Documents
Resources
Learning Center
Upload
Plans & pricing Sign in
Sign Out

Health Innovation

VIEWS: 6 PAGES: 44

									GENETICS AND
POLITICS




                                         LBJ School, CHASP
     Benedicte Callan
 1   Sid Richardson Fellow
     LBJ School, Center for Health and
     Social Policy
TALK OVERVIEW
1.   The OECD
2.   Genetics & Genomics




                                                LBJ School, CHASP
3.   The controversies
4.   OECD “solutions”
5.   Under what conditions do countries
     establish international soft law for
     research and health policy?


                                            2
                                    LBJ School, CHASP
The Organisation for Economic
Cooperation and Development’s
30 member countries             3
MEMBER COUNTRIES
 Meetin specialist committees and
 Ministerial level annual meetings to:




                                                     LBJ School, CHASP
  Share policy experience
  Develop and publish comparable data
  Identify principles of good governance
  Do peer reviews of performance and policies
  Agree multilateral instruments


                                                 4
OECD STRUCTURE
                                       Council
                           Oversight and strategic direction
             Representatives of member countries and of the European Commission




                                                                                      LBJ School, CHASP
             Committees                             Secretariat
Discussion and implementation                      Analysis and proposals
Representatives of member countries and of         Secretary-General and Private Office
countries with Observer status work with the       Directorates
OECD Secretariat on specific issues

      Annual budget: 336 million euros funded by member countries
                                                                                  5
BIOTECHNOLOGY UNIT
 Committee on Scientific and Technology Policy
 Working Group on Biotechnology




                                                                      LBJ School, CHASP
 Task Force on Biomedicine an Health Innovation

 Task Force on Industrial Biotechnology

 Task Force on Biological Resource Centres


    Focuses on the application of advances in the life sciences
    to a variety of industrial sectors and their implications
    for society…


                                                                  6
OECD MINISTERIAL MANDATES in
RESEARCH & HEALTH:

   What policies will help capture the potential
    health benefits from genetics and genomics?




                                                        LBJ School, CHASP
   Can we do so while addressing the concerns
    of society about these new technologies.




                                                    7
WHAT IS GENETICS AND
GENOMICS?
   Genetics
       The roles and functions of single genes and variants




                                                                   LBJ School, CHASP
   Genomics
       The study of whole organism genomes: their
        sequence, genetic mapping, interactions between loci
        and alleles within the genome.
   Pharmacogenomics
       The use of genetic data to inform drug development
        and testing. An important application of
        pharmacogenomics is correlating individual genetic
        variation with drug responses.
                                                               8
HUMAN GENOME PROJECT (1990-2003)
• Genetic map:                    Polymorphic landmarks to trace inheritance
• Physical map:                   Clones covering all chromosomal regions




                                                                                LBJ School, CHASP
• Sequence:                       DNA sequence (3 billion bases)
• Gene List:                      Identification of all genes
                                  20-25,000 genes


         Information freely available
              without restriction

                                                                            9


    From Eric Lander, June 2009
SEQUENCING THE HUMAN
GENOME
 The Human Genome Project took 13 years and
  cost $3 billion




                                                       LBJ School, CHASP
 Recent costs of sequencing genome about $100 -
  250,000 per genome
 New techniques (SMRT, nanopores) bring costs
  closer to $50,000 and sequence time down
 November 6 announcement of whole-genome
  sequences at cost of $4,400
 NIH push to deliver the >$1000 sequence, to
  allow personal sequence data to be used routinely
  in medical care                                     10
                                                                           Sequencing Output
                                                                    (currently 1-2 Gb per machine per day)


                                     1,000,000,000

                                      100,000,000                                                  Massively parallel
                                                                                                   sequencing
                                       10,000,000                                                                                      Single
Kilobases per day per machine




                                                                                                                                       molecule?




                                                                                                                                                           LBJ School, CHASP
                                        1,000,000

                                          100,000                                                                                Short-read
                                                                                      Capillary sequencing                       sequencers

                                           10,000                                                                         Microwell
                                                        Gel-based systems                                                 pyrosequencing
                                              200
                                                                                                                 Second-generation
                                                                          Automated                              capillary sequencer
                                              100       Manual            slab gel
                                                                                              First-generation
                                                        slab gel
                                                                                              capillary
                                               10

                                                     1980          1985      1990      1995         2000           2005          2010 Future

                                11                                                          Year




                                                                                                  Slide from Eric Lander, data from MR Stratton et al. Nature
                                                                                                                                       458, 719-724 (2009)
IDENTIFY GENES, VARIATIONS,
EXPRESSION
   Monogenic diseases – rare single gene disorders:
    Thalassaemia
    Sickle cell anemia




                                                        LBJ School, CHASP
    Haemophilia
    Cystic Fibrosis
    Tay sachs disease
    Fragile X syndrome
    Huntington's disease…

   Genetic tests available for about 1800 diseases

   The accurate diagnosis of single-gene disorders
    and diseases has led, for example, to the
    development of screening programmes for cystic
    fibrosis and sickle cell anaemia in newborns.      12
MULTIFACTORIAL DISEASES
   Atherosclerosis, hypertension, obesity, diabetes,
    asthma, migraine, epilepsy, depression, bipolar
    disorder, autism, schizophrenia, multiple




                                                         LBJ School, CHASP
    sclerosis, psoriasis, cancers and pathogenic
    infections

 Complex diseases have a low heritability
 Several to many genes may contribute

 Environmental/lifestyle factors also contribute to
  risk
                                                        13
                                                                    FGFR2 TBL2 ITGAM
   Confirmed genetic contributors                                   TNRC9 TRIB1 BLK
                                                                   MAP3K1 KCTD10HMGA2
   to common human diseases                    (Dec 2007)              LSP1ANGLPT3 GDF5-UQCC
                                                                       8q24 GRIN3A HMPG
   Cholesterol            Age Related Macular Degeneration       CDKN2B/A MEIS1 CRAC1
   Obesity                Crohns Disease                         8q24 (n=6)LBXCOR1 JAZF1
   Myocardial infarction Type 1 Diabetes                          ATG16L1 BTBD9 CDC123
   QT interval            Systemic Lupus Erythematosus                 5p13 C3 ADAMTS9
                                                                      10q21 8q24 THADA




                                                                                    LBJ School, CHASP
   Atrial Fibrilliation   Asthma
   Type 2 Diabetes        Restless leg syndrome                       IRGM ORMDL3  WSF1
                                                                    NKX2-3 4q25 LOXL1
   Prostate cancer        Gallstone disease
                                                                      IL12B TCF2 GLUT9
   Breast cancer          Multiple sclerosis                           3p21 GCKR L7R
   Colon cancer           Rheumatoid arthritis           NOS1AP        1q24 FTO TRAF1/C5
   Height                 Glaucoma                         IFIH1     PTPN2 C12orf30STAT4
   Uric Acid              Celiac Disease                  PCSK9       TCF2 ERBB3 4q27
                                                         CFB/C2 CDKN2B/AKIAA0350   ABCG8
                                                 CD25 LOC387715 IGF2BP2 CD226 MLXIPL
                                                 IRF5       8q24   CDKAL1 16p13 GALNT2
           IBD5                                 PCSK9      IL23R     HHEX PTPN2 PSRC1
PPAR     NOD2        CTLA4 KCNJ11 PTPN22        CFH     TCF7L2   SLC30A8 SH2B3 NCAN

                                                                                  14
2000 2001 2002 2003 2004 2005                         2006                2007
           Slide from Eric Lander
ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTG
TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCC
CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAA
CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGT
ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCA
TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAAC
ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCT
GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCA
TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAAC
CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAA




                                                               LBJ School, CHASP
ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTC
GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCA
                           Single Nucleotide Polymorphisms (SNPs):
TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAAC
                                  1 heterozygous site per 1300
CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCT
TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCT
GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCA
                                Most SNPs are common variants
TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAAC
                                          in population
CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCT
TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTC
CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGT
CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCAC
CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACA
ATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAA
ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTC
CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACA  15
GTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACAC
ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCG
CGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATC
Human Genotyping: Major Technology Advances

                                  SNPs per assay
                                  1997    1
                                                   1998: POC 500-plex
                                  2001    10
                                  2002    1,000
                                  2004    50,000
                                  2006    500,000
                                  2007    1,000,000




       Slide from Eric Lander
LBJ School, CHASP
                    17
POLICY CHALLENGES: CIRCA
2000
 Tension between access to research results and
  commercial applications – open source & IPRs




                                                      LBJ School, CHASP
 Tension between research usage and
  privacy/security of personal genetic data
 International collaboration in research and
  clinical diagnostics in absence of harmonisation
  of “regulatory” approaches
 Uncertain receiving environment (regulatory &
  clinical) for new products
 Need for meaningful public engagement

                                                     18
ETHICAL, LEGAL & SOCIAL ISSUES –
CIRCA 2010
   Access and use of genetic information
       by insurers, employers, courts, researchers.




                                                        LBJ School, CHASP
 Privacy and confidentiality
 Clinical issues
       validation, appropriate use, interpretation,
        education/training
   Personal Genomics
       Direct to Consumer marketing of Genetic
        Information
 Psychological impact and stigmatization of
  individuals and groups
                                                       19
 Reproductive issues

 IP/Commercialisation
OECD EXPERT GROUPS CREATED
TO:
1. Examine possible impacts of restrictive
   licensing practices for genetic inventions and
   policy options for avoiding these.




                                                     LBJ School, CHASP
2. Develop internationally recognised and
   mutually compatible best practice policies for
   quality assurance of MGTs.
3. Develop guidance on privacy and security
   guidelines to ensure adequate security of
   biobanks and genetic databases.
4. Exploration of economic and social impacts of
   pharmacogenetics.

                                                    20
OECD RECOMMENDATIONS ON:

 2006-- Licensing practices for (patented)
 genetic inventions




                                                      LBJ School, CHASP
 2007   – Quality of clinical (molecular) genetic
 tests
 2009-- The privacy and security of biobanks
 and genetic databases



                                                     21
OECD RECOMMENDATION ARE…
 Instruments of the Organisation
 Negotiated texts




                                                    LBJ School, CHASP
 Adopted by consensus, at whole of government
  level
 Non-binding: a commitment on the part of
  member countries to make good faith efforts to
  implement
 Often serve as “pre-law” for articulation of
  national legal instruments
 An Acquis of the Organisation, such that new
  members must demonstrate they are willing and    22
  able to implement Instrument
NEGOTIATION STAGES

1. Identification of issue (surveys, analytical
   reports, workshops)
2. Creation of government appointed “expert




                                                     LBJ School, CHASP
   group”
3. Expert drafting of good practices
4. Agreement by countries to release draft “best
   practices” for public consultation
5. Expert redraft of “best practices” in light of
   comments
6. Substantive Committee agreement on draft
   Instrument
                                                    23
7. OECD Council Adoption of Recommendation
THE PROBLEM WITH GENETIC
INVENTIONS
 Proliferation of gene patents -- genes, SNPs,
  ESTs -- was issue of concern for a variety of
  interest groups




                                                     LBJ School, CHASP
 Dependency problems, reluctance of researchers
  to enter fields where genes have already been
  patented or where multiple groups are competing
  to patent a same gene, restrictive licensing
  practices, royalty stacking, database access
  problems.
 How frequently do these issues arise? What are
  the costs?
                                                    24
COUNTRIES WANTED TO
RESOLVE:
 Do gene patents impede research, new product
  development, access to new products/services?




                                                         LBJ School, CHASP
 Do patents on genes need to be circumscribed, or
  is the research and clinical community adapting
  to the new environment with new strategies?
 How can governments assure legitimate access to
  genetic information and distribute research
  results, funded by the public, so that they benefit
  the public.
 What are the policy tools available to
  governments to reach this objective?                  25
WHAT WAS AT STAKE?
 Harmonisation – or lack thereof – of global IP
  regime,(eg new exceptions to patentability)




                                                       LBJ School, CHASP
 Revenues for public research organisations

 Biotech industry business model

 Negotiation positions in other international
  organisations:
     WTO
     WIPO
     WHO

   Health care costs, quality and equity of access
                                                      26
SURVEY OF PATENTS & CLINICAL
GENETIC TESTING LABORATORIES

 65% offer genetic tests covered by patents
 recognized in the country




                                                LBJ School, CHASP
 Patent has affected:
     - Cost of Test                    70%
     - Number of Tests Performed       28%
     - Quality of the Test             20%
 10% of labs have ceased offering genetic
 test or tests that are covered by patent

                                               27
2006 GUIDELINES FOR THE LICENSING
OF GENETIC INVENTIONS
 Set out principles and best practices for those in
  business, research and health systems who enter
  into license agreements for genetic inventions




                                                        LBJ School, CHASP
  used for the purpose of human health care.
 Foster the objectives of stimulating genetic
  research and innovation while maintaining
  appropriate access to health products and
  services.
 [Change norms about the manner in which rights
  holders carry out licensing activities.
 While maintaining legitimacy of patents for
  genetic inventions…]                                 28
1. GENERAL LICENSING
   How to : ownership rights, collaborative research,
    confidentiality provisions…                     Myriad




                                                                 LBJ School, CHASP
    1.1 License agreements should permit licensees to develop
    and further improve the licensed genetic inventions.
                                                             DeCode
    1.5 License agreements should not provide the licensor
    with exclusive control over human genetic information,
    including collections of such information, derived from
    individuals through the use of the licensed genetic     Funding
    invention.
                                                             bodies
    1.6 Rights holders should be encouraged to agree to
    licensing terms and conditions that maximize the
    utilisation of their genetic inventions.
                                                                29
2. HEALTH CARE AND GENETIC
INVENTIONS                                          Myriad
   2.C Licensing practices should not be used to
    restrict the choice of other products or services by
    patients and their healthcare providers.




                                                              LBJ School, CHASP
                                                   Neglected
                                                  diseases?
   2.D Licensing practices should encourage
    appropriate access to and use of genetic
    inventions to address unmet and urgent health
    needs in OECD member countries and non-
    member economies.


                                                          30
3. RESEARCH FREEDOM
 3.B Commercial considerations in public
  research activities should not unduly hinder the
  academic freedom of researchers.




                                                        LBJ School, CHASP
 3.C Commercial considerations… should not
  unduly limit the ability to publish in a timely
  manner the results of research.
 3 D Commercial considerations in public research
  activities should not unduly limit the educational
  training of students.
                                 PRO policies and
                                contracts w/private    31
                                      sector
                                                  Gene
4. COMMERCIALISATION                              Chips
4.1 Should several licenses be required, license
  agreements should include a mechanism to set a
  reasonable overall royalty burden…




                                                          LBJ School, CHASP
4.2 License agreements should… maintain low
  barriers for access to genetic inventions… [and]
  … not include [] excessive up-front fees.      Oncomouse
4.3 License agreements should avoid reach-through
  rights….
4.4 Private and public sector participants should Pools &
  develop mechanisms to decrease transaction       Consortia
  costs in acquiring rights to use technology.
                                                       32
WHAT WAS MISSED?
   Definition of what sort      Conditions for
    of data or invention          patentability
    should be kept open?




                                                    LBJ School, CHASP
       SNPs data
       GWAS


   Contentious…




                                                   33
CREATION AND GOVERNANCE OF
HUMAN GENETIC RESEARCH
DATABASES
 Research involving data and samples from
  human biobanks and genetic research databases
  analysed in conjunction with personal or health




                                                     LBJ School, CHASP
  data is important for healthcare and drug
  discovery;
 That research must respect the participants and
  be conducted in a manner that upholds human
  dignity, fundamental freedoms and human
  rights;


                                                    34
BIOBANK EXAMPLES
 UK Biobank – 60 million NHS patients
 CARTaGENE – 20,000 Quebecois




                                                       LBJ School, CHASP
 GenomeEUtwin – 600,000 twin pairs

 deCode, Iceland – >270,000 Icelandic citizens

 23andMe – maybe 6,000 paying customers

 Kaiser Permanente -- 100,000 Northern
  Californians to be included ina genetic database:
  Research Program on Genes, Environment, &
  Health

                                                      35
BIOBANKS: WHAT COUNTRIES
WANTED
   Guidance for the establishment, governance,
    management, operation, access, use and
    discontinuation of HBGRDs.




                                                                 LBJ School, CHASP
       governance structure and oversight mechanisms;
       privacy and confidentiality;
       terms of participation; access; funding mechanisms;
       benefit sharing,
       intellectual property and commercialisation;
       protection and security of human biological materials
        and data;
       the qualifications, education and training of staff;
        disposal of materials and data and the                 36
        discontinuation of a HBGRD.
BIOBANKS: WHAT IS AT STAKE?
 Public Trust and participation in large scale
  genomic studies – public or private




                                                     LBJ School, CHASP
 Large scale research on genetic basis of health
  and disease
 Privacy and security of personal health
  information
 Public money – biobanks are subsidised and go
  bust



                                                    37
3. GOVERNANCE, MANAGEMENT,
AND OVERSIGHT
3.A The HBGRD should be governed by the
  principles of transparency and accountability.




                                                         LBJ School, CHASP
3.B The operators of the HBGRD should clearly
  formulate its governance structure and the
  responsibilities of its management and should
  make such information publicly available.
3.C The governance structure should be designed
  to ensure that the rights and well-being of the
  participants prevail over the research interests of
  the operators and users of the HBGRD.
3.D The… should have in place oversight
  mechanisms to ensure that… comply with legal          38

  requirements and ethical principles.
4. TERMS OF PARTICIPATION
   4.A Participant recruitment should be carried out in a
    non-coercive and equitable manner that respects individual
    freedom of choice.               Consent for new research




                                                                    LBJ School, CHASP
   4.B Prior, free and informed consent should be obtained
    from each participant.
   4.C The operators of the HBGRD should give careful
    consideration to any special issues related to the
    participation of vulnerable populations or groups, and their
    involvement should be subject to protective conditions ...
   4.D …should have a clearly articulated policy on whether
    participants may be re-contacted [and] the situations for
    which re-contact will be permitted...

                           DTC consumer                            39
7. ACCESS
   7.A            Access to human biological materials and data
    should be based on objective and clearly articulated
    criteria, and should be consistent with the participants’




                                                                    LBJ School, CHASP
    informed consent.
   7.D            Researchers should only have access to
    human biological materials or data that are coded or
    anonymised, such that the participant cannot be identified,
    and researchers should be required to not attempt to re-
    identify participants. ..
   7.8            The operators of the HBGRD should
    formulate policies and procedures setting out the manner
    in which an individual participant can request information
    and data about him/herself contained in the HBGRD, how
    those requests will be handled, and which information and      40
    data, if any, can be made available.
9. CUSTODIANSHIP, BENEFIT-
SHARING AND INTELLECTUAL
PROPERTY
   9.B Benefits arising from research using the HBGRD’s
    resources should be shared as broadly as possible,
    including by the sharing of information, licensing, or




                                                                   LBJ School, CHASP
    transferring of technology or materials.
   9.C The… HBGRD should have a clearly articulated
    policy and explicitly indicate to participants whether they
    and/or the HBGRD retain any rights over the human
    biological materials and/or data and the nature of such
    rights.
   9.D The… HBGRD should have a clearly articulated
    policy… relating to the commercialisation of its own
    resources, research results derived from those resources,
    and/or commercial products, if any, that may arise from
    research using its resources.                                 41
WHAT IT MISSED?
 Public willingness to participate in [commercial]
  biobanks in exchange for personal genetic data
  and “information”




                                                       LBJ School, CHASP
 Blurring of research and commercial databanks

 Emerging norm of making personal genetic
  information “open”




                                                      42
COMMON FEATURES OF TOPICS
THAT ARE AMENDABLE TO
INTERNATIONAL SOFTLAW
 Confluence of research, and industry and
  governmental concern
 A tangible and a specific problem to be solved




                                                    LBJ School, CHASP
 Existence of set of feasible solutions

 Demand for inter-governmental action

 “Lowest common denominator” approach – no
  country can insist on highest standard
 Large country leadership

 Needed for public legitimacy

 Needed to pressure action domestically

 Low/no cost – (e.g. no new infrastructures)      43

 Implementation is local/national
                                          LBJ School, CHASP
     THANK YOU!


44   Benedicte.Callan@austin.utexas.edu

								
To top