAGGATGAC 0 AAACTGCAAAAG 0 CCR5 Exon 35.6% GATGAGGAcGAC 1 AAACTGCAAAAa 1 CCR2 Exon 4.1% GATGAGGATGAC 0 GATGAGGATGcC 1 ABLIM2 Intron ~1/20K AAACTGCAAAAc 1 AAACTGCAAAAG 0 None N/A N.D. cAACaGCAAAAG 2 AAACTGCAAAAG 0 ABCA6 Intron N.D. GATGAGGAgGcC 2 GgTGAGGATGAC 1 None N/A N.D. GcTGAGGATGAC 1 GATGAacATGAC 2 CACHD1 Exon N.D. AAACaGCAAAAc 2 AAACTGCAAAAG 0 None N/A N.D. 2 0 None N/A N.D. AAACaGCAAAAc AAACTGCAAAAG gAACTGGAAAAG 1 AAACTaGAAAAG 1 None N/A N.D. AAACTGGAAAAa 1 AAtCTGCAAAAG 1 None N/A N.D. 1 1 None N/A N.D. AAACTGCAtAAG AAACTGGAAAAa GcTGAGGATGAt 2 AAACaGGAAAAG 1 None N/A N.D. AAACTGGAAcAG 1 GcTGAGGATaAC 2 WBSCR17 Intron N.D. 1 2 DGKK Intron N.D. GATGAGGATGAg AcAaTGCAAAAG AAACaGCAgAAG 2 GcTGAGGATGAC 1 GALNT13 Intron N.D. N.D. – not detectable Of these 15 sites, 7 fall within annotated genes, 2 occur within exonic sequences (1) Mutation or disruption has not been connected with any known pathology (2) They have no described function in CD4+ T-cells. Approach to Pre-Clinical Testing of CCR5-ZFN UPENN Elena Perez Jim Riley Sangamo Mike Holmes Philip Gregory Primary CD4 cells Donor Donor ( HIV+) ( HIV-) Activate CD4 Cells Introduce ZFN plasmids Electroporation Ad5/35 Cell lines PM-1 Ghost Infect HIV-1 Culture 10 - 70 days Transfer to NOD/SCID/γc-/- Assess for genotoxicity Assess CCR5 gene disruption Assess function HIV resistance Cel 1 Assay for ZFN Gene Disruption Surveyor nuclease (Transgenomic) that preferentially cuts DNA at sites of duplex distortions. The ratio of uncleaved (wt-wt duplexes) to cleaved (wt-mutant or mutantmutant duplexes) is determined by analyzing the digested products on a nondenaturing polyacrylamide gel CCR5-ZFN Modified PM1 Cells Preferentially Survive and Expand in the Presence of HIV PM-1 Challenge - CCR5 Sequences at Day 52 DELETIONS: TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATC-TGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCCTG--AAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCCT--TAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATC--GATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCA--CTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATC---ATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATC----TAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCC----AAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATC-----AAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCA-----ATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGAT-----GCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGAT-------AAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATC-------TGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCC-------GATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATC--------GATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGAT--------AAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTC---------AACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTT----------TGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCC-----------AAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTC-------------TAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATG----------------TGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGC-----------------GTAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGA------------------AGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTG-------------------ACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTAGGCAACATGCTGGTCATCCTCA--------------------CTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCA---------------------AAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGC--------------------------AAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATG------------------------------------AAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACAT-------------------------------------------ATGACTGACATCTACCTGCTC INSERTIONS: TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATatAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGC TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATaaAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGC TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATgatAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTG TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGActgaTAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCT TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATtgatAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCT TTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATctgatAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACC TTTTGTGGGCAACATGCTGGTCATCCTCATCttaatttaATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACC ZFN-Modified Primary CD4 T-cells Preferentially Expand during HIV Challenge HIV Challenge #1 25 20 %CCR5 Modified Alleles 15 10 5 ZFN Mock ZFN HIV 0 Day 0 Day 5 Day 11 Day 17 Days Post Infection In Vivo Selection of CCR5-ZFN Modified Cells in NOD/SCID IL-2Rγnull Mice Primary CD4+ T Cells Isolated from Spleen Day 40 after HIV Challenge HIV+ Donor: Expansion of Enriched CD4+ T Cells in vitro 8 Population Doubling Level 7 6 5 4 3 2 1 0 -1 0 2 4 6 Day of Culture 8 10 12 Media Control Transduced HIV+ Donor ZFN Induced CCR5 Disruption 50 % CCR5 Disruption 40 30 20 10 0 0 4 7 Day of Culture 10 12 Autologous CD4+ T-cells genetically modified at the CCR5 gene with SB-728 zinc finger nucleases in patients with HIV Ad5/F35 Chimeric Vector knob shaft Penton base tail SBS8196z G T C A T C C T C A T C C T G A T A A A C T G C A A A A G C A G T A G G A G T A G G A C T A T T T G A C G T T T T C Ad35 fiber • CD46 receptor • Shown to transduce HSCs, APCs, T-cells Ad5/F35 delivery of ZFN Pheresis Enrich CD4+ Follow Safety, CD4/HIV, CCR5 selection Infuse Expand, Cryopreserve, Test cell product Properties of Anti-CD3/CD28 Based Culture System • Clinical scale up: no feeder • Clinical scale up: no feeder cells required cells required • Maintains function and • Maintains function and homing of T cells homing of T cells • Ex vivo gene therapy: • Ex vivo gene therapy: efficient gene transduction efficient gene transduction J Immunol 1997; 159: 5921 J Immunol 1997; 159: 5921 Science 1997; 276: 273 Science 1997; 276: 273 Immunol. Rev. 1997; 160: 43 Immunol. Rev. 1997; 160: 43 Immunol. Mol. Ther. 2004; 9; 902 Mol. Ther. 2004; 9; 902 Ther. Activated T Cell Therapy for Hematologic Malignancy 1. Obtain cells from patient and enrich or isolate particular cells of interest 6. Quality Control Reinfuse cells 2. Stimulate cells to grow Bead 5. Remove beads and wash cells 3. Insert therapeutic genes into cells 4. Large scale cell expansion Study Design Overview 2 wk 2 wk 1 Safety Evaluation 2 n=6 HAART failures 2 n=6 Well controlled Study Design Rationale • Rationale for two cohorts •Initial safety of DNA modified T cells has been shown in 9 retro/lenti clinical trials to date •Well controlled patients have healthier immune systems and therefore are better candidates for an immunotherapy •In addition to safety, primary endpoints include evaluating the effect of viral load—which will likely require immunecompetency Study Design Rationale Cont’d • Rationale for STI in well controlled patients •STI is different than CD4-guided intermittent treatment (SMART and DART study) •Many patients have preference to be off drugs due to toxicity-informed consent process •Allows patients to be off of drugs in an intensively monitored setting. •Analytical treatment interruptions remain an important toll for evaluating immunological and genetic HIV interventions Release testing for ZFN-Modified CD4 T Cells Test Endotoxin HIV p24 Sterility Viability Residual beads CD3 % % ZFN modification Residual adenovirus Mycoplasma Method Kinetic or Endpoint Chromogenic Limulus Amoebocyte Lysate (LAL) ELISA ELISA Bactec (Khuu et al., 2006)/fungal cultures Trypan Blue Dye Exclusion Bead count Flow cytometry CEL-1 PCR Lonza MycoAlert Pre-Clinical Summary • CCR5-ZFNs efficiently and with high specificity modify the CCR5 locus in both transformed and primary human CD4+ T-cells • Modified CD4+ T-cells are resistant to infection by R5tropic HIV and preferentially expand in the presence of virus in studies performed both in vitro and in vivo • Development of the large-scale, clinical process for transducing T-cells • ZFN treated HIV- and HIV+ donor CD4 cells retain normal growth and function, no significant off-target effects observed (to date) ZFNs - Powerful and Specific Tools for Gene Modification • Pre-IND Meeting with FDA - √ • NIH RAC Review - √ (unanimous) • Targeted CCR5 gene disruption in T-cells could provide an effective approach for therapy of HIV infection • ZFN-mediated gene correction or disruption may be a promising strategy for a variety of acquired and congenital diseases cRegulatory Oversight for Physician Sponsored IND NIH NIAID RAC ACC Office of Compliance FDA OBA Abramson Cancer Center SoM Vice Dean & Assoc. Dean University Vice Provost OHR EHRS IRB/ORA CISC Sponsor External Regulatory Consultant DSMB Dept. Chair Clinical Trials Unit Study Monitor GOVERNMENT ACRONYMS FDA - Food and Drug Administration NIAID - National Institute of Allergy & Infectious Disease NIH - National Institutes of Health OBA - Office of Biotechnology Activities RAC - Recombinant DNA Advisory Committee PENN ACRONYMS ACC - Abramson Cancer Center DSMB - Data & Safety Monitoring Board OHR - Office of Human Research EHRS - Environmental Health & Radiation Safety IRB - Institutional Review Board ORA - Office of Regulatory Affairs CISC - Conflict of Interest Standing Committee Principal Investigator Study Coordinator Medical Monitor • Currently Sub-PI & grant study Co-PI • Medical Monitoring for Site & for Sponsor Zinc Finger Nucleases (ZFNs): Potential Applications • Engineered Zinc Finger Transcription Factors • “Hit and Run” gene therapy with ZFN’s: • Gene repair – Transcriptional repressor to inhibit VEGF – Knockout genes: transgenic animals, cell lines, agricultural applications, etc. – Sickle cell anemia – X-SCID: IL-2Rγ • Genome editing to introduce disease resistance mutations – CCR5 32 for HIV resistance Translational Research • • • • • • • • • CVPF • • • • • • • • • • • Naeemah Alston Andrea Cannon Anne Chew Julio Cotte Morgan DeCaul David Dobrzynski Elaine Huang Hong Huynh Lori Landgrebe Dawn Maier Zoe Zheng Carl June Elena Perez Gwen Binder Richard Carroll Jim Riley Elizabeth Veloso Olga Liu Carmine Carpenito Jordan Orange • • • • • • • • • • Dale Ando Philip Gregory Michael Holmes Fyodor Urnov Gary Lee Colleen Stewart Jianbin Wang Kenneth Kim Nathaniel Wang Lei Zhang HUP HUP Rob Roy MacGregor Rob Roy MacGregor Pablo Tebas Pablo Tebas Funding: NIAID Integrated Pre-Clinical Clinical Program Sangamo