Goals of the Human Genome Project
• • • • • • determine the entire sequence of human DNA identify all the genes in human DNA store this information in databases improve tools for data analysis transfer related technologies to the private sector address the ethical, legal, and social issues (ELSI) that may arise from the project.
Sequencing a genome
Obtain Genomic DNA Sample
Sequence genomic DNA
Assemble sequences in order
Annotate sequence
Sanger Sequencing
Chemical reaction that includes: DNA polymerase DNA primer Nucleotide bases (A, T, G, C) Nucleotide bases that are „labeled‟ Addition of labeled bases stops reaction. Repeated many times.
DNA separated by size using a gel and an electric current
_
Sequenced sample put in well
DNA moves towards positive charge
Short DNA moves faster
+
How do we sequence a genome?
For the HGP, two approaches were used:
1. Hierarchical sequencing 2. Shotgun sequencing
How do we put the sequences together in the right order?
Genome assembly - based on finding regions of overlap between individual sequencing fragments
CCCATTAGATGCGATGGGTTAAAA
GGTTAAAAATCGATCCCATTTTACG
Very, very difficult problem for complex genomes!!
Genome Annotation
Annotation – identifying what part of DNA corresponds to genes, etc. Compare to known genes: • Gene already described and sequenced • Expressed Sequence Tags (EST), essentially randomly sequenced mRNA Predict genes: • Computer predictions
Genome made of two types of DNA
• Euchromatic
– Comprises 93% of your DNA – Contains most of the genes in your genome – 99% has been sequenced
• Heterochromatic DNA
– Comprises ~7% of your DNA – Highly repetitive – Some parts are structural: contains centromeres, telomeres – Gene sparse – Very difficult to sequence, largely unexplored.
Euchromatic DNA
• 2.8 Billion base pairs
• ~30,000 genes
– Many fewer than expected, initial guesses were ~100,000 genes – 50% have unknown function – Less than 2% of the total genome
• 98% “junk” DNA
– Does not code for genes – Function is unknown - but potentially very important!!! – Many (~50%) repeated sequences (e.g. AGAGAGAGAGAG) and transposable elements
What does the draft human genome sequence tell us?
How the genome is arranged
• Genes occur in gene-dense “jungles” and gene poor “deserts”.
• Genes appear to be concentrated in random areas along the genome, with vast expanses of noncoding DNA between. • Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest (~231).
HapMap
An NIH program to map genetic variation within the human genome
• Begun in 2002 • Construct a map of the patterns of variation that occur across human populations.
• Facilitate the discovery of genes involved in complex human traits and diseases.
Evolutionary Genomics - comparing genomes of different species to learn about genome evolution and function
Organism
Human (Homo sapiens)
Laboratory mouse (M. musculus) Mustard weed (A. thaliana) Roundworm (C. elegans) Fruit fly (D. melanogaster)
Genome Size (Bases)
3 billion
2.6 billion 100 million 97 million 137 million
Estimated Genes
30,000
30,000 25,000 19,000 13,000
Yeast (S. cerevisiae)
Bacterium (E. coli) Human immunodeficiency virus (HIV)
12.1 million
4.6 million 9700
6,000
3,200 9
Gene number does not directly scale with complexity of organism!
What do evolutionary comparisons tell us?
How the Human Compares with Other Organisms?
• Humans have 3X as many kinds of proteins as the fly or worm • mRNA transcript "alternative splicing" and chemical modifications to the proteins.
• This process can yield different protein products from the same gene. • Large portions of non-genic DNA highly conserved, suggesting the serve some function.
sammyc2007 4/15/2008 |
55 |
0 |
0 |
educational
sammyc2007 4/16/2008 |
106 |
1 |
0 |
educational
sammyc2007 4/12/2008 |
107 |
3 |
0 |
educational
sammyc2007 4/17/2008 |
29 |
1 |
0 |
educational
sammyc2007 4/17/2008 |
34 |
1 |
0 |
educational
mountainmom01 5/14/2008 |
89 |
5 |
0 |
educational
sammyc2007 4/17/2008 |
80 |
2 |
0 |
educational
sammyc2007 4/17/2008 |
47 |
0 |
0 |
educational
sammyc2007 3/28/2008 |
90 |
2 |
0 |
educational
anonymous 4/11/2008 | 85 | 4 | 0 | educational
sammyc2007 3/29/2008 |
65 |
0 |
0 |
educational
sammyc2007 4/17/2008 |
31 |
0 |
0 |
educational
McCaber 4/24/2008 |
47 |
1 |
0 |
creative
sammyc2007 4/24/2008 |
168 |
13 |
0 |
educational
sammyc2007 4/11/2008 |
48 |
0 |
0 |
educational
sammyc2007 6/13/2008 |
292 |
2 |
0 |
legal
sammyc2007 6/13/2008 |
249 |
0 |
0 |
legal
sammyc2007 6/13/2008 |
310 |
4 |
0 |
legal
sammyc2007 6/13/2008 |
277 |
3 |
0 |
legal
sammyc2007 6/13/2008 |
519 |
2 |
0 |
legal
sammyc2007 6/13/2008 |
422 |
1 |
0 |
legal
sammyc2007 6/13/2008 |
247 |
0 |
0 |
legal
sammyc2007 6/13/2008 |
228 |
0 |
0 |
legal
sammyc2007 6/13/2008 |
352 |
0 |
0 |
legal
sammyc2007 6/13/2008 |
315 |
0 |
0 |
legal